Regulation of Bile Acid Synthesis by Fat-Soluble Vitamins

8/8/2019 Regulation of Bile Acid Synthesis by Fat-Soluble Vitamins

1/83

Regulation of Bile AcidRegulation of Bile Acid

-Synthesis by Fat soluble-Synthesis by Fat solubleVitamins A and DVitamins A and D

:Journal Report by

,larito Eunice Lovelle,larito Kristy Ann, .hua Ma Aurea,irilo Gerry Marc

-MD 1 A2

,September 23 2010

. , . , ,By Daniel R Schmidt Sam R Holmstrom Klementina Fon Tacer. , . .Angie L Bookout Steven A Kliewer and David J Mangelsdorf

, ,University of Texas Southwestern Medical Center DallasTexas

,From THE JOURNAL OF BIOLOGICAL CHEMISTRY ,May 7 2010


2/83

INTRODUCTIONINTRODUCTION,CLARITO Eunice Lovelle


3/83

LIPID-SOLUBLE VITAMINSLIPID-SOLUBLE VITAMINS

Essential for human health ( , , , )Four major groups A D E K The body does not need these every day and

.stores them in the liver when not used , ,Megadoses of vitamins A D E or K can be

.toxic and lead to health problems


4/83

VITAMIN AVITAMIN A

Retinol basic form of Vitamin A ,It is found in animal liver whole

,milk and some fortified foods

can also be synthesized in the liverfrom -carotene ,In the body retinol is converted to

several metabolites that function as

signaling molecules in various,biological processes including, , ,vision development growth

,metabolism and cell differentiation


5/83

VITAMIN DVITAMIN D

Two major physiologically relevant forms ofwhich are vitamin D2 ( )ergocalciferol andvitamin D3 ( )cholecalciferol

, ,Food sources such as fatty fish eggs andmeat are rich in vitamin D It is also produced endogenously when

ultraviolet rays from sunlight strike the

skin and trigger vitamin D synthesis


6/83

VITAMIN DVITAMIN D


7/83

Mechanism of action of Vitamins A and DMechanism of action of Vitamins A and D

Members of the nuclear receptor family oftranscription factors

uc l e a r r e ce pt o r swork with other proteins toe g u l at e th e ex pr e s s i o n o f s p ec if ic g e ne s, ,by controlling the development homeostasis and

metabolism

Vitamin A regulate gene transcription by bindingto and activating the ( ; )ARs NR1B and the

( ;etinoid X receptors RXRs NRretinoic)cid receptors 2B Vitamin D are mediated by the itamin D( ; )eceptor VDR NR1I1


8/83



9/83



10/83

BILE ACIDSBILE ACIDS

Amphipathic sterols synthesized fromcholesterolin the liver and secretedinto the intestine

,At high concentrations they function toemulsify dietary lipids ile saltsare bile acids conjugated to

glycine or taurine


11/83

Bile Acid SynthesisBile Acid Synthesis


12/83

Regulation of Bile Acid SynthesisRegulation of Bile Acid Synthesis

Cholesterol 7-hydroxylase (CYP7A1) -enzyme that catalyzes the rate

limiting step in bile acid

biosynthesis tightly regulated at the

transcriptional level by i l e a c i d sand other signaling molecules


13/83

Regulation of Bile Acid SynthesisRegulation of Bile Acid Synthesis

ositive transcriptionalregulators orphan nuclear receptors

- ( - - ; )LRH 1 liver related homologue 1 NR5A2 ( )hepatocyte nuclear factor 4 NR2A1


14/83

Negative feedback regulatorsNegative feedback regulators

ILE ACIDSarnesoid X receptor(F X R )

F G F 1 5 ( ;ibroblast growth factor 15F G F 1 9in humans

S H P ( )mall heterodimer partner and F G F R 4 ( ibroblast growth factor)eceptor4

C y p 7 a 1


15/83


ILE ACIDS (arnesoid X receptor F X R )

transcription of S H P

-R H 1and e p a t o c y t e n u c l e a ra c t o r 4

C y p 7 a 1


16/83



17/83

Although it is well established thatbile acids are essential for the

-absorption of lipid soluble,vitamins it is not known whether

-lipid soluble vitamins affect bile

.acid biosynthesis

,In this study they demonstrate thatvitamins A and D regulate bile acidsynthesis by overlapping but

.distinct mechanisms


18/83

Vitamin D on bile acid homeostasis

occurs through activation of VDR .

,Interestingly the action of vitamin A

is mediated through the /XR FXR.heterodimer


19/83

METHODOLOGYMETHODOLOGY,CLARITO Kristy Ann


20/83

Acclimatization of mice

Animal Treatments

Killing of mice

Homogenization of liver, gallbladder, intestines and attached mesentery

Mice pulverized and pooled

Total DNA ExtractionTotal RNA Extraction and Reverse Transcription RT (PCR)Bile acid Extraction and Analysis

Reverse-Phase Liquid Chromatography

Mass Spectrometry

Chromatin Immunoprecipitation Analysis (CHIP)

Cotransfection and Luciferase Assay

Mouse Ileum Explant Culture

Statistical Analysis


21/83

Acclimatization of MiceAcclimatization of Mice

:UBJECTS / -Male C57BL 6 mice - - ( - )6 mo n t h ol d a ge m a t ch e d

. Vehicle Group . Treatment Group

o VDR+/+ nd VDR/ mice from heterozygous

breeders on a ure 129T2 background .o FXR+/+ nd FXR/ mice from heterozygous

breeders on a ure 129S background .o FGF15+/+ nd FGF15/ mice from homozygous

breeders on a / ;ixed C57BL 6 129Sbackground .o SHP+/+ nd SHP/ mice from homozygous breeders

on a ure 129S background .


22/83

EnvironmentEnvironment

Housed in the same specific-pathogen free facility

-maintained under a temperaturecontrolled environment

- /with 12 h light dark cycles

with access to water and irradiatedrodent chow

Synchronous feeding cycle


23/83

n the day prior to death , chowwas removed 10 h before the dark,cycle replaced at the onset of the

,dark cycle and removed 4 h after

.the onset of the dark cycle Thechange in body weight between thebeginning and end of the dark cycle

was < % .for all animals


24/83

Animal TreatmentsAnimal Treatments

o itamin D ( , - ; 25 dihydroxycholecalciferol)igma -by ntraperitoneal injection at the.end of the dark cycle and 4 h before death

(VDR+/+ VDR/ ,FXR+/+ FXR/ ,FGF15+/+ ndFGF15/ )mice

o itamin A / (00mg kg retinyl palmitate ,/ ; ) (1800 USP units mg Sigma FXR+/+ nd FXR/

and SHP+/+ SHP/ )miceo itamin E / ( - -00 mg kg d tocopherolacetate , / ; )-1360 IU g Sigma y oral gavage

at the beginning and end of the dark cycle ( 6)nd 4 h before death .


25/83

DietDiet

GW4064 ( )- /laxoSmithKline 500mg kg TTNPB ( ) - . /igma 0 25 mg kg provided for

12 h before death

LG268- /0 mg kgby ral gavage12 hbefore death

Cholestyraminewas admixed in the diet TTNPB- ( )synthetic ligands selective for RAR LG268- selective for RXR GW4064- FXR


26/83

Killing of MiceKilling of Mice

Between 4 and 6 h after the beginningof the light cycle

by isoflurane inhalation and

exanguinated via the descending venacava prior to tissue collection


27/83

Mouse Ileum Explant CultureMouse Ileum Explant Culture

. cm of the terminal ileumwas collectedand flushed with -hosphate bufferedsaline

.2 ( )Segments 1 3 mm of the ileum werecultured at %7 C and 95 oxygen forh in Dulbecco's modified Eagle'smedium % -supplemented with 10 charcoal

-stripped heat inactivated fetal bovine, , /serum 25 mm HEPES 100 units ml

, / ,penicillin 100 g ml streptomycin and. %ither vitamin D or 0 1 ethanol( ).ehicle .3 From which otal RNA was extracted at- .he end of the 6 h culture period


28/83

Mouse Ileum Explant CultureMouse Ileum Explant Culture

NA Extraction and Quantitative( )-everse Transcription RT PCR :olymerase chain reaction An enzymatic method

( )for the repeated copying and thus amplificationof the two strands of DNA that make up a particular

gene sequence.4 Total RNA was extracted from liver and ileum

using -NA STAT 60TM ( soTex)iagnostics ..5 ( ) -RNA 4 g from each sample was DNase

-treated and reverse transcribed using.random hexamers.6 The resulting DNA was analyzed by-uantitative RT PCRRelative RNAevels were calculated using the

omparative C Tmethodnormalized toU36b4.


29/83

Bile Acid Extraction and AnalysisBile Acid Extraction and Analysis

ile Acid Extraction and Analysis - to( )determine the extent of VDR enterocytes

contribution to bile acid metabolism in vivo.1 , , ,Liver gallbladder intestines and attached

mesentery were removed

en bloc

and homogenized

.in ethanol.2 , ,Homogenates were heating to boiling cooled and

.then filtered and was repeated twice.3 Filtrates were combined and adjusted to a constant

.volume.4 Bile acids were resolved by -everse phaseiquid chromatography (C8 ,precolumn C18

)analytical column and quantified by assspectrometrywith electrospray ionization in.negative ion mode


30/83

Bile Acid Extraction and AnalysisBile Acid Extraction and Analysis


31/83


32/83

Chromatin Immunoprecipitation (ChIP) AnalysisChromatin Immunoprecipitation (ChIP) Analysis

. ,1 The ileum was collected flushed with- ,phosphate buffered saline and frozen

.immediately in liquid nitrogen . (2 Samples from four to five mice VDR +/+

nd VDR -/-) .were pulverized and pooled .3 300 mg from each pool was fixed in

- %phosphate buffered saline with 1formaldehyde for 10 min and quenched

.with glycine for 5 min .4 Subsequent ChIP steps were done using

( )the ChIP EZ kit Upstate materials andmethods


33/83


34/83


35/83

nhancer response elementnhancer response element Promoter Promoter tructuraltructuralGeneene

egulatedexpression asalexpressionistal regulatoryelements Promoterromoter proximalelements

o di ng r eg io nher regulatory elements(+) (-)nhancer and repressor elements ( / , .)romoter proximal elements GC CAAT etc

TATA DPEnr+1

VDR tk LUC


36/83

Fgf15 Promoter and Intron 2 CloningFgf15 Promoter and Intron 2 Cloning

.2 -A 2338 nucleotide region of the Fgf15promoter including six nucleotidesdownstreamof the transcriptional

start site was amplified using the

following primers containingrestriction endonuclease sites( ):underlinedCCTAAACCAAGCTT ( )CTGGCCATCTG forward

and AGAGTTACTGCGTCGAC ( ).AGTGG reverse

.3 This product was inserted upstream ofthe thymidine kinase promoter-sequence in the pTk LUC plasmid to+ .generate p2300Fgf15 TATA_TkLUC


37/83


.4 This plasmid was used to amplify shorterregions of the Fgf15 ,promoter which were

- .likewise inserted into pTk LUC.5 Promoter regions were amplified usingistinct forward primers( CTGCGAAAGCTTGCTAAAGGAGAG for

+ ,p400Fgf15 TATA_TkLUCCCACCAAGCTTCTGTGCATTGAAC for

+ ,p230Fgf15 TATA_TkLUC and

CCTGTCGACGCATCAAGTCTCC for+ )p100Fgf15 TATA_TkLUC and a ommoneverse primer( ).GGATCCTCTAGAGTCGACAGTGG


38/83


.6 +p230Fgf15 TATA_TkLUC was amplified usingthe following verlapping primers

containing two altered nucleotides( ):underlinedGGCCTGGGCGGGAC ( )CACTGGGTTGGGG forwardand CCCAACCCAGTGGT CCCGCCCAGGCC( ).reverse

.7 The Fgf15promoter region containing the

-two nucleotide mutation was reinserted- ( -into pTk LUC to generate p230 mut) + .145 Fgf15 TATA_TkLUC


39/83


.8 -A 2460 nucleotide region encompassing the second intronof Fgf15was amplified using the following primers

containing restriction endonuclease sites( ):underlined GAGCGCGGTCGAC ( )AAGATATACG forward andAAGGTACAGTCGAC ( ).CTCCGAGTAG reverse The product was

inserted in reverse orientation upstream of the

-thymidine kinase promoter sequence in pTk LUC to.generate pFgf15intron2rev_TkLUC.9 The modified regions of all plasmids were verified by

DNA sequencing at the McDermott Sequencing Core ofthe University of Texas Southwestern Medical

.Center VDR binds directly to the Fgf15 promoterand regulates Fgf15 expression through a direct

.transcriptional mechanism10.


40/83


otransfection and Luciferase Assay.0 EK293 cells were grown at 37 C and% CO2 -n 96 well plates inulbecco's modified Eagle's mediumand transfected by alcium phosphate

- .co precipitation


41/83

Cotransfection and Luciferase AssayCotransfection and Luciferase Assay

. EK293 cells were grown at 37 C and% CO2 -n 96 well plates inulbecco's modified Eagle's mediumand transfected by alcium phosphate

- .co precipitation

Transfection- the introduction of any

, ,naked nucleic acid molecule not just DNAinto cultured eukaryotic cells


42/83


43/83



44/83


-ollowing a 16 h treatment with,W4064 and vitamin D luciferase-nd galactosidase activitiesere measured . Luciferase activity was normalized for-transfection efficiency using

galactosidase activity and expressed.as relative luciferase units

,or each experiment all conditions,ere tested in triplicate andll experiments were repeated.hree times Data shown are the mean . .S D of triplicate assays from one

.representative experiment


45/83

Statistical AnalysisStatistical Analysis

. .Data are presented as the mean S Eand were analyzed by -wo tailednpaired Student's t .est p

< .alues 0 05 were considered.ignificant


46/83

RESULTSRESULTS, .CHUA Ma Aurea


47/83

Bile Acid Metabolism Is Dysregulated in VDRBile Acid Metabolism Is Dysregulated in VDR// MiceMice

To determine the extent of VDR contribution to bile acidmetabolism in vivo, the bile acid pool size andcomposition in VDR/ .mice was measured

:Results

( )1 VDR/

%mice had an 30 larger bileacid pool size at 3 months of ageand more than twice the amount ofbile acids at 6 months of age as

- .their wild type littermates

( )2 Loss of VDR also increased thehydrophobicity of the bile acid pool dueto a greater increase in taurocholic acid

.relative to tauromuricholic acids

* -VDR vitamin D receptor


48/83


A, total bile acids were extracted from the gallbladder, liver, intestine, and portal blood and quantitated by liquidchromatography/mass spectrometry. The results shown are bile acid pool size and composition in 3-month-old (n = 7)and 6-month-old (n = 4) male mice of the indicated genotype. Taurocholate (tCA) and tauromuricholates (tMCA;includes -, -, and -muricholate) compose the majority of bile acids in the mouse. See Experimental Proceduresfor a complete list of bile acids grouped as others.

* - ,VDR vitamin D receptor ( ) ( ) Taurocholate tCA and tauromuricholates tMCA


49/83


To determine the mechanism underlying the perturbation of bile,acid homeostasis caused by the loss of VDR the expression of

genes in the liver which are known to play a role in bile.acid metabolism were analyzed

:Results( )1 VDR/ -mice had 3 fold higher expressionof Cyp7a1.

( )2 The enzyme that catalyzes the final step,in the synthesis of cholic acid Cyp8b1, was

.increased ( ) -3 changes were accompanied by a 2 fold

decrease in Shp .mRNA

* - , - VDR vitamin D receptor Cyp7a1 Cholesterol 7 - , -hydroxylase Cyp8b1 Cholesterol 8b-hydroxylase


50/83


Data represent the mean S.E. B and C, total RNA was extracted from the liver (B) and ileum (C)and analyzed by quantitative RT-PCR. Data represent the mean S.E. of seven animals/group. For allpanels, the p value was determined by Student's t test.

* - , - VDR vitamin D receptor Cyp7a1 Cholesterol 7 - , -hydroxylase Cyp8b1 Cholesterol 8b-hydroxylase Shp Small heterodimer partner


51/83


( )Gene expression in the terminal small intestine ileum was.examined

:Results

( )1 Bile acid activation of FXR inducesexpression of bile acid transportersand .Fgf15

( )2 The expression of Fgf15was decreasedmarkedly in VDR/ .mice

* - , VDR vitamin D receptor Fgf15 fibroblast growth factor 15


52/83


Data represent the mean S.E. B and C, total RNA was extracted from the liver (B) and ileum (C)and analyzed by quantitative RT-PCR. Data represent the mean S.E. of seven animals/group. For allpanels, the p value was determined by Student's t test.

* - , , VDR vitamin D receptor Fgf15 Fibroblast growth factor 15 FXR Farnesoid X receptor


53/83

Vitamin D Induces Fgf15 to Suppress Cyp7a1Vitamin D Induces Fgf15 to Suppress Cyp7a1

VDR is expressed in enterocytes and Fgf15expression waslower in VDR/ .mice

VDR might regulate Fgf15 .at the transcriptional level :Results

( )1

Increased Fgf15

expression in the

intestine and decreased Cyp7a1inthe liver;

( )2 Intestinal bile acid transporters were;also decreased

( )3 Repression of Cyp7a1by vitamin D was- (absent in FGF15 null FGF15/ ) mice

* - , , - - VDR vitamin D receptor Fgf15 Fibroblast growth factor 15 Cyp7a1 Cholesterol 7ahydroxylase


54/83


/ . ( ) (treated for 4h by intraperitoneal injjection of 75 mg kg of vitamin D mRNA expression in the ileum Fgf15 and liver cy


55/83


To determine whether physiological levels of vitamin Dcontribute to the regulation of Fgf15, the induction of

Fgf15was compared with that of the gene encoding- ( ) .Calbindin D9k a known VDR target gene in ileum explants

:Results ( )1 Both genes were induced by vitamin D in a

- .comparable dose dependent manner


56/83


- .as extracted and analyzed by quantitative RT PCR The level of mRNA expression was normalized to


57/83


Taken together with the finding that VDR isrequired for normal expression of Fgf15, these

data provide evidence that the transcriptionalregulation of Fgf15by vitamin D is

.physiologically relevant


58/83


/ -ChIP analysis was performed to identify VDR RXRbinding sites in the regulatory regions of

Fgf15. :Results

( )1 -Strong RXR binding site was detected in the second,intron and an additional binding site was foundin the proximal promoter near the

.transcriptional start site( )2 VDR binding was also detected at both sites

( )3

VDR transactivation occurred exclusively through

,the proximal promoter site whereas FXRtransactivation occurred exclusively at the

second intron( )4 VDR binds directly to the Fgf15promoter and

regulates Fgf15expression through a direct

.transcriptional mechanism


59/83


, and nucleotides mutated in the promoter analysis shown in Fare .underlined F, ( + ;the promoter 2332 to 6 white boxes) (+and intron 2 67


60/83


Both VDR and FXR induce .Fgf15 determine whether VDR could substitute for FXR in

.mediating repression of bile acid synthesis

:Results( )1 transcriptional regulation of Fgf15by

; ,VDR is not dependent on FXR howeverFXR is required for the induction of

Fgf15to levels that suppress Cyp7a1.


61/83

Vitamin A Induces Fgf15 and Shp to SuppressVitamin A Induces Fgf15 and Shp to Suppress

Cyp7a1Cyp7a1

-To determine whether other lipid soluble vitamins also cause.repression of bile acid synthesis

:Results

( )1 - - ( . . )d tocopherol i e vitamin E had noeffect on Cyp7a1 or any other genes, ( . .analyzed retinyl palmitate i e)vitamin A dramatically increased

Fgf15 expression in the intestine

.and suppressed Cyp7a1 in the liver( )2 Vitamin A increased expression of Shp

.in the liver

i i d f d h


62/83


Cyp7a1Cyp7a1

/ ( ). (mg kg retinyl palmitate vitamin A mRNA expression in the ileum Fgf15) (and liver Cyp7a1and Shp) was

i i A d f1 d Sh S


63/83


Cyp7a1Cyp7a1

In vivo, -vitamin A may be metabolized to all trans- ,retinoic acid, -which activates RAR and 9 cis- ,retinoic acid which activates both

.RAR and RXR To determine which nuclear receptor was mediating the

transcriptional effects of vitamin A on Fgf15, Cyp7a1, and Shp,-wild type mice was treated with the synthetic ligands TTNPB

( ) ( ).selective for RAR and LG268 selective for RXR

:Results( )1 Both RAR and RXR induced Shpand

suppressed Cyp7a1; ,however Fgf15was

.induced only by RXR

i i d f d hVi i A I d F f15 d Sh S


64/83


Cyp7a1Cyp7a1

.e treated for 1 day with diets containing the indicated synthetic ligands The target nuclear receptor

Vi i A I d F f15 d Sh SVi i A I d F f15 d Sh S


65/83


Cyp7a1Cyp7a1

To test if induction of Fgf15by RXR ligand occurs through/ ,activation of the RXR FXR heterodimer FXR/ mice was.treated with vitamin A

:Results( )1 ,In the absence of FXR vitamin A had noeffect on Fgf15 .expression

(2)

Fgf15is induced by vitamin A through the RXR/ .partner of the RXR FXR heterodimer complex

Vi i A I d F f15 d Sh SVit i A I d F f15 d Sh t S


66/83


Cyp7a1Cyp7a1

Despite the absence of Fgf15 ,inductionvitamin A still efficiently repressed

Cyp7a1in FXR/ ,mice indicating that-additional vitamin A dependent mechanisms

exist to suppress .Cyp7a1 despite lower basal levels of Shpin FXR/

,mice FXR was not required for inductionof Shp ,by vitamin A suggesting that Shp

induction contributed to Cyp7a1.repression by vitamin A

repression of Cyp7a1by vitamin A was.greatly reduced in the absence of SHP

Vi i A I d F f15 d Sh SVit i A I d F f15 d Sh t S


67/83


Cyp7a1Cyp7a1

( ). (palmitate vitamin A mRNA expression in the ileum Fgf15) (and liver Cyp7a1and Shp) was determined b

Vit i A I d F f15 d Sh t SVit i A I d F f15 d Sh t S


68/83


Cyp7a1Cyp7a1

( ). (palmitate vitamin A mRNA expression in the ileum Fgf15) (and liver Cyp7a1and Shp) was determined b

Vitamin A Rescues Fgf15 and Shp Expression and SuppressesVitamin A Rescues Fgf15 and Shp Expression and Suppresses


69/83


Cyp7a1 under Conditions of Impaired Bile Acid FeedbackCyp7a1 under Conditions of Impaired Bile Acid Feedback

RepressionRepression

Vitamin A analogs might be usefultherapeutically in pathological

conditions in which feedback repression.of bile acid synthesis is interrupted

Bile acid malabsorption-characterized bydecreased intestinal bile acid

,reabsorption resulting in low FGF19( )levels human ortholog of FGF15 and

excessive bile acid synthesis by the.liver



70/83




The effects of bile acid malabsorption on expressionof bile acid feedback regulatory genes can be

-mimicked by administering the bile acid binding, .resin cholestyramine

:Results

( )1 -cholestyramine treatment of wild type micedramatically decreased Fgf15and Shpexpression

and increased Cyp7a1expression( )2 vitamin A completely rescued Fgf15and Shpexpression

and reversed the derepression of Cyp7a1caused byinterrupted bile acid reabsorption in-cholestyramine treated animals

(1) These data highlight the potential of vitamin A

analogs to correct disrupted feedback repression of

.bile acid biosynthesis



71/83




( ). .e vitamin A Vitamin D and A treatments were administered The control group received standard chow


72/83

Summary of ResultsSummary of Results

Dietary vitamins A and D inhibit bile acid synthesis-by repressing hepatic expression of the rate

.limiting enzyme CYP7A1 Receptors for vitamin A and D induced expression of

Fgf15, -an intestine derived hormone that acts on

liver to inhibit Cyp7a1. Induction of Fgf15by vitamin D is mediated through

,its receptor the induction of Fgf15by vitamin A is/mediated through the retinoid X receptor farnesoid X

receptor heterodimer and is independent of bile

,acids suggesting that this heterodimer functions as.a distinct dietary vitamin A sensor Vitamin A treatment reversed the effects of the bile

acid sequestrant cholestyramine on Fgf15, Shp, andCyp7a1 .expression


73/83

DISCUSSIONDISCUSSION,CIRILO Gerry Marc


74/83

Bile acids are essential

structural components of lipidmicelles because of their unique

physicochemical properties and

because of thus bile acidspromote intestinal absorption oflipids and lipid soluble

.vitamins

The study revealed an unexpected link


75/83

The study revealed an unexpected link-between lipid soluble vitamins and

.bile acid biosynthesiso Vitamin A and Dwhich are lipid

soluble vitamins exert negativefeedback on bile acid synthesis in

vivo by .decreasing Cyp7a1 expressiono

FGF15 and SHP play a central role inthe feedback regulation of bile acid.synthesis by bile acids and FXR

o FGF15is integral to the mechanism ofCyp7a1 regulation by vitamin D and

that FGF15 with SHP are importantfor the regulation of bile acid.synthesis by vitamin A


76/83

VDR transcriptionally regulated FGF15 inthe intestine and that this pathway was

essential for the repression of bile acid.synthesis by vitamin D

,Surprisingly VDR was required to maintainnormal Fgf15 expression and bile acids

levels in vivo. These results show that

vitamin D and its receptorcontribute to the feedbackregulation of bile acid

synthesis by controlling.expression of FGF15


77/83

Cyp7a1 repression by Vitamin DCyp7a1 repression by Vitamin D

Cyp7a1 repression by vitamin D required anintact FXR signaling pathway indicating

that VDR is not sufficient enough to.supress bile acid synthesis

:Explanation

.a Activation of both VDR and FXR may berequired to induce Fgf15 to the level

.suitable for Cyp7a1 suppression

.b Feedback repression of bile acidsynthesis may require corresponding signals

in the intestine and liver and that the.latter needs both VDR and XFR to occur

i b i i


78/83

Cyp7a1 repression by Vitamin ACyp7a1 repression by Vitamin A

-Vitamin A repressed Cyp7a1 through FXR-dependent and FXR independent

.mechanisms FXR required for theinduction of Fgf15 by vitamin A and

.RXR itself induced Fgf15

Proof that RXR functions as avitamin A receptor in vivo and

/demonstrates that the RXR FXRheterodimer can serve as a sensor for.dietary vitamin A

C 1 i b i i A


79/83


,Under normal physiologic conditions bile acids.are efficiently reabsorbed in the ileum

Bile acid malabsorption is a pathologicalcondition often seen in patients with Crohn

disease and is characterized by reduced ilealbile acid reabsorption and delivery of largequantities of bile acids in the colon induce

,fluid secretion resulting in cholerheicenteropathy and the characteristic symptom of

.watery diarrhea Bile acid sequestrants are currently the primarytherepy nad provide symptomatic relief but

does not correct bile acid overproduction and.hypersecretion by the liver

C 7 1 i b Vi i A


80/83


The findings in the study thatvitamin A induces Fgf15 and

suppresses bile acid synthesis under

conditions of interrupted bile acidreabsorption suggests that vitamin Amay provide therapeutic benefit to

patients with bile acid

malabsorption and increased hepatic.bile acid synthesis


81/83

Elevated levels of bile acid in the

,colon may promote colon cancerwhereas vitamin D is associated with.reduced risk of colon cancer

VDR is activated by lithocholic acidand induces enzymes that detoxify

.bile acids in the colon

I


82/83

In summary..In summary..

The findings in the study highlightthe importance of nuclear receptors

in the regulation of bile acid

metabolism and provide mechanisticinsight into the signaling pathwaysinvolving Fgf15 and SHP that governfeedback repression of bile acid

.biosynthesis


83/83

.Thank you for listening

Regulation of Bile Acid Synthesis by Fat-Soluble Vitamins

Documents

Transcript of Regulation of Bile Acid Synthesis by Fat-Soluble Vitamins