Crystal structure of the binary complex of ribulose-1, 5-bisphosphate ...
Real Time RT PCR. Broad and Long Term Objective To characterize the expression of ribulose 1-5...
-
date post
19-Dec-2015 -
Category
Documents
-
view
213 -
download
0
Transcript of Real Time RT PCR. Broad and Long Term Objective To characterize the expression of ribulose 1-5...
![Page 1: Real Time RT PCR. Broad and Long Term Objective To characterize the expression of ribulose 1-5 bisphosphate carboxylase oxygenase and chlorophyll AB binding.](https://reader038.fdocuments.in/reader038/viewer/2022110322/56649d395503460f94a12951/html5/thumbnails/1.jpg)
Real Time RT PCR Real Time RT PCR
![Page 2: Real Time RT PCR. Broad and Long Term Objective To characterize the expression of ribulose 1-5 bisphosphate carboxylase oxygenase and chlorophyll AB binding.](https://reader038.fdocuments.in/reader038/viewer/2022110322/56649d395503460f94a12951/html5/thumbnails/2.jpg)
Broad and Long Term ObjectiveBroad and Long Term Objective
To characterize the expression of ribulose 1-5 bisphosphate To characterize the expression of ribulose 1-5 bisphosphate
carboxylase oxygenase and chlorophyll AB binding gene in carboxylase oxygenase and chlorophyll AB binding gene in Lycopersicon esculentumLycopersicon esculentum (Tomato) leaves subjected to either 48 or (Tomato) leaves subjected to either 48 or 72 hours in the dark as compared to the expression in leaves grown 72 hours in the dark as compared to the expression in leaves grown under normal 12 hr light/dark cycle and harvested at noon.under normal 12 hr light/dark cycle and harvested at noon.
![Page 3: Real Time RT PCR. Broad and Long Term Objective To characterize the expression of ribulose 1-5 bisphosphate carboxylase oxygenase and chlorophyll AB binding.](https://reader038.fdocuments.in/reader038/viewer/2022110322/56649d395503460f94a12951/html5/thumbnails/3.jpg)
Research PlanResearch Plan
RNA Isolation leaf material grown in light and in the dark
RNA Electrophoresis and cDNA synthesis
Assessing Gene Expression
Northern Blot
RNase Protection
Quantitative PCR
Quantitative real time RT PCR
![Page 4: Real Time RT PCR. Broad and Long Term Objective To characterize the expression of ribulose 1-5 bisphosphate carboxylase oxygenase and chlorophyll AB binding.](https://reader038.fdocuments.in/reader038/viewer/2022110322/56649d395503460f94a12951/html5/thumbnails/4.jpg)
Electrophoresis of RNA and cDNAElectrophoresis of RNA and cDNA
Intact High Quality RNA Characterized by:Intact High Quality RNA Characterized by: Two prominent rRNA BandsTwo prominent rRNA Bands Slight smear of various sized mRNA molecules in backgroundSlight smear of various sized mRNA molecules in background When isolating RNA from leaf material, may see plastid rRNA bandsWhen isolating RNA from leaf material, may see plastid rRNA bandscDNA Synthesis Products Characterized by:cDNA Synthesis Products Characterized by: A smear of many different sizee transcripts between .5-3.0 KbA smear of many different sizee transcripts between .5-3.0 Kb
![Page 5: Real Time RT PCR. Broad and Long Term Objective To characterize the expression of ribulose 1-5 bisphosphate carboxylase oxygenase and chlorophyll AB binding.](https://reader038.fdocuments.in/reader038/viewer/2022110322/56649d395503460f94a12951/html5/thumbnails/5.jpg)
Today’s Laboratory ObjectivesToday’s Laboratory Objectives
To understand the theoretical basis behind primer design for real time To understand the theoretical basis behind primer design for real time RT-PCR analysisRT-PCR analysis
To become familiar with the manner in which a real time RT PCR experiment To become familiar with the manner in which a real time RT PCR experiment is set up and the data is collectedis set up and the data is collected
![Page 6: Real Time RT PCR. Broad and Long Term Objective To characterize the expression of ribulose 1-5 bisphosphate carboxylase oxygenase and chlorophyll AB binding.](https://reader038.fdocuments.in/reader038/viewer/2022110322/56649d395503460f94a12951/html5/thumbnails/6.jpg)
Primer Design Primer Design
Primer Design ParametersPrimer Design Parameters►Targets an amplicon length of 75 to 150 bp►50 to 60% GC content►Limit secondary structure►Limit stretch of G or C’s longer than 3 bases►No stable interaction between forward and reverse primers ►Place C’s and G’s on ends of primers (no more than 2 inlast 5 bases on 3’ end)►Melting Temperature (Tm) above 50 °C (70-72° C)►Verify specificity
![Page 7: Real Time RT PCR. Broad and Long Term Objective To characterize the expression of ribulose 1-5 bisphosphate carboxylase oxygenase and chlorophyll AB binding.](https://reader038.fdocuments.in/reader038/viewer/2022110322/56649d395503460f94a12951/html5/thumbnails/7.jpg)
Experimental DesignExperimental Design
Relative ExpressionRelative Expression► Samples: 1) cDNA derived from RNA from leaves at 48 or 72 hour in darkSamples: 1) cDNA derived from RNA from leaves at 48 or 72 hour in dark
2) cDNA derived from RNA from leaves harvested at 12 noon2) cDNA derived from RNA from leaves harvested at 12 noon
3) no template control 3) no template control ► Each experimental sample assayed in triplicate Each experimental sample assayed in triplicate ► No template controls assayed in duplicateNo template controls assayed in duplicate► Total of 8 samples/groupTotal of 8 samples/group
► Dilute cDNA 1/100Dilute cDNA 1/100► Prepare a Master Mix for 9 RxnsPrepare a Master Mix for 9 Rxns
Reaction MixcDNA (diluted 1:100) 5.0 μl Sybr Green Super Mix 7.1 μl x 9 = 63.9 ulPrimer A (20 μM) 0.3 μl x 9 = 2.7 ulPrimer B (20 μM) 0.3 μl x 9 = 2.7 uldH2O 12.3 μl x 9 = 110.7 ultotal volume per reaction 25 μl x 9=
![Page 8: Real Time RT PCR. Broad and Long Term Objective To characterize the expression of ribulose 1-5 bisphosphate carboxylase oxygenase and chlorophyll AB binding.](https://reader038.fdocuments.in/reader038/viewer/2022110322/56649d395503460f94a12951/html5/thumbnails/8.jpg)
Plate Set UpPlate Set Up
A1Tiffany/ShinobuLight
A2 Light
A3Light
A4Dark
A5Dark
A6Dark
A7NT
A8NT
A9 Max/KittyLight
A10Light
A11Light
A12Dark
B1Jack/SeanLight
B2Light
B3Light
B4Dark
B5Dark
B6Dark
B7NT
B8NT
B9Dark
B10Dark
B11NT
B12NT
C1Robyn/Cricket
C2Light
C3Light
C4Dark
C5Dark
C6Dark
C7NT
C8NT
C9AshleyAdnan
C10Light
C11Light
C12Dark
D1Thao/TramLight
D2Light
D3Light
D4Dark
D5Dark
D6Dark
D7NT
D8NT
D9Dark
D10Dark
D11NT
D12NT
E1Sandy/Beads
E2Light
E3Light
E4Dark
E5Dark
E6Dark
E7NT
E8NT
E9EEKLight
E10Light
E11Light
E12Dark
F1OBE/Chris
F2Light
F3Light
F4Dark
F5Dark
F6Dark
F7NT
F8NT
F9Dark
F10Dark
F11NT
F12NT
G1Damon/Phoenix
G2Light
G3Light
G4Dark
G5Dark
G6Dark
G7NT
G8NT
G9 G10 G11 G12
H1CourtneyAmanda
H2Light
H3Light
H4Dark
H5Dark
H6Dark
H7Dark
H8NT
H9 H1024 D&P
H1124 D&P
H1224 D&P
![Page 9: Real Time RT PCR. Broad and Long Term Objective To characterize the expression of ribulose 1-5 bisphosphate carboxylase oxygenase and chlorophyll AB binding.](https://reader038.fdocuments.in/reader038/viewer/2022110322/56649d395503460f94a12951/html5/thumbnails/9.jpg)
1 aaaaatgaaa aactcgtcag aaagaaaaag caaaagcaac aaaaaaattg caagtatttt 61 ttaaaaaaga aaaaaaaaac atatcttgtt tgtcagtatg ggaagtttga gataaggacg 121 agtgaggggt taaaattcag tggccattga ttttgtaatg ccaagaacca caaaatccaa 181 tggttaccat tcctgtaaga tgaggtttgc taactctttt tgtccgttag ataggaagcc 241 ttatcactat atatacaagg cgtcctaata acctcttagt aaccaattat ttcagcaatg 301 gcttcttcag taatgtcctc agcagctgtt gccacccgcg gcaatggtgc acaagctagc 361 atggttgcac ccttcactgg actcaagtcc accgcttctt tccctgtttc aaggaagcaa 421 aaccttgaca ttacctccat tgctagcaac ggtggaagag tcagttgcat gcaggtttgt 481 gtgtgtatat atatatacgt acaacaaaat tcattgacta taatgttata ctcgattagc 541 taatttaact atttataatt gtataggtgt ggccaccaat taacatgaag aagtacgaga 601 ctctgtcgta ccttcctgat ttgtccgacg agcaattgct cagcgaaatt gagtacctat 661 tgaaaaatgg atgggttcct tgcttggaat tcgagactga ggtcaacatc tatctcctct 721 gtttttaaaa tttactagct agtatgttga tatgtcgtgt taacagtgtt gtgggatatc 781 atgtgcagca cggatttgtg taccgtgaga accataagtc accaggatac tacgatggca 841 gatactggac catgtggaag ttgcccatgt tcgggtgcac tgatgcaacc caggtcttgg 901 ctgaggtgca ggaggcaaag aaggcttacc cacaggcatg ggtccgtatc atcggattcg 961 acaatgttcg tcaagtgcag tgcatcagtt tcatcgctta caagcccgaa ggatactaaa 1021 tgtgtatatg tcaacagtga gaaactgttc gcattttccg ttttgcttct ttctttctat 1081 tcaatgtatg ttgttggatt ccagttgaat ttattatgag aactaataat aatagtaata 1141 atcatttgtt tctttactaa tttgcatttt cacatatgat ttctggtgca tatcataatt 1201 ttcattccac caatattaat ttccccattc aagttactta tgaaatagaa atcctcttct 1261 ccgactactt tatttgtccg aaagtcttgt ggctgctata taacgcaaaa tggatagaga 1321 agattcatta ctaagccgat c
RubisCO Small Subunit accession #X05986
Coding Sequence
![Page 10: Real Time RT PCR. Broad and Long Term Objective To characterize the expression of ribulose 1-5 bisphosphate carboxylase oxygenase and chlorophyll AB binding.](https://reader038.fdocuments.in/reader038/viewer/2022110322/56649d395503460f94a12951/html5/thumbnails/10.jpg)
RubisCO Primer SetsRubisCO Primer Sets
Start Length Tm %G+C Seq
Primer Set A
Left Primer 276 20 60.69 45 AAATGGATGGGTTCCTTGCT
Right Primer 422 20 59.58 50 AAGACCTGGGTTGCATCAGT
Product Size: 147
Primer Set B:
Left Primer 216 22 59.87 50 GTCGTACCTTCCTGATTTGTCC
Right Primer 375 20 59.96 55 GGTCCAGTATCTGCCATCGT
Product Size: 160
![Page 11: Real Time RT PCR. Broad and Long Term Objective To characterize the expression of ribulose 1-5 bisphosphate carboxylase oxygenase and chlorophyll AB binding.](https://reader038.fdocuments.in/reader038/viewer/2022110322/56649d395503460f94a12951/html5/thumbnails/11.jpg)
Chlorophyll A/B Binding Protein (CAB-1b) Accession # M14443 Chlorophyll A/B Binding Protein (CAB-1b) Accession # M14443 Coding Sequence Coding Sequence
1 atgaagaagt tgatggatta tagattgcca agtgtgctac acatgggatc ttgataccca1 atgaagaagt tgatggatta tagattgcca agtgtgctac acatgggatc ttgataccca 61 atgagatcat acatatagat atcacttgat aagatgattc tctctctttt ctcctatata 61 atgagatcat acatatagat atcacttgat aagatgattc tctctctttt ctcctatata
121 121 ttctcaaccc caactaactt catcttcatc acccatcaaa cacttaattc ttctctt acccatcaaa cacttaattc ttctcttaaa 181 ataaacacaa atggcagctg ctacaatggc tctttcttcc ccttcatttg ctggacaggc 181 ataaacacaa atggcagctg ctacaatggc tctttcttcc ccttcatttg ctggacaggc 241 agtc241 agtcaaactc tcaccatctg cctcagaaat ttctggaaat ggaaggatca ctatgagaaa gaaat ttctggaaat ggaaggatca ctatgagaaa 301 ggctgttgcc aagtccgccc catctagcag cccatggtat ggccctgacc gtgttaagta 301 ggctgttgcc aagtccgccc catctagcag cccatggtat ggccctgacc gtgttaagta 361 cttgggccca ttctctggtg agtccccaag ctacttgacc ggtgaa361 cttgggccca ttctctggtg agtccccaag ctacttgacc ggtgaatttc ctggtgatta 421 421 cgggtgggat accgctggac tttcagcaga ccctgaaact tttgccaaga accgtgaact ggat accgctggac tttcagcaga ccctgaaact tttgccaaga accgtgaact 481 tgaagtgatc cactgcagat gggctatgct tggtgctctt ggatgtgtct tccctgagct 481 tgaagtgatc cactgcagat gggctatgct tggtgctctt ggatgtgtct tccctgagct 541 cttggcccgt aatggtgtca agttcggtga ggctgtgtgg ttcaaggccg gatcccagat 541 cttggcccgt aatggtgtca agttcggtga ggctgtgtgg ttcaaggccg gatcccagat 601 cttcagtgaa ggtggacttg actacttggg caacccaagc ttggtccatg cacaaagcat 601 cttcagtgaa ggtggacttg actacttggg caacccaagc ttggtccatg cacaaagcat 661 cttggccatc tgggcttgcc aagttgtgtt gatgggagct gttgagggtt accgtattgc 661 cttggccatc tgggcttgcc aagttgtgtt gatgggagct gttgagggtt accgtattgc 721 tggtggacct cttggtgagg ttgtcgaccc actctaccct ggtggcagct tcgacccatt 721 tggtggacct cttggtgagg ttgtcgaccc actctaccct ggtggcagct tcgacccatt 781 aggccttgct gaagacccag aggcatttgc tgagctcaag gtaaaggaga tcaagaacgg 781 aggccttgct gaagacccag aggcatttgc tgagctcaag gtaaaggaga tcaagaacgg 841 tagacttgct atgttctcta tgtttggatt ctttgttcaa gctattgtca ccggaaaggg 841 tagacttgct atgttctcta tgtttggatt ctttgttcaa gctattgtca ccggaaaggg 901 tccattggag aaccttgctg atcaccttgc agaccccgta aacaacaatg cctgggcttt 901 tccattggag aaccttgctg atcaccttgc agaccccgta aacaacaatg cctgggcttt 961 cgccacaaac tttgtccccg gaaaatgact ctaaacgtct caagtcttgg tcgtttgatg961 cgccacaaac tttgtccccg gaaaatgact ctaaacgtct caagtcttgg tcgtttgatg
1021 acagtgtaaa gatgtagtgt gctacctgac aatataatga aattttgttt gtgtttgaat1021 acagtgtaaa gatgtagtgt gctacctgac aatataatga aattttgttt gtgtttgaat 1081 ggcttttctg tactgagttt cattttccca agtcaactca taaatcaagc actaacaatg1081 ggcttttctg tactgagttt cattttccca agtcaactca taaatcaagc actaacaatg 1141 atacaacaaa atgacccctc acatatgagt aataactaga aaaactgcaa tgctatgttg1141 atacaacaaa atgacccctc acatatgagt aataactaga aaaactgcaa tgctatgttg 1201 taaggttgaa cttgaatttt caactagagc agtttattta atttaatgaa ttc1201 taaggttgaa cttgaatttt caactagagc agtttattta atttaatgaa ttc
![Page 12: Real Time RT PCR. Broad and Long Term Objective To characterize the expression of ribulose 1-5 bisphosphate carboxylase oxygenase and chlorophyll AB binding.](https://reader038.fdocuments.in/reader038/viewer/2022110322/56649d395503460f94a12951/html5/thumbnails/12.jpg)
Chlorophyll A/B Binding Protein Chlorophyll A/B Binding Protein Primer SetPrimer Set
Start Length Tm %G+C Seq
Primer Set A
Left Primer 55 21 59.86 47.62 AAACTCTCAACCATCTGCCTCA
Right Primer 236 20 60.74 50 CACCCGTAATCACCAGGA
Product Size: 147
![Page 13: Real Time RT PCR. Broad and Long Term Objective To characterize the expression of ribulose 1-5 bisphosphate carboxylase oxygenase and chlorophyll AB binding.](https://reader038.fdocuments.in/reader038/viewer/2022110322/56649d395503460f94a12951/html5/thumbnails/13.jpg)
Real Time RT PCR
Sample---RNA Isolation---cDNA Synthesis---RT PCR Amplification
Real Time PCR Work Flow
![Page 14: Real Time RT PCR. Broad and Long Term Objective To characterize the expression of ribulose 1-5 bisphosphate carboxylase oxygenase and chlorophyll AB binding.](https://reader038.fdocuments.in/reader038/viewer/2022110322/56649d395503460f94a12951/html5/thumbnails/14.jpg)
Real Time RT PCR Cycling Real Time RT PCR Cycling ParametersParameters
Polymerase activationPolymerase activation 95° C 95° C 10 min10 min40 cycles40 cyclesDenaturationDenaturation 95° C 95° C 60 sec60 secPrimer AnnealingPrimer Annealing 60° C 60° C 30 sec30 secExtensionExtension 7272˚ C˚ C 45 sec45 sec
Melt CurvesMelt CurvesDenaturationDenaturation 95° C 95° C 1 min1 minRenaturationRenaturation 55° C 55° C 1 min1 minDenaturationDenaturation Ramp 0.5° C every 10 secRamp 0.5° C every 10 sec
![Page 15: Real Time RT PCR. Broad and Long Term Objective To characterize the expression of ribulose 1-5 bisphosphate carboxylase oxygenase and chlorophyll AB binding.](https://reader038.fdocuments.in/reader038/viewer/2022110322/56649d395503460f94a12951/html5/thumbnails/15.jpg)
Defining Parameters ofDefining Parameters ofReal Time RT PCRReal Time RT PCR
Cycle Threshold: Cycle # when product fluoresence exceeds that of background
Fold Change: 2ΔCt
Melt Curve: fluorescence plotted as a function of temperature as thermal cycler heats through dissociate temperature of product
![Page 16: Real Time RT PCR. Broad and Long Term Objective To characterize the expression of ribulose 1-5 bisphosphate carboxylase oxygenase and chlorophyll AB binding.](https://reader038.fdocuments.in/reader038/viewer/2022110322/56649d395503460f94a12951/html5/thumbnails/16.jpg)
Presentation of Real Presentation of Real Time RT PCR DataTime RT PCR Data
What to includeWhat to include::► Melt CurveMelt Curve► Raw Quantitative GraphRaw Quantitative Graph► Histogram of Relative Fold ChangeHistogram of Relative Fold Change
![Page 17: Real Time RT PCR. Broad and Long Term Objective To characterize the expression of ribulose 1-5 bisphosphate carboxylase oxygenase and chlorophyll AB binding.](https://reader038.fdocuments.in/reader038/viewer/2022110322/56649d395503460f94a12951/html5/thumbnails/17.jpg)
Next Lab Dec 5thNext Lab Dec 5th
Real Time RT PCR Data Analysis using Real Time RT PCR Data Analysis using ICycler SoftwareICycler Software