Regulation of Hyphal Growth and N-Acetylglucosamine … · 2017. 5. 2. · | INVESTIGATION...

| INVESTIGATION

Regulation of Hyphal Growth and N-AcetylglucosamineCatabolism by Two Transcription Factors in Candida albicans

Shamoon Naseem1 Kyunghun Min1 Daniel Spitzer Justin Gardin and James B Konopka2

Department of Molecular Genetics and Microbiology Stony Brook University New York 11794

ORCID ID 0000-0001-5989-4086 (JBK)

ABSTRACT The amino sugar N-acetylglucosamine (GlcNAc) is increasingly recognized as an important signaling molecule in additionto its well-known structural roles at the cell surface In the human fungal pathogen Candida albicans GlcNAc stimulates severalresponses including the induction of the genes needed for its catabolism and a switch from budding to filamentous hyphal growth Weidentified two genes needed for growth on GlcNAc (RON1 and NGS1) and found that mutants lacking these genes fail to induce thegenes needed for GlcNAc catabolism NGS1 was also important for growth on other sugars such as maltose but RON1 appeared to bespecific for GlcNAc Both mutants could grow on nonfermentable carbon sources indicating that they do not affect mitochondrialfunction which we show is important for growth on GlcNAc but not for GlcNAc induction of hyphal morphogenesis Interestinglyboth the ron1D and ngs1D mutants were defective in forming hyphae in response to GlcNAc even though GlcNAc catabolism is notrequired for induction of hyphal morphogenesis The ron1D mutant showed a partial defect in forming hyphae which was surprisingsince it displayed an elevated level of filamentous cells under noninducing conditions The ron1D mutant also displayed an elevatedbasal level of expression of genes that are normally upregulated during hyphal growth Consistent with this Ron1 contains an Ndt80-likeDNA-binding domain indicating that it regulates gene expression Thus Ron1 is a key new component of the GlcNAc response pathwaythat acts as both an activator and a repressor of hyphal morphogenesis

KEYWORDS Candida albicans hyphal morphogenesis filamentous growth germ tube N-acetylglucosamine GlcNAc

THE fungal pathogen Candida albicans grows as a com-mensal organism on humans and causes lethal systemic

infections when the normal barriers to infection are disrup-ted such as a compromised immune system New therapiesare needed to treat systemic C albicans infections as there is40 attributable mortality despite recent advances in an-tifungal therapy (Pfaller and Diekema 2010 Brown et al2012) One underlying virulence property is the ability ofC albicans to grow in different morphologies ranging frombudding cells to long chains of hyphal or pseudohyphal cells(Sudbery 2011) Hyphal growth can be induced by a widerange of environmental stimuli that are encountered by

C albicans in vivo including serum alkaline pH CO2 bacterialpeptidoglycan breakdown products and N-acetylglucosamine(GlcNAc) (Biswas et al 2007Whiteway and Bachewich 2007Davis 2009 Sudbery 2011) Hyphal morphogenesis is signifi-cant as it promotes invasive growth of C albicans into tissuesand biofilm formation (Finkel and Mitchell 2011 Sudbery2011) Cells induced to form hyphae also show increased ex-pression of virulence factors (Whiteway and Oberholzer 2004Kumamoto and Vinces 2005 da Silva Dantas et al 2016)

GlcNAc induction of hyphal morphogenesis and virulencegene expression in C albicans is part of the growing evidencethat this amino sugar is an important signaling molecule Forexample GlcNAc induces hyphal growth in a diverse set offungi (Kim et al 2000 Gilmore et al 2013) it regulates stressand virulence responses in bacteria and it can stimulate NLRP3inflammasome activation in mammalian cells (Konopka 2012Naseem and Konopka 2015 Wolf et al 2016) GlcNAc iscommonly found at the extracellular surface of a wide rangeof cells as a component of bacterial peptidoglycan fungalcell wall chitin and mammalian cell glycosaminoglycans(Moussian 2008) Thus GlcNAc released during cell-surface

Copyright copy 2017 by the Genetics Society of Americadoi httpsdoiorg101534genetics117201491Manuscript received February 23 2017 accepted for publication March 24 2017published Early Online March 27 2017Supplemental material is available online at wwwgeneticsorglookupsuppldoi101534genetics117201491-DC11These authors contributed equally to this work2Corresponding author Department of Molecular Genetics and MicrobiologyStony Brook University 130 Life Sciences Building Stony Brook NY 11794-5222 E-mail jameskonopkastonybrookedu

Genetics Vol 206 299ndash314 May 2017 299

remodeling due to growth or damage can act as a signal-ing molecule for both intercellular and interspeciescommunication

In C albicans GlcNAc is thought to act intracellularly inpart because the Ngt1 transporter that facilitates GlcNAc up-take into cells promotes the ability of this sugar to stimulatehyphal growth (Alvarez and Konopka 2007) GlcNAc doesnot have to be catabolized to induce hyphal growth becausea strain lacking the genes needed for GlcNAc metabolism(hxk1D nag1D dac1D) can be induced to form hyphae(Naseem et al 2011 2015) This led to the proposal that cellssensitively distinguish exogenous GlcNAc taken up from theenvironment vs GlcNAc synthesized inside the cell becauseexogenous GlcNAc is not phosphorylated whereas cells onlysynthesize phosphorylated forms of this sugar (eg GlcNAc-6-PO4) (Naseem et al 2012) Previous studies suggested thatthe cAMP pathway might be involved in GlcNAc signalingsince a cyr1D mutant that lacks adenylyl cyclase is not in-duced by GlcNAc to form hyphae However a faster-growingpseudorevertant version of the cyr1D strain can be inducedto form hyphae indicating that GlcNAc can induce hyphalmorphogenesis by cAMP-independent pathways (Parrinoet al 2017)

GlcNAc also induces the expression of the genes that pro-mote its catabolism in C albicans (Kumar et al 2000) TheGlcNAc catabolic genes are present in a cluster in the C albicansgenome that consists of a GlcNAc kinase that generates GlcNAc-6-PO4 (HXK1) a deacetylase (DAC1) and a deaminase (NAG1)(Kumar et al 2000 Yamada-Okabe et al 2001) The combinedaction of the catabolic genes results in the conversion of GlcNActo fructose-6-PO4 which can be used for glycolysis In additionGlcNAc stimulates the expression of the GlcNAc transporter(NGT1) and GIG1 which appears to play a role in metabolicregulation (Gunasekera et al 2010) These GlcNAc-responsivegenes are controlled independently of hyphal signaling sincethey can be induced under conditions that do not promotehyphal growth (eg at low temperature or in a cyr1D adenylylcyclase mutant)

To better understand how C albicans responds to GlcNAcwe identified two genes needed for growth on GlcNAc NGS1(CR_00190W) and RON1 (CR_04250W) These genes wereidentified in part because their orthologs are adjacent to thecluster of GlcNAc catabolic genes in some species (Gilmoreet al 2013 Kappel et al 2016) although this is not the case inC albicans Furthermore during our studies on these genesorthologs of NGS1 and RON1 were shown to be required forGlcNAc catabolism in the filamentous fungus Trichodermareesei and NGS1 was reported to be needed for growth onGlcNAc by C albicans (Kappel et al 2016 Su et al 2016)NGS1 encodes a protein with one domain of homology tofamily 3 glycohydrolases and another domain similar to theGNAT family of GCN5-related N-acetyltransferases (Qin et al2015) Ngs1 has been suggested to act in conjunction withthe Rep1 transcription factor in C albicans (Su et al 2016)We found that NGS1 is also important for growth on othersugars includingmaltose whereas RON1 appears to be specific

for GlcNAc RON1 encodes a protein with an Ndt80-like DNA-binding domain indicating it acts as a transcription factorMutants lacking C albicans NGS1 or RON1 were defective inresponding to GlcNAc to induce the catabolic genes Interest-ingly the ngs1D mutant was strongly defective in forminghyphae in response to GlcNAc whereas the ron1D strainwas partially defective The results identify Ron1 and Ngs1as critical regulators of both GlcNAc catabolism and hyphalgrowth in C albicans

Materials and Methods

Strains and media

The genotypes of the C albicans strains that were used aredescribed in Table 1 The cells were grown in rich YPD me-dium (yeast extract peptone dextrose) or in synthetic me-dium made with yeast nitrogen base (YNB) (Styles 2002)Most of the homozygous gene deletion mutant strainswere constructed by the sequential deletion of both copiesof the targeted gene from the diploid C albicans genomeThe ron1D strain was constructed by deleting the entireopen reading frame from C albicans strain BWP17 (arg4Dhis1D ura3D) using methods described previously (Wilsonet al 1999) In brief PCR primers containing 70 bp ofsequence homologous to the sequences flanking the openreading frame of RON1 were used to amplify the ARG4 andthe HIS1 selectable marker genes Integration of these de-letion cassettes at the appropriate site to delete RON1 wasverified by PCR using combinations of primers that flankedthe integration and primers that annealed within the intro-duced cassettes Complementation of the ron1D deletionmutation was carried out by introducing a plasmid carryinga wild-type copy of RON1 into the genome The plasmid wasconstructed by PCR amplification of genomic DNA from1000 bp upstream of the initiator ATG to 400 bp down-stream of the terminator codon of RON1 This RON1 DNAfragment was then inserted between the SacI and SacII re-striction sites of the URA3 plasmid pDDB57 (Wilson et al2000) The resulting RON1 plasmid was linearized in the pro-moter region by digestion with SnaBI and then integrated intothe ron1Dron1D strain SN1423 using URA3 selection to createcomplemented strain SN1425 The plasmid pBSK-URA3 wasdigested with the restriction enzymes PstI and NotI to liberatethe URA3-IRO1 sequence which was then transformed intoron1D strain SN1423 and integrated by homologous recombi-nation into the genome to restore URA3 at its native locus tocreate strain SN1424

The ngs1D strain was constructed as previously described(Noble et al 2010) A complemented strain was constructedby integrating a copy of the wild-typeNGS1 sequence into thegenome The NGS1 plasmid was constructed by PCR ampli-fication of genomic DNA from 980 bp upstream of the initia-tor ATG to 584 bp downstream of the terminator codon ofNGS1 This NGS1 DNA fragment was then inserted betweenthe SacI and SacII restriction sites of a version of plasmidpDDB57 that carries anNAT1 selectable marker A prototrophic

300 S Naseem et al

control strain (SN1430) was constructed in which the ARG4sequence was amplified by PCR from genomic DNA and thentransformed into the ngs1D strain SN1428

The double mutant strain ngs1D hxk1D was created usingtransient expression of CRISPRCas9 to facilitate the homo-zygous deletion of HXK1 from the ngs1D strain KM1433 Themethods were essentially as described previously (Min et al2016) Briefly the ngs1D strain was cotransformed with aHXK1-SAT-Flipper deletion construct (3 mg) the CaCas9

cassette (1 mg) and the single-guide RNAs cassette (1 mg) byusing the lithium acetate transformation method (Waltherand Wendland 2003) We then used the following 20-bptarget sequence of the sgRNA as reported byVyas et al (2015)to delete the HXK1 gene (AATCCCTGTCCCCAACACCA)

GFP-tagged reporter strains were constructed by trans-forming a PCR-amplified cassette carrying NGT1-GFP andHXK1-GFP carrying the URA3 or ARG4 selectable marker(Zhang and Konopka 2010) These cassettes carry the GFPg

Table 1 Calbicans strains used in this study

Strain Short genotype Full genotype

BWP17 Parental strain his1hisGhis1hisG arg4hisGarg4hisG ura3Dlimm434ura3Dlimm434

DIC185 Prototrophic wild-type control ura3Dlimm434URA3 his1hisGHIS1 arg4hisGARG4SN1423 ron1D ron1DHIS1ron1DARG4 his1hisGhis1hisG arg4hisGarg4hisG

ura3Dlimm434ura3Dlimm434SN1421 NGT1-GFP HIS1his1hisG ARG4arg4hisG NGT1-GFPURA3NGT1 ura3Dl

imm434ura3Dlimm434SN1422 HXK1-GFP HIS1his1hisG ARG4arg4hisG HXK1-GFPURA3HXK1 ura3Dl

imm434ura3Dlimm434SN1424 ron1D ron1DHIS1ron1DARG4 his1hisGhis1hisG arg4hisGarg4hisG

URA3ura3Dlimm434SN1425 ron1D+RON1 ron1DHIS1ron1DARG4 his1hisGhis1hisG arg4hisGarg4hisG

RON1URA3ura3Dlimm434SN1426 ron1D ron1DHIS1ron1DARG4 his1hisGhis1hisG arg4hisGarg4hisG

NGT1-GFPURA3NGT1 ura3Dlimm434ura3Dlimm434NGT1-GFPSN1427 ron1D ron1DHIS1ron1DARG4 his1hisGhis1hisG arg4hisGarg4hisG

HXK1-GFPURA3HXK1 ura3Dlimm434ura3Dlimm434HXK1-GFPSN1428 ngs1D ngs1DLEU2ngs1DHIS1 leu2Dleu2D his1Dhis1D arg4Darg4D

URA3ura3Dimm IRO1iro1DimmSN1429 ngs1D ngs1DLEU2ngs1DHIS1 leu2Dleu2D his1Dhis1D ARG4arg4D

URA3ura3Dimm IRO1iro1DimmSN1430 ngs1D+NGS1 ngs1DLEU2ngs1DHIS1 NGS1NAT1 leu2Dleu2D his1Dhis1D

ARG4arg4D URA3ura3Dimm IRO1iro1DimmSN1431 ngs1D ngs1DLEU2ngs1DHIS1 NGT1-GFPARG4NGT1 leu2Dleu2D

his1Dhis1D arg4Darg4D URA3ura3Dimm IRO1iro1DimmNGT1-GFPSN1432 ngs1D ngs1DLEU2 ngs1DHIS1 HXK1-GFPARG4HXK1 leu2Dleu2D

his1Dhis1D arg4Darg4D URA3ura3Dimm IRO1iro1DimmHXK1-GFPKM1433 ngs1D ngs1DLEU2ngs1DHIS1 leu2Dleu2D his1Dhis1D ARG4arg4D

URA3ura3Dimm IRO1iro1Dimm hxk1DNAT1hxk1DNAT1hxk1DAG734 nag1D nag1HIS1nag1ARG4 URA3ura3Dlimm434 his1hisGhis1hisG

arg4hisGarg4hisGAG732 dac1D dac1HIS1dac1ARG4 URA3ura3D limm434 his1hisGhis1hisG

arg4hisGarg4hisGAG736 hxk1D hxk1URA3hxk1ARG4 ura3Dlimm434ura3Dlimm434 HIS1

his1hisG arg4hisGarg4hisGAG738 h-d (hxk1D nag1D dac1D) [hxk1 nag1 dac1]ARG4[hxk1 nag1D dac1D]URA3 HIS1his1hisG

ura3Dlimm434ura3Dlimm434 arg4hisGarg4hisGSN152 Parental strain arg4Darg4D leu2Dleu2D his1Dhis1D URA3ura3Dimm IRO1

iro1DimmLLF100 Prototrophic WT control ARG4arg4D LEU2leu2D HIS1his1D URA3ura3Dimm IRO1iro1D

immSN1434 mci4D mci4HIS1mci4LEU2 arg4Darg4D leu2Dleu2D HIS1his1D URA3

ura3Dimm IRO1iro1DimmSN1435 nuo1D nuo1HIS1nuo1LEU2 arg4Darg4D leu2Dleu2D HIS1his1D URA3

ura3Dimm IRO1iro1DimmKM1436 hxk1D nag1D dac1D [hxk1D nag1D dac1D]ARG4[hxk1 nag1D dac1D]URA3 HIS1his1

hisG ura3Dimm434 ura3Dimm434 arg4hisGarg4hisGgig1DSAT-Flippergig1DSAT-Flipper

gig1D-1

KM1437 hxk1D nag1D dac1D [hxk1D nag1D dac1D]ARG4[hxk1 nag1D dac1D]URA3 HIS1his1hisG ura3Dimm434 ura3Dimm434 arg4hisGarg4hisGgig1DSAT-Flippergig1DSAT-Flipper

gig1D-2

GlcNAc Regulation of Hyphal Morphogenesis 301

variant that is more photostable (Zhang and Konopka 2010)PCR primers were used that carry70 bp of homology to thesequences adjacent to the termination codon of NGT1 orHXK1 as described previously (Zhang and Konopka 2010Naseem et al 2011) The resulting PCR products were thenused to transform the corresponding strains to create GFPfusion genes Similar results were observed for at least fourindependent transformants for each strain

Growth assays

Wild-type and mutant strains of C albicans were tested forgrowth on different sugars by spotting dilutions of cells onsynthetic agar medium containing Yeast Nitrogen Base (YNB)and the indicated source of carbon and energy Strains weregrown overnight adjusted to 107 cellsml and then serial dilu-tions of cells were prepared Three microliters of each dilutionwas then spotted onto the indicated type of plate The plateswere incubated for 2 or 3 days as indicated and then photo-graphed Each assay was done at least three independent times

Hyphal morphogenesis

The ability to form hyphae in liquid media was analyzed withcells that were grown overnight at 37 to early log phase insynthetic medium with galactose The cells were then ad-justed to 13 106 cellsml and then growth was continuedin medium with galactose alone or with galactose plus theindicated concentration of GlcNAc Similar experiments werecarried out with the media adjusted to pH 68 with 10 mMPIPES In addition the cells were also induced by addition ofserum to 10 final concentration (vv) Samples were thenincubated at 37 for the indicated time Cells were concen-trated by centrifugation and then images were captured us-ing differential interference contrast (DIC) optics

Invasive hyphal morphogenesis was analyzed by spotting3 ml of cells on an agar plate with the indicated type of me-dium and then incubating at 37 At different times the mor-phology of the cells at the edge of the zone of growth wasphotographed to record the extent of invasive hyphal growthinto the agar

Induction of NGT1-GFP and HXK1-GFP reporter genes

Cells were grown overnight to early log phase in syntheticmediumYNBwith galactose The cellswere then resuspendedin the same medium containing 50 mM galactose 650 mMfinal concentration of GlcNAc and grown for different lengthsof time at 30 Cells were then photographed using DIC opticsto detect cell morphology and by fluorescence microscopy todetect the production of GFP Photographic images were cap-tured using an Olympus BH2 microscope equipped with aZeiss AxioCam digital camera

Sequencing of complementary DNAs (cDNAs) (RNA-seq)

C albicans cells were grown in YNB-basedmedia at 37 underthe specified conditions cells were harvested and then RNAwas extracted using an Ambion Yeast Ribopure RNA Purifi-cation Kit (Fisher Scientific Pittsburgh PA) The RNA was

then reverse transcribed and then the resulting cDNA wasprepared for DNA sequencing using an Ovation UniversalRNA-Seq System (NuGEN Technologies) The library ofcDNAs was then sequenced on an Illumina MiSeq machineusing a 150 cycle MiSeq Reagent Kit to obtain paired-endreads (Illumina) In preparation for bioinformatic analysisthe RNA-seq reads were processed as follows reads weretrimmed at the 39 end to a length of 65 nt poly(A) regionswere removed and the read quality was then filtered usingthe FASTX-Toolkit The remaining paired-end reads wereidentified using a custom Python script and then mappedto the C albicans SC5314 genome (Assembly 22) usingHISAT2 (Kim et al 2015 Pertea et al 2016) The numberof reads in genes was counted using the program HTSeq-count (Anders et al 2015) The relative expression was thencalculated as transcripts per million (TPM) (Wagner et al2012) For comparison differential expression analyseswere conducted using DESeq2 package from Bioconductor(Gentleman et al 2004 Love et al 2014)

Data availability

The authors state that all data necessary for confirming theconclusions presented in the article are represented fullywithin the article RNA-seq data are presented in Supplemen-tal Material Tables S1 and S2 in File S2 All yeast strains andplasmids will be made available upon request

Results

Ndt80-like transcription factor Ron1 is needed forC albicans growth on GlcNAc

Genes encoding a transcription factor with a DNA-bindingdomain similar to Saccharomyces cerevisiae Ndt80 are com-monly found near the cluster of GlcNAc catabolic genes infilamentous fungi suggesting they could be involved in reg-ulating transcription of the genes needed for catabolism ofGlcNAc (Kappel et al 2016) There are no Ndt80-like tran-scription factor genes near the GlcNAc catabolic genes in theC albicans genome so we analyzed the two C albicans genesthat are most closely related to T reesei RON1 (Figure 1A)Cells lacking the C albicans NDT80 (C2_00140W ororf192119) grew well on GlcNAc However cells lackingthe uncharacterized gene CR_04250W (orf19513) showeda strong defect (Figure 1B) This mutant was also defective ingrowing on glucosamine indicating a general defect in me-tabolizing hexosamines Therefore we will refer to this geneas RON1 since this is the name given to an NDT80-likegene that is needed for growth on GlcNAc in T reesei(Kappel et al 2016)

The C albicans ron1D mutant grew well on other sugarsincluding glucose fructose maltose and galactose (Figure 1B and C) These results indicate that Ron1 plays a specific rolein regulating the ability of cells to grow on the hexosaminesugars such as GlcNAc and glucosamine Comparison withknown GlcNAc mutants demonstrated that the ron1D mu-tant was distinct from cells lacking the GlcNAc transporter

302 S Naseem et al

(ngt1D) which grew well on glucosamine (Figure 1C) (SeeFigure 1D for a diagram of the GlcNAc catabolic pathway)The ron1D mutant differed from the dac1D and nag1D mu-tants in that it grew well on medium containing both galac-tose and GlcNAc indicating that GlcNAc does not have adeleterious effect on the growth of the ron1D mutant as itdoes for the mutants lacking the enzymes needed to deace-tylate (dac1D) or deaminate (nag1D) GlcNAc Thus theron1D mutant was most similar to the strains that lack theGlcNAc kinase (hxk1D) or the entire GlcNAc catabolic genecluster (hxk1D nag1D dac1D)

NGS1 is important for growth on GlcNAc andother sugars

Another type of gene commonly found near the GlcNAccatabolic gene cluster has been referred to as NGS1 in

C albicans and is distinguished by containing two domainsan N-terminal region similar to family 3 glycohydrolases thatcleave GlcNAc-containing sugar polymers and a C-terminaldomain similar to GNAT family N-acyltransferases (Su et al2016) Interestingly the glycohydrolase domain is lackinga conserved His residue at position 197 that is requiredfor catalytic activity in other family members (Figure 2A)(Litzinger et al 2010) In addition the conserved Tyr-736is substituted with Phe suggesting that this protein wouldlack N-acyltransferase activity (Qin et al 2015) In spite ofthis Ngs1 was reported to act as an acetyltransferase in con-junction with the Rep1 transcription factor (Su et al 2016)

An ngs1D mutant showed poor growth on GlcNAc andglucosamine similar to results published recently while ourstudy was in preparation (Su et al 2016) However we foundthat the ngs1D mutant has additional phenotypes including

Figure 1 Ron1 has a DNA-binding domain similar to Ndt80 family transcription factors and is needed for growth on GlcNAc (A) Diagram illustrating therelative position of the DNA-binding domain in S cerevisiae Ndt80 C albicans Ndt80 and C albicans Ron1 (CR_04250W) The homology between thedifferent Ndt80-family proteins is restricted to the DNA-binding domains (B) Growth of ndt80D and ron1D cells on GlcNAc and other sugars Dilutionsof cells were spotted onto synthetic medium plates containing the indicated sugar The genotype of the strain in each row is indicated on the left (C)Comparison of ron1D cells with known GlcNAc mutants for ability to grow on different sugars The sugars were present at 50 mM except for the platescontaining only GlcNAc which was present at 25 mM to limit growth of the ngt1D mutant Plates were incubated at 30 for 2 days and thenphotographed The ron1Dmutant was specifically defective in growing on the hexosamine sugars glucosamine and GlcNAc The wild-type control strainwas DIC185 ron1D was SN1424 and the ron1D + RON1 complemented strain was SN1425 Other strains used are indicated in Table 1 (D) Diagramillustrating the steps in catabolism of GlcNAc The proteins that catalyze each step are indicated above the arrows


poor growth on maltose (Figure 2B) These phenotypes wereexacerbated at 37 where there was essentially no growth ofthe ngs1Dmutant on maltose (Figure 2D) The growth of thengs1D mutant was slightly slower on galactose plus GlcNAcsimilar to the inhibitory effect of GlcNAc on the growth of thenag1D and dac1D mutants (Figure 2C) This toxic effect ofGlcNAc is thought to be due to depletion of UTP as a result oftoo much GlcNAc-6-PO4 going into the anabolic pathway

that forms UDP-GlcNAc when the catabolic pathway isblocked (Naseem et al 2011) Consistent with this the in-hibition of growth was abrogated in a ngs1D hxk1D doublemutant that lacked the Hxk1 GlcNAc kinase (Figure 2D)thereby blocking the ability of GlcNAc to be metabolizedHowever deletion of hxk1D did not rescue the poor growthof the ngs1D mutant on galactose or maltose media(Figure 2D)

Figure 2 NGS1 gene is needed for growth on GlcNAc and other sugars (A) Diagram illustrating the relative position of two domains present in Ngs1an N-terminal region similar to family 3 glycohydrolases and a C-terminal domain similar to GNAT family acetyltransferases Residues 195 and 197 arekey for glycohydrolase activity in other species but residue 197 is not conserved in C albicans Ngs1 (Litzinger et al 2010) Similarly residue 736 ishighlighted because there is a Phe at this position rather than a Tyr that is expected for catalytically active GNAT transferases (Qin et al 2015) (B)Dilutions of the cells indicated on the left were tested for ability to grow on synthetic medium containing the sugars indicated at the top Note that thengs1Dmutant showed poor growth on maltose in addition to GlcNAc and glucosamine (C) Comparison of ngs1D cells with known GlcNAc mutants forability to grow on different sugars The sugars were present at 50 mM except for the plates containing only GlcNAc which was present at 25 mM tolimit growth of the ngt1D mutant Plates were incubated at 30 for 2 days and then photographed (D) The cells indicated on the left were spotted onplates containing the indicated medium and then incubated at a higher temperature of 37 which exacerbated the growth defects of the ngs1Dmutanton other sugars including galactose and maltose The wild-type control strain was LLF100 the ngs1D strain was SN1429 and the ngs1D + NGS1complemented strain was SN1430 Other strains used are indicated in Table 1

304 S Naseem et al

Control studies revealed another growth defect of thengs1D mutant in that it was slow in adapting to a changefrom rich YPD medium to minimal synthetic medium (FigureS1 in File S1) The lag in growth was seen for cells switchedfrom YPD to minimal media containing either dextrose ormaltose Deletion of HXK1 from the ngs1D strain showedthat as expected the ngs1D hxk1D double mutant was notsusceptible to the toxic effects of GlcNAc (Figure S2 in FileS1) However the ngs1D hxk1D mutant still grew poorly onmaltose These results indicate that Ngs1 plays a broaderrole and does not specifically regulate GlcNAc metabolism

RON1 and NGS1 are not required for growth onnonfermentable carbon sources

While screening collections of deletion mutants we discov-ered that mutants with mitochondrial defects grew poorly onGlcNAc For example mci4D and nuo1D were defective ingrowing on GlcNAc and the nonfermentable carbon sourcesglycerol and acetate (Figure 3) These mutants lack compo-nents of the mitochondrial respiratory chain complex I (Sheet al 2015) In contrast both ron1D and ngs1D grew well onglycerol and acetate (Figure 3) This indicates that RON1 andNGS1 directly regulate GlcNAc metabolism as they are notneeded for mitochondrial respiration

Although the mitochondrial mutants did not grow well onGlcNAc medium it was interesting that they could grow wellon galactose+GlcNAcmedium and could be induced to formhyphae (Figure 3C) Thus mitochondrial function is impor-tant for GlcNAc metabolism but not for hyphal induction

RON1 regulates expression of GlcNAc catabolic genes

To determine whether RON1 is needed for expression of theGlcNAc catabolic genes we carried out high-throughput se-quencing of RNAs (RNA-seq) from cells grown in dextrose vscells shifted to GlcNAc medium for 30 min (Figure 4A andTable S1 in File S2) Although the ron1D cells do not grow onGlcNAc they can be sustained for this 30-min incubation bynutrient stores and by metabolizing amino acids added tothe medium To simplify some of the metabolic transitionscaused by this shift inmedia we also compared cells grown ingalactose to cells grown in galactose plus GlcNAc for 30 minGalactose does not repress the GlcNAc genes as does dextrose(Gunasekera et al 2010) so GlcNAc can be added as aninducer into the galactose medium This has the advantagesthat it does not require washing the cells and does not leadto activation of glucose-repressed genes As expected for thewild-type control cells the previously identified GlcNAc-regulated genes were all highly induced30-fold by GlcNAc

Figure 3 Defective ability of ron1D and ngs1D mutants to grow on GlcNAc is not due to defects in mitochondrial function Ability of (A) ron1D and (B)ngs1D mutants to grow on the nonfermentable carbon sources acetate and glycerol Dilutions of cells indicated on the left were spotted onto syntheticmedium containing the carbon source indicated at the top The mitochondrial mutants with defects in complex I of the respiratory chain (nci4D andmuo1D) showed growth defects on GlcNAc and on the nonfermentable carbon sources (C) Hyphal induction of the mitochondrial mutants nci4D andmuo1D The indicated strains were grown in galactose medium and then GlcNAc was added to 50 mM to half the culture Cells were incubated at 37for 4 hr and then photographed Bar 10 mM The strains included nci4D strain (SN1434) and muo1D strain (SN1425) The other strains in (A) aredescribed in the legend to Figure 1 and the strains in (B) are described in the legend to Figure 2


(Figure 4A) This set of genes (NGT1 HXK1 DAC1 NAG1and GIG1) is specifically regulated by GlcNAc as these genesdo not require induction of the hyphal pathway to be induced(Kumar et al 2000 Gunasekera et al 2010) There were nosignificant changes in the levels of actin (ACT1) or othercontrol genes caused by GlcNAc under either condition (Fig-ure 4A and Table S2 in File S2)

In contrast to wild-type cells the ron1D mutant wasstrongly defective as it did not detectably induce theGlcNAc-regulated genes after a shift from dextrose to GlcNAcor a shift from galactose to galactose plus GlcNAc In partic-ular the expression levels of the core catabolic genes HXK1DAC1 and NAG1 were all very low when grown in the ab-sence or presence of GlcNAc (ie 13 TPM as compared to369ndash9960 TPM for the different genes in wild-type controlcells) This indicates that the ron1D mutant is defective ingrowing on GlcNAc because of a failure to induce the GlcNAccatabolic genes

To confirm the RNA-seq results we examined the ability ofron1D cells to induce two different reporter genesNGT1-GFPand HXK1-GFP As expected both genes were induced in thewild-type control cells (Figure 4B) Ngt1-GFP was present atthe plasma membrane consistent with its role as the GlcNActransporter Hxk1-GFP was detected in the cytoplasm In con-trast the ron1D cells did not induce Ngt1-GFP or Hxk1-GFPafter a 2-hr incubation (Figure 4B) Similar results wereobtained in independent assays and after longer times of in-cubation with GlcNAc (data not shown) These results extendthe RNA-seq results by showing that the ron1D mutant isdefective in inducing the GlcNAc catabolic genes even afterlonger times of exposure to GlcNAc

NGS1 is needed for regulation of GlcNAc catabolic genes

The ngs1Dmutant was also analyzed by RNA-seq to examinethe expression of the GlcNAc catabolic genes (Figure 5A) Aprevious study examined an ngs1D mutant for ability to ex-press a subset of the GlcNAc catabolic genes (NGT1 HXK1and DAC1) by qRT-PCR and found that it was defective ininducing these genes in response to 25 mMGlcNAc (Su et al2016) We observed similar results by RNA-seq using 50 mMGlcNAc which helped to ensure that the defects in respond-ing to GlcNAc were not due to reduced sensitivity to a lowdose of GlcNAc The RNA-seq results also showed that thengs1Dmutant failed to induce other GlcNAc-regulated genesincludingNAG1 and GIG1 (Figure 5A) In addition the ngs1Dmutant failed to induce the GlcNAc genes in galactose plusGlcNAc medium Although the GlcNAc genes were not sig-nificantly induced in the ngs1D mutant the basal level ofHXK1 expression was 10-fold higher in the ngs1D mutantthan in the ron1D mutant (Table S2 in File S2) consistentwith the susceptibility of the ngs1Dmutant to the toxic effectsof GlcNAc which requires the function of HXK1 (Figure 2D)

To confirm the RNA-seq results NGT1-GFP andHXK1-GFPreporter genes were introduced into the ngs1Dmutant As forthe ron1D mutant the ngs1D mutant did not induce thesereporter genes after a 2-hr induction in galactose plus GlcNAc

medium (Figure 5B) Similar results were observed at longertimes of incubation including overnight incubation (data notshown) Altogether these results indicate that the ngs1Dmu-tant is strongly defective in inducing the family of GlcNAc-regulated genes

Figure 4 The ron1D mutant is defective in inducing the GlcNAc catabolicgenes (A) Regulation of the GlcNAc catabolic genes in wild-type (DIC185)and ron1D (SN1424) strains as indicated at the top Color-coded map ofRNA-seq results shows log2 ratios of TPMs (transcripts per million reads)for cells grown in GlcNAc vs dextrose or galactose + GlcNAc vs galac-tose (Note that gray indicates a log2 ratio could not be calculated due toa zero value) Cells were grown at 37 in 50 mM dextrose and thenswitched to 50 mM GlcNAc for 30 min or grown in 50 mM galactoseand then GlcNAc was added to one sample for 30 min Samples wereanalyzed as described in the Materials and Methods (B) NGT1-GFP andHXK1-GFP reporter genes were constructed in wild-type control cells(SN1421 and SN1422) and in ron1D cells (SN1426 and SN1427) by tag-ging the 39 end of the open reading frame with GFP Cells were grown at30 in 50 mM galactose medium GlcNAc was added to part of thesample for 2 hr and then the cells were photographed by fluorescencemicroscopy to detect GFP fluorescence (lower panels) Upper panels showlight microscope images as a reference for cell morphology Bar 10 mm

306 S Naseem et al

The ron1D and ngs1D mutants are defective inresponding to GlcNAc to form hyphae in liquid medium

To determine whether the mutant cells could be induced toform hyphae they were grown in medium containing galac-tose to provide a source of energy and thenGlcNAcwas added

to 25 50 or 250 mM As expected the wild-type controlstrain was induced to form filamentous cells under all threeconditions (Figure 6) Although the ngt1Dmutant lacking theGlcNAc transporter did not form hyphae efficiently at 25 mMGlcNAc it was induced at the higher concentrations ofGlcNAc where this sugar can be taken up by alternativepathways (Alvarez and Konopka 2007) In contrast boththe ron1D and ngs1D cells showed a strong defect in form-ing hyphae even at the higher concentrations of GlcNAc(Figure 6B)

The ron1D mutant was distinct in that it formed an ele-vated level of filamentous cells when grown in galactose(Figure 6) About 65 of the ron1D cells were in a filamen-tous morphology in galactose medium as compared to33 for the wild-type control (P 005) This is consis-tent with the elevated basal level of expression of hyphal-specific genes in the ron1Dmutant (see below) The numberof filamentous cells went up to 10 with 25 mM GlcNAcand then increased to 20 in medium containing 50 mMGlcNAc or 250 mM GlcNAc (Figure 6B) These results in-dicate that although the ron1Dmutant showed an increasedbasal level of filamentous growth it was only weakly in-duced by GlcNAc to form additional hyphae

The ron1D mutant was also tested for hyphal growth inmedium buffered with PIPES to raise the pH to 68 aswould normally occur for wild-type cells grown in GlcNAcWhereas cells grown in dextrose or galactose acidify the me-dium cells grown in GlcNAc raise the ambient pH which cansynergize with GlcNAc to stimulate hyphal growth (Naseemet al 2015) However raising the ambient pH with PIPES didnot increase the ability of GlcNAc to induce the ron1Dmutant(Figure 6)

The ngs1D mutant was strongly defective in hyphalgrowth there were essentially no filamentous cells detectedeven after treatment with high concentrations of GlcNAc orthe addition of PIPES to raise the ambient pH The hyphaldefect was not due to the inhibitory effects of GlcNAc on thegrowth of ngs1D cells since deletion of HXK1 from ngs1Dprevented the inhibitory effects of GlcNAc (Figure 2D) butthe ngs1D hxk1D cells did not form hyphae in response toGlcNAc (Figure 7B) During our studies Su et al (2016)reported that deleting HXK1 from the ngs1Dmutant restoredthe ability to form hyphae The reason for these differencesare unclear However we note that we were careful to pre-culture the cells at 37 and to maintain them at low celldensity to prevent hyphal induction caused by a temperatureshift or the removal of farnesol when diluting dense culturesof cells (Enjalbert and Whiteway 2005) These were impor-tant factors to consider as the ngs1D and ron1Dmutants canrespond to other hyphal inducers (see below)

To determine whether the ron1D and ngs1Dmutants weredefective in responding to other hyphal inducers we exam-ined their ability to be stimulated by serum which containsseveral factors that promote hyphal morphogenesis (Xu et al2008) Interestingly both the ron1D and ngs1Dmutants werestimulated efficiently by serum to form hyphae (Figure 6)

Figure 5 The ngs1D mutant is defective in regulating the GlcNAc cata-bolic genes (A) Regulation of the GlcNAc catabolic genes in wild-type(LLF100) and ngs1D (SN1428) strains as indicated at the top Color codedmap of RNA-seq results shows log2 ratios for cells grown in GlcNAc vsdextrose or galactose + GlcNAc vs galactose Cells were grown at 37 in50 mM dextrose and then switched to 50 mM GlcNAc for 30 min orgrown in 50 mM galactose and then GlcNAc was added to one samplefor 30 min Samples were analyzed as described in the Materials andMethods (B) NGT1-GFP and HXK1-GFP reporter genes were constructedin wild-type control cells (SN1421 and SN1422) and in ngs1D (SN1431and SN1432) cells by tagging the 39 end of the open reading frame withGFP Cells were grown at 30 in 50 mM galactose medium GlcNAc wasadded to part of the sample for 2 hr and then the cells were photo-graphed by fluorescence microscopy to detect GFP fluorescence (lowerpanels) Upper panels show light microscope images as a reference forcell morphology Bar 10 mm


Figure 6 The ron1Dmutant has a partial defect and ngs1Dmutant is strongly defective in forming hyphae in response to GlcNAc (A) The cells indicatedon the left were incubated in synthetic medium containing the sugar indicated at the top Some samples were grown in the presence of 10 mM PIPES tobuffer the ambient environment to pH 68 One set of samples was induced with 10 serum to form hyphae Note that the ron1D and ngs1D mutantswere defective in being induced by GlcNAc to form hyphae but both strains were induced efficiently by serum Samples were incubated at 37 for 4 hr

308 S Naseem et al

These results suggest that Ron1 and Ngs1 function in anupstream step specific to GlcNAc rather than a downstreamstep that would be required in common by other inducers ofhyphal growth

The ron1D mutant shows delayed invasive hyphalgrowth and the ngs1D mutant is strongly defective

The mutant cells were also tested for ability to undergoinvasive hyphal growth into agar in a GlcNAc-dependentmanner Wild-type control cells formed detectable invasivehyphaewithin 1 day after spotting the cells onto the surface ofan agar plate containing galactose plus GlcNAc and the zoneof hyphal growth continued to expand through day 4 (Figure7A) This invasive hyphal growth was stimulated by GlcNAcas there were essentially no detectable hyphae emanatingfrom the zone of growth for the wild-type cells spotted ontogalactose or dextrose medium

The ron1D mutant showed only rare hyphal outgrowthsafter 1 day of incubation on agar containing galactose plusGlcNAc but hyphal cells could be readily seen by day 2and 3 (Figure 7A) After 4 days of incubation there wasextensive invasive growth into the agar As for the wild-type control cells this invasive growth was dependent onGlcNAc There were essentially no hyphal filaments seeninvading into the agar for ron1D cells grown on galactoseThis shows that ron1D cells are capable of invasive hyphalgrowth but are delayed in comparison to the wild type

The ngs1D cells were strongly defective in invasivegrowth as there were no hyphal outgrowths seen even after4 days of incubation on galactose plus GlcNAc agar (Figure7A) To determine whether GlcNAc toxicity played a rolein this we examined ngs1D hxk1D cells and found thatthey were completely defective in forming invasive hyphae(Figure 7B) Thus the hyphal defect of ngs1D cells does notappear to be due to the cells taking a longer time to adapt tonew media or to the toxic effects of GlcNAc on the growth ofthis mutant

Abnormal regulation of hyphal-specific genes in ron1Dand ngs1D mutants

To gain a better understanding of the ron1D and ngs1D de-fects in hyphal morphogenesis we examined the RNA-seqdata for the expression of a set of genes that are induced byGlcNAc and other hyphal-inducing stimuli (Figure 8A) In-terestingly most of the hyphal-induced genes that were iden-tified in previous microarray studies were also induced by thetransition from dextrose to GlcNAc (Gunasekera et al 2010Naseem et al 2015) The observation that some hyphal geneswere not as highly induced as in previous studies may reflectthe fact that the cells were only induced for 30 min in theRNA-seq study shown in Figure 8 whereas previous micro-

array studies used a 2-hr induction Consistent with a pre-vious microarray study hyphal genes were not as highlyinduced in galactose + GlcNAc medium as compared toGlcNAc alone (Naseem et al 2015) A set of control genesincluding ACT1 (actin) CYR1 (adenylyl cyclase) and NRG1(hyphal repressor) did not show a significant change in ex-pression in the presence or absence of GlcNAc

The set of 11 hyphal geneswas not significantly induced byGlcNAc in the ron1D cells consistent with the defect of thismutant in hyphal morphogenesis However the hyphal geneswere expressed at a high basal level in the ron1D mutantunder noninducing conditions All 11 hyphal genes showedan elevated level of expression in ron1D cells vs the wild-typecontrol cells when cells were grown in glucose and similarresults were seen in galactose (Figure 8A right side) In con-trast control genes such as ACT1 CYR1 and NRG1 did notshow a significant difference in expression between ron1Dand wild-type cells grown in dextrose or galactose The highbasal level of expression correlates with the presence of fila-mentous cells in cultures of ron1D cells grown in galactose(Figure 6) or dextrose (data not shown) Altogether theseresults indicate that Ron1 is important both to induce hyphalgenes and to prevent their expression in the absence ofGlcNAc

The ngs1D mutant showed a very different profile ofhyphal-specific gene expression (Figure 8B) There wasno consistent pattern for the effects of GlcNAc on the setof hyphal genes in the ngs1D cells A subset of the hyphalgenes may have been weakly induced (fourfold) but themagnitude of these changes was usually minor since themajority of hyphal genes showed lower basal levels of ex-pression in the ngs1D cells These results are consistentwith the strong defect of ngs1D cells in hyphal morphogen-esis in response to GlcNAc

Discussion

GlcNAc is well known as a structural component of the fungalcell surface and is now emerging as an important signalingmolecule in a wide range of fungi For example in C albicansGlcNAc stimulates hyphal morphogenesis gene expressionepigenetic switching from white to opaque phase and underspecial conditions cell death (Simonetti et al 1974 Kumaret al 2000 Huang et al 2010 Du et al 2015 Naseem andKonopka 2015) GlcNAc also stimulates hyphal morphogen-esis in the yeast Yarrowia lipolytica as well as the dimorphicfungal pathogens Histoplasma capsulatum and Blastomycesdermatitidis (Kim et al 2000 Gilmore et al 2013) Otherstudies have implicated GlcNAc in colonization of rice byMagnaporthe oryzae (Kumar et al 2016) and for recycling

and then photographed Bar 10 mM (B) Graph summarizing the percent of filamentous cells after growth in the indicated conditions The wild-typecontrol strain was DIC185 the ron1D strain was SN1424 the ron1D + RON1 complemented strain was SN1425 the ngs1D strain was 1429 and thengs1D + NGS1 complemented strain was SN1430


of chitin in intraradical mycelium of arbuscular mycorrhizalfungi (Kobae et al 2015) GlcNAc signaling is also importantfor a broad range of organisms beyond the fungal kingdomas it regulates virulence functions in bacteria and inflamma-some activation in mammalian cells (Naseem and Konopka2015 Wolf et al 2016)

The mechanisms of GlcNAc signaling are not well definedin part because the model yeasts S cerevisiae and Schizosac-charomyces pombe have lost the genes required to metabolizeexogenous GlcNAc and do not appear to respond to it

(Alvarez and Konopka 2007 Wendland et al 2009) Thusstudies on GlcNAc signaling in C albicans are providing auseful model for understanding the mechanisms by whichGlcNAc regulates cell signaling To better define the mecha-nisms of GlcNAc-regulated morphogenesis and gene expres-sion in this study we identified and characterized two genesneeded for the ability to grow on GlcNAc RON1 and NGS1As discussed further below the results were surprising in thatthese genes were also important for hyphal induction byGlcNAc

Figure 7 The ron1D mutant was delayed in forming invasive hyphae on GlcNAc medium whereas the ngs1D mutant was strongly defective (A) Thecells indicated on the left were spotted onto agar plates containing the sugar listed at the top The plates were incubated at 37 and then photographedafter the indicated number of days Note that the ron1D cells showed a delay in forming invasive hyphae into medium containing GlcNAc The ngs1Dmutant was strongly defective and did not form invasive filaments (B) Analysis of ngs1D hxk1D cells for invasive growth as described above Cells weregrown on galactose plus GlcNAc medium for 4 days and then the edge of the spot of cells was photographed The strains included the wild-type control(DIC185) ron1D (SN1424) ron1D + RON1 complemented strain (SN1425) ngs1D (SN1429) and ngs1D + NGS1 complemented strain (SN1430) andtwo independent isolates of ngs1D hxk1D (KM1433)

310 S Naseem et al

Ngs1 regulates growth on GlcNAc and other sugars

Ngs1 belongs to a group of proteins containing a family3 glycohydrolase domain and a GNAT acetyltransferase do-main (Qin et al 2015) The Ngs1 amino acid sequence pre-dicts it is defective in glycohydrolase activity (Figure 2A)which suggests it could act as a sensor by binding GlcNAcRecent studies by Su et al (2016) suggested that Ngs1 actswith the Ndt80-family transcription factor Rep1 to regulatethe GlcNAc catabolic genes by binding GlcNAc with theN-terminal glycohydrolase domain and then influencing gene

expression via the GNAT family acetyltransferase domainThis is consistent with the defect of ngs1D cells in inducingthe GlcNAc catabolic genes in our studies (Figure 5) How-ever we found that Ngs1 has a complex function the ngs1Dmutant grew poorly on maltose especially at 37 (Figure 2)The ngs1Dmutant was also slow to resume growth when thecarbohydrate source was switched and or when cells wereswitched from rich YPDmedium to synthetic medium (Figure2 and Figures S1 and S2 in File S1) These results are consis-tent with reports that the Rep1 has other roles including

Figure 8 Abnormal regulation of hyphal-specific genes in ron1D and ngs1D mutants Summary of RNA-seq results for expression of hyphal genes inwild-type control cells vs (A) ron1D or (B) ngs1D mutants The color-coded diagram illustrates the relative log2 change in gene expression as indicated by thescale bar at the bottom The left side shows the fold induction of a set of hyphal-regulated genes by GlcNAc for cells grown in GlcNAc vs dextrose or galactose +GlcNAc vs galactose The right side compares the basal level of expression of the hyphal genes for ron1D vs wild-type control cells grown in dextrose or ingalactose as indicated Numbers in white boxes correspond to TPM values that included a zero value which prevented calculation of a log2 ratio


regulating the expression of the MDR1 drug efflux pump(Hiller et al 2006) Thus Ngs1 does not specifically regulatethe GlcNAc catabolic genes

The ngs1Dmutant was strongly defective in responding toGlcNAc to undergo hyphal morphogenesis (Figure 6 and Fig-ure 7) This was not due to an inhibitory effect of GlcNAc ongrowth since deletion ofHXK1 to create ngs1D hxk1D doublemutant abrogated the toxic effects of GlcNAc but did not en-able cells to form hyphae (Figure 2 Figure 7 and Figure S2 inFile S1) Based on the broad role of Ngs1 in metabolism it isdifficult to assign a specific role for Ngs1 in transducing theGlcNAc signal to induce hyphae It will likely require specialmutations to distinguish the role of Ngs1 in transducing asignal for GlcNAc vs other sugars However Ngs1 does showsome specificity in that the ngs1D cells could be induced byserum to form hyphae (Figure 6)

Ron1 regulates GlcNAc catabolic genes andhyphal morphogenesis

Consistent with the failure to grow on GlcNAc medium RNA-seq studies showed that theC albicans ron1Dmutant failed toexpress the GlcNAc catabolic genes (Figure 4A) Analysis oftwo reporter genes (NGT1-GFP and HXK1-GFP) showed thatthe ron1D mutant was strongly defective in inducing thesegenes in response to GlcNAc even after long periods of in-duction (Figure 4B) Ron1 appears to be specific for aminosugars as the ron1D mutant grew well on other sugarssuch as maltose and galactose (Figure 1) Thus althoughC albicans Ndt80 Rep1 and Ron1 all contain a similarDNA-binding domain only Ron1 appears to be specific forregulating GlcNAc catabolism

A ron1Dmutant was partially defective in forming hyphaein response to GlcNAc which is the first evidence for a role ofRon1 in hyphal morphogenesis Although the ron1D cellsshowed a slightly higher basal level of filamentous cells un-der noninducing conditions the mutant cells were only in-duced to a limited degree to form hyphal cells after a shortexposure to GlcNAc in liquid (Figure 6) Longer induction onsolid agar plates demonstrated that ron1D cells could formextensive invasive hyphal filaments after delay of 24ndash48 hrcompared to the wild type (Figure 7) This defect was sur-prising since the GlcNAc catabolic genes (HXK1NAG1DAC1)are not required for induction of hyphal responses (Naseemet al 2011) One difference between ron1D and the hxk1Dnag1D dac1D triple mutant is that ron1D cells also fail toinduce GIG1 (Figure 4) However the absence of GIG1 ex-pression is unlikely to be the basis for the ron1D hyphal defectbecause a gig1D mutant does not have a hyphal defect(Gunasekera et al 2010) and a quadruple mutant lackingthe GlcNAc catabolic genes and GIG1 (hxk1D nag1D dac1Dgig1D) formed hyphae efficiently (Figure S3 in File S1)

Control studies showed that the ron1Dmorphogenesis de-fect was specific to GlcNAc since hyphal growth could beinduced by serum (Figure 6) Furthermore the failure ofron1D cells to induce hyphae was not due to an inhibitoryeffect on growth that is seen for the nag1D dac1D or ngs1D

mutants (Figure 1) Interestingly the elevated level of fila-mentous cells seen when the ron1D mutant was grown inmedium containing noninducing sugars such as galactose(Figure 6) correlated with the increased basal level of hy-phal-regulated genes (Figure 8) This indicates that Ron1also negatively regulates the hyphal genes Thus the partialdefect of ron1D cells in undergoing hyphal growth in re-sponse to GlcNAc may stem from abnormal regulation ofthe hyphal pathways in these mutant cells

Mitochondrial function is needed for GlcNAc catabolismbut not hyphal growth

Mitochondrial complex 1 mutants mci4D and nuo1D grewpoorly on GlcNAc (Figure 3) as did several other mitochon-drial mutants in the deletion mutant collection created byNoble et al (2010) This likely explains why other mutantswith defects in growing on nonfermentable carbon sourcesfail to grow on GlcNAc (Guan et al 2015 Jia et al 2015) Onepossibility is that this is related to the ability of GlcNActo induce cell death under special conditions which is cor-related with increased mitochondrial activity (Du et al2015) Interestingly the mci4D and nuo1D mitochondrialmutants grew well in the presence of galactose plus GlcNAcand could be induced to form hyphae (Figure 3) Althoughmitochondrial function has been linked to the cAMP path-way and regulation of hyphal growth (Morales et al 2013)it may not be important for GlcNAc to induce hyphae sincethis amino sugar can activate cAMP-independent pathways(Parrino et al 2017)

Role of transcription factors in hyphal morphogenesis

A large set of transcription factors regulates the induction offilamentous growth by hyphal inducers or biofilm-formingconditions including Efg1 Cph1 Bcr1 Bgr1 Tec1 Ume6Rim101 Nrg1 and Tup1 (Finkel and Mitchell 2011 Carlisleand Kadosh 2013 Lu et al 2014) Although this suggests itshould be possible to identify target genes that stimulatehyphalmorphogenesis this goal has been elusive Only a coreset of eight genes was induced under a variety of differenthyphal growth conditions and none of these genes is key forhyphal growth (Martin et al 2013) In addition hyphae canbe induced under some conditions with limited or no obviousinduction of the typical hyphal-regulated genes (Naseemet al 2015) Furthermore a recent study found that dimin-ished expression of the CAK1 protein kinase could bypassseveral of the transcription factors that are needed for hyphalmorphogenesis (Woolford et al 2016) Thus the role of tran-scriptional regulators in hyphal morphogenesis is complexThe special role for Ron1 in GlcNAc signaling therefore pro-vides an important new tool for defining the interplay be-tween transcription factors and hyphal morphogenesis

Acknowledgments

We thank Hong Qin for assistance with RNA-seq and theGenetics Stock Center (McCluskey et al 2010) for sending

312 S Naseem et al

deletion mutant strain collections We also thank the mem-bers of our laboratory for their helpful advice and sugges-tions on the manuscript This research was supported by aPublic Health Service grant awarded to JBK from the Na-tional Institutes of Health (RO1 GM-116048)

Literature Cited

Alvarez F J and J B Konopka 2007 Identification of anN-acetylglucosamine transporter that mediates hyphal induc-tion in Candida albicans Mol Biol Cell 18 965ndash975

Anders S P T Pyl and W Huber 2015 HTSeqmdasha Pythonframework to work with high-throughput sequencing data Bio-informatics 31 166ndash169

Biswas S P Van Dijck and A Datta 2007 Environmental sens-ing and signal transduction pathways regulating morphopatho-genic determinants of Candida albicans Microbiol Mol BiolRev 71 348ndash376

Brown G D D W Denning N A Gow S M Levitz M G Neteaet al 2012 Hidden killers human fungal infections SciTransl Med 4 165rv113

Carlisle P L and D Kadosh 2013 A genome-wide transcrip-tional analysis of morphology determination in Candida albi-cans Mol Biol Cell 24 246ndash260

da Silva Dantas A K K Lee I Raziunaite K Schaefer J Wageneret al 2016 Cell biology of Candida albicansndashhost interactionsCurr Opin Microbiol 34 111ndash118

Davis D A 2009 How human pathogenic fungi sense and adaptto pH the link to virulence Curr Opin Microbiol 12 365ndash370

Du H G Guan X Li M Gulati L Tao et al 2015 N-Acetylglucosamine-induced cell death in Candida albicans and its implications foradaptive mechanisms of nutrient sensing in yeasts MBio 6e01376ndashe01315

Enjalbert B and M Whiteway 2005 Release from quorum-sensingmolecules triggers hyphal formation during Candida albicansresumption of growth Eukaryot Cell 4 1203ndash1210

Finkel J S and A P Mitchell 2011 Genetic control of Candidaalbicans biofilm development Nat Rev Microbiol 9 109ndash118

Gentleman R C V J Carey D M Bates B Bolstad M Dettlinget al 2004 Bioconductor open software development forcomputational biology and bioinformatics Genome Biol 5 R80

Gilmore S A S Naseem J B Konopka and A Sil2013 N-acetylglucosamine (GlcNAc) triggers a rapidtemperature-responsive morphogenetic program in thermallydimorphic fungi PLoS Genet 9 e1003799

Guan G H Wang W Liang C Cao L Tao et al 2015 Themitochondrial protein Mcu1 plays important roles in carbonsource utilization filamentation and virulence in Candida albi-cans Fungal Genet Biol 81 150ndash159

Gunasekera A F J Alvarez L M Douglas H X Wang A PRosebrock et al 2010 Identification of GIG1 a GlcNAc-induced gene in Candida albicans needed for normal sensitivityto the chitin synthase inhibitor nikkomycin Z Eukaryot Cell 91476ndash1483

Hiller D D Sanglard and J Morschhauser 2006 Overexpressionof the MDR1 gene is sufficient to confer increased resistance totoxic compounds in Candida albicans Antimicrob Agents Chemo-ther 50 1365ndash1371

Huang G S Yi N Sahni K J Daniels T Srikantha et al2010 N-acetylglucosamine induces white to opaque switching amating prerequisite in Candida albicans PLoS Pathog 6 e1000806

Jia C K Zhang Q Yu B Zhang C Xiao et al 2015 Tfp1 isrequired for ion homeostasis fluconazole resistance andN-acetylglucosamine utilization in Candida albicans BiochimBiophys Acta 1853 2731ndash2744

Kappel L R Gaderer M Flipphi and V Seidl-Seiboth 2016 TheN-acetylglucosamine catabolic gene cluster in Trichoderma reeseiis controlled by the Ndt80-like transcription factor RON1 MolMicrobiol 99 640ndash657

Kim D B Langmead and S L Salzberg 2015 HISAT a fastspliced aligner with low memory requirements Nat Methods12 357ndash360

Kim J S A Cheon S Park Y Song and J Y Kim 2000 Serum-induced hypha formation in the dimorphic yeast Yarrowialipolytica FEMS Microbiol Lett 190 9ndash12

Kobae Y M Kawachi K Saito Y Kikuchi T Ezawa et al 2015 Up-regulation of genes involved in N-acetylglucosamine uptake andmetabolism suggests a recycling mode of chitin in intraradical my-celium of arbuscular mycorrhizal fungi Mycorrhiza 25 411ndash417

Konopka J B 2012 N-acetylglucosamine (GlcNAc) functions incell signaling Scientifica (Cairo) 2012 489208

Kumamoto C A and M D Vinces 2005 Alternative Candida albicanslifestyles growth on surfaces Annu Rev Microbiol 59 113ndash133

Kumar A S Ghosh D N Bhatt A Narula and A Datta2016 Magnaporthe oryzae aminosugar metabolism is essentialfor successful host colonization Environ Microbiol 18 1063ndash1077

Kumar M J M S Jamaluddin K Natarajan D Kaur and A Datta2000 The inducible N-acetylglucosamine catabolic pathway genecluster in Candida albicans discrete N-acetylglucosamine-induciblefactors interact at the promoter of NAG1 Proc Natl Acad Sci USA97 14218ndash14223

Litzinger S S Fischer P Polzer K Diederichs W Welte et al2010 Structural and kinetic analysis of Bacillus subtilisN-acetylglucosaminidase reveals a unique Asp-His dyad mecha-nism J Biol Chem 285 35675ndash35684

Love M I W Huber and S Anders 2014 Moderated estimationof fold change and dispersion for RNA-seq data with DESeq2Genome Biol 15 550

Lu Y C Su and H Liu 2014 Candida albicans hyphal initiationand elongation Trends Microbiol 22 707ndash714

Martin R D Albrecht-Eckardt S Brunke B Hube K Hunnigeret al 2013 A core filamentation response network in Candidaalbicans is restricted to eight genes PLoS One 8 e58613

McCluskey K A Wiest and M Plamann 2010 The fungal ge-netics stock center a repository for 50 years of fungal geneticsresearch J Biosci 35 119ndash126

Min K Y Ichikawa C A Woolford and A P Mitchell2016 Candida albicans gene deletion with a transient CRISPR-Cas9 system mSphere 1 DOI 101128mSphere00130-16

Morales D K N Grahl C Okegbe L E Dietrich N J Jacobs et al2013 Control of Candida albicans metabolism and biofilm for-mation by Pseudomonas aeruginosa phenazines MBio 4 e00526ndashe00512

Moussian B 2008 The role of GlcNAc in formation and functionof extracellular matrices Comp Biochem Physiol B BiochemMol Biol 149 215ndash226

Naseem S and J B Konopka 2015 N-acetylglucosamine regu-lates virulence properties in microbial pathogens PLoS Pathog11 e1004947

Naseem S A Gunasekera E Araya and J B Konopka 2011 N-acetylglucosamine (GlcNAc) induction of hyphal morphogenesisand transcriptional responses in Candida albicans are not de-pendent on its metabolism J Biol Chem 286 28671ndash28680

Naseem S S Parrino D Beuenten and J B Konopka 2012 Novelroles for GlcNAc in cell signaling Commun Integr Biol 5 156ndash159

Naseem S E Araya and J B Konopka 2015 Hyphal growth inCandida albicans does not require induction of hyphal-specificgene expression Mol Biol Cell 26 1174ndash1187

Noble S M S French L A Kohn V Chen and A D Johnson2010 Systematic screens of a Candida albicans homozygousdeletion library decouple morphogenetic switching and patho-genicity Nat Genet 42 590ndash598


Parrino S M H Si S Naseem K Groudan J Gardin et al2017 cAMP-independent signal pathways stimulate hyphal mor-phogenesis in Candida albicans Mol Microbiol 103 764ndash779

Pertea M D Kim G M Pertea J T Leek and S L Salzberg2016 Transcript-level expression analysis of RNA-seq experimentswith HISAT StringTie and Ballgown Nat Protoc 11 1650ndash1667

Pfaller M A and D J Diekema 2010 Epidemiology of invasivemycoses in North America Crit Rev Microbiol 36 1ndash53

Qin Z Y Xiao X Yang J R Mesters S Yang et al 2015 Aunique GCN5-related glucosamine N-acetyltransferase regionexist in the fungal multi-domain glycoside hydrolase family3 beta-N-acetylglucosaminidase Sci Rep 5 18292

She X K Khamooshi Y Gao Y Shen Y Lv et al 2015 Fungal-specific subunits of the Candida albicans mitochondrial complex Idrive diverse cell functions including cell wall synthesis CellMicrobiol 17 1350ndash1364

Simonetti N V Strippoli and A Cassone 1974 Yeast-mycelialconversion induced by N-acetyl-D-glucosamine in Candida albi-cans Nature 250 344ndash346

Styles C 2002 How to set up a yeast laboratory Methods Enzy-mol 350 42ndash71

Su C Y Lu and H Liu 2016 N-acetylglucosamine sensing by aGCN5-related N-acetyltransferase induces transcription via chro-matin histone acetylation in fungi Nat Commun 7 12916

Sudbery P E 2011 Growth of Candida albicans hyphae Nat RevMicrobiol 9 737ndash748

Vyas V K M I Barrasa and G R Fink 2015 A CRISPR systempermits genetic engineering of essential genes and gene fami-lies Sci Adv 1 e1500248

Wagner G P K Kin and V J Lynch 2012 Measurement ofmRNA abundance using RNA-seq data RPKM measure is incon-sistent among samples Theory Biosci 131 281ndash285

Walther A and J Wendland 2003 An improved transformationprotocol for the human fungal pathogen Candida albicans CurrGenet 42 339ndash343

Wendland J Y Schaub and A Walther 2009 N-acetylglucos-amine utilization by Saccharomyces cerevisiae based on expres-sion of Candida albicans NAG genes Appl Environ Microbiol75 5840ndash5845

Whiteway M and C Bachewich 2007 Morphogenesis in Can-dida albicans Annu Rev Microbiol 61 529ndash553

Whiteway M and U Oberholzer 2004 Candida morphogenesisand host-pathogen interactions Curr Opin Microbiol 7 350ndash357

Wilson R B D Davis and A P Mitchell 1999 Rapid hypothesistesting with Candida albicans through gene disruption withshort homology regions J Bacteriol 181 1868ndash1874

Wilson R B D Davis B M Enloe and A P Mitchell 2000 Arecyclable Candida albicans URA3 cassette for PCR product-directed gene disruptions Yeast 16 65ndash70

Wolf A J C N Reyes W Liang C Becker K Shimada et al2016 Hexokinase is an innate immune receptor for the detec-tion of bacterial peptidoglycan Cell 166 624ndash636

Woolford C A K Lagree W Xu T Aleynikov H Adhikari et al2016 Bypass of Candida albicans filamentationbiofilm regula-tors through diminished expression of protein kinase Cak1PLoS Genet 12 e1006487

Xu X L R T Lee H M Fang Y M Wang R Li et al2008 Bacterial peptidoglycan triggers Candida albicans hyphalgrowth by directly activating the adenylyl cyclase Cyr1p CellHost Microbe 4 28ndash39

Yamada-Okabe T Y Sakamori T Mio and H Yamada-Okabe2001 Identification and characterization of the genes forN-acetylglucosamine kinase and N-acetylglucosamine-phosphatedeacetylase in the pathogenic fungus Candida albicans EurJ Biochem 268 2498ndash2505

Zhang C and J B Konopka 2010 A photostable green fluores-cent protein variant for analysis of protein localization in Can-dida albicans Eukaryot Cell 9 224ndash226

Communicating editor A P Mitchell

314 S Naseem et al

remodeling due to growth or damage can act as a signal-ing molecule for both intercellular and interspeciescommunication

In C albicans GlcNAc is thought to act intracellularly inpart because the Ngt1 transporter that facilitates GlcNAc up-take into cells promotes the ability of this sugar to stimulatehyphal growth (Alvarez and Konopka 2007) GlcNAc doesnot have to be catabolized to induce hyphal growth becausea strain lacking the genes needed for GlcNAc metabolism(hxk1D nag1D dac1D) can be induced to form hyphae(Naseem et al 2011 2015) This led to the proposal that cellssensitively distinguish exogenous GlcNAc taken up from theenvironment vs GlcNAc synthesized inside the cell becauseexogenous GlcNAc is not phosphorylated whereas cells onlysynthesize phosphorylated forms of this sugar (eg GlcNAc-6-PO4) (Naseem et al 2012) Previous studies suggested thatthe cAMP pathway might be involved in GlcNAc signalingsince a cyr1D mutant that lacks adenylyl cyclase is not in-duced by GlcNAc to form hyphae However a faster-growingpseudorevertant version of the cyr1D strain can be inducedto form hyphae indicating that GlcNAc can induce hyphalmorphogenesis by cAMP-independent pathways (Parrinoet al 2017)

GlcNAc also induces the expression of the genes that pro-mote its catabolism in C albicans (Kumar et al 2000) TheGlcNAc catabolic genes are present in a cluster in the C albicansgenome that consists of a GlcNAc kinase that generates GlcNAc-6-PO4 (HXK1) a deacetylase (DAC1) and a deaminase (NAG1)(Kumar et al 2000 Yamada-Okabe et al 2001) The combinedaction of the catabolic genes results in the conversion of GlcNActo fructose-6-PO4 which can be used for glycolysis In additionGlcNAc stimulates the expression of the GlcNAc transporter(NGT1) and GIG1 which appears to play a role in metabolicregulation (Gunasekera et al 2010) These GlcNAc-responsivegenes are controlled independently of hyphal signaling sincethey can be induced under conditions that do not promotehyphal growth (eg at low temperature or in a cyr1D adenylylcyclase mutant)

To better understand how C albicans responds to GlcNAcwe identified two genes needed for growth on GlcNAc NGS1(CR_00190W) and RON1 (CR_04250W) These genes wereidentified in part because their orthologs are adjacent to thecluster of GlcNAc catabolic genes in some species (Gilmoreet al 2013 Kappel et al 2016) although this is not the case inC albicans Furthermore during our studies on these genesorthologs of NGS1 and RON1 were shown to be required forGlcNAc catabolism in the filamentous fungus Trichodermareesei and NGS1 was reported to be needed for growth onGlcNAc by C albicans (Kappel et al 2016 Su et al 2016)NGS1 encodes a protein with one domain of homology tofamily 3 glycohydrolases and another domain similar to theGNAT family of GCN5-related N-acetyltransferases (Qin et al2015) Ngs1 has been suggested to act in conjunction withthe Rep1 transcription factor in C albicans (Su et al 2016)We found that NGS1 is also important for growth on othersugars includingmaltose whereas RON1 appears to be specific

for GlcNAc RON1 encodes a protein with an Ndt80-like DNA-binding domain indicating it acts as a transcription factorMutants lacking C albicans NGS1 or RON1 were defective inresponding to GlcNAc to induce the catabolic genes Interest-ingly the ngs1D mutant was strongly defective in forminghyphae in response to GlcNAc whereas the ron1D strainwas partially defective The results identify Ron1 and Ngs1as critical regulators of both GlcNAc catabolism and hyphalgrowth in C albicans

Materials and Methods

Strains and media

The genotypes of the C albicans strains that were used aredescribed in Table 1 The cells were grown in rich YPD me-dium (yeast extract peptone dextrose) or in synthetic me-dium made with yeast nitrogen base (YNB) (Styles 2002)Most of the homozygous gene deletion mutant strainswere constructed by the sequential deletion of both copiesof the targeted gene from the diploid C albicans genomeThe ron1D strain was constructed by deleting the entireopen reading frame from C albicans strain BWP17 (arg4Dhis1D ura3D) using methods described previously (Wilsonet al 1999) In brief PCR primers containing 70 bp ofsequence homologous to the sequences flanking the openreading frame of RON1 were used to amplify the ARG4 andthe HIS1 selectable marker genes Integration of these de-letion cassettes at the appropriate site to delete RON1 wasverified by PCR using combinations of primers that flankedthe integration and primers that annealed within the intro-duced cassettes Complementation of the ron1D deletionmutation was carried out by introducing a plasmid carryinga wild-type copy of RON1 into the genome The plasmid wasconstructed by PCR amplification of genomic DNA from1000 bp upstream of the initiator ATG to 400 bp down-stream of the terminator codon of RON1 This RON1 DNAfragment was then inserted between the SacI and SacII re-striction sites of the URA3 plasmid pDDB57 (Wilson et al2000) The resulting RON1 plasmid was linearized in the pro-moter region by digestion with SnaBI and then integrated intothe ron1Dron1D strain SN1423 using URA3 selection to createcomplemented strain SN1425 The plasmid pBSK-URA3 wasdigested with the restriction enzymes PstI and NotI to liberatethe URA3-IRO1 sequence which was then transformed intoron1D strain SN1423 and integrated by homologous recombi-nation into the genome to restore URA3 at its native locus tocreate strain SN1424

The ngs1D strain was constructed as previously described(Noble et al 2010) A complemented strain was constructedby integrating a copy of the wild-typeNGS1 sequence into thegenome The NGS1 plasmid was constructed by PCR ampli-fication of genomic DNA from 980 bp upstream of the initia-tor ATG to 584 bp downstream of the terminator codon ofNGS1 This NGS1 DNA fragment was then inserted betweenthe SacI and SacII restriction sites of a version of plasmidpDDB57 that carries anNAT1 selectable marker A prototrophic

300 S Naseem et al































gig1D-1


gig1D-2



Growth assays










Data availability


Results




302 S Naseem et al











304 S Naseem et al

















306 S Naseem et al











308 S Naseem et al











Discussion








310 S Naseem et al

















Acknowledgments


312 S Naseem et al


Literature Cited































































314 S Naseem et al































gig1D-1


gig1D-2



Growth assays










Data availability


Results




302 S Naseem et al











304 S Naseem et al

















306 S Naseem et al











308 S Naseem et al











Discussion








310 S Naseem et al

















Acknowledgments


312 S Naseem et al


Literature Cited































































314 S Naseem et al


Growth assays










Data availability


Results




302 S Naseem et al











304 S Naseem et al

















306 S Naseem et al











308 S Naseem et al











Discussion








310 S Naseem et al

















Acknowledgments


312 S Naseem et al


Literature Cited































































314 S Naseem et al











304 S Naseem et al

















306 S Naseem et al











308 S Naseem et al











Discussion








310 S Naseem et al

















Acknowledgments


312 S Naseem et al


Literature Cited































































314 S Naseem et al

















306 S Naseem et al











308 S Naseem et al











Discussion








310 S Naseem et al

















Acknowledgments


312 S Naseem et al


Literature Cited































































314 S Naseem et al











308 S Naseem et al











Discussion








310 S Naseem et al

















Acknowledgments


312 S Naseem et al


Literature Cited































































314 S Naseem et al











Discussion








310 S Naseem et al

















Acknowledgments


312 S Naseem et al


Literature Cited































































314 S Naseem et al





310 S Naseem et al

















Acknowledgments


312 S Naseem et al


Literature Cited































































314 S Naseem et al

















Acknowledgments


312 S Naseem et al


Literature Cited































































314 S Naseem et al


Literature Cited































































314 S Naseem et al
























314 S Naseem et al

Regulation of Hyphal Growth and N-Acetylglucosamine … · 2017. 5. 2. · | INVESTIGATION...

Documents

Transcript of Regulation of Hyphal Growth and N-Acetylglucosamine … · 2017. 5. 2. · | INVESTIGATION...