Biotechnology Letters 24: 1089–1096, 2002.© 2002 Kluwer Academic Publishers. Printed in the Netherlands.

1089

Regulation of the xylanase gene, cgxA, from Chaetomium gracile bytranscriptional factors, XlnR and AnRP

Uma Rao, Junichro Marui, Masashi Kato, Tetsuo Kobayashi & Norihiro Tsukagoshi∗Department of Biological Mechanisms and Functions, Graduate School of Bioagricultural Sciences, Nagoya Uni-versity, Nagoya 464-8601, Japan∗Author for correspondence (Fax: 81-52-789-4087; E-mail: tukagosi@agr.nagoya-u.ac.jp)

Received 28 March 2002; Revisions requested 10 April 2002; Revisions received 25 April 2002; Accepted 26 April 2002

Key words: Aspergillus nidulans, Aspergillus nidulans repressor protein (AnRP), cgxA, Chaetomium gracile, XlnR

Abstract

The roles of XlnR and AnRP in regulating the expression of the xylanase gene, cgxA, from Chaetomium gracilewere investigated using Aspergillus nidulans as an intermediate host. The XlnR consensus binding sequence–GGCTAA– in the promoter region was functional in vivo. The cgxA gene was induced when xylan was used as acarbon source but this inducibility was abolished when the XlnR binding sequence was mutated. Furthermore, theinduction by xylan was increased when the AnRP binding sequence –TTGACAAAT– was mutated. Electrophoreticmobility shift assays using partially purified AnRP and an Aspergillus oryzae XlnR fusion protein, MalE-AoXlnR,provided evidence that the binding of the two proteins to their respective sites in the cgxA promoter region wasmutually exclusive.

Introduction

The availability of a number of regulatory mutantsand an effective DNA mediated transformation systemmakes Aspergillus nidulans a model organism for thestudy of regulation of gene expression in filamentousfungi. Aspergilli are used for the production of manyindustrial enzymes including extracellular enzymessuch as amylases, proteases, cellulases, hemicellulasesand lipases. Xylan is the most abundant componentof hemicellulases and is a β-1, 4 linked polymer ofxylose substituted with side-chains of other pentoses,hexoses and uronic acids depending on its botanicalorigin. Because of xylan’s heterogeneity, microor-ganisms produce a complex spectrum of xylanolyticenzymes, the major of which is endo-β-1, 4-xylanases(Biely 1985). Recently fungal xylanases are receivingattention due to their potential biotechnological ap-plications, especially in the paper industry (Duarte &Costa-Ferreira 1994, Haarhoff et al. 1999, Beg et al.2001).

Cloning and characterization of transcriptional ac-tivators involved in regulation of extracellular en-

zymes such as AmyR (Petersen et al. 1999, Gomiet al. 2000, Tani et al. 2001) and ACEII (Aro et al.2001) have helped in elucidating the mechanisms un-derlying transcriptional regulation of amylase and cel-lulase genes, respectively. Although a number of xy-lanase genes have been cloned from filamentous fungi,little is known about their regulation apart from thewide domain regulatory systems involving carboncatabolite repressor CreA (Ronne 1995) and pH reg-ulator, PacC (Denison 2000). Our understanding ofthe regulatory mechanisms of xylanolytic enzymeshas gained momentum with the cloning of the xlnRgene (van Peij et al. 1998) encoding a transcriptionalactivator of the xylanolytic genes in A. niger.

We have previously reported the isolation and char-acterization of two xylanase genes, cgxA and cgxB,from a fungal plant pathogen Chaetomium gracile(Yoshino et al. 1995). These xylanases showed astrong preference for internal linkages and hydrolysedmore than 90% of birchwood xylan under optimalconditions, where xylobiose comprised approximately80% of the hydrolysate. While investigating the ex-pression of cgxA in A. nidulans by promoter deletion

1090

analysis, a negative regulatory sequence was iden-tified (Mimura et al. 1998). Further electrophoreticmobility shift assays confirmed the presence of a neg-ative regulatory factor designated AnRP which boundspecifically to a –TTGACAAAT– sequence (−331 to−323). Following the cloning of the xlnR gene andthe identification of its binding sequence –GGCTAA–,the cgxA promoter was examined for the presence ofany XlnR binding sequences and one such sequence–GGCTAA– was located at −435. Consequently, weinvestigated the functionality of the XlnR binding se-quence in vivo and the mechanism by which XlnRand AnRP regulate the expression of the cgxA gene.Due to lack of an effective transformation system inChaetomium gracile, all the investigations were doneusing A. nidulans as an intermediate host. To avoidinterference in the enzyme activity by the endogenouscyanoses produced by A. nidulans, the Taka-amylaseA gene, taaG2 (Tsukagoshi et al. 1989), was used asa reporter gene in this study.

Materials and methods

Strains, plasmids, media and transformation

Aspergillus nidulans G191 (pyrG89; pabaA1; fwA1;uaY9), a uridine-requiring host for transformation,was grown at 37 ◦C in standard A. nidulans com-plete and minimal culture media supplemented with2 mg uridine ml−1 and 2 µg p-aminobenzoicacid ml−1. Minimal media contained the following:0.6% NaNO3, 0.152% KH2PO4, 0.052% KCl, 0.052%MgSO4, trace elements and 1% (w/v) glucose as car-bon source. Complete medium contained 2% (w/v)malt extract, 0.2% Bactopeptone and 2% glucosewas used as carbon source. Plasmid pTG1 carryingthe Neurospora crassa pyr4 gene on pUC 18 (Katoet al. 1997) was used as a vector during transfor-mation experiments. Protoplast preparation and trans-formation were performed by the method of Balance& Turner (1985). The transformants were grown inDP medium (Iimura et al. 1987) supplemented with2 µg PABA ml−1 and with the carbon source in themedium replaced with starch or glucose or xylan.In DP medium the nitrogen was provided from 1%polypeptone and 0.1% NaNO3.

The Escherichia coli strain JM109 was used forDNA manipulations. Vector pUC118 (Vierra & Mess-ing 1982) was used to subclone various restrictionfragments. Strains of E. coli carrying various plas-mids were grown at 37 ◦C in LB medium containing

50 µg ampicillin ml−1. Transformations of E. coliwere performed by the method of Lederberg & Cohen(1974)

Construction of cgxA::taaG2 fusion genes

Plasmids pUC118CGXA containing a 3.5 kb cgxAgene and pTG1TaaG2 containing the taaG2 gene wereused as templates to amplify the promoter region ofcgxA and the structural gene of taaG2, respectively.

The first PCRs were performed with the follow-ing oligonucleotide combinations: the wild type full-length 5′-non-coding region of the cgxA gene from−764 to −1 was amplified using primers cgx-ecoplus cgxtaa-AS (Table 1). A 5′ region of the taaG2structural gene from +1 to +151 was amplified us-ing primers cgxtaa-AS plus taa-sal. Recombinant PCR(Higuchi et al. 1988) was employed to introduce sitedirected mutations into the cgxA promoter. Mutationwas introduced into the XlnR binding sequence us-ing primers cgx-eco plus XlnRM-AS and XlnRM-Splus cgxtaa-AS. Mutation in AnRP binding sequencewas introduced using cgx-eco plus AnRPM-AS andAnRPM-S plus cgxtaa-AS.

The PCR products amplified by in each primerset were combined, subjected to a second PCR withprimers cgx-eco and taa-sal, digested with EcoRIand SalI and introduced into pUC118 to generatepCGXTAA, pXMTAA and pAMTAA.

pXAMTAA carrying a mutation in both the XlnRand AnRP binding sequences was constructed by thesame procedure as pAMTAA, except that pXMTAAwas used as template DNA. The EcoRI-SalI fragmenton pCGXTAA, pXMTAA, pAMTAA and pXAMTAAwas inserted together with a SalI-XbaI fragment onpTG1TaaG2 containing the rest of the taaG2 structuralgene into the EcoRI-XbaI site of pTG1.

Preparation of partially purified AnRP andelectrophoretic mobility shift assays

Nuclear extracts were prepared from A. nidulans G191grown in DP medium (Nagata et al. 1993) sup-plemented with 1% starch. AnRP enriched nuclearfractions were purified by heparin–Sepharose columnchromatography (Nagata et al. 1993). A fraction elu-ated with 0.54 M KCl was used in gel mobility shiftassays.

The binding reaction was carried out in 20 µlof buffer [25 mM HEPES/KOH, 50 mM KCl,5 mM MgCl2, 0.5 mM EDTA, 1 mM dithiothre-itol, 10% (w/v) glycerol] containing 1 µg poly (dI-

1091

Table 1. Primers used in the construction of cgxA::taaG2 fusion genes.

Oligonucleotide Location Sequence (5′ to 3′)

cgx-eco −788 to −765 CCCCGAATTCGCCGCTCGCTCTTT

cgxtaa-S −21 to +14a GCCCCGCACGCAACAATGATGGTCGGTGG

cgxtaa-AS +14 to −21 CCACGCGACCATCATTGTTGCGTGCGGGGC

taa-sal +151 to +134a AAGTCGCAGTCGTCGACC

AnRPM-S −345 to −316 CTCGTCGGCTCTAGATCTCAAATCGCCAAA

AnRPM-AS −316 to −345 TTTGGCGATTTGAGATCTAGAGCCGACGAG

XlnRM-S −447 to −420 GCGGATATTCAGATCTATACTGTATT

XlnRM-AS −420 to −447 AATACAGTATAGATCTGAAATATCCGC

aReferring to the putative translation start site of taaG2 gene as +1.The sequences underlined indicate the positions where the mutations have been introduced.

dC) and 20 000 cpm of the 3′ end labelled DNAfragments and incubated for 30 min on ice. Elec-trophoresis was performed at 4 ◦C on 4% (w/v)acrylamide gels prepared in 0.5× TAE buffer at7.5 volts/cm. The gel was dried and autoradiographedand the shift bands were detected with an im-age analyser BAS 2500(FUJI FILM). Primers 144–S5′CCCCGAATTCGGGCGGGCGGATATTTCAGGCTAA-3′ and 144 –AS 5′TCGAGGATCCTTTGGCGATTTGTCAACCAG-3′ corresponding to −449 to−430– and −316 to −335 region on the cgxA pro-moter respectively, were used to amplify a 144 bpcgxA promoter fragment containing the XlnR andAnRP binding sites (Figures 1, 3A). The amplifiedfragment was digested with EcoRI and BamHI.

The DNA fragments were labelled at the 3′end with T7 polymerase and [α-32P]dCTP. Oligonu-cleotides 13CDS 5′-CTAGTGGTTGACAAATCG-CCT-3′ and 13CD AS 5′-CTAGAGGCGATTTGTCA-ACCA-3′ were annealed and cloned in XbaI site ofvector pUC118. A 25 bp XbaI-HincII fragment wasprepared and used as competitor for AnRP.

Oligonucleotides U-23 S 5′-GATCGGGGTATTAGGCTAAACGTGGCT-3′ and U-23AS, 5′-GATCAGCCACGTTTAGCCTAATACCCC-3′ were annealed andcloned in the BamH1 region of vector pUC118. AnEcoR1-HindIII fragment was prepared and used ascompetitor for the XlnR.

Other methods

Recombinant DNA techniques were carried out bystandard procedures (Sambrook et al. 1989). Chro-mosomal DNA was extracted as described previously(Tsukagoshi et al. 1989). For Southern analysis, DNAwas fractionated by electrophoresis on an agarose geland transferred onto hybond-N+ membrane (Amer-

sham) by capillary blotting (Sambrook et al. 1989). A2.4 kb taaG2 fragment was used as a probe. Labelling,hybridisation and detection of Southern blots was car-ried out using the ECL direct nucleic acid labellingand detection systems (Amersham Pharmacia).

α-Amylase activity was measured at 37 ◦C in a so-lution consisting of 1%(w/v) soluble starch, 20 mMacetate buffer (pH 5.9) and 10 mM CaCl2. The amountof reducing sugar liberated was determined by theSomogyi Nelson method. Protein concentration wasdetermined by means of standard Bio-Rad proteinassay with bovine plasma γ -globulin as a standard.

Nucleotide sequences were determined by thedideoxy chain-termination method (Sanger et al.1977) with a DNA sequencer (Applied Biosystems,373A)

Results and discussion

Features of the cgxA promoter sequence

Although the cgxA gene contained no typical TATAbox like most eukaryotic promoters, three CreA bind-ing sequences, three PacC binding sequences and anXlnR binding sequence were found in the promoterregion (Figure 1). No other nucleotide sequences withsufficient similarity to known DNA-binding targetswere detected. During our previous studies to eluci-date cis-elements regulating the cgxA gene, a negativecontrol element and its binding factor AnRP wereidentified (Mimura et al. 1998). To get an overallunderstanding of the cgxA gene regulation, the full-length cgxA promoter with all its potential bindingsequences described above was used in this study. TheXlnR and AnRP binding sequences were mutated to

1092

Fig. 1. Nucleotide sequence of the cgxA promoter.The transcription start site is indicated as +1.The putative CreA binding sites are overlined.Putative PacC binding sites are underlined. The XlnR and AnRP binding sequences are boxed. The DNA fragment used as a probe in gel shiftassays is shown by a dotted underline.

examine the regulatory roles of these factors in thecgxA gene expression.

XlnR mediated expression of the cgxA gene

Four cgxA::taaG2 fusion genes containing: (1) theauthentic cgxA promoter with the XlnR and AnRPbinding sequences (CGXTAA); (2) a mutation in theXlnR binding sequence (XMTAA); (3) a mutationin the AnRP binding sequence (AMTAA); and (4)mutations in both the XlnR and AnRP binding se-quences (XAMTAA) were constructed as describedin Materials and methods (Figure 2A). All the aboveconstructs were cloned into the vector pTG1 carry-ing the Neurosopra crassa pyr4 gene and introducedinto A. nidulans G191 as described in Materials andmethods. Three independent transformants of eachconstruct were analysed for their enzyme produc-tion. Amylase activity was normalized to the quantityof cgxA::taaG2 DNA as described in Materials andmethods.

Amylase actvity of the CGXTAA transformantswas considerably higher when grown on inducible

carbons such as xylan (Figure 2B) than when grownon starch (Figure 2C) or glucose (data not shown).This induction by xylan was abolished when the XlnRbinding sequence was mutated as observed with thetransformants XMTAA and XAMTAA. This clearlyshows that the XlnR binding sequence functions inthe inducible expression of cgxA, indicating furtherthat XlnR mediates expression of the cgxA gene.However, the AMTAA transformants produced signif-icantly higher activities of amylase than those of theCGXTAA transformants in the xylan medium. Theenhanced expression of amylase in the AMTAA trans-formants could be due to the loss of AnRP function.

To rule out the possibility that the increase wasdue to the effect of an integration event, 12 AM-TAA transformants were analysed. All the AMTAAtransformants examined showed significant increasesin amylase activity compared to that of the CGX-TAA transformants. It was also confirmed by EMSAthat mutation of the AnRP binding sequence abolishedbinding of AnRP (data not shown). All these data in-dicate that the induction of the cgxA gene mediatedby XlnR is hampered in the presence of a functional

1093

Fig. 2. Effects of mutations of the XlnR binding site (XBS) and AnRP binding site (ABS) on the induction of cgxA. Schematic representationof the wild type and mutant cgxA promoters. All these promoters were fused to the taaG2 structural gene and used for transformation.All transformants were grown at 37 ◦C for 48 h on 2% (w/v) xylan (B) or 2% (w/v) starch (C). The amylase activity of three independenttransformants was determined for each construct and normalized to the relative copy number of taaG2 determined by Southern analyses.

AnRP binding sequence. When grown on starch, theAMTAA transformants showed a rather high basallevel of amylase activity (Figure 2C) suggesting thatin the absence of AnRP binding sequence, the basallevel expression of the cgxA gene is enhanced due tounknown reasons. All the above data indicate that theexpression of the cgxA gene in A. nidulans is regulatedprimarily by induction and repression mediated byXlnR and AnRP, respectively. To examine further therelationship between XlnR and AnRP, EMSA was per-formed with a recombinant XlnR and partially purifiedAnRP.

Binding of XlnR and AnRP to the cgxA promoter

To prove that the regions of the cgxA promoter de-scribed above are responsible for the binding of XlnRand AnRP and to study the interaction between the twofactors, gel mobility shift assays were performed. Par-tially purified AnRP from nuclear extracts of A. nidu-lans grown on starch were used in EMSA. MalE-AoXlnR fusion protein containing the DNA bindingregion of the A. oryzae XlnR protein (Marui et al.2002) was used in EMSA since the A. nidulans xlnRgene has not been isolated. A 144 bp cgxA promoterfragment, XA 144, containing the XlnR and AnRPbinding sequences was used as a probe (Figure 1,Figure 3A).

When AnRP purified partially from nuclear frac-tions prepared from starch grown cells was used forDNA binding, one major shift band was formed (Fig-ure 3B, lane 2). The sequence specificity of thisprotein-DNA interaction was confirmed in competi-tion experiments. A decrease in the intensity of thisband was evident on addition of 10 and 100 fold mo-lar excess of unlabelled 13CD fragment carrying onlythe AnRP binding sequence (Figure 3B, lanes 3, 4),whereas it remained unaffected on addition of an un-related unlabelled DNA fragment (Figure 3B, lanes 5,6).

Contrary to our expectations, two shift bands CIand CII of higher and lower mobility respectivelywere detected with MalE-AoXlnR fusion protein (Fig-ure 3B, lane 7). The formation of CII was observedwith increasing quantities of AoXlnR fusion protein(data not shown). One possible explanation for the ob-served phenomena could be due to dimerization of theAoXlnR fusion protein. The sequence specific bindingof the AoXlnR fusion protein was also confirmed incompetition experiments under similar conditions tothose described above. The intensities of both shiftbands CI and CII were decreased on addition of 10and 100 fold molar excess of unlabelled XlnR specificcompetitor (Figure 3B, lanes 8, 9), while their intensi-ties appeared unaffected even on the addition of 100fold unlabelled non-specific competitor (Figure 3B,lane 11)

1094

Fig. 3. Electrophoretic mobility shift assays. (A) Probe DNAs shown schematically were prepared as described in Materials and methods. (B)Specific binding of AnRP and MalE-AoXlnR. Two µg of AnRP enriched nuclear extracts from starch-grown cells was mixed with 20 000 cpmof probe XA144 (lane 2). Ten and 100-fold molar excess fold specific competitor 13CD (lane 3, 4) or non-specific competitor MCS (lanes 5, 6)were added in the binding reactions. 0.5 µg MalE-AoXlnR was mixed with probe XA144 (lane 7) in the presence of 10 and 100 fold specificcompetitor U-23 (lanes 8, 9) and non-specific competitor (lanes 10, 11). The bands corresponding to the AnRP-DNA interactions (A) and thatof MalE-AoXlnR (CI and CII) are indicated by arrows. (C) Competition between AnRP and MalE-AoXlnR for binding to the cgxA promoter.EMSA was performed using probe XA144, a constant amount of MalE-AoXlnR and increasing amounts of AnRP enriched nuclear extractsfrom starch-grown cells. Lane 1, free probe; lane 2, 2.5 µg of AnRP from starch grown cells; lane 3, 0.5 µg of MalE-AoXlnR; lanes 4–10,0.5 µg MalE-AoXlnR with 2, 2.5, 3, 3.5, 4, 4.5 and 5 µg AnRP enriched nuclear extracts.

1095

The specific interactions between AnRP and XlnRwas further investigated by performing EMSA witha mixture of both proteins. The shift band formedwith 2.5 µg partially purified AnRP was competedout by the addition of 0.5 µg MalE-AoXlnR (Fig-ure 3C, compare lanes 2 and 4). On increasing thequantity of AnRP in the binding mixture to 4.5 µgor more, AoXlnR specific bands were competed outand AnRP specific shift band was formed (Figure 3C,lanes 9, 10). Although the molar quantity of AnRP inthe nuclear extract is not known, 4.5 µg of partiallypurified AnRP might be the threshold quantity neces-sary to compete out AoXlnR binding in the presenceof 0.5 µg AoXlnR. Thus binding of either protein tothe promoter results in inhibition of binding of theother protein. This data clearly indicates that AnRPand XlnR compete to bind to the promoter in a mutu-ally exclusive way by interfering with the binding ofthe other factor.

Competition has been observed in the A. nidulansethanol regulon where AlcR, the specific transacti-vator of the ethanol regulon genes alcA and aldA,and the carbon catabolite repressor CreA compete toregulate the expression of genes involved in ethanolmetabolism (Mathieu et al. 1994). Competition be-tween Mig1p (the CreA equivalent in Saccharomycescerevisiae) and Mal63p, an activator of the maltoseutilization genes, has also been reported (Wang et al.1997).

AnRP and XlnR could exclude each other by twopossible ways, either through AnRP-XlnR interactionsor through stearic hinderance caused by the bindingof one factor to the promoter. If protein-protein in-teraction is the case, unbound AnRP in transformantsAMTAA carrying a mutated AnRP binding sequence(Figure 2B) would interact with XlnR and result in in-hibition of XlnR mediated induction of the cgxA gene.Likewise unbound XlnR in transformants XMTAAcarrying a mutated XlnR binding sequence, wouldbring about derepression of AnRP mediated repressionof the cgxA gene. However, free AnRP and XlnR hadno effect on the expression of the cgxA gene as shownin Figure 2B, suggesting that stearic hinderance couldbe the mechanism by which AnRP and XlnR excludeeach other.

A search of the TRANSFAC databases (Wingen-der et al. 2000) and Transcription element SearchSoftware (http://www.cbil.upenn.edu/tess) for factorsbinding to a similar sequence as AnRP did not showany hits. Purification of AnRP and analysis of possibleinteractions between AnRP and XlnR will allow us to

understand the mechanism of repression by AnRP inmore detail.

References

Aro N, Saloheimo A, Ilmen M, Penttila M (2001) ACEII, a noveltranscriptional activator involved in regulation of cellulase andxylanase genes of Trichoderma reesei. J. Biol. Chem. 276:24309–24314.

Balance DJ, Turner G (1985) Development of a high frequencytransforming vector for Aspergillus nidulans. Gene 36: 321–331.

Beg OK, Kapoor M, Mahajan L, Hoondal GS (2001) Micro-bial xylanases and their industrial applications: a review. Appl.Microbiol. Biotechnol. 56: 326–338.

Biely P (1985) Microbial xylanolytic systems. Trends Biotech. 743:286–290.

Denison SH (2000) pH regulation of gene expression in fungi.Fungal Genet. Biol. 29: 61–71.

Duarte JC, Costa-Ferreira M (1994) Aspergilli and lignocellu-losics: enzymology and biotechnological applications. FEMSMicrobiol. Rev. 13: 377–86.

Gomi K, Akeno T, Minetoki T, Ozeki K, Kumagai C, OkazakiN, Iimura Y (2000) Molecular cloning and characterizationof a transcriptional activator gene amyR involved in the amy-lolytic gene expression in Aspergillus oryzae. Biosci. Biotechnol.Biochem. 64: 816–827.

Haarhoff J, Moes CJ, Cerff C, van Wyk WJ, Gerischer G, JanseBJH (1999) Characterization and biobleaching effect of hemi-cellulases produced by thermophilic fungi. Biotechnol. Lett. 21:415–420.

Iimura Y, Gomi K, Uzu H, Hara S (1987) Transformation of As-pergillus oryzae through plasmid mediated complementationof methionine auxotrophic mutation. Agric. Biol. Chem. 51:323–328.

Kato M, Aoyama A, Naruse F, Kobayashi T, Tsukagoshi N (1997)An Aspergillus nidulans nuclear protein, AnCP, involved in en-hancement of Taka-amylase A gene expression, binds to theCCAAT-containing taaG2, amdS, and gatA promoters. Mol. Gen.Genet. 254: 119–126.

Lederberg EM, Cohen SN (1974) Transformation of Salmonellatyphimurium by plasmid DNA. J. Bacteriol. 119: 1072–1074.

Marui J, Tanaka A, Mimura S, de Graaf LH, Visser J, Kitamoto N,Kato M, Kobayashi T, Tsukagoshi N (2002) A transcriptionalactivator, AoXlnR, controls the expression of genes encodingxylanolytic enzymes in Aspergillus oryzae. Fungal Genet. Biol.35: 157–169.

Mathieu M, Felenbok B (1994) The Aspergillus nidulans CreA pro-tein mediates glucose repression of the ethanol regulon at variouslevels through competition with the AlcR-specific transctivator.EMBO J. 13: 4022–4027.

Mimura S, Rao U, Yoshino S, Kato M, Tsukagoshi N (1998) Dere-pression of the xylanase-encoding cgxA gene of Chaetomiumgracile in Aspergillus nidulans. Microbiol. Res. 153: 369–376.

Nagata O, Takashima T, Makoto T, Tsukagoshi N (1993) As-pergillus nidulans nuclear proteins bind to a CCAAT element andthe adjacent upstream sequence in the promoter region of thestarch-inducible Taka-amylase A gene. Mol. Gen. Genet. 237:251–260.

Petersen KL, Lehmbeck J, Christensen T (1999) A new transcrip-tional activator for amylase genes in Aspergillus. Mol. Gen.Genet. 262: 668–676.

1096

Ronne H (1995) Glucose repression in filamentous fungi. TrendsGenet. 11: 12–17.

Sambrook J, Fritsch EF, Maniatis T (1989) Molecular Cloning: ALaboratory Manual, 2nd edn. Cold Spring Harbor, NY: ColdSpring Harbor Laboratory Press.

Sanger F, Nicklen S, Coulson AR (1977) DNA sequencing withchain terminating inhibitors. Proc. Natl. Acad. Sci. USA 74:5463–5467.

Tani S, Katsuyama Y, Hayashi T, Suzuki H, Masashi K, Gomi K,Kobayashi T, Tsukagoshi N (2001) Characterization of the amyRgene encoding a transcriptional activator for the amylase genesin Aspergillus nidulans. Curr. Genet 39: 10–15.

Tsukagoshi N, Furusawa M, Nagaba H, Kirita N, Tuboi A, UdakaS (1989) Isolation of a cDNA encoding Aspergillus oryzae Taka-amylase A: evidence for multiple related genes. Gene 84: 319–327.

van Peij NNME, Visser J, de Graaf LH (1998) Isolation and analysisof xlnR, encoding a transcriptional activator co-ordinating xy-lanolytic expression in Aspergillus niger. Mol. Microbiol. 278:131–142.

Vieira J, Messing J (1982) The pUC plasmids, an M13mp7 derivedsystem for insertion mutagenesis and sequencing with syntheticuniversal primers. Gene 19: 259–268.

Wang J, Sirenko O, Needleman R (1997) Genomic footprinting ofMig1p in the MAL62 promoter. J. Biol. Chem. 272: 4613–4622.

Wingender E, Chen X, Hehl R, Karas H, Liebich I, Matys V, Mein-hardt T, Prüß M, Reuter I, Schacherer F (2000) TRANSFAC:an integrated system for gene expression regulation. Nucl. AcidsRes. 28: 316–319.

Yoshino S, Oishi M, Moriyama R, Kato M, Tsukagoshi N (1995)Two family G xylanase genes from Chaetomium gracile and theirexpression in Aspergillus nidulans. Curr.Genet. 29: 73–80.