Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time...
-
Upload
georgina-willis -
Category
Documents
-
view
215 -
download
0
Transcript of Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time...
![Page 1: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.](https://reader031.fdocuments.in/reader031/viewer/2022033107/56649e0c5503460f94af5b6f/html5/thumbnails/1.jpg)
Recombinant DNA Technology
![Page 2: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.](https://reader031.fdocuments.in/reader031/viewer/2022033107/56649e0c5503460f94af5b6f/html5/thumbnails/2.jpg)
Further Historical Perspective
Geneticists have known for a long time how to isolate DNA from cells.
Geneticists have known for a long time how to chop DNA into small pieces.
What geneticists did not know how to do until the early 1970s was to replicate small fragments of DNA.
![Page 3: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.](https://reader031.fdocuments.in/reader031/viewer/2022033107/56649e0c5503460f94af5b6f/html5/thumbnails/3.jpg)
1970s Breakthrough
• The discovery of the restriction enzyme
(or restriction endonuclease).
![Page 4: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.](https://reader031.fdocuments.in/reader031/viewer/2022033107/56649e0c5503460f94af5b6f/html5/thumbnails/4.jpg)
Properties of RE
• Cut double-stranded DNA at specific target sites.
• Allow fragments of DNA that have been cut with the same RE to be rejoined.
![Page 5: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.](https://reader031.fdocuments.in/reader031/viewer/2022033107/56649e0c5503460f94af5b6f/html5/thumbnails/5.jpg)
![Page 6: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.](https://reader031.fdocuments.in/reader031/viewer/2022033107/56649e0c5503460f94af5b6f/html5/thumbnails/6.jpg)
AnimationAnimation
• Recombinant DNA_Animation_1
• Recombinant DNA_Animation_2
![Page 7: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.](https://reader031.fdocuments.in/reader031/viewer/2022033107/56649e0c5503460f94af5b6f/html5/thumbnails/7.jpg)
The joining of two DNA fragments by DNA ligase produces a recombinant DNA molecule
![Page 8: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.](https://reader031.fdocuments.in/reader031/viewer/2022033107/56649e0c5503460f94af5b6f/html5/thumbnails/8.jpg)
![Page 9: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.](https://reader031.fdocuments.in/reader031/viewer/2022033107/56649e0c5503460f94af5b6f/html5/thumbnails/9.jpg)
![Page 10: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.](https://reader031.fdocuments.in/reader031/viewer/2022033107/56649e0c5503460f94af5b6f/html5/thumbnails/10.jpg)
![Page 11: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.](https://reader031.fdocuments.in/reader031/viewer/2022033107/56649e0c5503460f94af5b6f/html5/thumbnails/11.jpg)
![Page 12: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.](https://reader031.fdocuments.in/reader031/viewer/2022033107/56649e0c5503460f94af5b6f/html5/thumbnails/12.jpg)
Therefore, eukaryotic DNA could be propagated in prokaryotic cells.
A great breakthrough!!!!!
•
![Page 13: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.](https://reader031.fdocuments.in/reader031/viewer/2022033107/56649e0c5503460f94af5b6f/html5/thumbnails/13.jpg)
Carriers of foreign DNA are Vectors:
• Most carriers are
• 1. Plasmids
• 2. Bacteriophages (viruses)
![Page 14: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.](https://reader031.fdocuments.in/reader031/viewer/2022033107/56649e0c5503460f94af5b6f/html5/thumbnails/14.jpg)
• A bacteriophage is a virus that
infects a bacteria.
![Page 15: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.](https://reader031.fdocuments.in/reader031/viewer/2022033107/56649e0c5503460f94af5b6f/html5/thumbnails/15.jpg)
![Page 16: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.](https://reader031.fdocuments.in/reader031/viewer/2022033107/56649e0c5503460f94af5b6f/html5/thumbnails/16.jpg)
Introduction to PCR• PCR (polymerase chain reaction)
• PCR is a means to enhance/replicate the amount of DNA collected (in vitro)
* p r c
![Page 17: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.](https://reader031.fdocuments.in/reader031/viewer/2022033107/56649e0c5503460f94af5b6f/html5/thumbnails/17.jpg)
PCR Creates more DNA for Study
• PCR Animation
![Page 18: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.](https://reader031.fdocuments.in/reader031/viewer/2022033107/56649e0c5503460f94af5b6f/html5/thumbnails/18.jpg)
DNA Replication Review:
• Add DNA polymerase, all 4 DNA building blocks ???
5’ CTGACGCTGCTGCATGCTAGCT 3’
3’ GACTACGACGACGTACGATCGA 5’
![Page 19: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.](https://reader031.fdocuments.in/reader031/viewer/2022033107/56649e0c5503460f94af5b6f/html5/thumbnails/19.jpg)
DNA Replication Review:
• Primers are required:
5’ CTGACGCTGCTGCATGCTAGCT 3’
CGA 5’
5’ CTG
3’ GACTACGACGACGTACGATCGA 5’
![Page 20: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.](https://reader031.fdocuments.in/reader031/viewer/2022033107/56649e0c5503460f94af5b6f/html5/thumbnails/20.jpg)
DNA Replication Review:
• Primers are required:
5’ CTGACGCTGCTGCATGCTAGCT 3’
. . . t a c g a t CGA 5’
5’ CTG a t g c t g . . . .
3’ GACTACGACGACGTACGATCGA 5’
![Page 21: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.](https://reader031.fdocuments.in/reader031/viewer/2022033107/56649e0c5503460f94af5b6f/html5/thumbnails/21.jpg)
![Page 22: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.](https://reader031.fdocuments.in/reader031/viewer/2022033107/56649e0c5503460f94af5b6f/html5/thumbnails/22.jpg)
![Page 23: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.](https://reader031.fdocuments.in/reader031/viewer/2022033107/56649e0c5503460f94af5b6f/html5/thumbnails/23.jpg)
![Page 24: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.](https://reader031.fdocuments.in/reader031/viewer/2022033107/56649e0c5503460f94af5b6f/html5/thumbnails/24.jpg)
![Page 25: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.](https://reader031.fdocuments.in/reader031/viewer/2022033107/56649e0c5503460f94af5b6f/html5/thumbnails/25.jpg)
Introduction to Agarose Gel Electrophoresis
![Page 26: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.](https://reader031.fdocuments.in/reader031/viewer/2022033107/56649e0c5503460f94af5b6f/html5/thumbnails/26.jpg)
Weigh out ~ a gram of agarose.
![Page 27: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.](https://reader031.fdocuments.in/reader031/viewer/2022033107/56649e0c5503460f94af5b6f/html5/thumbnails/27.jpg)
• Mix the agarose with 50- 100 ml of buffer.
![Page 28: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.](https://reader031.fdocuments.in/reader031/viewer/2022033107/56649e0c5503460f94af5b6f/html5/thumbnails/28.jpg)
• Heat to dissolve the agarose.
![Page 29: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.](https://reader031.fdocuments.in/reader031/viewer/2022033107/56649e0c5503460f94af5b6f/html5/thumbnails/29.jpg)
• Assemble the gel tray and comb.
![Page 30: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.](https://reader031.fdocuments.in/reader031/viewer/2022033107/56649e0c5503460f94af5b6f/html5/thumbnails/30.jpg)
Pour the gel.
![Page 31: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.](https://reader031.fdocuments.in/reader031/viewer/2022033107/56649e0c5503460f94af5b6f/html5/thumbnails/31.jpg)
• Pick up the DNA sample with a micro-pipettor.
![Page 32: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.](https://reader031.fdocuments.in/reader031/viewer/2022033107/56649e0c5503460f94af5b6f/html5/thumbnails/32.jpg)
• Load one DNA sample into each well on the gel.
![Page 33: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.](https://reader031.fdocuments.in/reader031/viewer/2022033107/56649e0c5503460f94af5b6f/html5/thumbnails/33.jpg)
Connect the gel to a low voltage power supply.
![Page 34: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.](https://reader031.fdocuments.in/reader031/viewer/2022033107/56649e0c5503460f94af5b6f/html5/thumbnails/34.jpg)
After completion of the run, add a DNA staining material and visualize the DNA
under UV light.
![Page 35: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.](https://reader031.fdocuments.in/reader031/viewer/2022033107/56649e0c5503460f94af5b6f/html5/thumbnails/35.jpg)
• Analyze the results.
![Page 36: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.](https://reader031.fdocuments.in/reader031/viewer/2022033107/56649e0c5503460f94af5b6f/html5/thumbnails/36.jpg)
![Page 37: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.](https://reader031.fdocuments.in/reader031/viewer/2022033107/56649e0c5503460f94af5b6f/html5/thumbnails/37.jpg)
• Gel Electrophoresis – demonstration
• Ensure you’re plugged into the web ;)
![Page 38: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.](https://reader031.fdocuments.in/reader031/viewer/2022033107/56649e0c5503460f94af5b6f/html5/thumbnails/38.jpg)
• Electrophoresis Demo 1 – flash simulation
• Electrophoresis Demo 2 – java applet
• You need to be hooked to the web for these to work ;)