Regulation of Ribosomal Protein Operons rplM-rpsI, rpmB-rpmG, andrplU-rpmA at the Transcriptional and Translational Levels

Leonid V. Aseev, Ludmila S. Koledinskaya, Irina V. Boni

Shemyakin-Ovchinnikov Institute of Bioorganic Chemistry RAS, Moscow, Russia

ABSTRACT

It is widely assumed that in the best-characterized model bacterium Escherichia coli, transcription units encoding ribosomalproteins (r-proteins) and regulation of their expression have been already well defined. However, transcription start sites forseveral E. coli r-protein operons have been established only very recently, so that information concerning the regulation of theseoperons at the transcriptional or posttranscriptional level is still missing. This paper describes for the first time the in vivo regu-lation of three r-protein operons, rplM-rpsI, rpmB-rpmG, and rplU-rpmA. The results demonstrate that transcription of all threeoperons is subject to ppGpp/DksA-dependent negative stringent control under amino acid starvation, in parallel with the rRNAoperons. By using single-copy translational fusions with the chromosomal lacZ gene, we show here that at the translation level onlyone of these operons, rplM-rpsI, is regulated by the mechanism of autogenous repression involving the 5=untranslated region (UTR) ofthe operon mRNA, while rpmB-rpmG and rplU-rpmA are not subject to this type of regulation. This may imply that translational feed-back control is not a general rule for modulating the expression of E. coli r-protein operons. Finally, we report that L13, a primary pro-tein in 50S ribosomal subunit assembly, serves as a repressor of rplM-rpsI expression in vivo, acting at a target within the rplM transla-tion initiation region. Thus, L13 represents a novel example of regulatory r-proteins in bacteria.

IMPORTANCE

It is important to obtain a deeper understanding of the regulatory mechanisms responsible for coordinated and balanced syn-thesis of ribosomal components. In this paper, we highlight the major role of a stringent response in regulating transcription ofthree previously unexplored r-protein operons, and we show that only one of them is subject to feedback regulation at the trans-lational level. Improved knowledge of the regulatory pathways controlling ribosome biogenesis may promote the developmentof novel antibacterial agents.

Ribosomal protein (r-protein) operons rplM-rpsI, rplU-rpmA,and rpmB-rpmG encode r-proteins L13-S9, L21-L27, and

L28-L33, respectively. Despite long-term studies of the regulationof expression of ribosomal components (1–5), these three operonshave never been explored and their regulation remains largelyunexplained. At the same time, the products of the operons playnoticeable roles in ribosome assembly and functioning, whichstimulates investigation into the control mechanisms of their ex-pression, given the importance of knowledge about ribosome bio-genesis and its control.

Proteins L21 and L27 encoded by rplU-rpmA are bacteriumspecific (6). L27 was suggested to contribute to the function of theribosomal peptidyl transferase center (PTC) via interactions of itsN-terminal tail with both the A-site and P-site tRNAs, facilitatingtheir accommodation in the PTC (7, 8). The L27-lacking strainhas severe growth defects and is deficient in both the assembly andfunctioning of the 50S ribosomal subunits (7). However, a recentstudy of the impact of L27 on the activity of PTC argues against akey role of L27 in peptide bond formation on the ribosome, al-though the lack of L27 slightly reduced the average elongation ratein vitro (9). This implies that the slow-growth phenotype of theL27-deficient strain may be attributed to the impaired ribosomeassembly, reducing the pool of active ribosomes inside the cell,rather than to defects in the PTC (9). As for the rpmA-encodedL21, it has been reported to interact with 23S rRNA (10), but westill do not know much about its functional importance.

The rplM-rpsI operon encodes universal ribosomal proteinsL13 and S9 (6). An essential protein, L13 is an early 50S assembly

component interacting with 23S RNA, and its incorporation invivo requires the DEAD-box RNA helicase SrmB (11). It has beenproposed that SrmB is necessary for organizing the L13 bindingsite on 23S rRNA by preventing formation of erroneous alterna-tive structures (12). Protein S9 is also very important. The bindingof S9 to 16S RNA during 30S assembly depends on S7 and addi-tional assembly cofactors (13, 14). Though viable, the rpsI knock-out strain exhibits a strong growth defect (15, 16), most likelybecause of the active role of S9 in maintaining the translationreading frame via contacts of its long C-terminal tail with theP-site tRNA (15, 17). In addition, the mutant producing reducedamounts of S9 displays an increased accumulation of immature16S rRNA (17S rRNA), and thereby smaller amounts of 70S ribo-somes and polysomes are formed (18).

Proteins L28 and L33 are bacterium specific (6). The generpmG (L33) can be deleted without any impact on growth rate,indicating the redundant role of L33 in ribosome synthesis andfunctions (19, 20). In contrast to L33, L28 encoded by rpmB plays

Received 26 February 2016 Accepted 30 June 2016

Accepted manuscript posted online 5 July 2016

Citation Aseev LV, Koledinskaya LS, Boni IV. 2016. Regulation of ribosomal proteinoperons rplM-rpsI, rpmB-rpmG, and rplU-rpmA at the transcriptional andtranslational levels. J Bacteriol 198:2494 –2502. doi:10.1128/JB.00187-16.

Editor: R. L. Gourse, University of Wisconsin—Madison

Address correspondence to Irina V. Boni, irina_boni@ibch.ru.

Copyright © 2016, American Society for Microbiology. All Rights Reserved.

crossmark

2494 jb.asm.org September 2016 Volume 198 Number 18Journal of Bacteriology

on October 2, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

an important role in ribosome assembly, as in its absence only afew 70S ribosomes are made, while 30S and 47S particles accumu-late. The 47S intermediates are easily converted to mature 50Ssubunits when L28 is supplied from a plasmid (19, 20).

While the products of the rplU-rpmA, rplM-rpsI, and rpmB-rpmG operons are important for ribosome assembly and/or func-tioning, little if anything is known about the mechanisms of theirregulation. Moreover, their transcriptional start sites (TSSs) havebeen located only very recently by the differential RNA sequencing(RNA-seq) approach (21). In the present work, we define the fea-tures of promoter regions upstream of the TSSs. We show thattranscription of the three operons is subject to negative stringentcontrol in a ppGpp/DksA-dependent manner, most likely due tothe features of the discriminator region separating the �10 pro-moter element from the TSS. At the same time, translational feed-back regulation was observed only for the rplM-rpsI operon andwas not found for rplU-rpmA or rpmB-rpmG. Finally, we showthat protein L13 serves as a translational repressor that regulatesrplM-rpsI expression in vivo.

MATERIALS AND METHODSStrains and plasmids. The strains and plasmids used in this study arelisted in Table 1. Plasmids pL13/S9, pL21/L27, and pL28/L33 were con-structed to express in trans the products of the three operons studied here;all of them were created by cloning the entire operon sequences flankedwith their own promoters and terminators into BamHI/HindIII sites ofpACYC184 (rplU-rpmA and rpmB-rpmG) or into BamHI/ClaI sites in thecase of rplM-rpsI. The corresponding regions were amplified by PCR onEscherichia coli genomic DNA by using Phusion Hot Start II high-fidelityDNA polymerase (Thermo Scientific) and pairs of appropriate primerswhich comprised the restriction sites for subsequent cloning. The result-

ing plasmids were checked by sequencing. Expression of the wild-typeprotein S9 from plasmid pL13/S9 was also confirmed by its ability tosuppress the slow-growth phenotype of the rpsI::kan strain (a generousgift of M. Bubunenko). To build the plasmid expressing only rplM, therpsI gene was deleted from plasmid pL13/S9 by the “outward” PCR tech-nique used to amplify the whole plasmid except for the rpsI coding se-quence. The primer rpsI_left (5=-TCAGCCATTGCCTATAATCCCG)was complementary to positions �14 to �8 relative to the rpsI ATG startcodon, and the primer rpsI_right (5=-ATTGGCTTCTGCTCCGGCAG)corresponded to the sequence separating the rpsI stop codon and therho-independent terminator of the operon. The primers were phosphor-ylated by T4 polynucleotide kinase (New England BioLabs) and then usedin PCR comprising Phusion Hot Start II high-fidelity DNA polymeraseand pL13/S9 as a template. The PCR product was purified, circularized byligation of blunt ends, and used for transformation of DH5�. The result-ing plasmids were sequenced to choose the right clone.

Construction of fusions with the chromosomal lacZ gene. The strat-egy to generate specialized strains in which expression of the chromo-somal lacZ gene would be governed by the transcriptional and trans-lational regions of the unrelated gene has been described previously(22–24). Based on this approach, we created rplU=-=lacZ, rplM=-=lacZ, andrpmB=-=lacZ chromosomal fusions. PCR products for cloning into thepEMBL�46 vector (25) in-frame with the lacZ coding sequence were ob-tained with E. coli genomic DNA by using the same forward primers asthose used for constructing the above-mentioned plasmids expressingoperon products, while the reverse primers were complementary to thecoding regions of the first genes of the operons and comprised a restric-tion site appropriate for cloning. For the rplU-rpmA operon, we also cre-ated a rplU-rpmA=-=lacZ fusion, taking into account that a presumableregulatory site might be situated at the beginning of the second cistron.The resulting plasmids were checked by sequencing and then usedfor transformation of E. coli strain ENS0 to generate Lac� clones byhomologous recombination (22–25). The strains obtained were named

TABLE 1 Escherichia coli strains and plasmids used in this study

E. coli strain or plasmid Relevant characteristic(s) Reference or source

StrainsDH5� Cloning host Laboratory stockENS0 his, formerly HfrG6�12, Lac� 25LABrplU::lacZ ENS0 derivative bearing chromosomal rplU=-=lacZ reporter under the rplU promoter This workLABrplU-rpmA::lacZ ENS0 bearing rplU-rpmA=-=lacZ reporter This workLABrplM::lacZ ENS0 bearing rplM=-=lacZ This workLABrpmB(P2)::lacZ ENS0 bearing rpmB=-=lacZ This workLABrplY::lacZ ENS0 bearing rplY=-=lacZ 24IBrpsO188::lacZ ENS0 bearing rpsO=-=lacZ 40CF1693 MG1655 relA251::kan spoT207::Cm 42RLG8124 dksA::tet R. L. GourseNB470 W3110 �red (exo-beta-gam) rpsI::kan M. Bubunenko

PlasmidspEMBL�46 pEMBL8� derivative lacking lacZ RBS 25pEL21TIR pEMBL�46 derivative bearing the rplU=-=lacZ reporter under the rplU promoter This workpEL13TIR pEMBL�46 derivative bearing rplM=-=lacZ under the rplM promoter This workpEL28TIR-P2 pEMBL�46 derivative bearing rpmB=-=lacZ under the rpmB P2 promoter This workpACYC184 Tetr Cmr; cloning vector Laboratory stockpL13/S9 pACYC184 derivative expressing rplM-rpsI This workpL13 pACYC184 derivative expressing rplM This workpL21/L27 pACYC184 derivative expressing rplU-rpmA This workpL28/L33 pACYC184 derivative expressing rpmB-rpmG under the rpmB P2 promoter This workpS1 (pSP261) pACYC184 derivative expressing rpsA 43pHfq (pTX381) pACYC184 derivative expressing hfq 44pL25 pACYC184 derivative expressing rplY 24pS15 pACYC184 derivative expressing rpsO 40

Regulation of Ribosomal Protein Operons

September 2016 Volume 198 Number 18 jb.asm.org 2495Journal of Bacteriology

on October 2, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

LABrplU::lacZ, LABrplU-rpmA::lacZ, LABrplM::lacZ, and LABrpmB(P2)::lacZ (Table 1).

Site-directed mutagenesis to create a C-to-G substitution in the dis-criminator region of the rplU promoter. The technique of introducingmutations in the discriminator region by using a two-step PCR was de-scribed previously (23). Here, we applied it for changing C(�5) to G in thediscriminator region of the rplU promoter. In the first step, two overlap-ping PCR fragments were generated using pEL21TIR (Table 1) as a tem-plate and two pairs of primers. The overlapping “internal” primers com-prised the desirable mutation (in bold), namely, rplU-C(�5)G-for(5=-TGGCGCCCTATTGTGAATATTTATAGC) and rplU-C(�5)G-rev(5=-CAATAGGGCGCCAATATTACGCAAAAC) (overlapping segmentsunderlined), while the “external” primers (UPlac, 5=-GTTAGCTCACTCATTAGGCACCCC; DSlac, 5=-GGCGATTAAGTTGGGTAACGCCAGGG) corresponded to the invariant plasmid regions (26). In the secondstep, the two purified PCR products were mixed and amplified in thepresence of UPlac and DSlac. The resulting product was treated withBamHI and HindIII and cloned in pEMBL�46. The presence of the de-sired mutation was checked by sequencing. The construction was trans-ferred onto the chromosome of strain ENS0 as described above. The re-sulting strain was named LABPrplUmut::lacZ.

Induction of stringent response and isolation of total RNA. The pro-cedure for the induction of a stringent response and isolation of total RNAwas carried out essentially as described previously (24). Strains weregrown in LB medium at 37°C with vigorous shaking. At an optical densityat 600 nm (OD600) of �0.4 to 0.5, 2-ml aliquots of cell cultures werewithdrawn and mixed with 4 ml RNAprotect bacterial reagent (Qiagen).To induce a stringent response, L-serine hydroxamate (SHX; Sigma) wasadded to the residual volume of the culture (0.5 mg/ml final concentra-tion), and cultivation was continued for an additional 15 min. Aliquots of2 ml were withdrawn at this time point and mixed with 4 ml RNAprotectbacterial reagent. Total RNA was isolated from treated and untreatedprobes by using the RNeasy minikit (Qiagen) according to the recommen-dations of the manufacturer. RNase-free DNase (Qiagen) was added tothe columns during RNA extraction for 15 min to ensure the absence ofDNA contamination in RNA samples. The amount of total RNA in thepreparations was estimated by measuring the OD260.

Quantification of the in vivo transcripts by RT-qPCR using Light-Cycler software. To study whether the rplM-rpsI, rpmB-rpmG, and rplU-rpmA operons are stringently regulated by ppGpp/DksA during aminoacid starvation, we quantified the corresponding transcripts in total RNApreparations isolated before and 15 min after SHX treatment of the wild-type, ppGpp0 (relA::kan spoT::Cm), and dksA::tet cells. For this purpose,we exploited the reverse transcription-quantitative PCR (RT-qPCR) ap-proach based on using the external RNA standard (24, 27). To generateRNA standards for the calibration curves, DNA templates were preparedby PCR with the transcript-specific primers (Table 2). The forward primercomprised the T7 promoter sequence fused to the beginning of the cor-responding transcript, and the reverse primer was complementary to the

coding region of the first gene in the operon. The purified PCR productswere transcribed in vitro with T7 RNA polymerase by using the RiboprobeSystem-T7 (Promega); the transcription was followed by RQ DNase di-gestion. The resulting RNA products were purified according to the Pro-mega protocol, and RNA concentrations were estimated by measuring theOD260. Serial dilutions of the individual RNA standard (from 10 ng/�l to100 fg/�l) were then prepared in RNase-free water mixed with MS2 RNA(0.5 �g/�l final concentration). These serial dilutions (2 �l each) wereused in 20-�l RT reaction mixtures with the corresponding reverseprimer. In parallel with RNA standards, 1 �g total RNA isolated from eachstrain before and 15 min after SHX treatment was reverse transcribed withthe same transcript-specific primer. RT reactions were performed in afinal volume of 20 �l for 1 h at 42°C. Real-time PCR was then run with theuse of a LightCycler 480 II system (Roche). Each 25-�l reaction mixturecontained 5 �l 5 qPCRmix HS SYBR (Evrogen), reverse and forwardprimers for the transcript under study (1 �l of 5 �M solution), and 2 �l ofthe corresponding RT mix.

The amount of each transcript (synthesized from rplM, rplU, andrpmB promoters) was determined using the external standard curve forquantification with the second derivative maximum method (27). TheRNA concentrations were calculated in transcript copies per micro-gram of total RNA. It should be mentioned that for quantificationof the rplU=-=lacZ transcript, RT-qPCRs were done with primersrplU_tss_for (Table 2) and DS-lac (see above), and the correspondingstandard curve was obtained using T7-rplU (Table 2) and DS-lac.

Cell growth and �-galactosidase assay. Cell cultures were grown inLB medium at 37°C, harvested in exponential phase (OD600, �0.4 to 0.5),and used for preparing clarified cell lysates as described previously (26).Protein concentration in a fraction of soluble proteins was determined bythe Bradford assay (Bio-Rad). The specific -galactosidase activities weremeasured as previously described (26) and expressed in nanomoles ofONPG (o-nitrophenyl--D-galactopyranoside) hydrolyzed per minuteper milligram of total soluble cell proteins.

Western blot analysis. Total soluble proteins from strains bearing therplM=-=lacZ chromosomal reporter and either pACYC184 or its deriva-tive, pL13, were prepared as described for the -galactosidase assay andanalyzed in a 12% Laemmli gel (5 �g/lane). Separated proteins were trans-ferred onto a nitrocellulose membrane (Bio-Rad) and successively re-vealed with polyclonal goat antibodies against L13 and S9 (a generous giftfrom P. Sergiev, Lomonosov Moscow State University) and then withsecondary donkey anti-goat IgG conjugated with horseradish peroxidase(HRP; Santa Cruz Biotechnology). Visualization was accomplished withthe Immun-Star HRP chemiluminescence reagent (Bio-Rad) and a Bio-Rad VersaDoc MP4000 image station.

Bioinformatics tools. Nucleotide sequences corresponding to the reg-ulatory regions of the bacterial r-protein operons rplU-rpmA, rplM-rpsI,and rpmB-rpmG were obtained from the NCBI Gene database. Multiplepromoter regions of the operons from several gammaproteobacterialfamilies were aligned by using WebLogo (28). A list of species for align-

TABLE 2 Primers used in this work for promoter regulation studies

Primer Sequence (5=¡3=) Position descriptiona

rplU_tss_for GTGAATATTTATAGCGCACTCTGAATC �60 to �34rplU_RT_rev CTTCACCGTTTGCGATCATCAGC 114 to 136T7_rplUb AGTAATACGACTCACTATAGGGTGAATATTTATAGCG �60 to �45rplM_tss_for CCCCACGTTACAAGAAAG �156 to �139rplM_RT_rev GACGAGCCAGTTCAGTAGC 85 to 103T7_rplMb AGTAATACGACTCACTATAGGGACCCCACGTTAC �157 to �146rpmBP2_tss_for CCTTTGAGAATCTCGGGTTTGGC �139 to �117rpmB_RT_rev GCGTTTAGTCGCGTTCAGTGC 61 to 81T7_rpmBP2b AGTAATACGACTCACTATAGGGCCTTTGAGAATCTCG �139 to �125a The positions of primers are indicated relative to the AUG start codon, where A is �1; all forward primers correspond to, and reverse primers are complementary to, the indicatedregions.b For this primer, the T7 promoter is underlined, and positions are indicated for the regions relating to the operon.

Aseev et al.

2496 jb.asm.org September 2016 Volume 198 Number 18Journal of Bacteriology

on October 2, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

ment included representatives of Enterobacteriaceae (E. coli, Yersinia pes-tis, Salmonella enterica, Morganella morganii, Erwinia amylovora, Edward-siella ictaluri, Hafnia alvei), Pasteurellaceae (Haemophilus influenzae,Mannheimia haemolytica, Pasteurella multocida), Vibrionaceae (Vibriocholerae, Vibrio fischeri, Vibrio parahaemolyticus), Shewanellaceae (She-wanella oneidensis), and Aeromonadaceae (Aeromonas hydrophila).

RESULTS AND DISCUSSIONLocalization of the rplM-rpsI, rplU-rpmA, and rpmB-rpmG pro-moters and their regulation by alarmone ppGpp and transcrip-tion factor DksA under amino acid starvation. Ribosome bio-genesis requires the coordinated synthesis of all ribosomalcomponents in stoichiometric amounts (16S, 23S, and 5S rRNAsand more than 50 r-proteins) and is tightly controlled. Transcrip-tion of rRNA operons proceeds at a high level during growth onrich media, but it dramatically decreases upon starvation, the phe-nomenon known as a ppGpp/DksA-dependent negative stringentresponse (4). Recent works have shown that promoters of manyr-protein operons are also subject to negative stringent controlmediated by ppGpp and its cofactor DksA, in parallel with therRNA operon promoters (5, 23, 24). This indicates that the strin-gent response plays an important role in regulating the synthesisof all ribosomal components (both rRNAs and r-proteins) to pro-vide rapid reallocation of scarce resources from costly ribosomebiogenesis to processes necessary for stress resistance and aminoacid synthesis. It seems important to know whether stringent con-trol works for all r-protein operons. Here, we studied three previ-ously unexplored operons, rplM-rpsI, rplU-rpmA, and rpmB-rpmG. Recent localization of the transcription start sites (TSSs) forall E. coli transcription units by RNA-seq (21; E. Hajnsdorf, per-sonal communication) allowed us to outline the promoter regionsfor these operons and to study transcriptional control.

As expected for promoters that drive expression of ribosomalcomponents, the rplU, rplM, and rpmB P2 promoters bear fea-tures typical of the �70-dependent promoters (29); in particular,the divergence from the consensus �10 element is marginal (Fig.1A). The promoter patterns of the three operons are well con-served in gammaproteobacteria (Fig. 1B). Importantly, all of thede novo localized promoters possess a GC-rich discriminator re-gion downstream from the �10 element, suggesting that tran-scription might be stringently regulated by ppGpp and DksA un-der conditions of nutrient limitation (4, 5, 23, 24). To test thispossibility, we evaluated the changes in the amounts of the tran-scripts in total RNA isolated just before and 15 min after inductionof serine starvation by SHX treatment of wild-type cells, as well asof relA spoT (ppGpp0) and dksA mutants (see Materials and Meth-ods). For this purpose, RT-qPCR with an external RNA standardwas used (24, 27). In each case, the RNA standard was identical tothe part of the individual transcript analyzed, and all the reactionswith the individual transcripts and the corresponding RNA stan-dards were done in parallel with the same primers. We took intoaccount that unlike rplU-rpmA and rplM-rpsI, which are governedby single promoters, the rpmB-rpmG operon has two promoters,namely, rpmB P1 at the end of the preceding radC (yicR) gene (30)and rpmB P2 in the intergenic radC-rpmB region (21). In this case,we evaluated transcription from both promoters by choosing theRNA standard that corresponds to the beginning of the transcriptfrom the intergenic promoter P2 (Table 2).

The results (Fig. 1C) indicate that transcription of all threeoperons is subject to a ppGpp/DksA-mediated negative stringent

response. Indeed, a significant decrease in transcript abundancewas observed for 15 min after induction of serine starvation inwild-type cultures, ranging from a 3.3-fold downregulation in thecase of the rplM promoter to a 5.6-fold decline for rplU (Fig. 1C).In the relA spoT strain (ppGpp0), expression of all three operonswas higher, downregulation upon induction of serine starvationdisappeared (relax response), and moreover, a further increase intranscript amounts after SHX treatment took place in the cases ofthe rplM and rpmB promoters. An analogous situation was re-cently described for rplY transcription (24). Since significantchanges in profiles of expression under serine starvation have beenreported not only for wild-type cells but also for the relA mutant(31), the increase in transcript amounts under starvation, ob-served for some r-protein operons in the ppGpp0 mutant, may berelated to as-yet-undefined factors. One of the possible factorsmay be an elevated stability of the transcripts, given that expres-sion of the rne gene that encodes RNase E, the major endoribonu-clease involved in mRNA degradation, is downregulated underthese conditions (31).

Our data also indicate an important role for DksA in negativeregulation of the r-protein promoters during the stringent re-sponse. Indeed, no decrease in transcript abundance under serinestarvation was observed for the rplM and rpmB promoters in thedksA mutant (Fig. 1C). In the case of rplU, some reduction tookplace but to a much lesser extent: 2-fold in the dksA mutant versus5.6-fold in wild-type cultures (Fig. 1C). These results most likelyreflect divergent DksA dependence of the promoters, as the pos-sibility of a DksA-independent impact of ppGpp on the kineticfeatures of individual promoters cannot be excluded (32).

Taken together, the data obtained demonstrate that transcrip-tion of the rplM-rpsI, rplU-rpmA, and rpmB-rpmG operons isdownregulated by ppGpp/DksA during the stringent response,which is undoubtedly important for coordinated synthesis of ri-bosomal components.

Stringent regulation of the rplU-rpmA operon requires spe-cific promoter features. To show that the changes in transcriptlevels during a stringent response can be attributed to the regula-tion of r-protein promoter activities and not to the posttranscrip-tional events like transcript decay, we changed the discriminatorregion in the rplU promoter within the rplU=-=lacZ fusion. Earlier,Haugen et al. (33) proposed that rRNA promoters as well as otherstringently regulated promoters had evolved to make weak con-tacts between the discriminator region and � region1.2, resultingin short-lived open complexes that are susceptible to ppGpp/DksA regulation. In particular, when the base two positionsdownstream from the �10 element was a C, complexes with RNApolymerase (RNAP) were much shorter lived than complexes withthe same promoters bearing G in this position. It was demon-strated that the rrnB P1 with a C-to-G substitution was not regu-lated during a stringent response (33). We introduced theC(�5)G mutation in the rplU promoter within the rplU=-=lacZreporter initially on plasmid pEL21 (Table 1) and then transferredthis mutation onto the chromosome by homologous recombina-tion. The resulting strain, LABPrplUmut::lacZ, was used for totalRNA isolation from nontreated and SHX-treated cells. We thencompared the rplU=-=lacZ transcript abundances in the two RNApreparations. The results indicate that the rplU promoter with aC(�5)-to-G substitution is no longer susceptible to a stringentcontrol. Moreover, at an elevated concentration of ppGpp causedby starvation, the transcript level from the mutated promoter even

Regulation of Ribosomal Protein Operons

September 2016 Volume 198 Number 18 jb.asm.org 2497Journal of Bacteriology

on October 2, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

increased, while the promoter activity under normal conditionswas lower than that with the wild-type promoter (Fig. 1D). Thefollowing explanation may be proposed. The C(�5)G substitu-tion strengthens the RNAP-promoter complex due to the optimal

contact with �1.2. This may slow down promoter clearance, lead-ing to less-efficient transcription. The elevated ppGpp concentra-tion upon starvation reduced the longevity of the open complex,thus facilitating promoter clearance. These experiments demon-

FIG 1 Promoters of the rplU-rpmA, rplM-rpsI, and rpmB-rpmG operons. (A) E. coli sequences upstream of the transcription start sites (TSSs) reported by Thomasonet al. (21) with classic promoter elements (boxed) and their match with consensus hexamers (in parentheses) indicated. (B) Conservation of promoter patterns ingammaproteobacteria according to WebLogo analysis (26). (C) Transcription of the rplU-rpmA, rplM-rpsI, and rpmB-rpmG operons is subject to ppGpp/DksA-dependent negative stringent control under amino acid starvation. Quantification of transcripts (molecules per microgram of total RNA) from the rplU, rplM, and rpmBpromoters in wild-type (wt), ppGpp0, and dksA strains before and 15 min after SHX addition by RT-qPCR with external RNA standards using LightCycler software. Theaverage results of two independent RT-qPCR experiments (each probe in triplicate) and standard deviations are shown. (D) Effect of serine starvation on transcriptionof the rplU=-=lacZ reporter expressed under wild-type rplU promoter (Pwt) or its variant with a C(�5)G point mutation in the discriminator region.

Aseev et al.

2498 jb.asm.org September 2016 Volume 198 Number 18Journal of Bacteriology

on October 2, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

strate that a decrease in the rplU transcript level upon starvation isdue mainly to promoter features (suboptimal interactions of �1.2with the discriminator). We suppose that the same is true for therplM-rpsI and rpmB-rpmG operons, whose promoters also have aC in the �5 position (Fig. 1A). At the same time, we cannot com-pletely rule out possible effects of the mRNA leader features on thetranscript level during the stringent response.

Autogenous regulation of rplM-rpsI at the translation leveland the lack of autogenous control of the rplU-rpmA and rpmB-rpmG operons. Genes encoding dozens of bacterial r-proteinsform operons (21 in E. coli) which may include only one (e.g.,rpsT, rpsO, rplY, or rpmE), two (e.g., rplM-rpsI or rplU-rpmA), ormany genes (e.g., spc or S10 operons encode 11 r-proteins). It hasbeen suggested that r-protein operons of E. coli are commonlyregulated at the translation level by the mechanism of autogenousrepression (1–3, 34, 35). Such a feedback control is based on thecapability of some r-proteins to act not only as structural ribo-somal components but also as highly specific repressors of theirown mRNAs when they are produced in excess over the rRNA

available for de novo ribosome assembly. In E. coli, the repressorr-protein may inhibit translation either by hampering ribosomebinding to mRNA or by entrapment of the ribosome in the non-productive complex (3, 34). A link connecting r-protein synthesisand rRNA level has been reported for many E. coli r-protein oper-ons but not for all, so that about half of the operons are still waitingfor their control mechanisms to be unraveled (35). Although re-cent studies have extended a list of autogenously regulated E. colioperons by adding rplY (24) and rpsF-priB-rpsR-rplL (36–38), sev-eral operons still represent an open field for investigations.

We examined the potentiality of rplU-rpmA, rplM-rpsI, andrpmB-rpmG operons for autogenous control in vivo. The experi-mental approach used here is based on chromosomally integratedfusions of the operon regulatory regions with the lacZ reporter(see Materials and Methods). This approach has already demon-strated its effectiveness in studies of regulatory loops of rpsA (39),rpsB-tsf (22), rpsO (40), and rplY (24). Most frequently, the targetfor autogenous repression is located in the structured 5= region ofthe operon mRNA, although there are two exceptions, i.e., when

FIG 2 Analysis of the feedback regulation of the rplU-rpmA, rplM-rpsI, and rpmB-rpmG operons. (A) Structures of the operons. P, promoter; t, terminator.Arrows designate the primers used for cloning the whole operons in pACYC184 or the promoters and translation initiation regions in pEMBL�46 (see Materialsand Methods). Numbers beside arrows indicating primers represent the 5= positions relative to the initiation codon of the first operon gene; numbers belowoperons correspond to the length (in base pairs) of the operon parts. (B) Effects of expression of operon products in trans on activities of the rplU=-=lacZ,rplU-rpmA=-=lacZ, rplM=-=lacZ, and rpmB(P2)=-=lacZ reporters in the -galactosidase assay. Average results for at least four independent assays and standarddeviations are shown. An empty vector, pACYC184 (pCtr), and its derivatives, pS1 and pHfq, were used as specificity controls.

Regulation of Ribosomal Protein Operons

September 2016 Volume 198 Number 18 jb.asm.org 2499Journal of Bacteriology

on October 2, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

the repressor protein binds within the intercistronic region (S7 inregulation of the str operon) or even when it binds at the begin-ning of the third cistron in the case of S8-mediated regulation ofthe spc operon (reviewed in references 3, 34, and 35). We firstgenerated chromosomal lacZ fusions (rplU=-=lacZ, rplM=-=lacZ,and rpmB=-=lacZ) in which the lacZ expression was governed bythe operon promoter and translation initiation region (TIR) of thefirst gene (Fig. 2A). The -galactosidase synthesis was measured inthe presence of the empty vector pACYC184 (pCtr) or its deriva-tives bearing active rplU-rpmA, rplM-rpsI, and rpmB-rpmG oper-ons. We also used plasmids expressing r-protein S1 and Hfq be-

cause both of the proteins possess high sequence-nonspecificRNA-binding activities and thus may serve as specificity controls(41).

The results of the -galactosidase assays showed that autogenousrepression that involved the 5=untranslated region (UTR) and TIR ofthe first operon gene took place only for the rplM=-=lacZ reporter,whereas neither rplU=-=lacZ nor rpmB=-=lacZ reacted to the overex-pression of their operon products (Fig. 2B). However, we did notcompletely exclude the possibility that a mechanism similar to theS8-mediated repression of the spc mRNA may operate in otherr-protein operons. To test such a possibility, we constructed a

FIG 3 The rplM-rpsI operon is regulated by r-protein L13 at the translation level. (A) Specific downregulation of the rplM=-=lacZ reporter by L13 in trans. Anempty vector, pACYC184 (pCtr), and its derivatives, pL13, pL25, and pS15, were used to transform strains carrying rplM=-=lacZ, rplY=-=lacZ, and rpsO=-=lacZfusions. The average results of three independent -galactosidase assays and standard deviations are shown. (B) Overexpression of L13 does not affect therplM=-=lacZ transcript level. Results of RT-PCR analysis are shown. RT-PCR products obtained with primers rplM_tss_for and DSlac were separated in a 2%agarose gel. Lane M, 100-bp DNA ladder (Fermentas). (C) Toxic effect of pL13 on E. coli growth rate. Growth curves in the presence of pACYC184 and pL13 areshown. (D) Effects of L13 in trans on cellular amounts of S9 as revealed by Western blotting. Two independent samples of total proteins isolated frompL13-transformed cells were tested.

Aseev et al.

2500 jb.asm.org September 2016 Volume 198 Number 18Journal of Bacteriology

on October 2, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

rplU-rpmA=-=lacZ reporter and integrated it into the chromo-some. The -galactosidase activity in the cell was measured in thepresence of either the control vector or its derivative, pL21/L27.We observed only a small decrease, about 23%, in the -galacto-sidase level (Fig. 2B, rplU-rpmA=-=lacZ construct). In our opinion,this marginal difference cannot be designated feedback regulationbased on the accepted definition. As for rpmB-rpmG, it was re-ported earlier that overexpression of L28 from a plasmid had noimpact on the level of L33 in a cell and vice versa (20). Togetherwith our observations, these data support our proposal that rpmB-rpmG is not feedback regulated.

The rplM-rpsI operon is regulated by L13 at the level of trans-lation. Thus, only one of the three studied operons, rplM-rpsI,appeared to be autogenously regulated. This raises the question ofwhich one of the encoded r-proteins, L13 or S9, is a repressor ofrplM=-=lacZ mRNA expression. To resolve this, we deleted the rpsIcoding sequence from pL13/S9 to obtain a pACYC184 derivative,pL13, expressing only the rplM gene. The -galactosidase assayrevealed downregulation of the rplM=-=lacZ reporter in the pres-ence of pL13 (Fig. 3A), indicating that L13 acted as an autogenousrepressor. This effect is specific only for the rplM-lacZ fusion, asneither rplY-lacZ nor rpsO-lacZ reporters changed their activitiesin the presence of L13 in trans (Fig. 3A). In E. coli, most r-proteinsacting as autogenous regulators block translation initiation, ex-cept for L4, which affects both transcription and translation of theS10 operon (3). Transcription regulation was found to result fromthe L4-stimulated premature termination within the S10 mRNAleader (3). To test such a possibility for the L13-mediated autog-enous control, we determined whether the level of the rplM=-=lacZtranscript could change in the presence of pL13 in comparisonwith the control vector. No alteration in the transcript amount hasbeen revealed by RT-PCR analysis (Fig. 3B), allowing us to con-clude that L13-mediated autogenous regulation occurs at thetranslation level.

It should be mentioned that pL13 slowed cell growth, revealinga toxic effect of excessive L13 amounts on cell metabolism (Fig.3C). This is most likely because L13 in excess downregulates theexpression of chromosomally encoded S9, which is very impor-tant for ribosomal activity (see the introduction). Western blotanalysis argued in favor of this assumption, showing that in thepresence of pL13 the level of S9 was reduced by about 1.5-fold(Fig. 3D). Thus, L13 represents a novel bifunctional r-protein in-volved not only in ribosome assembly but also in regulation ofexpression of its own mRNA

Concluding remarks and perspectives. In this work, we stud-ied for the first time transcriptional and translational regulation ofthe rplM-rpsI (encoding L13 and S9), rpmB-rpmG (L28 and L33),and rplU-rpmA (L21 and L27) operons. Transcription of theseoperons was found to be negatively regulated by ppGpp/DksA inresponse to amino acid starvation. Translation regulation hasbeen examined in vivo with the use of the operon-specific chro-mosomal lacZ fusions under normal versus augmented synthesisof the operon products. Only the rplM-lacZ reporter appeared tobe feedback regulated, whereas rplU-lacZ and rpmB-lacZ did notexhibit any autogenous control. The data obtained suggest thatnot all E. coli r-protein operons are autogenously regulated at thelevel of translation and highlight an important role of transcrip-tion regulation in a cascade of mechanisms controlling balancedand coordinated synthesis of ribosomal components.

Studies of the regulation of the rplM-rpsI translation revealed a

novel r-protein regulator. We found that L13, a primary protein in50S ribosomal subunit assembly, served as an autogenous repres-sor of the operon mRNA. Our preliminary data have shown that a157-nt-long 5= UTR of the rplM-rpsI mRNA folds in a developedsecondary structure and comprises a number of highly conservedsequence/structure features, including an unusual Shine-Dal-garno sequence (GGU), thus encouraging further studies of theregulatory mechanism.

ACKNOWLEDGMENTS

We thank Richard Gourse and Mikhail Bubunenko for strains and PetrSergiev for antibodies against r-proteins L13 and S9. We are grateful toEliane Hajnsdorf for sharing with us the unpublished RNA-seq data onthe location of transcription start sites.

This work was supported by the Russian Foundation for Basic Re-search (RFBR) grant 15-04-04597 and by the Program of the Presidium ofRAS “Molecular and Cellular Biology.”

FUNDING INFORMATIONThis work, including the efforts of Irina V. Boni, Leonid V. Aseev, andLudmila S. Koledinskaya, was funded by Russian Foundation for BasicResearch (RFBR) (15-04-04597). This work, including the efforts of IrinaV. Boni, Leonid V. Aseev, and Ludmila S. Koledinskaya, was funded byRussian Academy of Sciences (RAS).

REFERENCES1. Nomura M, Yates JL, Dean D, Post LE. 1980. Feedback regulation of

ribosomal protein gene expression in Escherichia coli: structural homologyof ribosomal RNA and ribosomal protein mRNA. Proc Natl Acad Sci U S A77:7084–7088. http://dx.doi.org/10.1073/pnas.77.12.7084.

2. Nomura M, Gourse R, Baughman G. 1984. Regulation of the synthesis ofribosomes and ribosomal components. Annu Rev Biochem 53:75–117.http://dx.doi.org/10.1146/annurev.bi.53.070184.000451.

3. Zengel JM, Lindahl L. 1994. Diverse mechanisms for regulating ribo-somal protein synthesis in Escherichia coli. Prog Nucleic Acid Res Mol Biol47:331–370. http://dx.doi.org/10.1016/S0079-6603(08)60256-1.

4. Haugen SP, Ross W, Gourse RL. 2008. Advances in bacterial promoterrecognition and its control by factors that do not bind DNA. Nat RevMicrobiol 6:507–519. http://dx.doi.org/10.1038/nrmicro1912.

5. Lemke JJ, Sanchez-Vazquez P, Burgos HL, Hedberg G, Ross W, GourseRL. 2011. Direct regulation of Escherichia coli ribosomal protein promotersby the transcription factors ppGpp and DksA. Proc Natl Acad Sci U S A108:5712–5717. http://dx.doi.org/10.1073/pnas.1019383108.

6. Wilson DN, Nierhaus KH. 2005. Ribosomal proteins in the spotlight.Crit Rev Biochem Mol Biol 40:243–267. http://dx.doi.org/10.1080/10409230500256523.

7. Wower IK, Wower J, Zimmermann RA. 1998. Ribosomal protein L27participates in both 50 S subunit assembly and the peptidyl transferasereaction. J Biol Chem 273:19847–19852. http://dx.doi.org/10.1074/jbc.273.31.19847.

8. Maguire BA, Beniaminov AD, Ramu H, Mankin AS, Zimmermann RA.2005. A protein component at the heart of an RNA machine: the impor-tance of protein L27 for the function of the bacterial ribosome. Mol Cell20:427– 435. http://dx.doi.org/10.1016/j.molcel.2005.09.009.

9. Maracci C, Wohlgemuth I, Rodnina M. 2015. Activities of the peptidyltransferase center of ribosomes lacking protein L27. RNA 21:2047–2052.http://dx.doi.org/10.1261/rna.053330.115.

10. Vladimirov SN, Druzina Z, Wang R, Cooperman BS. 2000. Identifica-tion of 50S components neighboring 23S rRNA nucleotides A2448 andU2604 within the peptidyl transferase center of Escherichia coli ribosomes.Biochemistry 39:183–193. http://dx.doi.org/10.1021/bi991866o.

11. Charollais J, Pflieger D, Vinh J, Dreyfus M, Iost I. 2003. The DEAD-boxRNA helicase SrmB is involved in the assembly of 50S ribosomal subunitsin Escherichia coli. Mol Microbiol 48:1253–1265. http://dx.doi.org/10.1046/j.1365-2958.2003.03513.x.

12. Proux F, Dreyfus M, Iost I. 2011. Identification of the site of action ofSrmB, a DEAD-box RNA helicase involved in Escherichia coli ribosomeassembly. Mol Microbiol 82:300 –311. http://dx.doi.org/10.1111/j.1365-2958.2011.07779.x.

Regulation of Ribosomal Protein Operons

September 2016 Volume 198 Number 18 jb.asm.org 2501Journal of Bacteriology

on October 2, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

13. Bunner AE, Beck AH, Williamson JR. 2010. Kinetic cooperativity inEscherichia coli 30S ribosomal subunit reconstitution reveals additionalcomplexity in the assembly landscape. Proc Natl Acad Sci U S A 107:5417–5422. http://dx.doi.org/10.1073/pnas.0912007107.

14. Bunner AE, Nord S, Wikström PM, Williamson JR. 2010. The effect ofribosome assembly cofactors on in vitro 30S subunit reconstitution. J MolBiol 398:1–7. http://dx.doi.org/10.1016/j.jmb.2010.02.036.

15. Hoang L, Fredrick K, Noller HF. 2004. Creating ribosomes with anall-RNA 30S subunit P site. Proc Natl Acad Sci U S A 101:12439 –12443.http://dx.doi.org/10.1073/pnas.0405227101.

16. Bubunenko M, Baker T, Court DL. 2007. Essentiality of ribosomal andtranscription antitermination proteins analyzed by systematic gene re-placement in Escherichia coli. J Bacteriol 189:2844 –2853. http://dx.doi.org/10.1128/JB.01713-06.

17. Arora S, Bhamidimarri SP, Weber MH, Varshney U. 2013. Role of theribosomal P-site elements of m2G966, m5C967, and the S9 C-terminal tailin maintenance of the reading frame during translation elongation inEscherichia coli. J Bacteriol 195:3524 –3530. http://dx.doi.org/10.1128/JB.00455-13.

18. Kaczanowska M, Rydén-Aulin M. 2004. Temperature sensitivity causedby mutant release factor 1 is suppressed by mutations that affect 16S rRNAmaturation. J Bacteriol 186:3046 –3055. http://dx.doi.org/10.1128/JB.186.10.3046-3055.2004.

19. Maguire BA, Wild DG. 1997. The roles of proteins L28 and L33 in theassembly and function of Escherichia coli ribosomes in vivo. Mol Micro-biol 23:237–245. http://dx.doi.org/10.1046/j.1365-2958.1997.2131578.x.

20. Maguire BA, Wild DG. 1997. Mutations in the rpmBG operon of Esche-richia coli that affect ribosome assembly. J Bacteriol 179:2486 –2493.

21. Thomason MK, Bischler T, Eisenbart SK, Förstner KU, Zhang A,Herbig A, Nieselt K, Sharma CM, Storz G. 2015. Global transcriptionalstart site mapping using differential RNA sequencing reveals novel anti-sense RNAs in Escherichia coli. J Bacteriol 197:18 –28. http://dx.doi.org/10.1128/JB.02096-14.

22. Aseev LV, Levandovskaya AA, Tchufistova LS, Skaptsova NV, Boni IV.2008. A new regulatory circuit in ribosomal protein operons: S2-mediatedcontrol of the rpsB-tsf expression in vivo. RNA 14:1883–1894.

23. Aseev LV, Koledinskaya LS, Boni IV. 2014. Dissecting the extended “-10”Escherichia coli rpsB promoter activity and regulation in vivo. Biochem-istry (Mosc) 79:776 –784. http://dx.doi.org/10.1134/S0006297914080057.

24. Aseev LV, Bylinkina NS, Boni IV. 2015. Regulation of the rplY geneencoding 5S rRNA binding protein L25 in Escherichia coli and relatedbacteria. RNA 21:851– 861. http://dx.doi.org/10.1261/rna.047381.114.

25. Dreyfus M. 1988. What constitutes the signal for the initiation of proteinsynthesis on Escherichia coli mRNAs? J Mol Biol 204:79 –94. http://dx.doi.org/10.1016/0022-2836(88)90601-8.

26. Komarova AV, Tchufistova LS, Supina EV, Boni IV. 2002. Protein S1counteracts the inhibitory effect of the extended Shine-Dalgarno se-quence on translation. RNA 8:1137–1147. http://dx.doi.org/10.1017/S1355838202029990.

27. Tobisch S, Koburger T, Jürgen B, Leja A, Hecker M, Schweder T. 2003.Quantification of bacterial mRNA by one-step RT-PCR using the Light-Cycler system. Biochemica 3:5– 8.

28. Crooks GE, Hon G, Chandonia JM, Brenner SE. 2004. WebLogo: asequence logo generator. Genome Res 14:1188 –1190. http://dx.doi.org/10.1101/gr.849004.

29. Shultzaberger RK, Chen Z, Lewis KA, Schneider TD. 2007. Anatomy ofEscherichia coli sigma70 promoters. Nucleic Acids Res 35:771–788. http://dx.doi.org/10.1093/nar/gkl956.

30. Gifford CM, Wallace SS. 1999. The genes encoding formamidopyrimi-dine and MutY DNA glycosylases in Escherichia coli are transcribed as partof complex operons. J Bacteriol 181:4223– 4236.

31. Durfee T, Hansen AM, Zhi H, Blattner FR, Jin DJ. 2008. Transcriptionprofiling of the stringent response in Escherichia coli. J Bacteriol 190:1084 –1096. http://dx.doi.org/10.1128/JB.01092-07.

32. Magnusson LU, Gummesson B, Joksimovic P, Farewell A, Nyström T.2007. Identical, independent and opposing roles of ppGpp and DksA inEscherichia coli. J Bacteriol 189:5193–5202. http://dx.doi.org/10.1128/JB.00330-07.

33. Haugen SP, Berkmen MB, Ross W, Gaal T, Ward C, Gourse RL. 2006.rRNA promoter regulation by non-optimal binding of sigma region 1.2:an additional recognition element for RNA polymerase. Cell 125:1069 –1082. http://dx.doi.org/10.1016/j.cell.2006.04.034.

34. Aseev LV, Boni IV. 2011. Extraribosomal functions of bacterial ribo-somal proteins. Mol Biol 45:739 –750. http://dx.doi.org/10.1134/S0026893311050025.

35. Fu Y, Deiorio-Haggar K, Anthony J, Meyer MM. 2013. Most RNAsregulating ribosomal protein biosynthesis in Escherichia coli are narrowlydistributed to Gammaproteobacteria. Nucleic Acids Res 41:3491–3503.http://dx.doi.org/10.1093/nar/gkt055.

36. Matelska D, Purta E, Panek S, Boniecki MJ, Bujnicki JM, Dunin-Horkawicz S. 2013. S6:S18 ribosomal protein complex interacts with astructural motif present in its own mRNA. RNA 19:1341–1348. http://dx.doi.org/10.1261/rna.038794.113.

37. Fu Y, Deiorio-Haggar K, Soo MW, Meyer MM. 2014. Bacterial RNAmotif in the 5= UTR of rpsF interacts with an S6:S18 complex. RNA 20:168 –176. http://dx.doi.org/10.1261/rna.041285.113.

38. Babina AM, Soo MW, Fu Y, Meyer MM. 2015. An S6:S18 complexinhibits translation of E. coli rpsF. RNA 21:2039 –2046. http://dx.doi.org/10.1261/rna.049544.115.

39. Boni IV, Artamonova VS, Tzareva NV, Dreyfus M. 2001. Non-canonicalmechanism for translational control in bacteria: synthesis of ribosomalprotein S1. EMBO J 20:4222– 4232. http://dx.doi.org/10.1093/emboj/20.15.4222.

40. Le Derout J, Boni IV, Régnier P, Hajnsdorf E. 2010. Hfq affects mRNAlevels independently of degradation. BMC Mol Biol 11:17. http://dx.doi.org/10.1186/1471-2199-11-17.

41. Hajnsdorf E, Boni IV. 2012. Multiple activities of RNA-binding proteinsS1 and Hfq. Biochimie 94:1544 –1553. http://dx.doi.org/10.1016/j.biochi.2012.02.010.

42. Xiao H, Kalman M, Ikehara K, Zemel S, Glaser G, Cashel M. 1991.Residual guanosine 3=,5=-bispyrophosphate synthetic activity of relA nullmutants can be eliminated by spoT null mutations. J Biol Chem 266:5980 –5990.

43. Skouv J, Schnier J, Rasmussen MD, Subramanian AR, Pedersen S. 1990.Ribosomal protein S1 is the effector for the regulation of its own synthesis.J Biol Chem 265:17044 –17049.

44. Tsui HC, Leung HC, Winkler ME. 1994. Characterization of broadlypleiotropic phenotypes caused by an hfq insertion mutation in Escherichiacoli K12. Mol Microbiol 13:35– 49. http://dx.doi.org/10.1111/j.1365-2958.1994.tb00400.x.

Aseev et al.

2502 jb.asm.org September 2016 Volume 198 Number 18Journal of Bacteriology

on October 2, 2020 by guest

http://jb.asm.org/

Dow

nloaded from