Instituto de Literatura y Ciencias del Lenguaje

Reinforcing vocabulary learning through the use of

mobile devices

An elective workshop for Pre-Service Teachers of English

TRABAJO DE TITULACIÓN

para optar al título de Profesor de Inglés

y al grado de Licenciado en Educación

Estudiante: Antonella Castro Aspe.

Profesora guía: Mónica S. Cárdenas-Claros.

Primer Semestre 2015

2

Acknowledgements I would like to thank the people who have always been there for me and that people who

have supported me. I’m talking about my parents, Claudia and Franklin, who gave me their

unconditional love and support; my grandparents, María Isabel, Celso, and Ana María

who always had a word to tell me keep on working you are almost there; to my five

siblings, Franco, Enzo, María Teresa, María Lorenza and María Franca, who always gave

me a smile; of course to my boyfriend, Mauricio, who have been there for me in moments of

crisis, when I did not know what else to write and who was patient these couple months in

which I did not have much time for him; to Punti Pooh, my dog, who has been a great

company every moment since she arrived; and finally to my friends and the rest of my

family.

Also to Mrs. Mónica Cárdenas-Claros who enlightened me to find my path into this

graduation project, for trusting me and leading me.

3

Table of contents

Acknowledgements ............................................................................................................. 2

1. Abstract ............................................................................................................................... 4

2. Introduction ........................................................................................................................ 5

3. Theoretical Framework....................................................................................................... 8

3. 1 Importance of teaching vocabulary .............................................................................. 8

3. 2 Strategies for vocabulary learning ............................................................................... 8

3. 3 Mobile Assisted Language Learning ........................................................................... 9

3. 3.1 Mobile devices ...................................................................................................... 9

3. 3.2 Mobile devices in language learning ................................................................... 10

3. 4 Collaborative learning ................................................................................................ 11

3. 5 Viability of the project into the current Chilean context ........................................... 12

3.6 Type of syllabus .......................................................................................................... 12

4. Course Syllabus ................................................................................................................ 13

Course description ............................................................................................................ 13

Course organization .......................................................................................................... 13

General Objective ............................................................................................................. 15

Specific Objectives ........................................................................................................... 15

Evaluation criteria ............................................................................................................. 16

5. Sample lessons .................................................................................................................. 17

6. References ........................................................................................................................ 31

7. Appendix .......................................................................................................................... 35

7.1 Appendix A: Needs Analysis ...................................................................................... 35

7.2 Appendix B: Survey .................................................................................................... 38

4

1. Abstract

This graduation project proposes a course syllabus that focuses on the incorporation of

mobile devices into the classroom as a tool to reinforce vocabulary learning through

collaborative activities. The proposal shows that with proper guidance it is possible that

teachers incorporate mobile devices in the language classroom and use them with

pedagogical purposes.

Key words: technology, mobile devices, vocabulary learning, collaborative activities.

5

2. Introduction “…technology alone does not create language learning any more than dropping a learner

into the middle of a large library does” (Healy, 1999, p.136). Moreover, “not only it is

important to provide the tools to learn, but also the skills and the impetus for learners to do

it” (Stockwell, 2013, p.205).

We live in a world surrounded by technology (Stanley, 2013); it is in every aspect of our

lives, so teachers cannot stay behind, instead they should make use of the technological

resources that are available today in a way that it is conducive to learning. But, bringing

technology into the classrooms is only beneficial if the users –teachers and learners- know

how to use it for the purposes desired (UNESCO, 2002).

So, in order to integrate technologies into the classroom, teachers should know what

exactly they want to do with it, what objectives students are expected to accomplish and

most importantly, how to achieve them.

In the Chilean context, the use of technology for learning purposes was introduced with the

program Enlaces in the 1990s, an initiative created by the Ministry of Education of Chile

(MINEDUC) that aimed at integrating ICTs in the classrooms to improve the students’

learning and to develop students’ digital competences (MINEDUC, 2012). The Enlaces

program basically focuses on the integration of computers into the classroom as a learning

tool. Although this initiative has been successful, it has not included mobile devices that

allow a more direct interaction with the user.

The use of mobile devices was not explored in Chile until 2010 when the international

multisector partnership, BridgeIT, started a new program called Puentes Educativos. This

initiative aims to integrate the use of smartphones in the class, but the use of it is limited to

the teacher as he or she has access to the smartphone to enter multimedia resources and

show them to the class (UNESCO, 2012). However, this has not been done in the language

classroom and it leaves the meaningful interaction between the user and the mobile device

to the teacher only because students act as viewers not as the main character of the learning

process.

6

Stockwell (2013) points out that considering the general population, mobile phones are the

devices that have the greatest rate of penetration. However, there are some potential

problems of using mobile devices in the classrooms. As we are dealing with children, there

might be the case that they are not allowed to bring these devices to classes, or maybe they

don’t have access to one of their own: so we want to integrate mobile devices into the

language classroom and we have to face these barriers, we have to think of collaborative

work where not every learner is required to have a mobile device (Stockwell, 2010);

learners will share one and work with it in pairs or small groups.

Some teachers may see mobile devices –or technology in general- as a threat to their

classes (MINEDUC, 2012). Teachers need to start thinking of it as a complementary tool

that might help enhance students in their learning. Maybe one of the problems teachers

have is that they would not know exactly what learners are doing in their devices; teachers

cannot be monitoring every single student, especially if they have a large class. The answer

is working collaboratively where students monitor themselves and have the responsibility

to be working on the activities because they are not working alone. Furthermore, teachers

will be relating Vygotsky’s (1930-1934/1978) idea that humans are social beings, adding an

important component to learning which is interaction with their peers, also by developing

collaborative learning the learners will feel more comfortable as they are working with their

peers in the same learning level.

As expressed in Bases Curriculares 2012, Idioma Extranjero Inglés; the learning of

vocabulary is essential to develop the four skills in the language. Not only is it important to

develop fluency in the productive skills –speaking and writing, - but also to develop

fluency and comprehension in the receptive skills –listening and reading- (MINEDUC,

2012). Vocabulary supports the understanding of a language and the communication of the

same. According to DeCarrico (2001) “Vocabulary learning is central to acquisition,

whether the language is first, second or foreign” (p. 285) following the same path as

MINEDUC, the learning of vocabulary is an important part of the puzzle when teaching a

language as it helps us to understand the language and it give us more resources –words and

expressions- to communicate with others.

7

In this graduation project I will focus on the use of mobile devices (tablets, iPads and

smartphones) in the Chilean classrooms. The generations of students that we face today are

all called digital natives (Prensky, 2001) which means they were born with technology so

that it is a natural component of their lives, that is the reason why it is necessary to include

these kind of technology in the classrooms; we cannot expect that today’ students learn

everything teachers teach them by standing in front of the class and talking about a subject,

students need to use the resources they know better –mobile devices- (Stockwell, 2013).

MINEDUC (2012) states that the use of ICTs supports the teaching and learning of the

English language as it motivates and engages the students’ attention into the activities

during the class, but the use of mobile devices is not addresses yet.

This graduation projects seeks to train pre-service teachers of English to reinforce

vocabulary through the use of mobile devices aligning the imperative of incorporating

technologies into the classroom to the importance of vocabulary when learning a language.

The project suggests a series of activities (sample lessons) supported by (1) the discussion

of theoretical aspects that involve vocabulary teaching and learning, and the incorporation

of mobile devices into the classroom, as well as the viability of the project in the Chilean

context and (2) the analysis of the information gathered through a survey directed to pre-

service teachers of English to design a course syllabus that fits the needs detected.

8

3. Theoretical Framework This section discusses five relevant aspects to this graduation project: the importance of teaching vocabulary, strategies for vocabulary learning, mobile assisted language learning, collaborative work, and the viability of this project in the current Chilean context.

3. 1 Importance of teaching vocabulary Back in 1972, Wilkins said “…without grammar little can be conveyed meanwhile without

vocabulary nothing can be conveyed” (p. 111) and what can be understood from it is that if

we don’t have lexis to produce language, we would not have linguistic resources to do so.

In order to communicate, to interact given our social nature (Vygotsky, 1978), and to

express our ideas and understand others we need to learn vocabulary. We never cease to be

vocabulary learners as Ur (2012) points out “lexical items are an open set, constantly being

added to (and lost as archaic words gradually go out of use)” (p. 3). So, according to Coady

and Huckin (1997) vocabulary is the heart of communicative competence because it is an

essential component for learners to develop the ability needed to communicate

appropriately and successfully.

3. 2 Strategies for vocabulary learning According to Hedge (2010), language learners use different strategies to learn and acquire

new words. There are two types of strategies to learn vocabulary which are cognitive and

metacognitive. Cognitive strategies involve direct mental operations which mean the

learner works on new words to understand them, categorize them and store them in the

mental lexicon (Hedge, 2010). Examples of these strategies are making associations,

learning words in groups, exploring range of meaning, and inferring the meaning from the

context (Hedge, 2010). On the other hand, metacognitive strategies involve indirect

strategies that facilitate learning by actively involving the learner in conscious efforts to

remember the new words (Hedge, 2010). Examples of these strategies include collecting

words from authentic contexts –consciously, - making word cards, categorize words into

lists, reactivating vocabulary in internal dialogue (Hedge, 2010).

The strategies learners use to acquire vocabulary can be expressed in types of teaching

vocabulary as well; where we can find explicit and implicit teaching. According to

Decarrico (2001), explicit teaching, which can be aligned to metacognitive strategy where

9

learners are aware of their learning process, is a kind of teaching where learners are

engaged in activities that make them focus on vocabulary, Sökmen (1997) states that its

goal is to build a large recognition of vocabulary by integrating new words, connect them

with old ones and have the learner as much as possible encounter the words. On the other

hand, implicit teaching that can align with cognitive learning is when learners are focused

on something else such as understanding a text and at the same time they are learning the

vocabulary of the text without noticing (DeCarrico, 2001).

It is very important for teachers encourage learners in effective strategies and also

incorporate some of them in teaching vocabulary (Hedge, 2010). Joining the two ideas

about learning strategies and types of teaching, teachers should aim to implement a balance

approached to teach vocabulary (DeCarrico, 2001) where learners are taught vocabulary in

different ways –consciously or unconsciously- and providing opportunities for learners to

rely on different strategies to learn it and different contexts to use it.

3. 3 Mobile Assisted Language Learning Some of the benefits that incorporating technology into the classroom brings is that it

allows the learner to transcend the traditional concept of the classroom (Drexler, 2010) and

also it enhance learners to take the ownership of their learning (Terrel, 2011). In order to

categorize the use of technology as an effective learning tool, giving control to learners to

own their process of learning and also delivering to teacher innovative tools that can be

used inside or outside the classroom.

3. 3.1 Mobile devices The Oxford Language Dictionaries define mobile device as a “portable computing device

such as a smartphone or tablet computer” (n.d.). Additionally, Trinova et al., (2004) defines

a mobile device but they add an element to the definition relating it to education; according

to Trinova et al., (2004), a mobile device is “any device that is small, autonomous and

unobtrusive enough to accompany us in every moment and can be used for educational

purposes” (p. 1). So, a mobile device is always available for us to use and as Stockwell

(2013) points out we should feel that we can reach it into our pockets or bags and engage in

a form of learning in the same way we do when we reach our books from our bags.

10

Traxler (2007) states that one of the most important advantages of mobile assisted learning

–provided by mobile devices- is that it allows learners to use short periods of time and also

space for learning.

According to Warschauer (2011), mobile devices offer three main advantages if we

compare them with laptops or computers. Mobile devices are lighter in weight and have

orientation flexibility which makes them superior for digital reading or accessing contents.

Also their instant-on capability and fast switching among applications allows learning

activities without delay. Additionally, the touch screen allows a high degree of interactivity

with the user.

3. 3.2 Mobile devices in language learning One of the pioneer studies in the use of mobile devices for vocabulary learning is that of

Stockwell (2007), he developed a platform that could identify Japanese English learners’

progress on vocabulary activities; the platform included a five-level-difficulty program that

could be run on the cellphone or the laptop and when the learner entered the program it

started with simple questions regarding vocabulary they were studying in class and as long

as the learner answered correctly the activities were advancing in terms of complexity.

Even though the vast majority of students chose to complete the activities on their laptops,

the difference in scores was not relevant (Stockwell, 2010).

Stockwell’s study (2007) identified some considerations to take into account when

integrating mobile devices in language learning. Physical issues, psychological issues and

pedagogical issues are to be considered according to Stockwell (2013). Physical issues

include the size of cellphones, mainly the screen size that may difficult the reading of long

texts, students would prefer to read them in desktop computers or laptops; so teachers

should consider short texts when working with mobile devices. Psychological issues are

concerned mainly with the assumption that learners –and teachers- are competent users of

new technologies (Stockwell, 2013), so teachers should take into consideration that

integrating mobile devices into the language classroom is a process that needs a lot of

guidance at the beginning to give learners the tools and develop their skills to work with the

devices as desired. Pedagogical issues referred mainly to the non-pedagogical use of mobile

11

devices, so learners may get distracted when using them inside the classroom (Stockwell,

2013).

Then, if teachers are to incorporate mobile devices into the classroom they should think that

learners need to be trained or taught on how to use mobile devices with learning purposes,

and by using mobile devices teachers are recognizing the advantages that technology brings

to the classroom. This advantage refers to the way in which learners interact with the

devices (Stockwell, 2013):

“Thus, learners are able to interact with their surroundings in a way that can

facilitate language learning through relating it to potential opportunities that arise as

a part of their daily lives rather than just what occurs in the classroom or in

completing activities or tasks as a part of the class.” (Stockwell, 2013, p. 213).

3. 4 Collaborative learning Vygotsky (1930-1934/1978) pointed out that human beings are social in nature, so in early

childhood cognitive skills develop when interacting with others; first with caregivers and/or

parents, then with community members and at school with their peers when they work in

groups. Later on, in 1986 Vygotsky’s edited work puts a lot of emphasis on the value of

social interaction through which learners develop more than social skills, including

cognitive and critical thinking.

Dillenbourg (1999) defines collaborative learning as “a situation in which two or more

people learn or attempt to learn together or solve a problem” (p. 6); together with Barkley,

Cross and Major (2005) add that the participants of the collaborative work engage in

learning or solving the problem as they act in a coordinated effort to a common goal or

shared goal as Barkley, Cross and Major (2005) points out.

Collaborative learning is beneficial in the sense that students become critical thinkers; they

are able to share and become responsible of their own knowledge (Gokhale, 1995). Also,

by collaborative learning students improve their self-confidence because they are

interacting with their peers which allow them to make mistakes in a more comfortable

environment reducing the fear of failure (Willis, 2011).

12

By working collaboratively, teachers may address the issue of getting distracted with other

platforms available to use (i.e. WhatsApp, Facebook) because they will be working in pairs

or small groups where the learners play different roles such as facilitator, time keeper,

checker, encourager, recorder, summarizer, elaborator, among others (Farrell & Jacobs,

2010). As consequence, learners will feel responsible for developing the activity since they

will not be working on their own, they will be working with someone else which makes

them responsible for the other’s learning too (Farrell & Jacobs, 2010).

3. 5 Viability of the project into the current Chilean context Statistics presented by Censo Nacional de Informática Educativa (MINEDUC, 2012), show

that more than 50% of students have access to a smartphone (private and semi-private

schools, public schools 49%) and also have internet connection, so that teachers should be

trained and incorporate mobile devices to the classrooms as an innovative tool for teaching.

As most of the students use the mobile devices to play games, there is a need for teachers to

teach the learners that these devices can be used with educational purposes. There is a lack

in the Chilean context regarding the use of mobile devices inside the classrooms, teachers

tend to think of them as a threat to their classes, but they need to take advantage and use

them for teaching (MINEDUC, 2012).

3.6 Type of syllabus The course is organized in a task-based syllabus which is defined by Richards and Rodgers

(2001) as an approach based on the use of tasks as the main unit for planning in language

teaching. Also, Richards and Rodgers (2005) postulate that tasks can improve learner

motivation in order to improve learning. So, in this course, learners will be able to use the

vocabulary they are reinforcing in meaningful tasks that may be close to real life situations.

13

4. Course Syllabus

Course description This is a 36-hour workshop for pre-service English teachers interested in incorporating

mobile devices into the Chilean classrooms to teach and reinforce vocabulary. It is a

theoretical-practical proposal to study the key concepts to understand mobile learning, to

incorporate mobile devices into the classrooms and to have the students create different

kind of activities to reinforce vocabulary teaching using mobile devices inside the

classrooms.

This workshop is addressed to pre-service teachers that need and want to incorporate

mobile devices as a tool for learning vocabulary and to motivate students to learn as shown

in the Needs Analysis (see Appendix A). The course trains pre-service English teachers to

incorporate mobile devices as a teacher-friendly tool to the teaching and reinforcing of

vocabulary as agreed by the majority of respondents of the survey. As a way to assess

learning, they will create a digital portfolio with their reflections and all the activities they

create.

Course organization This workshop is divided into four units which will train them to integrate mobile devices

into the classrooms by using apps to reinforce vocabulary and to create collaborative

activities to pass the barrier in case not all of the future students have a mobile device.

Units one and two are meant to teach pre-service teachers of English the theory behind the

use of mobile devices for learning and teaching. Unit three consists of practical lessons

Name of the course: Teaching and reinforcing vocabulary learning through the use of mobile devices. Audience: Pre-Service English Teachers. English level: Advanced. Number of classes: 18 sessions. Class duration: 90 minutes. Class hours: 36 pedagogical hours. Teacher: Antonella Castro. Mail: anto.castro.aspe@gmail.com

14

where students will be able to create their own vocabulary activities to be completed in

mobile devices. In unit four, students will be taught on how to incorporate collaborative

work into the activities already created.

15

General Objective By the end of this course, students will be able to incorporate mobile devices in their

language classrooms by using them in collaborative activities to reinforce vocabulary

learning.

Specific Objectives Unit 1:

Learning about mobile

learning and mobile

devices

To define and show understanding of what a mobile device is.

To discuss the features of mobile learning.

To identify the benefits of incorporating mobile devices into the

classroom to teach vocabulary.

To create a digital portfolio of reflections about the course (one

entry per class).

Unit 2:

Using existing resources

To identify apps that would be useful to teach and reinforce

vocabulary learning.

To build up criteria to evaluate the resources.

To evaluate an app to teach and reinforce vocabulary.

To reflect and expand on criteria for selection.

Unit 3:

Creating your own

resources

To create different activities using mobile devices to teach and

reinforce vocabulary learning focusing on a specific grade and

unit.

To evaluate the activities by doing them with the rest of the

class.

To reflect on the activities by discussing with the class how can

be improved.

Unit 4:

Setting collaborative

activities using mobile

devices

To design collaborative activities using apps to teach

vocabulary.

To share the activities with the class.

To evaluate their classmates activities.

To reflect on the course and organize the digital portfolio.

To share the digital portfolio with the class and present the

activities created.

16

Evaluation criteria Students will be graded according to the following percentages:

Attendance: 10% Students are expected to attend all the classes as it is a theoretical-practical workshop where they are expected to discuss, build their opinions and create activities during class time. So if they miss more than 3 classes, they will fail the course.

Assignments: 40% - Activities developed during the course. - Collaborative activities created by the students to reinforce vocabulary learning. - Classes’ reflections.

Students will create different types of activities to reinforce vocabulary teaching, create activities that are collaborative to teach vocabulary using apps, and write reflections each class.

Portfolio: 40% Portfolio should include all the activities done in class, the reflections of each class and the activities created by the student.

Presentation of the digital portfolio: 10%

Students will be asked to present the activities on their portfolios to the class.

17

5. Sample lessons

The following sample lessons correspond to unit 4 “Setting collaborative activities and using mobile devices.” In the following lessons, students will be able to reinforce vocabulary learning using their mobile devices in collaborative activities and also use language in different communicative activities that involve the use of mobile devices.

18

Lesson 1 & 2: Creating and using flashcards for collaborative activities in mobile devices. Objectives: To recall and identify useful apps to create flashcards. To experience the creation of flashcards on the vocabulary of a specific unit. To practice vocabulary of a specific unit using the flashcards created. To employ the flashcards and experience a collaborative activity to study vocabulary. To evaluate your own word and the one of your classmates. To test your knowledge of the vocabulary and the one of your classmates. To reflect on the use of flashcards in a collaborative activity.

Individual Work! k! Look at the following apps’ icons and write for what purposes of vocabulary teaching are useful.

Share your notes with a partner and then with the rest of the class.

Pair work!

1. Go to www.google.cl and search for “Planes y Programas Inglés 2 medio” and download the PDF.

Click this entry to download the PDF you need.

19

2. Then, open the file and look for the vocabulary of unit 1 which is related to sports and hobbies on page 27. 3. The class will be divided into 2 groups. Group 1 will find the meaning of 10 words from the vocabulary on Sports and group 2 will find the meaning of 10 words from the vocabulary on Hobbies in an online dictionary they can access through the browser (Safari/Chrome). You may scroll down to find the Oxford or Cambridge online dictionary. For example:

4. After reading the definitions, find a partner from your group and together write your own definitions.

5. Find images in Google that represent each word and take a screen shot. To do it, follow the instruction: press power button and volume (up or down) button simultaneously or power button and home button simultaneously. For example:

20

Individual work.

Using your mobile phone, go to the Play Store (if it has Android system) or Itunes Store (if it has IOS system) and download Studyblue app . Then, follow the instructions:

Step 1: Open the app 1: Open the appand you will find this Step 11: Open the app and you will find thisou will find this

message. Tap on Ok.and you will find this message. Tap on message Tap on Ok.Ok

Step 2: Then, you will 2: Then, you willfind this screen. Tap on Step 22: Then, you will find this screen. Tap on his screen Tap on

I’m a Teacher.find this screen.I m a Teacher.I’m a Teacher

Step 3: Tap Add an 3: Tap Add an interest.

Step 33: Tainterest.st

Step 4: Find English and 4: Find English andtap it. Then tap Step 44: Find Englistap it. Then tap Then tapContinue. tap it. Then tContinue.Continue

Step 5: Your screen will Step 5: Your screen willshow you this, tap on Step 5: Your screen will show you this, tap on show you this tap on

Make Cards.show you this,Make Cards.Make Cards

Step 6: The app will ask Step 6: The app will askto access your camera Step 6: The app will ask to access your camerato access your cameraor photo gallery. Tap to access your cameraor photo gallery. Tap or photo gallery Tap

Ok.or phOk.Ok

Step 7: You are creating Step 7: You are creatinga Deck and the screen Step 7: You are creating a Deck and the screena Deck and the screenwill show you this. In a Deck and the screen will show you this. Inwill show you this Inthe Untitled space tap will show you this. In thethe UntitledUntitled space tap space tapSports or Hobbies the Untitled space taSportsSports oror HobbiesHobbies(depending on the Sports or Hobbies(depend(depending on theing on thewords you looked up). (depending on the words you looked up).words you looked up

Step 8: Tap on Choose a 8: Tap on Choose a Location find English Step 88: Tap on Choose Locationon find Enfind Englishglishand then tap Save. Location find English and then tap and then tap Save.Save

21

Step 9: Start creating Step 9: Start creatingthe flashcards, tap Add Step 9: Start creating the flashcards, tap the flashcards tap Add Adda card. the flashcaa card.a card

Step 10: Your screen Step 10: Your screen will show you the Step 10: Your screenwill show you thewill show you thefollowing and tap the will show you thefollowing and tap thefollowing and tap thclip. followinclip.clip

Step 11: Tap the camera and choose one of the images of the vocabulary.

Step 12: Tap the term Step 12: Tap the termand the definition of the Step 12: Tap the term and the definition ofand the definition of the theword. and the dword.word

Step 13: You can add an Step 13: You can add an audio on the term Step 13: You can addaudio on the termaudio on the termsection or the definition audio on the term section or the definitionsection or the definitsection if you want by section or the definitionsection if you want by section if you want bytapping the section if youtapping thetapping themicrophone. tapping themicrophone. microphone

Step 14: Create a card Step 14: Create a cardfor each of the words by Step 14: Create a card for each of the words by for each of the words bytapping +. for each of thtapping +.tapping +

Term Definition

22

Pair work!

Find a partner from the same group as you. Choose one set of cards from your mobile phone.

1. One of you is going to be student A and the other is going to be student B.

2. Tap Flip Cards and then tap Let’s Do This.

3. Student A will select one image with the term and Student B will have to define it.

4. Student A taps the screen and decides if the definition provided by Student B is close to the one on the screen and taps the green thumb up (correct) or the red thumb down (incorrect) accordingly.

5. Take turns to ask each other.

6. Exchange the mobile phone with a partner from a different group (if you are from group 1, he mobile phone with a partner from a different group (if you are from group 1,exchange with group 2; if you are from group 2, exchange with group 1) and do the activity with 6. Exchange thhe mobile phone with a partner from a different group (if you are from group 1, exchange with group 2; if you are from group 2, exchange with group 1) and doh group 2; if you are from group 2 exchange with group 1) and do the activity with the activity withyour partner. exchange with gryour partner. your partner

Student A Student A Correct Correct Incorrect IncorrectTerm 1 Term 1 Term 2 Term 2 Term 3 Term 3 Term 4 Term 4 Term 5 Term 5 Term 6 Term 6 Term 7 Term 7 Term 8 Term 8 Term 9 Term 9 Term 10 Term 10

Student B Student B Correct Correct Incorrect IncorrectTerm 1 Term 1 Term 2 Term 2 Term 3 Term 3 Term 4 Term 4 Term 5 Term 5 Term 6 Term 6 Term 7 Term 7 Term 8 Term 8 Term 9 Term 9 Term 10 Term 10

23

Pair work!

Discuss with the following statements.

Small group Work! Small group Work!

Work with a partner that has worked with the same set as you (Sports or Hobbies). 1. W1.2. Find a couple that has worked with the same set as you. 3. Using one of your mobile devices, enter to Studyblue and select the set you haven’t been working with. 4. You and your partner will be team 1 and the other couple will be team 2 (Pair vs pair activity). 5. Each team will have one opportunity to play. Team 1 begins and Student A taps Cards without showing to the partner. 6. Student A has to do mimics to Student B while Student B has to guess the by saying the definition of the terms that is being mimiced. If it is correct, team 1 awards a point and team 2 will continue. But, if it is incorrect, Student A in team 2 has to mimic the same term and Student B will have to guess. Write the correct or incorrect answers in the table.

TEAM 1 TEAM 2 Term Correct Incorrect Correct Incorrect

1. 2. 3. 4. 5.

7. Exchange roles until there are no more terms. 8. Count the correct answer.

Your opinions on the activities we did on today’s class. How would you incorporate the activities in your classes?

24

Individual work!

Write a reflection on today’s lesson. Include the following aspects:

Note! These activities are to be done after ThThThhThThThTThThThheseseseseseseseseseesesseseesseseseesseeeeeeeeeeeeeeeeThThThhesesesesesessessesessessssseseeeeeeeeeeeThThThThThThTThThThTThTThThThTThhesesesesesesesesesessesesesesesessseeseeseeeeeeeeeeeeeeeeeeee acacacacacacaccacaacacacacaacacacaaccctitititititititiitttittitt viviviviviviviviiviiiiivivivivv titititititititititiitiiiiitttttitiesesesesesesesesesesesesesesesesesesseeessese aaaaaaaaaaaaaaaaaaaaaaaaaaaarerererererererererereererererererereeeeeee ttttttttttttttttttoooooooooooooooooooooo bebebebebebebebebbebebebebebebeebebebebebebbe dddddddddddddddddddddoooooooooooooooooooooooooaccaacaaccaaaaaaaa tititiitititiiiiiiiitacacacacacacacacaacacacacacaaaaacaccacacacaa tititititititiitiiitttittt neneneneneneneneneneneneeeeeneneeneeee aaaaaaaaaaaaaaaaaaaaaaaaaftftftftftftftftftftftfftffftftftftttererererererererereerereeerererereererreerpresenting the vocabulary in ThTThhTThTThThThhhTThesseseseseseseeseseseseseesseseeseseesesseeeeeeeeeeeeeeeeeeeee acaacacacacacaacacacacaccacaaaaaccacaacaccctitititittititttitititttiitttt vivivivivviviiviviviittitiititttititiittittttttiesesseseseseseseseesesssesesesseseesesss aaaaaaaaaaaaaaaaaaaaaareererereereerreeerreeereereeee ttttttttttttttttto oooooooooooooooooooo bebebebbebebebbebebebebbebbebebbeebbbebbee ddddddddddddddddddddoooooooooooooooooooooneneneneneneneeeeneneneeeeeneeee aaaaaaaaaaaaaaaaaaaaftftfttfttffttftftftttftttterrerereereeeerererereeeererereeeeer prprprprprprprrprprppppppresesesesesesesesesesesesesesesesseseseseeesseneneneneneneneneneneneneeeeeentititttititttittttiiingngngngngngngngngngggngngggggg tttttttttttttheheheheheheheheheheheeeeeeheeehee vvvvvvvvvvvvvvvocococoocoococococococococcocooooococcabababababbababababababababaababababa ulululululululuuluuuluuuularararararararararararaaaaaaaa yyyyyyyyyyyy inininininnininnininprprrprprppppprprprprpprrprrrpreseseseseeseseseseseesssssseseseseseneneeneneneneeeneennennene titititititititttiiititittt ngngngngngnggngngnggggngnnngnng ttttttttttttttttthehehehehehehehehehheheeehehehehhe vvvvvvvvvococococooococcccococoococoocococcabbbababababaaaababbbabababaabbaabbabbulululululu ararrarrarraraararaaaarararaarrarryyyyyyyyyyy inininiininininiininiiiiiiinnnncontext, maybe at some point prprprprprppprprprppprpprprprrpppppp esesesesesesseseesesesseseseseeeseesseneneneneeneeneneneeneeeeneeneee titiitttittitttiitttititttingnggngngnggngnggngngnggngnggggggggggg ttttttttttttttttheeeeheheheheheheeheeheehehehheeee vvvvvvvvvvvvocococococococococcocococococoooccooocococo ababababababababbabaababbababaababaababbbulululuuuuuluuluuulululuuuuuuuullaraaararararaaraararaaraaaary yyyyyyyyyyyyyyyyyyy ininininninnnninininiinn cococococococococococccoocooococcc ntntntntntntntntntnnttnnttexexexexexexexexexexexexexexeexexexee t,ttt,t,t,t,tttt,tt mmmmmmmmmmmmmmmayayayayayayayayayayayayyaaaaaaaaa bebebebebebebebebebebeeebeebeebeebebbe aaaaaaaaaaaaaaaaaaaaatttttttttttt sososososososososososossosossoossssooosooomemememememememememememeeemeeeememee pppppppppppppppppcocococcccococoocoococococcoccontntntntntntntnntntntnttntnnnn exexexexexexexexxxexeexexe tttttttttttttt mmmmmmmmmmmmmmmmmayyayayayayayaaaaaaayayyaayaaa bebebebebebebebebebeeebebbebbbe aaaaaaaaaaaaaaaaaaaattttttttttttt sosososossosssososoooooosomemememememememememmemmmmememmemm ppppppppppppppppppoioiooioioioioioiooioioooooo ntntntnntntntntntntntnttoioioiiioioioioiiiiiiioioooooo ntntntntnttntnttntntntntttnnnnnbefore the class finishes; to practice coocococococoocococococcoococococcccocooocconttntntntnttntntntnnttttntnntttttttexexxexexexexeexeexexexeexeexexexeeeexe t,t,t,t,t,t,tt,t,t,t,t,tt,t,t,tttt,,, mmmmmmmmmmmmmmmmmayaaayayayayayayayayayayayaaayayaaaaayybebebebebebebeebebbebebebbebbebebebebbbebeeebeb aaaaaaaaaaaaaaaaaaaaat tttttttttttttttttt soossososossosososososossososoooossosossosoosomememeemememememeemememeemeemememeeeee pppppppppppppppppppppppppoiooiooiooooioioooioiooioioooooo ntnttnttntntnttnntntnttt bebebebebebebebebebebeebebeeebebbbefofofofofofofofofofofoooooooorerererrererererereeeeeeereereee ttttttttttthehehehheheheheheheeeeeehehee cccccccccccccccclalalalalaalalalalaaaaaalaaaassssssssssssssssssssssssssssssssssssssssssss fffffffffininininnininnnininiiinisisissisissssisssssisssssssisheheheheheheheheheheheeeeeeeeeees;ss;;;s;s;ss;;s;sssssssss;sssbebebebebebebebebeebeebebebbeeebeb fofofofofofofffofffofofofffofoofofofoooorerererererereereererereereererrr tttttttttttttttheheheheheeheeheehehehhheeheeehehee ccccccccccccccccccccclalalalaaaaaaaaaaaaaaaassssssssssssssssssssssssssssssssssss fffffffffffffffffffffininininiiiiiiininiininnnnnnnnisisisisisiisisiisisisisisssssssshehehehehheheheheheheheeheeeeh s;s;s;s;s;s;s;ss;sssssssss;s;;; tototototoootototototoottotooo pppppppppppppppppppprararararararaarararaaaraaraaaararaaraaaactctctctctctctctctctcctccctcttccttctctticiciciciccicccicicciciicciccicccciccccce eeeeeeeeeeeeeeeeeeeeeeetottotototottototototototottooo ppppppppppppppppprararararrararaaaraararraraaaarractctctctctctctctctccttctccccttctttcc iciciciciciciciciciciciciciciciccccccceeeeeeeeeeeeeeeeeeand learn the vocabulary. bebebebbebebebebebebbbbebbebeebbebebebeefofofofofoofooofofooooofooooooooorererrerererereeerrerereerereeeeee tttttttttttttttttheheheheheheeheheheheheeheheeeeee ccccccccccccccccccccccclalalalalaaalalalalalaalaaaaaaaaaassssssssssssssssssssssssssssssssssssssssssss ffffffffffffinininininiinininininnnisisisisisssssisississisiiissssisssheheheheheheheeheheheeeeeeeheheeeeeeees;s;s;s;s;ss;;s;sss;s;s;sssss;sss;;;;;;; totototototototootottototootoottttotooooototo pppppppppppppppppanananananananananananaananananaaannaaaandddddddddddddddddddddddd leleleleleeleleleeeleleleeleleleleleleeeeearararaarararararararaaaarararararaaaaaa nnnnnnnnnnnnnnnnnn ththththththhthhthththtthtthhttththeeeeeeeeeeeeeeeeeeeeeeeee vovovovovovovoovovovovovovovovovoovvoovoooooocacacacacacacacaacacaacacacacacaaccacaaccacaabubububububububububububububububububbuububuububbubuulalalalaaalaalalaaalaalalalaalaalalaaaaaaryryryryryryryryryryryryyrrrryyy.................ananananananaaaaaannanananaaanaaananandddddddddddddddddd leleleleleeeeeeeeeeeeearrararararaaraaaaaarrrararaaaarrnnnnnnnnnnnnnnn thththththththththththtthhththththeeeeeeeeeeeeee vovovovovvovovovovooovovoooovoocacacacacccaccccacacaaaaacaccacaaccacabububuubuubbbbbbbbbb lalalaaaaaaaaaaaaaaaaaryryryryryryryryryryryrrrrrrr

25

WRITING A SHORT DESCRIPTION OF YOUR FAVORITE SPORT OR HOBBY

Lesson 3 & 4: Sharing experiences and creating a leaflet. Objectives: To recall the vocabulary studied in previous classes. To share experiences about your favorite sport or hobby. To experience the use of the video recording function of the mobile phone. To reflect on the use of mobile devices to make videos about the unit being studied.

Individual work! 1. Think of your favorite hobby or sport and answer the following questions.

2. Now, using the answers you wrote, write a short description of the sport or hobby you like the most. For example: My favorite sport is doing yoga. It is a relaxing sport. Many people can participate in a group class of yoga or you can practice it on your own. It is done in one’s house or in a yoga center. I enjoy it because I free my mind and it is very relaxing.

WR

A) What is your favorite sport or hobby? My favorite sport/hobby is ____________.

B) What type is it? It is a _____________ sport/hobby.

C) How many people can participate? ____________ people can participate / Only one.

D) Where do you play/do it?It is played/done in _______________.

E) Why do you enjoy it? I enjoy it because ________________________________________________.

26

PLANNING AN INTERVIEW: GUIDELINES

Individual work! Pair work! 1. Make sure you have different sports or hobbies. 2. Using your mobile device, interview your partner about his or her favorite sport/hobby (Record a video with his/her answer). 3. Exchange roles. 4. Exchange mobile phones with another group. 5. With your partner write what your classmates say in the video.

P

A) Greet the person you are going to interview: “Hello __________!”

B) Start asking simple questions such as: “What’s your favorite sport or hobby?” “How do you play/do it?” “Where can you play/do it?” “How many people can play/do it?

C) Then ask a personal question about it: “Why do you enjoy it?” “Why do you recommend it?”

A) Decide which of you is going to be interviewed first. B) The interviewer should pick up the mobile phone and open the camera app. C) The interviewer records a video interviewing his/her partner. D) When you finish, pause the video.

27

Small group work! 1. Gather in groups of 4. 2. Make sure you have different sports or hobbies. 3. Each of you has the description of his or her favorite sport/hobby, you are using the information to create a leaflet. 4. Each of you will be in charge of one aspect of the leaflet: 5. The leaflet should include 4 sports/hobbies, vocabulary related to that, description of each of them, and images. For example:

What is it?

Yoga is a type of sport

What does it consist of?

It consists of doing bodily postures, meditation and breathing exercises for health and relaxation.

Participants

You can do yoga alone or join a yoga class.

Student 1 Design the leaflet

(organization, colors)

Student 2 Gather the descriptions

and classify the information you will use

Student 3 Find images that represent each sport/hobby.

Student 4 Check the leaflet in terms of grammar,

punctuation and spelling of the words

used.

28

Small group work! 1. Gather in new groups of 4. Make sure you are all from different groups (activity 3). 2. Share and explains the leaflet to your classmates.

Individual work!

Write a reflection of the activities done in these classes. Your reflection should include the following aspects.

What do you think of the activities? How would you incorporate these activities into your classes? How much time do you think your students would need to do it? What contents would your students need to have developed to do it?

29

Lesson 5: Learning from videos created by my classmates. Objectives: To describe a sport or hobby. To explain a sport or hobby through a video. To share experiences with the classmates about what you watched in the video. To reflect on the use of student-made videos to learn new topics/contents.

Pair work! 1. Choose a sport or hobby you know nothing about (from the ones studied in lesson 1-2) 2. Find information about it on the internet and complete the following chart: Sport/Hobby Participants Rules or steps to follow

Instruments (if any) needed

Place where you play/do it.

Pair work! 1. Select the most important information you found on the internet. 2. Write a description of the sport or hobby you selected (very similar to what we practice in lessons 3-4, activity 1.2. 3. Your description should include name of the sport/hobby, the participant, brief set of rules/steps, your own opinion about it (you like it, you did not like it, why?)

________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________

30

When we communicate verbally, apart from our speech; it is very important our body language, intonation and rhythm.

Pair work! 1. With the same partner you worked in activity 2, record a 3-minute video where you talk about the sport/hobby you knew nothing about. 2. Use your mobile device to record yourselves, open the camera app. 3. Student A will be in charge of the mobile device, recording and taking the time (no more than 3 minutes); while student B will be talking about the sport/hobby selected.

4. Planning the video:

5. Practice and rehearse the speech before recording. 6. Record the video. 7. Write down five comprehension questions about it. For example: What do you need to play volleyball?

Pair work! 1. With the same partner, exchange mobile devices and the comprehension questions with another pair. 2. Discuss with your partner the content of the video to answer the comprehension questions. 3. Answer the questions.

A) Name the sport o hobby you are going to talk about. You can use a cardboard with the name written.

B) Tell the main characteristic of it. C) Talk about the instruments needed.

D) Tell how many people can participate. E) Tell if you like it or not, tell why.

Comprehension Questions:

1)_____________________________________________________

2)_____________________________________________________

3)_____________________________________________________

4)_____________________________________________________

5)_____________________________________________________

31

Small group work!

1. Gather in groups of 3. 2. Make sure you have not worked together during this lesson. 3. Share with your classmates the content of the video you watched. 4. Ask questions such as What was the video about?-Do you like that sport/hobby? Why?-What is it about?-Who can participate?-How many people can participate? 4. Complete the chart with the information about sports/hobbies from the videos you watched. Sport/Hobby Student A: Student B: Student C: Brief description Participants Instruments Individual work! 1. Write a reflection on today’s lesson. 2. Include the following aspects:

Answers:

1)_____________________________________________________

2)_____________________________________________________

3)_____________________________________________________

4)_____________________________________________________

5)_____________________________________________________

What did you learn today’s lesson? Would you include videos activities in your classes? If so, how would you do it? Is it useful that students do their own research of something they know nothing

about? Why?

32

6. References Barkley, F., Cross, P., & Major, C. (2005). Collaborative learning techniques: A handbook

for College Faculty. San Francisco: Jossey-Bass.

Coady, J. & Huckin, T. (1997). Second language vocabulary acquisition. Cambridge:

Cambridge University Press.

DeCarrico, J. (2001). Vocabulary learning and teaching. In M. Celce-Murcia, Teaching

English as a second or foreign language (Third ed., pp. 285-299). United States:

Heinle & Heinle.

Drexler, W. (2010). The networked student model for construction of personal learning

environments. In Australasian Journal of Educational Technology, 26 (3),

369-385).

Dillenbourg, P. (1999). What do you mean by collaborative learning? In P. Dillenbourg,

Collaborative-learning: Cognitive and computational approaches (First ed.)

Oxford: Elsevier.

Farrell, T. & Jacobs, G. (2010). Essential for successful English language teaching.

London: Continuum International Publishing Group.

Gokhale, A. (1995). Collaborative learning enhances critical thinking. In Journal of

Technology Education (Vol. 7, 1). Retrieved from

http://scholar.lib.vt.edu/ejournals/JTE/v7n1/gokhale.jte-v7n1.html

Hedge, T. (2010). Teaching and learning in the language classroom. Oxford: Oxford

University Press.

Ministerio de Educación, (2012). Bases curriculares idioma inglés.

Ministerio de Educación, (2012). Censo nacional de informática educativa (CENIE).

Retrieved from

http://www.enlaces.cl/tp_enlaces/portales/tpe76eb4809f44/uploadImg/File/2013/dc/

censo/Presentacion_Resultados_CENIE_2012.pdf

33

Morris, L. (2011). Helping your lecturers to creatively introduce ubiquitous computing

technologies into their teaching: What every lecturer should know. In T. T. Kidd &

I. Chen (Editors), Ubiquitous learning: Strategies for pedagogy, course design, and

technology (p. 209-228). Charlotte, NC: Information Age Publishing, Inc.

Oxford Language Dictionaries Retrieved from

http://www.oxforddictionaries.com/definition/english/mobile-device

Prensky, M. (2001). Digital natives, digital immigrants. In On the Horizon (9, 5).

MCB University Press. Retrieved from

http://www.marcprensky.com/writing/Prensky%20-

%20Digital%20Natives,%20Digital%20Immigrants%20-%20Part1.pdf

Richards, J., Rodgers, T. (2001). Approaches and methods in language teaching.

Cambridge: Cambridge University Press.

Stanley, G. (2013). Language learning with technology: Ideas for integrating technology

in the classroom. Cambridge: Cambridge University Press.

Sökmen, A. (1997). Current trends in teaching second language vocabulary. In N.

Schmitt and M. McCarthy, Vocabulary: Description, acquisition, and

pedagogy.Cambridge: Cambridge University Press.

Stockwell, G. (2007). Vocabulary on the move: Investigating an intelligent mobile phone-

based vocabulary tutor. In Computer Assisted Language Learning, 20(4), 365-383.

Stockwell, G. (2010). Using mobile phones for vocabulary activities: Examining the effect

of the platform. In Language Learning & Technology, 14(2), 95-110.

Stockwell, G. (2013). Mobile-Assisted language teaching. In M. Thomas, H. Reinders &

M. Warschauer, Contemporary Computer-Assisted Language Learning (Paperback

First Edition, pp. 201-2016). United States: Bloomsbury Publishing Plc.

Terrell, S (2011). Integrating online tools to motivate young English language learners to

practice English outside the classroom. In International Journal of Computer-

Assisted Language Learning and Teaching (IJCALLT), I (2), 16-22.

34

Traxler, J. (2007). Defining, discussing, and evaluating mobile learning: The moving finger

writes and having writ…. International Review Research in Open and Distance

Learning, 8(2), 1-12.

United Nations Educational, Scientific and Cultural Organization (2002). Technologies for

education: potentials, parameters and prospects. Retrieved from

http://unesdoc.unesco.org/images/0011/001191/119129e.pdf

United Nations Educational, Scientific and Cultural Organization (2012). Mobile learning

for teachers in Latin America: Exploring the potential of mobile technologies to

support teachers and improve practice. Retrieved from

http://unesdoc.unesco.org/images/0021/002160/216081E.pdf

Vygotsky, L. (1978). Mind in society: The development of higher psychological processes.

Cambridge: Harvard University Press. (Original manuscripts [ca. 1930-1934]).

Vygotsky, L. (1986). Thought and Language. Cambridge: The MIT Press. (Original

manuscripts [ca. 1934]).

Warschauer, M. (2011). Eventually tablets will facilitate more personalized and interactive

learning. Educational Technology Debate-Exploring Learning in Developing

Countries. Retrieved from http://edutechdebate.org/tablet-computers-in-

education/eventually-tablets-will-facilitate-more-personalized-and-interactive-

learning/

Willis, J. (2011). Cooperative learning is a brain turn-on. learning styles and

differences. Retrieved from

http://www.education.com/reference/article/Ref_Cooperative_Learning/

Wilkins, D. (1972). Linguists in language teaching. London: Edward Arnold, p. 111-112.

35

7. Appendix

7.1 Appendix A: Needs Analysis As to design and elaborate a proper syllabus for pre-service English teachers, a survey with 20 questions in English was conducted among thirty three pre-service teachers of English from the Pontificia Universidad Católica de Valparaíso. The participants were asked to answer the questions according to their personal information, future experience and assumptions they have regarding the use of mobile devices. The survey was posted online, so the identity of the participants is unknown and it was easier to save time and asking people to participate.

The questionnaire is divided into four sections:

I. The first section has four multiple choice questions that refer to the respondents’ personal information and future experience as English teachers.

II. Section two has six questions that refer to how the respondents view the use of technology –mobile devices- as a teacher-friendly tool to teach and reinforce vocabulary.

III. The third section includes seven questions that refer to the respondents’ assumption on learners’ uptake of mobile devices.

IV. The last section has three multiple choice questions that refer to the need and want of the respondents to be trained on how to take advantage of mobile devices for language learning, specifically vocabulary.

For the analysis of the results I will focus on the key questions that are more relevant to the project.

I. The results of the survey showed the following about the respondents’ information and future experience, retrieved from the first section:

Figure 1 shows that most of the respondents see themselves working in a semi-private school which may mean that they will have more resources available in their classrooms and also that most of their students will have access to a mobile device. It also may mean that they will be teaching large groups of 25-35 students, but not that large as in a public school were we can see groups of 45 students. The results in figure 2 show that most of the pre-service teachers that answered the survey believe that second language learners learn more vocabulary working in small groups or in pairs and less than a third of the respondents believe learners learn more vocabulary individually.

36

II. The results of the second section of the survey show the following according to the view of technology –mobile devices- as a tool to reinforce vocabulary:

Figure 3 shows that more than half of the respondents feel comfortable using mobile devices –cellphones or tablets,- seven of them strongly agree with feeling comfortable using mobile devices and only one respondent disagree with the assumption.

Figure 4 shows that none of the respondents disagree with the assumption that using mobile devices is a motivational strategy for students. All of the participants believe that the use of mobile devices can be used as a motivational strategy for students.

According to the results about the need of training in using mobile devices as a learning tool in Chile, all of the respondents agreed, more than a half of them strongly agreed, that the Chilean English teachers need to be trained to use mobile devices as a learning tool. III. Section three’s results about students’ uptake of mobile devices are the following: Figure six shows that more than half of the participants believe that their future students will have a mobile device to work with, only five respondents disagree with this assumption and a third of them strongly agree with it.

Figure six shows that more than half of the participants believe that their future students will have a mobile device to work with, only five respondents disagree with this assumption and a third of them strongly agree with it.

37

Figure seven shows that all the participants believe that students need to be trained to use mobile devices with learning purposes.

The results in figure 8 show that all the respondents agreed that students enjoy working in groups when doing vocabulary activities, fifteen of them strongly agreed with this assumption. IV. The results of section four related to the need and want to be trained to use mobile devices as a learning tool are the following:

Figures 9 and 10 show that all the participants would like to be trained to use mobile devices as a teacher-friendly tool and to enroll in a workshop where this is taught. The results of the survey reflect that pre-service English teachers need and want to be trained to use mobile devices with learning purposes, especially to learn how to take advantage of apps to teach vocabulary. So, pre-service English teachers’ workshops needs to be a theoretical-practical course where they will be able to study how mobile learning works, how to incorporate it in the classroom and the most important reasons teachers need to update to incorporate mobile devices to innovate and motivate our students. Then, pre-service English teachers will be able to learn about some useful apps that can be used to create vocabulary activities, to use these apps, and also to create a set of activities that relates one to the other in order to cover a unit of their choosing and that can be done in pairs or in small groups.

38

7.2 Appendix B: Survey Survey: Teaching vocabulary through mobile devices

Objectives:

Identify how much access students have to mobile devices according to pre-service

teachers of English’s assumptions.

Identify how comfortable and interested future teachers will feel introducing mobile

devices to their classrooms to improve vocabulary teaching.

I. Personal information and (future) experience.

II. Read each statement and select the answer that best completes it.

1. I am a...

a) Male. b) Female.

2. Once I graduate, I would like to work in a…

a) Public school. b) Semi-private school. c) Private school.

3. Once I graduate, my potential students will be

a) Beginner. b) Pre-Intermediate. c) Intermediate. d) Advanced.

4. SL2 language learners learn more vocabulary working …

a) Individually. b) In pairs. c) In small groups.

II. Technology –mobile devices- as a teacher-friendly tool to teach and reinforce vocabulary.

I. Teachers’ perceptions on ….

II. Read the following statements and mark with an “x” your level of agreement.

Regarding the use of mobile devices Disagree Agree Strongly

Agree

1. I know how to integrate mobile devices in my

language classes.

2. I know how to take advantage of mobile devices

for language learning.

3. I feel comfortable working with mobile devices

such as cellphones or tablets.

4. I think that mobile devices can be used as a

motivational strategy for students.

5. Chilean education needs to integrate mobile

devices in the language classrooms so as to update

with the “digital natives” students.

39

6. Chilean teachers (of English) need training in using

mobile devices as an educational tool

III. Teacher’s assumption on learners’ uptake of mobile devices

Regarding the students and the use of technology Disagree Agree Strongly

Agree

1. All the students I might work with have a mobile

device ( cellphone &/or tablet)

2. Students feel comfortable using mobile devices.

3. Students know how to use mobile devices to learn L2

vocabulary.

4. Students need to be taught how to use mobile devices

with a language learning purpose.

5. Students need to be supervised when using mobile

devices with language learning purpose.

6. Students would be able to work with mobile devices

with their peers without the teacher’s supervision.

7. Students would enjoy group activities using mobile

devices for vocabulary learning

IV. Taking advantage of cellphones, learning how to do it. Answer the following questions:

1. Do you think using apps in their mobile device would motivate your students to learn L2

vocabulary?

a) Yes. b) Could be. c) No.

2. Would you like to be trained on how to use mobile device in the classroom?

a) Yes. b) No.

3. Would you enroll in a workshop to take advantage of some useful apps to teach L2 vocabulary?

a) Yes. b) No.