Proc. Nati. Acad. Sci. USAVol. 91, pp. 7985-7989, August 1994Developmental Biology

Regulation in vitro of an L-CAM enhancer by homeobox genesHoxD9 and HNF-1

(cadherins/gene expression/homeodomain proteins)

RANDAL S. GOOMER, BRENT D. HOLST, IAN C. WOOD, FREDERICK S. JONES, AND GERALD M. EDELMANDepartment of Neurobiology, The Scripps Research Institute, 10666 North Torrey Pines Road, La Jolla, CA 92037

Contributed by Gerald M. Edelman, April 29, 1994

ABSTRACT Previous studies have shown that in vitroexpression of the neural cell adhesion molecule (N-CAM) canbe regulated by the products of homeobox genes HoxB9, -B8,and -C6. N-CAM is a Ca2+-independent immunogobulin-related CAM that plays an important role in neural develop-ment. In the present study, we investigated whether the livercell adhesion molecule (L-CAM) a member of the Ca2+-dependent CAM family (cadherins) is also regulated by ho-meobox-containing genes. In transient cotransfection experi-ments of NIH 3T3 cells, we observed that both HoxD9 andliver-enriched POU-homeodomain transcription factor,HNF-1, activated chloramphenicol acetyltransferase gene re-porter constructs containing the L-CAM promoter and anenhancer present in the second intron of the chicken L-CAMgene. Using electrophoretic mobility-shift assays, we found thatcomponents of cell extracts from NIH 3T3 cells transfected withHoxD9 bound to a small region of the L-CAM enhancer havinga consensus sequence that is a putative binding site for HNF-1.Components of extracts from the chicken hepatoma cell lineLMH that had been transfected with an HNF-1 expressionvector also bound to this same site. In nuclear run-on exper-iments with nuclei from LMH cells that were transfected withexpression vectors for HoxD9 or HNF-1, L-CAM RNA levelswere increased 33-fold and 4-fold respectively. Using the samerun-on procedure, it was confirmed that nuclei prepared fromnormal embryonic chicken liver cells expressed the RNAs forHoxD9, HNF-1, and L-CAM. Taken together with previousobservations, these data raise the possibilit that homeobox-containing genes will have a widespread role in the place-dependent expression of CAMs belongng both to immunoglo-bulin-related and to cadherin families.

Cell adhesion molecules (CAMs) play a critical morphoreg-ulatory role in animal development (1). A variety of obser-vations have shown that they appear during embryogenesis incharacteristic place-dependent patterns (2, 3). These patternsinclude those of immunoglobulin-related Ca2+-independentCAMs such as the neural cell adhesion molecule (N-CAM)and those of Ca2+-dependent CAMs or cadherins such as theliver cell adhesion molecule (L-CAM). Members of bothCAM families can play simultaneous roles in a given tissueand even in the same cell. N-CAM-related molecules areparticularly important in neural development, while L-CAM-related molecules are major contributors to the developmentof epithelial and parenchymal tissues.A key question concerns the control of the differential

place- and time-dependent expression of these morphoregu-latory proteins. In previous studies (4, 5), we have shown thatNIH 3T3 cells cotransfected with expression constructsdriving the expression of HoxB9, -B8, or -C6 along withreporter constructs having the 5' flanking region of the

N-CAM gene linked to a chloramphenicol acetyltransferase(CAT) reporter gene demonstrated strong induction of CATactivity.

In the present study, we wished to determine whethergenes ofmembers ofthe cadherin family ofCAMs would alsoshow similar behavior. We chose L-CAM [one of the firstcadherins to be isolated and characterized (6)] to explore thispossibility. In the chicken genome, the L-CAM gene isdownstream of the gene for another closely related molecule,K-CAM or B cadherin (7, 8). We have shown that a 630-bpintergenic region between the K- and L-CAM genes containsa promoter for L-CAM (9). Prompted by the suggestion fromtransgenic mouse experiments (10) that an enhancer waspresent in the L-CAM gene, we also found an enhancerhaving a liver-enriched POU-homeodomain transcriptionfactor HNF-1 consensus sequence in the second intron oftheL-CAM genomic sequence. When present together in suit-able constructs, the promoter and enhancer induced theexpression of CAT reporter constructs cotransfected intochicken hepatoma LMH cells (9).

In the experiments described here, NIH 3T3 cells werecotransfected with CAT reporter constructs containingL-CAM promoter/enhancer sequences and expression vec-tors for HoxD9 and HNF-1. Expression of each of thehomeobox genes resulted in increased CAT activity in onlythose constructs that contained the L-CAM enhancer. Elec-trophoretic mobility-shift assays (EMSAs) with extracts pre-pared from cells transfected with HoxD9 or HNF-1 showedincreased binding to the region ofthe enhancer containing anHNF-1 consensus binding site. Assays of nuclear run-ontranscription using LMH cells transfected with HoxD9 andHNF-1 showed an increase in L-CAM RNA of 33-fold and4-fold, respectively. Similar assays on embryonic chickenliver cell nuclei showed that HoxD9, HNF-1, and L-CAMwere all expressed in this tissue. The results suggest thatL-CAM expression is likely to be regulated by homeobox-containing genes, and they provide a basis for further explo-ration of this possibility in vivo.

MATERIALS AND METHODSPlasmid Constructs and Oligonucleotides. Reporter plas-

mids (Fig. 1) were constructed in the promoterless pCAT-basic plasmid (Promega). The LP-CAT construct contains anMbo I/Kpn I fragment (0.63 kb) of the L-CAM promoter (9)and the LPE1.3CAT construct also contains the Sst I frag-ment (1.3 kb) from the second intron of the chicken L-CAMgene (9) cloned downstream of the CAT gene. The HoxD9expression plasmid contains the human HOXD9 cDNA (11)inserted downstream of the simian virus 40 promoter in thepSG5 expression plasmid (12) and was a kind gift of DennisDuboule (EMBL, Heidelberg). The HNF-la expression vec-

Abbreviations: CAT, chloramphenicol acetyltransferase; EMSA,electrophoretic mobility-shift assay; CAM, cell adhesion molecule;L-CAM, liver CAM; N-CAM, neural CAM.

7985

The publication costs of this article were defrayed in part by page chargepayment. This article must therefore be hereby marked "advertisement"in accordance with 18 U.S.C. §1734 solely to indicate this fact.

7986 Developmental Biology: Goomer et al.

LP-CAT 1.0

LPE1 .3-CAT 1.0

Enhancer

ml ml lMI MIS

(1.3)

0.9 1.1

2.3 2.3

FIG. 1. (A) L-CAM promoter/enhancer CAT reporter constructsused in transient transfection experiments. LP-CAT contains a630-bp Mbo I/Kpn I L-CAM promoter fragment driving aCAT gene.In addition to the L-CAM promoter, the LPE1.3-CAT constructcontains a 1.3-kb segment ofDNA containing the L-CAM enhancer.The putative binding site for HNF-1 is indicated by a solid box.Restriction endonuclease cleavage sites for Mbo I (Mb), Kpn I (K),Mlu I (Ml), and Sst I (S) are indicated. (B) Induction ofCAT activityin NIH 3T3 cells transfected with the L-CAM gene/CAT reporterconstructs and the HoxD9 and HNF-1 expression vectors.

tor contains the mouse HNF-la gene (13, 14) inserted down-stream of the SRa promoter in the pBJ5-STOP plasmid andwas a kind gift of Gerald R. Crabtree (Stanford University).The HNF-la construct is referred to hereafter as HNF-1. Allplasmids were purified by CsCl/ethidium bromide equilib-rium centrifugation (15).

Oligonucleotides used as competitors for EMSAs werederived from the L-CAM enhancer sequence (9). Competi-tors A, B, and C (Fig. 2 Lower) were synthesized on anoligonucleotide synthesizer (Applied Biosystems). Double-stranded oligonucleotides were prepared by mixing equimo-lar amounts of complementary oligonucleotides in TE (10mM Tris HCl, pH 7.5/1 mM EDTA), heating to 100'C, andslowly cooling to 22TC.

Cellular Transfection and Gene Activity Assays. NIH 3T3fibroblasts (American Type Culture Collection) were cul-tured in Dulbecco's modified Eagle's medium supplementedwith 10%o (vol/vol) calf serum and transfected by the calciumphosphate method (16). Cells were cotransfected with 10 ugof reporter construct, 10 ug of either HNF-1 or HoxD9plasmid, and 5 pg of an internal standard, (3-galactosidase(3-gal) gene expression plasmid CMV-13 (Promega), andharvested as described (5). To determine transfection effi-ciency, 10-pg aliquots of cell extract were assayed for 3-galactivity with the FluoReporter lacZ/galactosidase kit (Mo-lecular Probes). Levels of activity were measured with afluorometer (CytoFluor; Millipore). The volumes of the cellextracts used were adjusted to the activity of the 13galinternal standard. CAT assays were performed as described(17). Levels ofCAT activity were quantitated on a Phosphor-Imager (Molecular Dynamics).The chicken hepatocellular carcinoma-derived cell line

(LMH) (18) was cultured as described (9). For LMH cells,each transfection was performed with 32 td of Lipofectamine(GIBCO/BRL) and 8 pg of DNA per 10-cm culture dish inserum-free medium. After 5 hr. the media were replaced andthe cells were allowed to recover for 48 hr.EMSAs. Binding reactions for HoxD9-transfected cells

were performed with a 353-bp radiolabeled probe derived

S HNF-l M

Ti T2

HNF-1

TiHNF-I

M S

Probe 1: 353 bp

Probe 2: 28 bp

Competitor oligonucleotides:

HNF-1A: gagcttaat|GGTTAATCATTTAC aag

5: gccctgta t tccgcacgttaatgaaggcT1 I I _T2

HNF-1C: gagcttaat TTAATCATTTAC aag...

gccctgta-jttccgccacgttaatgaaggcl T1 II T2

FIG. 2. (Upper) Diagram of the L-CAM enhancer and probes forEMSA analysis derived from it. Positions of the HNF-1 site andTAAT motifs 1 and 2 (T1 and T2) are indicated. (The boxed HNF-1site is emphasized and is not drawn to scale.) (Lower) Oligonucle-otides used as competitors in EMSA reactions. Sequences of com-petitors designated A, B, and C are all derived from the chickenL-CAM gene enhancer. Only the nucleotides from the top strand ofthe double-stranded DNA are shown. Nucleotides corresponding tothe HNF-1 site are printed in uppercase letters and are boxed. TAATmotifs are underlined and palindromic TAAT motifs are indicatedwith arrows.

from the second intron of the L-CAM gene. This probe wasgenerated with the PCR using a 16-mer oligonucleotide(5'-CGGATAATTACAGGGC-3') end-labeled with[y-32P]ATP (6000 Ci/mmol; 1 Ci = 37 GBq) and T4 polynu-cleotide kinase (Boehringer Mannheim), with unlabeled 28-mer oligonucleotide (5'-GAGCTTAATGGTTAATCATT-TACCAAAG-3') as primers, and with 50 ng of the LPE1.3-CAT plasmid as template. This probe was purified byelectrophoresis on a 5% polyacrylamide gel. Binding reac-tions for HNF-1-transfected cells were performed with a28-bp double-stranded oligonucleotide. Complementary oli-gonucleotides with the sequence 5'-GAGCTTAATGGT-TAATCATTTACCAAAG-3' were annealed and purified byelectrophoresis through a native 6% polyacrylamide gel. ThisDNA was end-labeled with [y-32P]ATP and T4 polynucle-otide kinase. Protein extracts were prepared from eitherNIH3T3 cells or LMH cells transfected individually with pUC19vector DNA (mock), HoxD9, or HNF-1 expression vectorsas described (5). Protein concentration was determined bythe method of Bradford (19). Probe DNA fragment (40,000cpm) was incubated in a final volume of 20 ul with 6 pg ofprotein extract in 15 mM Tris*HC1, pH 7.5/0.7mM EDTA/10mM dithiothreitol/bovine serum albumin (1 mg/ml)/3 pi of 1M KCl/11,l of0.1 M phenylmethylsulfonyl fluoride/2.5 pg ofpoly[d(GC)] (Boehringer Mannheim)/4 pg of calf thymusDNA (Sigma)/200-fold excess of unlabeled competitor oh-gonucleotides. Binding reaction mixtures were incubated for30 min at room temperature and subjected to electrophoresison a 5% polyacrylamide gel for 1 hr at 220 V in 0.25x TBEbuffer. Gels were dried and exposed, and intensities ofDNA-protein complexes were quantitated on a PhosphorIm-ager.

Nuclear Run-On Assays. Nuclear run-on assays were per-formed on dissociated embryonic day 8 chicken liver cells orLMH cells with DNA probes for HNF-1, HoxD9, U6 smallnuclear RNA, and L-CAM as described (20). Liver nucleiwere isolated from livers dissected from embryonic day 8

A Reporter Constructs:

PromoterLP-CAT CATI

(0.63)

Promoter HNF-1

LPEI.3-CAT Mb

A I

[MbInuto K S

B Induction of CAT activity:

Transfected DNAReporterConstruct pUC19 HoxD9 HNF-1

Proc. Natl. Acad. Sci. USA 91 (1994)

Proc. Natl. Acad. Sci. USA 91 (1994) 7987

chicken embryos and resuspended in collagenase/trypsin at370C for 30 min. DNase I was added to 0.5 mg/ml and cellswere pelleted at 1000 x g for 2 min. Liver or LMH cells werelysed and the nuclei were isolated as described (20). Resultswere quantitated with a PhosphorImager.

RESULTSTo determine whether L-CAM gene expression is regulatedin vitro by homeoprotein expression, we selected two ho-meobox-containing genes (HoxD9 and HNF-1) and testedtheir effects on CAT expression from L-CAM promoter/enhancer CAT constructs when they were cotransfected inNIH 3T3 cells. HoxD9 (formerly designated Hox4.4) is amember of the abdominal B class of homeodomains and haspreviously been shown to be expressed in the viscera duringvertebrate development (21) where L-CAM expression isprominent. HNF-1 is expressed during cellular differentia-tion in the liver and belongs to the POU-homeodomain familyof transcription factors (14).We conducted transient cotransfection experiments in

NIH 3T3 cells with either the HoxD9 or HNF-1 expressionvectors and two different segments ofDNA from the chickenL-CAM gene driving expression ofa bacterial CAT gene (Fig.1A). The LP-CAT construct contained an Mbo I/Kpn Ifragment derived from the intergenic region between the K-and L-CAM genes and drove the promoterless CAT gene.This segment of DNA has been shown to have L-CAMpromoter activity when combined with the L-CAM enhancer(9). The LPE1.3-CAT construct contained the L-CAM pro-moter driving the CAT gene and a 1.3-kb segment from thesecond intron of the chicken L-CAM gene that was shown tohave cell-type-specific enhancer activity (9) when transfectedinto chicken LMH hepatoma cells, a line that expressesL-CAM. The 1.3-kb segment from the second intron containsa consensus binding site for the liver-enriched POU-homeo-domain protein HNF-1 (Fig. 1A).

All L-CAM gene/CAT reporter constructs gave low levelsof CAT activity after transfection in NIH 3T3 cells in theabsence of any cotransfected homeobox gene expressionplasmid. Cotransfection of NIH 3T3 cells with the L-CAMpromoter/enhancer construct LPE1.3-CAT together with theHoxD9 expression plasmid resulted in a 2.3-fold enhance-ment of CAT expression over levels observed from a similarHoxD9 cotransfection with the pCAT basic vector. Cotrans-fection of HoxD9 and the LP-CAT construct containing onlythe L-CAM promoter segments and not the enhancer showedno induction of CAT activity (Fig. 1B). These data suggestthat sequences in the L-CAM enhancer when combined withL-CAM promoter are sufficient for activation by HoxD9.

Cotransfection of the L-CAM promoter/enhancer con-struct with the HNF-1 expression vector also led to a 2.3-foldincrease in CAT activity over levels observed after cotrans-fection with the pCAT basic vector (Fig. 1B). As was the casewith expression of HoxD9, expression of HNF-1 showed nosignificant increase in CAT activity when transfected with theLP-CAT reporter. The data suggest that the L-CAM en-hancer and promoter can respond to transcriptional cuesresulting from expression of HoxD9 and HNF-1.Because transient transfection of NIH 3T3 cells with

expression vectors for HoxD9 and HNF-1 showed increasedCAT activity for reporter constructs containing the L-CAMenhancer, we tested the HNF-1 consensus sequence andother TAAT motifs present in the L-CAM enhancer for theability to bind extracts of NIH 3T3 cells transfected with theHoxD9 and HNF-1 constructs. In scanning through thecomplete sequence of the L-CAM enhancer, we found fourTAAT motifs that appeared to be putative homeodomainbinding sequences. All four are shown in Fig. 2. Two TAATmotifs are located either within or immediately adjacent to a

consensus binding sequence for HNF-1 (see Fig. 2, oligonu-cleotides A and C). The other two TAAT motifs are locatedapproximately 350 and 500 bp downstream of the HNF-1motif and are designated T1 and T2, respectively, in Fig. 2Upper. We tested all four TAAT motifs for their ability eitherto bind or to compete specifically for binding of proteinextracts prepared from cells transfected with the HoxD9 andHNF-1 expression vectors. As shown in Fig. 2, two different32P-labeled double-stranded DNA probes (Fig. 2 Upperprobes 1 and 2) were used in EMSAs with extracts from cellstransfected with HoxD9 or HNF-1 expression vectors. Probe1 was 353 bp long and contained the HNF-1 motif and thedownstream TAAT motif T1. Probe 2 was 28 bp long andincluded a short segment of DNA including the HNF-1 siteand sequences immediately adjacent to it (see Fig. 2, oligo-nucleotide A).When an EMSA was performed with probe 1 (Fig. 2) using

extracts prepared from NIH 3T3 cells transfected with theHoxD9 expression vector, a shifted complex was observed(see species indicated by arrow; Fig. 3A, lane 3). A minorshifted complex, which migrated at the same position in thegel, also appeared when extracts from mock-transfected cellswere used (Fig. 3A, lane 2), indicating that some endogenousproteins in NIH 3T3 cells also bound to the DNA sequencesin probe 1. Nevertheless, the signal arising from the shiftedcomplex using extracts from HoxD9-transfected cells was onthe average 3-fold more intense than that observed withextracts from mock-transfected cells (Fig. 3A, compare lane3 to lane 2).To locate specific DNA sequences in the enhancer that are

bound by proteins from HoxD9-transfected NIH 3T3 cells,excess amounts of three different unlabeled double-strandedoligonucleotides were used to compete for DNA-proteincomplex formation. Inclusion of a 200-fold molar excess of a28-bp competitor, oligonucleotide A (identical to probe 2),containing the HNF-1 consensus sequence and adjacentsequences from the L-CAM enhancer, routinely reduced by>95% the DNA-protein complex formed between probe 1and proteins from HoxD9-transfected cells (Fig. 3A, comparelane 4 to lane 3). A 200-fold molar excess of oligonucleotideC, a 60-bp sequence containing the HNF-1 site and the twoother TAAT motifs found in the L-CAM enhancer (T1 andT2), also competed effectively for binding of proteins fromHoxD9-transfected cells to probe 1 (Fig. 3A, compare lane 6to lane 3). However, the same molar excess of oligonucleo-tide B, which contained only the two downstream TAATmotifs T1 and T2 and not the HNF-1 site, failed to competefor binding (Fig. 3A, compare lane 5 to lane 3). These bindingand competition data suggest that the 28-bp segment from theL-CAM enhancer binds proteins from extracts prepared fromHoxD9-transfected cells, while the other L-CAM enhancerTAAT motifs T1 and T2 alone do not. Experiments usingprobe 2 in binding and competition reactions gave similarresults (data not shown), further supporting the notion thatthe 28-bp segment of the L-CAM enhancer containing theHNF-1 site binds to proteins from HoxD9-transfected NIH3T3 cells.To determine whether the HNF-1 site in the L-CAM

enhancer could bind to proteins from cells that normallyexpress L-CAM, we carried out EMSA analysis with theradiolabeled probe 2 (Fig. 2) on LMH cell extracts trans-fected with the HNF-1 expression vector. As shown in Fig.3B, the HNF-1 consensus site and surrounding sequencesfrom the L-CAM enhancer bound to extracts from LMH cellstransfected with the HNF-1 expression vector. Competitionfor this complex was also observed with oligonucleotides Aand C, which contain the HNF-1 consensus sequence (Fig.3B, compare lanes 4 and 6 to lane 3), but not with oligonu-cleotide B, which did not contain the HNF-1 sequence (Fig.3B, compare lane 5 to lane 3). The combined results from the

Developmental Biology: Goomer et al.

7988 Developmental Biology: Goomer et al.

ACompetitor

Oligonucleotides:- - -A B C B

*----- ConlpetrtimC-a LM)ligClcot]dit N

_ _ _ Aj b (- l )a A

1 2 3 4 5 6

N. NS.- HoxD9HNF I-wNF-

FIG. 3. EMSA analysis of protein extract components from either NIH 3T3 cells transfected with HoxD9 expression vector (A) or LMHcells transfected with HNF-1 expression vector (B). Binding reactions were performed with probe alone (mock; M) (lanes 1), protein extractfrom untransfected cells (N.E.) (lanes 2), or with nuclear extracts from cells transfected with either HoxD9 or HNF-1 (lanes 3-6).Oligonucleotides A, B, and C (see Fig. 2) derived from the enhancer sequences and used as specific competitors ofbinding reactions are indicatedover the appropriate lanes.

EMSA analyses suggest that a small region of the L-CAMenhancer containing an HNF-1 consensus binding site bindsto proteins from cells in which HoxD9 and HNF-1 productsare expressed.As already shown in Fig. 1, elevated CAT activity was

observed for L-CAM gene promoter/enhancer constructs inNIH 3T3 cells cotransfected with HoxD9 and HNF-1 ex-pression vectors. These cells do not synthesize L-CAM. Wewere therefore interested in determining whether HoxD9 andHNF-1 transcription factors could upregulate expression ofL-CAM RNA transcribed from the endogenous gene in acellular environment where the L-CAM gene is normallyexpressed. To accomplish this, we performed a series ofnuclear run-on transcription assays ofRNA from embryonicday 8 liver nuclei and nuclei prepared from LMH cells [a cellline previously shown to express L-CAM (9)]. A preliminaryscreening of chicken liver showed that RNAs for HoxD9 andHNF-1 homeodomain proteins and L-CAM were present(Fig. 4A). Nuclear transcripts from mock-transfected LMHcells showed moderate expression of L-CAM and lowerlevels of expression of both HNF-1 and HoxD9 (Fig. 4 B andC). Transfection of LMH cells with the HoxD9 expressionvector resulted in a 33-fold increase in HoxD9 RNA and a4-fold increase in the level of L-CAM RNA (Fig. 4B).Transfection ofLMH cells with the HNF-1 expression vectorresulted in an 8.3-fold increase in HNF-1 RNA and a 4-foldincrease in L-CAM RNA. These data suggest that expression

A LiverNuclei:

Hcx D9

HNF-

L-CAM

U6

B Transfected DNA:

puiCb19 HcxD9

Probe U6

Hex D9 a

-CAM * _

of both HoxD9 and HNF-1 can stimulate transcription of theendogenous L-CAM RNA in the LMH cells that normallyexpress the L-CAM gene.

DISCUSSIONOne of the most striking features of immunoglobulin-relatedCAMs and cadherins is their place-dependent expression insequences that are characteristic for each adhesion moleculewithin and between tissues during development (1). Thepresence or absence of different combinations of CAMs onindividual cells determines whether these cells will migrate orlink to form collectives and epithelia in an embryonic region.The control of place-dependent CAM expression is thereforea major factor in morphoregulation (22). Although genes donot contain explicit information on a single cell's position, ananalysis of homeobox-containing genes indicates that theyhave a key role in determining anteroposterior patterning andregional patterns of cellular differentiation (23). Relatingtranscriptional control by homeodomain proteins to CAMexpression would therefore provide one basis for relatinggene patterning to the mechanochemical control of celladhesion (22, 24).

In our previous studies (5, 25), we provided evidence thatpromoter sequences of N-CAM were regulated in vitro byHoxB9, -B8, and -C6. We also showed that the activitydepended on two closely spaced regions of the proximal

C ronsfecled DNA

rJ:Y'HFINF-

Probe HNF-:'.

'-CAM

'l6

FIG. 4. Nuclear run-on transcription assays of nuclei prepared from embryonic day 8 liver (A) or LMH cells transfected with pUC19 DNA(mock) and either HoxD9 (B) or HNF-1 (C) expression vectors. Nuclear transcripts labeled with [32P]UTP were hybridized to slot blots containingcDNA probes for U6, HoxD9, HNF-1, and L-CAM genes. Filters were washed at high stringency, and the levels of hybridization werequantitated on a Phosphorlmager.

Proc. Natl. Acad. Sci. USA 91 (1994)

Proc. Natl. Acad. Sci. USA 91 (1994) 7989

N-CAM gene promoter called HBS-I and HBS-II (homeo-domain binding sites). Using EMSAs (5), we showed thatnuclear extracts of cells transfected with HoxC6 had com-ponents that bound to HBS-I. Furthermore, purified homeo-domain proteins bound to the HBS sequences (5). Thesestudies raised the possibility that certain CAMs of the im-munoglobulin superfamily may owe their place-dependentexpression in part to control by homeodomain products.To determine whether a cadherin might be similarly regu-

lated, we chose in the present study to analyze the chickenL-CAM promoter and enhancer. This choice was madebecause L-CAM plays a key role in liver morphogenesis andin the formation of epithelia (3, 6). Moreover, the enhancerregion of the L-CAM gene contains a sequence (9) corre-sponding to a key homeodomain binding element, HNF-1;this sequence may be important for L-CAM expressionduring the differentiation ofliver cells. The data show that theL-CAM enhancer can respond to cues from both HoxD9, anearly expressed homeobox gene of the Hox family of selectorgenes, and HNF-1, a POU-homeodomain protein expressedlater in development during liver differentiation. Moreover,nuclear extracts from cells in which these homeodomainproteins are expressed bind to a region of the L-CAMenhancer that contains the HNF-1 site. While the EMSAshowed that some of the sequences of the L-CAM enhancerare specifically involved in binding components of the nu-clear extract, the actual homeodomain proteins occupyingthese sites remain to be identified. Moreover, site-specificmutagenesis of the binding site must be performed in order toconfirm that the HNF-1 consensus sequence is bound di-rectly by these nuclear proteins.To extend these results obtained initially in NIH 3T3 cells,

it was important to search for stimulation of the synthesis ofL-CAM in cells that normally make this protein. LMH cellswere selected for this analysis not only because they endog-enously express L-CAM (9), but also because they werelikely to contain supplemental transcription factors contrib-uting to this expression. Both HoxD9 and HNF-1 increasedthe amount of L-CAM RNA transcribed in LMH cellstransfected with constructs that express these genes. Eval-uation of such nuclear run-on transcription experimentsrequired careful normalization to a standard gene marker.The marker used, U6, is an RNA polymerase III transcript(26), while our test mRNAs were RNA polymerase II tran-scripts. The suitability of U6 as a marker gene depends on theassumption that expression of this gene is not altered by thehomeodomain proteins used in our study. Although the levelsof U6 remained fairly constant within any one experiment,the remote possibility should be borne in mind that transcrip-tion of U6 could be influenced by homeobox gene transcrip-tion. Normalization to the U6 marker does not account fortransfection efficiency. Therefore, the -fold induction ofL-CAM transcription by HoxD9 and HNF-1 would be likelyto vary depending on how many cells within the populationare actively expressing these homeobox genes. In the LMHrun-on experiments, we routinely observed a 10-20% trans-fection efficiency. The overall amount of induction ofL-CAM transcription by either HoxD9 or HNF-1 would beexpected to increase with increasing transfection efficien-cies. We have observed, for example, that the level ofinduction of L-CAM transcription correlated well with thelevel of HoxD9 RNA in our experiments. Given these ob-servations, our values for the amount of induction ofL-CAMtranscription by HoxD9 and HNF-1 may be underestimates.

In our previous studies, we provided evidence for thepossible regulation of N-CAM gene expression by ho-meobox-containing genes (5, 25). We have also recently

shown that Pax gene products bind to and regulate theactivity of the N-CAM promoter (27). The present studyshows that the gene ofaCa2I-dependent CAM, L-CAM, mayalso be a target of a number of homeodomain proteins. Whilethe present experiments provide a good initial model for thecontrol of L-CAM expression, experiments must also beperformed in vivo in order to determine whether the HNF-1site plays a role in place-dependent expression of this CAMduring embryogenesis.

The authors are grateful to Ms. Madhavi Pondugula and Mr. BrettFenson for excellent technical assistance, Drs. Vincent Mauro andKathryn Crossin for helpful comments on the manuscript, and Ms.Julie Sonntag for help in preparation of the manuscript. This workwas supported by U.S. Public Health Service Grant AG09326 toG.M.E.

1. Edelman, G. M. & Crossin, K. L. (1991) Annu. Rev. Biochem.60, 155-190.

2. Thiery, J.-P., Delouvde, A., Gallin, W. J., Cunningham, B. A.& Edelman, G. M. (1984) Dev. Biol. 102, 61-78.

3. Crossin, K. L., Chuong, C.-M. & Edelman, G. M. (1985) Proc.Nat!. Acad. Sci. USA 82, 6942-6946.

4. Jones, F. S., Prediger, E. A., Bittner, D. A., De Robertis,E. M. & Edelman, G. M. (1992) Proc. Natl. Acad. Sci. USA 89,2086-2090.

5. Jones, F. S., Holst, B. D., Minowa, O., De Robertis, E. M. &Edelman, G. M. (1993) Proc. Nat!. Acad. Sci. USA 90, 6557-6561.

6. Gallin, W. J., Edelman, G. M. & Cunningham, B. A. (1983)Proc. Natl. Acad. Sci. USA 80, 1038-1042.

7. Napolitano, E. W., Venstrom, K., Wheeler, E. F. & Rei-chardt, L. F. (1991) J. Cell Biol. 113, 893-905.

8. Sorkin, B. C., Gallin, W. J., Edelman, G. M. & Cunningham,B. A. (1991) Proc. Nat!. Acad. Sci. USA 88, 11545-11549.

9. Sorkin, B. C., Jones, F. S., Cunningham, B. A. & Edelman,G. M. (1993) Proc. Nat!. Acad. Sci. USA 90, 11356-11360.

10. Begemann, M., Tan, S.-S., Cunningham, B. A. & Edelman,G. M. (1990) Proc. Nat!. Acad. Sci. USA 87, 9042-9046.

11. Zappavigna, V., Renucci, A., Izpisua-Belmonte, J.-C., Urier,G., Peschle, C. & Duboule, D. (1991) EMBOJ. 10, 4177-4187.

12. Green, S., Issemann, I. & Sheer, E. (1988) Nucleic Acids Res.16, 369-373.

13. Kuo, C. J., Conhey, P. B., Hsieh, C., Franke, W. & Crabtree,G. R. (1990) Proc. Natl. Acad. Sci. USA 87, 9838-9842.

14. Mendel, D. B. & Crabtree, G. R. (1991) J. Biol. Chem. 266,677-680.

15. Maniatis, T., Fritsch, E. F. & Sambrook, J. (1989) MolecularCloning: A Laboratory Manual (Cold Spring Harbor Lab.Press, Plainview, NY).

16. Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D. &Seidman, J. G., eds. (1989) Current Protocols in MolecularBiology (Wiley, New York).

17. Gorman, C. M., Moffat, L. F. & Howard, B. H. (1982) Mol.Cell. Biol. 2, 1044-1051.

18. Kawaguchi, T., Nomura, K., Hirayama, Y. & Kitagawa, T.(1987) Cancer Res. 47, 4460-4464.

19. Bradford, M. M. (1976) Anal. Biochem. 72, 248-254.20. Mauro, V. P., Wood, I. C., Krushel, L., Crossin, K. L. &

Edelman, G. M. (1994) Proc. Natl. Acad. Sci. USA 91, 2868-2872.

21. DoIld, P., Izpisua-Belmonte, J.-C., Boncinelli, E. & Duboule,D. (1991) Mech. Dev. 36, 3-13.

22. Edelman, G. M. (1992) Dev. Dynam. 193, 2-10.23. McGinnis, W. & Krumlauf, R. (1992) Cell 68, 283-302.24. Edelman, G. M. & Jones, F. S. (1993) J. Biol. Chem. 268,

20683-20686.25. Jones, F. S., Chalepakis, G., Gruss, P. & Edelman, G. M.

(1992) Proc. Nat!. Acad. Sci. USA 89, 2091-2095.26. Kunkel, G. R., Maser, R. L., Calvet, J. P. & Pederson, T.

(1986) Proc. Nat!. Acad. Sci. USA 83, 8575-8579.27. Holst, B. D., Goomer, R. S., Wood, I. C., Edelman, G. M. &

Jones, F. S. (1994) J. Biol. Chem., in press.

Developmental Biology: Goorner et al.