(R388) Multiple Activities of TraG (RP4) and TrwB Systems ...

10.1128/JB.185.15.4371-4381.2003.

2003, 185(15):4371. DOI:J. Bacteriol. Gunnar Schröder and Erich Lanka (R388)Multiple Activities of TraG (RP4) and TrwBSystems: Functional Dissection of the TraG-Like Proteins of Type IV Secretion

http://jb.asm.org/content/185/15/4371Updated information and services can be found at:

These include:

REFERENCEShttp://jb.asm.org/content/185/15/4371#ref-list-1This article cites 43 articles, 25 of which can be accessed free at:

CONTENT ALERTS more»cite this article),

Receive: RSS Feeds, eTOCs, free email alerts (when new articles

http://journals.asm.org/site/misc/reprints.xhtmlInformation about commercial reprint orders: http://journals.asm.org/site/subscriptions/To subscribe to to another ASM Journal go to:

on February 21, 2013 by P

EN

N S

TA

TE

UN

IVhttp://jb.asm

.org/D

ownloaded from

http://jb.asm.org/cgi/alerts

http://jb.asm.org/

JOURNAL OF BACTERIOLOGY, Aug. 2003, p. 4371–4381 Vol. 185, No. 150021-9193/03/$08.00�0 DOI: 10.1128/JB.185.15.4371–4381.2003Copyright © 2003, American Society for Microbiology. All Rights Reserved.

TraG-Like Proteins of Type IV Secretion Systems: FunctionalDissection of the Multiple Activities of TraG (RP4)

and TrwB (R388)Gunnar Schroder and Erich Lanka*

Max-Planck-Institut fur Molekulare Genetik, Abteilung Lehrach, Dahlem, D-14195 Berlin, Germany

Received 4 April 2003/Accepted 30 April 2003

TraG-like proteins are essential components of type IV secretion systems. During secretion, TraG is thoughtto translocate defined substrates through the inner cell membrane. The energy for this transport is presumablydelivered by its potential nucleotide hydrolase (NTPase) activity. TraG of conjugative plasmid RP4 is amembrane-anchored oligomer that binds RP4 relaxase and DNA. TrwB (R388) is a hexameric TraG-likeprotein that binds ATP. Both proteins, however, lack NTPase activity under in vitro conditions. We charac-terized derivatives of TraG and TrwB truncated by the N-terminal membrane anchor (TraG�2 and TrwB�1)and/or containing a point mutation at the putative nucleotide-binding site (TraG�2K187T and TraGK187T).Unlike TraG and TrwB, truncated derivatives behaved as monomers without the tendency to form oligomersor aggregates. Surface plasmon resonance analysis with immobilized relaxase showed that mutant TraGK187Twas as good a binding partner as the wild-type protein, whereas truncated TraG monomers were unable to bindrelaxase. TraG�2 and TrwB�1 bound ATP and, with similar affinity, ADP. Binding of ATP and ADP wasstrongly inhibited by the presence of Mg2� or single-stranded DNA and was competed for by other nucleotides.Compared to the activity of TraG�2, the ATP- and ADP-binding activity of the point mutation derivativeTraG�2K187T was significantly reduced. Each TraG derivative bound DNA with an affinity similar to that ofthe native protein. DNA binding was inhibited or competed for by ATP, ADP, and, most prominently, Mg2�.Thus, both nucleotide binding and DNA binding were sensitive to Mg2� and were competitive with respect toeach other.

Type IV secretion is an energy-driven mechanism for deliv-ery of effector molecules from bacterial donors to recipientcells. It mediates the transfer of toxic components into eukary-otic hosts by many pathogenic bacteria such as Helicobacterpylori, Legionella pneumophila, Brucella spp., and Bartonellahenselae and enables DNA transfer in bacterial conjugationsystems such as that encoded by plasmid RP4.

A set of genes is conserved among type IV secretion systems(T4SS). Most of these genes are responsible for the formationof a membrane-spanning protein complex and for biosynthesisof a pilus (8). In bacterial conjugation systems the pilus acts asa sex pilus that is required for initial attachment to recipientcells, followed by mating pair formation and DNA transfer(45). An additional component conserved among T4SS is theTraG-like protein (coupling protein). TraG is a putative nu-cleoside triphosphatase (NTPase) that may serve as the activemotor for secretion. It forms a membrane-anchored oligomer(1, 22, 38), which binds to DNA nonspecifically (27, 29, 38) andis involved in recognition of the substrate to be secreted (10,38). In the case of the conjugative plasmid RP4, this substrateconsists of the plasmid-encoded protein relaxase (TraI) that iscovalently attached to the linearized transfer DNA strand ofthe plasmid (32). The cytoplasmic domain of the TraG-likeprotein of plasmid R388, TrwB�N70, has a hexameric pore-

like structure that probably extends into the membrane (13),indicating that TraG-like proteins may serve as a gate throughthe inner membrane. In vitro studies with purified TraG-likeproteins TrwB (R388), TraG (RP4), TraD (F), and HP0524(H. pylori) failed to confirm the postulated NTPase activity (27,38). However, it was demonstrated that TrwB binds ATP (16,27).

In the present work, the nucleotide-binding properties ofTraG and TrwB were studied in detail and the multiple activ-ities of TraG and TrwB were dissected structurally and func-tionally. To this end, deletion mutation and point mutationderivatives were purified and biochemically characterized.Apart from binding DNA and ATP, the cytoplasmic domainsof TraG and of TrwB were also found to bind ADP. DNAbinding and nucleotide binding were competitive with eachother and were both inhibited by Mg2�. Other nucleotides(GTP, CTP, UTP, and dTTP) were shown to be effective incompeting for ATP binding. A point mutation at conservedresidue K187 of the proposed P-loop motif (Walker A motif)of TraG caused a significant decrease in nucleotide-bindingability. Removal of the membrane anchor of TraG and TrwBprevented oligomerization or aggregation. Furthermore, theaffinity of TraG for relaxase (TraI) was lost.

MATERIALS AND METHODS

Bacterial strains, plasmids, and media. Escherichia coli strains SCS1 (Strat-agene), HB101 (5) and HB101 Nxr (spontaneously nalidixic acid resistant deriv-ative of HB101) were grown in YT medium (25) buffered with 25 mM 3(N-morpholino)propanesulfonic acid (MOPS) (pH 8.0). When appropriate,antibiotics were added as follows: ampicillin (sodium salt, 100 �g/ml), chloram-

* Corresponding author. Mailing address: Max-Planck-Institut furMolekulare Genetik, Abteilung Lehrach, Ihnestraße 73, Dahlem,D-14195 Berlin, Germany. Phone: 49 30 8413 1696. Fax: 49 30 84131130. E-mail: [email protected].

4371


EN

N S

TA

TE

UN

IVhttp://jb.asm

.org/D

ownloaded from

http://jb.asm.org/

phenicol (10 �g/ml), nalidixic acid (30 �g/ml), and tetracycline (hydrochloride,10 �g/ml). Plasmids are listed in Table 1.

Reagents. The following reagents were obtained from the suppliers indicated:Ni-nitrilotriacetic acid (NTA) Superflow (Qiagen), Superdex 200 columns andradioactive nucleotides (Amersham Pharmacia Biotech), nucleotides (RocheMolecular Biochemicals or Sigma), 2�,3�-O-(2,4,6-trinitrophenyl)ATP, disodiumsalt (TNP-ATP) and TNP-ADP (Molecular Probes), adenosine-5�-(�-thio)-triphosphate, sodium salt (ATP�S) and adenosine-5-[(�,�)-imido]triphosphate,triethylammonium salt (AppNp) (Jena Bioscience), enzymes (New England Bio-labs), and Brij 58 and Triton X-100 (Sigma).

Buffers. The following buffers were used: buffer A (100 mM Tris-HCl [pH 7.6],40 mM NaCl, 8% [wt/vol] sucrose, 0.4 mg of lysozyme/ml, 0.15% Brij 58), bufferB (100 mM Tris-HCl [pH 7.6], 100 mM NaCl, 0.25% Brij 58), buffer C (50 mMKH2PO4–K2HPO4 [pH 8.0], 300 mM NaCl, 1 mM dithiothreitol [DTT]), bufferD (50 mM Tris–H3PO4 [pH 7.0], 40 mM NaCl, 1 mM DTT), buffer E (40 mMTris-HCl [pH 7.6], 50 mM NaCl, 1 mM DTT, 0.1 mM EDTA), buffer F (50 mMTris-HCl [pH 7.6], 500 mM NaCl, 1 mM DTT, 0.1 mM EDTA, 10% [wt/vol]glycerol, 0.01% Brij 58), buffer G (20 mM Tris-HCl [pH 7.6], 10 mM NaCl, 1 mMDTT, 0.05% Brij 58, 50 �g of bovine serum albumin [BSA]/ml), and buffer H (40mM Tris-HCl [pH 8.7]–20 mM NaCl).

DNA techniques. Standard molecular cloning techniques were performed asdescribed previously (36). pGS002, a vector for construction and overexpressionof His6-tagged genes, was generated as follows. pMS470�8 was digested withNdeI, and the resulting 5� overhangs were removed by using mung bean nuclease.The plasmid was then digested with HindIII and ligated with a His6 linker, whichwas prepared by annealing of oligonucleotides CATGCACCATCACCATCACCATATGGGCATGCA and AAGCTTGCATGCCCATATGGTGATGGTGATGGTGCATG. pGS003�1 was constructed by insertion of an NdeI/NsiI/BclI/HindIII/SacI linker (annealed oligonucleotides TATGCATCCGTCTGATCAAGCTTGTCCATGAGCTCATCACCATCACCATCACTGAT and AGCTATCAGTGATGGTGATGGTGATGAGCTCATGGACAAGCTTGATCAGACGGATGCA) into pMS470�8 (NdeI/HindIII). This was followed by deletion of an18-bp EcoRI-SmaI fragment by consecutive restriction, removal of 5� overhangs(using mung bean nuclease), and religation. RP4 traG deletion derivatives his6-traG�1 and his6-traG�2 in pGS006�1 and pGS006�2 were generated by PCRusing pSK470 as a template. Forward primers were CGTTCGAGCATATGAC

CGCGACGCAATATTTCGCCC and GCCGTCACGCATATGGTCAAGGC(nucleotides corresponding to the RP4 sequence are italicized, deviations fromthe original sequence are boldfaced, and the introduced NdeI site is underlined),and the reverse primer in both reactions was CTGTTTTATCAGACCGCTTCTGCG. pFS241M was generated by PCR with pBS140(K187T) (2) as the tem-plate and primers GCATTCCCATATGCACCATCACCATCACCATAAGAACCGAAACAACG and GCCTACGAAGCTTGGTGAGGCGCTGGAAGC.pGS007 was prepared by ligation of a 1,617-bp NsiI fragment of pSU4054 (4)into pGS003�1. The R388 trwB deletion derivative his6-trwB�1 in pGS012�1was generated by PCR with pGS007 as the template, primer GTTGTTTGTCTGGCATATGAATAGCGTCG (nucleotides corresponding to the R388 se-quence are italicized), and the same reverse primer as that used forpGS006�1. PCR fragments were generated with DeepVent DNA polymerase(New England Biolabs). Nucleotide sequences of PCR fragments were veri-fied.

Conjugations. Mating experiments to determine transfer frequencies of RP4-mediated conjugation were carried out on filters (2). HB101 cells carryingpDB127 (TraG�) plus pSK470 (TraG�), pGS006�1 (His6-TraG�1�), orpGS006�2 (his6-traG�2�) served as donors, and HB101 Nxr was used as arecipient.

Protein purification. For overproduction, broth cultures of the indicated E.coli strains were grown at 30°C. Isopropyl-�-D-thiogalactopyranoside (IPTG)-mediated induction of expression and harvesting, resuspension, and freezing ofcells were performed as described previously (19). Further steps were carried outat 4°C or on ice unless otherwise noted. RP4 His6-TraG and TraI were purifiedas described previously (30, 38). His6-TraGK187T was purified fromSCS1(pFS241M) in analogy to His6-TraG. His6-TraG�2 was purified as follows.SCS1(pGS006�2) cells (19.7 g, resuspended in 100 ml of 200 mM Tris [pH7.6]–20 mM spermidine-HCl–2 mM EDTA) were thawed, supplemented with200 ml of buffer A, and stirred for 90 min at room temperature. After centrif-ugation at 100,000 � g for 45 min, the supernatant was kept and the pellet wasresuspended in 100 ml of buffer B by using a Dounce homogenizer. The suspen-sion was centrifuged as before, and the supernatants of the two centrifugationsteps were combined. Proteins were precipitated by addition of 147 g of(NH4)2SO4 (60% saturation), collected by centrifugation at 25,000 � g for 30min, and resuspended in 35 ml of buffer C (fraction I, 35 ml). Fraction I was

TABLE 1. Plasmids used in this study

Plasmid Description Relevant phenotype Selectivemarker(s)a Reference

pBR329 Cloning vector; Ptac lacIq Ap, Cm, Tc 9pDB127 pDB126�[RP4 SfiI-SspI 48374–46670]b (TrbB-TrbM)� (TraF-TraM)� TraG� Cm 2pFS241M pMS470�8�[NdeI-HindIII][his6 RP4

48495–46588 (T47936G)]cHis6-TraGK187T� Ap This work

pGS002 pMS470�8�[NdeI-HindIII][his6linker]

Ap This work

pGS003�1 pMS470�8�[EcoRI-SmaI;NdeI-HindIII][NdeI/NsiI/BclI/HindIII/SacI linker]

Ap This work

pGS006�1 pGS002�[NdeI-HindIII][RP4 48387–46588]

His6-TraG�1� Ap This work

pGS006�2 pGS002�[NdeI-HindIII][RP4 48201–46588]

His6-TraG�2� Ap This work

pGS007 pGS003�1[NsiI-NsiI R388 16–1638]d TrwB� Ap This workpGS011 pGS006�2�[SfiI-SfiI][pFS241M SfiI-

SfiI 1467-bp fragment]His6-TraG�2K187T� Ap This work

pGS012�1 pGS002�[NdeI-HindIII][R388 229–1638]

His6-TrwB�1� Ap This work

pJF143 pBR329[BamHI, BamHI-XmaIIIlinker, RP4 XmaIII-AccI 50995–51269, AccI-BamHI linker]

OriT� Ap, Cm 11

pMS119EH Cloning vector; Ptac lacIq Ap 40pMS470�8 Cloning vector; phage T7 gene10 SD

sequence; Ptac lacIqAp 3

pSK470 pMS470�8�[NdeI-HindIII][RP448,495–46.588 kb]

TraG� Ap 38

a Ap, ampicillin; Cm, chloramphenicol; Tc, tetracycline.b RP4 base pair coordinates of inserted fragments are given according to accession no. L27758 (31).c his6 sequence CAC CAT CAC CAT CAC CAT.d R388 base pair coordinates of inserted fragments are given according to accession no. X63150 (24).

4372 SCHRODER AND LANKA J. BACTERIOL.


EN

N S

TA

TE

UN

IVhttp://jb.asm

.org/D

ownloaded from

http://jb.asm.org/

dialyzed against buffer C and applied to a Ni-NTA column. The column waswashed with buffer C alone and with buffer C containing 10% (vol/vol) glyceroland 20 mM imidazole (pH 7.6). Proteins were eluted with buffer C containing250 mM imidazole (pH 7.6). Fractions containing His6-TraG�2 were pooled(fraction II, 97 ml), dialyzed against buffer D, and applied to a phosphocelluloseP11 column. Adsorbed proteins were eluted with a linear gradient (40 to 600 mMNaCl) in buffer D. His6-TraG�2-containing fractions were pooled and concen-trated by dialysis against buffer E containing 20% (wt/vol) polyethylene glycol20000 (fraction III, 17.5 ml). His6-TraG�2K187T was purified fromSCS1(pGS011) by following the protocol used for TraG�2, starting with 19.1 gof cells in 100 ml of buffer. Purification of His6-TrwB�1 from SCS1(pGS012�1)was done similarly with 16.4 g of cells in 80 ml of buffer, except that the NaClconcentration in buffer A and buffer B was 1 M. Protein purity and concentra-tions were determined by laser densitometric quantification of Coomassie blue(Serva)-stained gels with serial concentrations of BSA as a reference, by usingthe Personal Densitometer scanning device (Amersham Biosciences) and Im-ageQuant software (version 5.0). The identity of TraG derivatives was confirmedby Western blot analysis with a TraG-specific antiserum (46). Purified proteinswere stored at �20°C in buffer E containing 50% (wt/vol) glycerol.

Gel filtration. A Superdex 200 HR 10/30 column was calibrated with a gelfiltration standard (Bio-Rad) consisting of four globular proteins of 670, 158, 44,and 17 kDa and vitamin B12 (1.4 kDa). The column was run with buffer F at aflow rate of 0.4 ml/min. Protein elution was monitored at a of 280 nm. TraG,TraG�2, and TrwB�1 were subjected to gel filtration under the same conditions.A trend line correlating the elution volumes of the gel filtration standards to thecorresponding Mrs was used to obtain estimates of the Mrs of TraG, TraG�2, andTrwB�1.

Fragment retardation assay. A 773-bp AccI-AvaI DNA fragment of pBR329(Table 1) was 5� labeled with [�-32P]ATP by using T4 polynucleotide kinase.Thirty-six femtomoles of the labeled fragment was incubated for 30 min at 37°Cwith different amounts of TraG�2 (1 to 5 pmol) or TrwB�1 (0.5 to 3 pmol) in atotal volume of 20 �l of buffer G. Samples were electrophoresed on nondena-turing polyacrylamide gels as described previously (47). The 32P-labeled DNAwas visualized by the storage phosphor technology and analyzed with Image-Quant software (Molecular Dynamics). Complex formation between protein andDNA was determined by monitoring the decrease in the amount of free DNA.The amount of free DNA in each lane was quantified with reference to theamount of free DNA present in the absence of protein. Competition or inhibitionof DNA binding by single-stranded DNA (ssDNA), Mg2�, ATP, or ADP wasanalyzed by quantifying the displacement of bound double-stranded DNA(dsDNA) fragments from dsDNA-protein complexes. Seventy-five femtomolesof 32P-labeled DNA fragments obtained by DraI/AccI restriction of pJF143(Table 1) was incubated as before with 10 pmol of TraG�2 or 3 pmol of TrwB�1.After 10 min, MgCl2, ATP, ADP, or ssDNA was added as appropriate, andmixtures were incubated for another 20 min at 37°C and electrophoresed asbefore. The bound and free DNA fragments were visualized and quantified asbefore, and the fraction of free DNA versus total DNA was calculated todetermine the percentage of complex resolution.

Transmission electron microscopy. dsDNA (25 fmol of pJF143 digested withEcoRI and BamHI) and/or ssDNA (25 fmol of M13 mp18) was incubated for 10min at room temperature with TraG or TraG�2 (0.48 pmol each). Followingfixation with 0.2% (wt/vol) glutaraldehyde for 10 min, the samples were preparedfor electron microscopy (with a Philips EM400) by adsorption to mica as de-scribed previously (39).

Nucleotide binding. The fluorescent nucleotide analogues TNP-ATP andTNP-ADP were used to study nucleotide-binding. Proteins and nucleotides werediluted in buffer H in a total volume of 400 �l. Final concentrations of NaCl wereadjusted to 36 mM (for TraG�2 and TraG�2K187T) or 50 mM (for TrwB�1).Mixtures were incubated for 20 s before measurement. Fluorescence spectrawere taken at room temperature by using a Shimadzu RF-5000 spectrofluorom-eter with excitation at 410 nm and emission scanning in the range of 470 to 620nm. The fluorescence maxima were determined graphically. For determinationof Kd, 7 �M protein solutions were titrated with TNP-ATP or TNP-ADP. The Kd

values of unlabeled ATP and ADP, as well as the inhibition constant of Mg2�,were determined by displacement of protein-bound TNP-nucleotides. Seven-micromolar protein solutions were incubated for 20 s with 50 �M TNP-ATP or70 �M TNP-ADP (50 �M TNP-ADP in the case of TrwB�1). ATP, ADP, orMgCl2 (from 0.5 or 0.1 M stock solutions in buffer H) was added, and fluores-cence was measured after incubation for 20 s.

Enhanced fluorescence (�F) was calculated as the difference between totalfluorescence (Ft) and the intrinsic fluorescence of TNP-nucleotides (TNP-N),buffer, and proteins:

�F � Ft � FTNP-N � Fbuffer � Fprotein (1)

�F represents the amount of receptor-ligand complexes (RL) that are formedthroughout the titration. �F reaches a maximum (�Fmax) as the receptor be-comes saturated, i.e., when RL equals the total receptor concentration (Rt):

�F � �Fmax � RL/Rt (2)

RL/Rt represents the fractional saturation of the receptor. Replacement of RL byan expression that relates RL, Rt, ligand (L), and Kd and takes ligand depletioninto account (17) results in equation 3:

�F � �Fmax � ��Rt � L � Kd � ��Rt � L � Kd�2 � 4RtL 1/2�/2Rt (3)

Displacement of TNP-nucleotides by unlabeled nucleotides or by Mg2� is de-scribed by equation 4:

�F � �Fmax � ��Fmax � �Fmin� � ��Rt � L � IC50� � ��Rt � L � IC50�2

� 4RtL�1/2 �/2Rt (4)

�Fmax and �Fmin are the fluorescences at the start and at the end of titration,respectively, and L is the concentration of the competitor (ATP, ADP, or Mg2�).IC50 represents the concentration of the competitor necessary to displace 50% ofbound TNP-nucleotides. It is related to the inhibition constant (Ki) of thecompetitor (6) as follows:

Ki � IC50/�1 � �Lt/KdTNP-N� (5)

Lt is the total concentration of the TNP-nucleotide at the start of titration, andKd

TNP-N is the dissociation constant of the respective TNP-nucleotide. In thecase of displacement by ATP or ADP, Ki corresponds to Kd

ATP or KdADP,

respectively. The coefficients of independent values in equations 3 and 4 werefitted to the data by using Sigma Plot (version 2.0, copyright 1986 to 1994; JandelCorp.).

Protein interaction analysis by surface plasmon resonance (SPR). Interac-tions between TraI and either TraG, TraGK187T, or TraG�2 were studied byusing the Biacore 2000 optical biosensor system (Biacore AB, Uppsala, Sweden)with a B1 pioneer sensor chip as described previously (38). The chip was loadedwith 480 response units (RU) of BSA (FC2), 498 RU of TraI (FC3), and 460 RUof TraG�2 (FC4). Dilutions were made in HBS-EP buffer (Biacore AB). Forreal-time analysis of interaction with the immobilized proteins, 100 nM solutionsof TraGK187T or TraG�2 were injected into the chip (FC1, -2, -3, and -4).Signals were corrected for nonspecific binding by subtracting curves for BSAinteraction from each curve. Binding constants were determined with the BIAe-valuation software (version 3.1, copyright 1994 to 1999, Biacore AB), by applyingthe Langmuir binding model for computational fitting.

RESULTS

The N-terminal membrane anchor of RP4 TraG is essentialfor conjugative transfer. His-tagged (His6) deletion derivativesTraG�1 and TraG�2, lacking the first 36 or the first 102residues of TraG, respectively, were constructed (Fig. 1).TraG�1 lacks the short cytoplasmic N terminus and the first oftwo transmembrane domains of TraG. In TraG�2, theperiplasmic domain and the second transmembrane domainare additionally removed. The corresponding plasmids encod-ing TraG�1 and TraG�2 (Table 1) were unable to restore thetransfer activity in complementation experiments with pDB127(�traG). In contrast, both full-length TraG and His6-TraGwere effective in complementing pDB127 (38). We concludethat membrane anchorage of TraG is required for transferactivity.

Truncated derivatives of RP4 TraG and R388 TrwB withincreased solubility were purified. TraG derivatives TraG�1and TraG�2 were overproduced and assayed for solubility.Under native conditions, by use of the mild nonionic detergentBrij 58 or Triton X-100, TraG�1 remained insoluble. In con-trast, TraG�2 proved to be highly soluble and therefore wasselected for purification. The crude extract, containing 42%

VOL. 185, 2003 FUNCTIONAL DISSECTION OF TraG AND TrwB 4373


EN

N S

TA

TE

UN

IVhttp://jb.asm

.org/D

ownloaded from

http://jb.asm.org/

TraG�2, was purified by successive Ni-NTA affinity and phos-phocellulose P11 chromatography, yielding a TraG�2 prepa-ration of 85% purity (Table 2). TraG�2K187T, containing amutation in the putative nucleotide-binding domain 1 (NBD1)(Fig. 1), was purified similarly (Fig. 2). R388 TrwB�1 is iden-tical to TrwB�N70, whose purification has been described pre-viously (27), except that TrwB�1 carries an N-terminal His6

tag. TrwB�1 was also purified by consecutive Ni-NTA andphosphocellulose P11 chromatography, yielding a TrwB�1preparation of 97% purity (Fig. 2).

Removal of the membrane anchor of TraG suppresses ag-gregation and results in loss of relaxase-binding ability. Upongel filtration, TraG behaves as a large oligomer or aggregateand solubilized TrwB forms a mixture of monomers and hex-amers (16, 38). In contrast, the truncated derivatives TraG�2and TrwB�1, which were characterized in the present study,behaved strictly as monomers in solution (Table 3). Aggregatesof full-length TraG were also visualized by electron microscopyof TraG-DNA complexes (Fig. 3). When TraG�2 was analyzed

analogously, however, no aggregates were seen and the proteinwas altogether invisible. Probably a single monomer ofTraG�2 was too small to be detected by electron microscopy.Our results indicate that the membrane anchors of TraG andTrwB contain a domain responsible for protein-protein inter-actions that lead to protein oligomerization or aggregation invitro. Interactions of TraG derivatives with RP4 relaxase(TraI) were measured with the optical biosensor system Bia-core 2000, which uses SPR technology. TraI, TraG�2, andBSA (used as a reference) were immobilized on sensor chipsurfaces, and real-time interactions with TraG derivatives weremonitored (Fig. 4). TraGK187T interacted with TraI to thesame extent as had previously been observed for wild-type

FIG. 1. Properties of deletion derivatives of RP4 TraG lackingtransmembrane segments. A hydophobicity profile (21) of TraG de-picts the hydrophobic regions of the protein. The domain structures ofTraG and derivatives TraG�1 and TraG�2 are schematically repre-sented. The transfer activity of each protein is indicated as positive (�)or negative (�). Cytoplasmic domains (open boxes), transmembranesegments (TM1 and TM2) (solid boxes), a periplasmic domain(hatched box), and two nucleotide-binding domains (NBD1 andNBD2) (shaded boxes) are indicated. The sequence of the conservedWalker motif A in NBD1 is given below the diagram, with residueK187 boldfaced. The numbers indicating amino acid (AA) positions atthe start of the proteins are the positions relative to the full-lengthprotein.

FIG. 2. Truncated derivatives of RP4 TraG and R388 TrwB werepurified in two steps. Shown are Coomassie blue-stained gels of sam-ples collected during the purification of TraG�2K187T (A) andTrwB�1 (B), resolved by sodium dodecyl sulfate-polyacrylamide gelelectrophoresis. Lanes 1, marker proteins (sizes in kilodaltons areindicated). Lanes 2, sodium dodecyl sulfate whole-cell extracts (20 �g).Lanes 3 to 5, samples of native protein extracts. Lanes 3, fraction I (17�g); lanes 4, fraction II (9 �g in panel A and 7 �g in panel B); lanes5, fraction III (7 �g).

TABLE 2. Purification of TraG�2, TraG�2K187T, and TrwB�1

Protein Fraction Purification step Total protein (mg) Yield (%)a Purity (%)b

TraG�2 I Crude extract 645 100 42II Ni-NTA 315 80 69III Phosphocellulose P11 98 31 85

TraG�2K187T I Crude extract 753 100 30II Ni-NTA 344 94 62III Phosphocellulose P11 107 38 80

TrwB�1 I Crude extract 715 100 44II Ni-NTA 264 81 97III Phosphocellulose P11 261 80 97

a Based on yield of first fraction of TraG�2, TraG�2K187T, or TrwB�1.b Laser densitometric evaluation of Coomassie blue-stained gels.



EN

N S

TA

TE

UN

IVhttp://jb.asm

.org/D

ownloaded from

http://jb.asm.org/

TraG (38). As before, association occurred rapidly (ka � 105

M�1) and dissociation was slow (Kd � 10�4 s�1). In contrast,derivatives TraG�2 and TraG�2K187T did not interact withTraI (shown for TraG�2 in Fig. 4B). Thus, relaxase binding ofTraG occurred independently of the nucleotide-binding signa-ture at residue K187 but did require the membrane anchor ofTraG. Interaction of full-length TraG with TraG�2 was weakand barely detectable (shown for TraGK187T in Fig. 4A).Also, TraG�2 self-interactions were absent (Fig. 4B). Thesedata are in line with the previous observation that, unlikefull-length TraG, TraG�2 is a monomer in solution.

TraG�2 and TrwB�1 bind ATP and ADP. TraG�2 andTrwB�1 were assayed for nucleotide binding by studying the

binding of the fluorescent ATP and ADP derivatives TNP-ATP and TNP-ADP. Binding of TNP-nucleotides causes anincrease in fluorescence (enhanced fluorescence), a phenom-enon that has been widely used to characterize the nucleotide-binding abilities of proteins (20). Fluorescence enhancementemerges from the changes in polarity in the near environmentof the TNP moiety upon binding (14, 26). TraG�2 andTrwB�1 produced significant fluorescence enhancement ofTNP-ATP and TNP-ADP (Fig. 5). The fluorescence increasewas coupled with a blue shift of the fluorescence maximumfrom 542 to 528 nm, suggesting that the TNP-nucleotides bindto a hydrophobic region of the protein (15). Competition ex-periments confirmed that nucleotide binding was specific, sinceaddition of an unlabeled nucleotide to TNP-nucleotide-proteincomplexes considerably reduced the fluorescence (Fig. 5; com-pare curves 3 with curves 4). In control experiments withoutprotein, TNP-nucleotide fluorescence remained unchangedwhen either the buffer contained in the used protein solutionsor unlabeled nucleotides were added (data not shown).

Kds for the binding of TNP-ATP and TNP-ADP were de-termined by titrating 7 �M solutions of TraG�2 and TrwB�1with TNP-nucleotides until saturation was observed (shown forTraG�2 in Fig. 6A and B). Saturation of the proteins by TNP-nucleotides is well described by a function that relates fluores-

FIG. 3. Removal of the membrane anchor of TraG suppresses its oligomerization. Shown are electron microscopic images of full-length TraG(A and B) or TraG�2 (C and D) preparations. The proteins were incubated either with ssDNA alone (A and C) or with a 1:1 mixture of ssDNAand dsDNA (B and D) prior to fixation and adsorption to mica. Solid arrowheads, ssDNA molecules; open arrowheads, dsDNA molecules. Largeprotein oligomers bound to ssDNA were present in TraG preparations (indicated by solid arrows) but absent in TraG�2 preparations.

TABLE 3. Oligomeric states of TraG, TraG�2, and TrwB�1

ProteinCalculated Mr

(103) of themonomera

Mr (103) evaluated by: Deducedoligomeric stateSDS-PAGEb Gel filtration

TraG 70.8 71.2 �1,300c �18c

TraG�2 59.7 59.3 50–60 1TrwB�1 49.57 47.3 27–33 1

a Calculated from the predicted amino acid sequence.b SDS-PAGE, sodium dodecyl sulfate-polyacrylamide gel electrophoresis.c Equivalent to a higher-order oligomer or aggregate.



EN

N S

TA

TE

UN

IVhttp://jb.asm

.org/D

ownloaded from

http://jb.asm.org/

cence enhancement (�F) with total TNP-nucleotide concen-tration, total protein concentration, Kd, and the maximumfluorescence enhancement (equation 3 in Materials and Meth-ods). Computationally fitted Kds for TNP-ATP and TNP-ADPbinding of TraG�2 and TrwB�1 were in the 4 to 5 �M range(Table 4).

Binding of TNP-nucleotides has often been observed to bestronger than binding of unlabeled nucleotides. This can beattributed to hydrophobic interactions between the TNP moi-ety and the protein that should further stabilize complexes,provided that nucleotide binding itself is not disturbed. Inorder to determine the true Kds of ATP and ADP, the dis-placement of bound TNP-nucleotides by unlabeled nucleotideswas quantified. Titration of TNP-nucleotide-saturated TraG�2or TrwB�1 with an excess of the respective nucleotide causeda progressive decrease in fluorescence (shown for TraG�2 inFig. 6C and D). Computational fitting determined the concen-tration of ATP or ADP that caused 50% dissociation of theTNP-nucleotide-protein complex (IC50), which, in combina-tion with the Kd of TNP-nucleotide binding, provided the Kd

for ATP or ADP binding (Table 4). The Kd of nucleotidebinding was hereby determined to be in the range of 0.3 to 0.4mM for TraG�2; nucleotide binding was somewhat strongerfor TrwB�1 (Kd, 0.1 to 0.2 mM). Thus, binding of unlabelednucleotides was significantly lower than binding of fluorescentTNP derivatives (30- to 40-fold lower for TrwB�1 and up to80-fold lower for TraG�2).

Mutation in the putative nucleotide-binding site of TraG(TraG�2K187T) causes reductions in its ATP- and ADP-binding abilities. Nucleotide binding of the derivativeTraG�2K187T was determined as before, by monitoring thefluorescence enhancement of TNP-ATP and TNP-ADP. Thebinding of TNP-nucleotides was only slightly weaker than thatseen with TraG�2. The Kds were determined to be 6.0 �M forTNP-ATP and 7.2 �M for TNP-ADP. However, displacementof TNP-nucleotides by unlabeled nucleotides revealed that thenucleotide-binding ability of the TraG�2K187T mutant wasreduced (Fig. 7). The Kd

ATP (0.81 mM) and KdADP (1.64 mM)

indicated 2.4- and 4.5-fold decreases in binding affinity for ATPand ADP, respectively.

ATP binding is inhibited in the presence of Mg2� and DNAand is competed for by other nucleotides. In analogy to thecompetition experiments performed with excess ATP (seeabove), other nucleotides and nucleotide derivatives were as-sayed for their abilities to displace TNP-ATP. Additionally, theeffects of inorganic salts and DNA were tested (Fig. 8). Forboth TraG�2 and TrwB�1, Mg2� had the largest effect (80%reduction in �F). This was also the case for displacement ofprotein-bound TNP-ADP (data not shown). The Ki for Mg2�

inhibition of TraG�2–TNP-ATP binding was determined to be

FIG. 4. Interactions of TraG derivatives with RP4 relaxase (TraI).Complex formation between TraGK187T, TraG�2, and TraI was mea-sured by SPR analysis on sensor chip surfaces. The sensor chip con-sisted of flow cells containing immobilized TraI (TraI�) or immobilizedTraG�2 (TraG�2�). A reference cell with immobilized BSA served asa negative control. Real-time interactions with the immobilized pro-teins were monitored by injecting 100 nM solutions of TraGK187T(A) or TraG�2 (B) through the flow cells for 4 min. The signals (inresponse units) were corrected by subtracting the signal obtained frominteraction with BSA. The start (0 min) and end (4 min) of injectionsare indicated by dashed lines delimiting association time (from 0 to 4min) and dissociation time (from 4 min to infinity).

FIG. 5. TraG�2 and TrwB�1 bind TNP-ATP. The fluorescentATP analogue TNP-ATP displayed enhanced fluorescence upon bind-ing by TraG�2 (A) and TrwB�1 (B). Fluorescence spectra 1 to 4 weretaken from the following samples: spectrum 1, protein (7 �M); spec-trum 2, TNP-ATP (50 �M); spectrum 3, protein (7 �M) plus TNP-ATP (50 �M); spectrum 4, protein (7 �M) plus TNP-ATP (50 �M) inthe presence of ATP (10 mM). Fluorescence intensities are expressedin arbitrary units (AU).



EN

N S

TA

TE

UN

IVhttp://jb.asm

.org/D

ownloaded from

http://jb.asm.org/

82 �M. DNA, especially ssDNA, was also a strong inhibitor forTNP-ATP binding of TrwB�1 but was a much weaker inhibitorfor that of TraG�2. All nucleotides and nucleotide derivativestested were able to compete with TNP-ATP to a certain extent.In the case of TraG�2 binding, ATP itself was the best naturalcompetitor of TNP-ATP, whereas UTP and dTTP were themost effective competitors for TrwB�1 binding. These obser-vations indicated that purine or pyrimidine moieties of nucle-otides did not particularly add to the specificity of nucleotidebinding of TraG�2 or TrwB�1. The synthetic ATP analoguesATP�S and AppNp were able to displace TNP-ATP to ahigher extent than ATP. ADP was a good competitor for bothproteins, whereas competition by AMP was poor. Similarly,pyrophosphate (PPi) was a much better competitor than phos-phate, although at a lower rate overall than ADP. Thus, thereseems to be binding specificity for at least the diphosphatemoiety of NTPs or nucleoside diphosphates, whereas purine orpyrimidine moieties are more or less equally well bound andmerely add to the strength of binding.

FIG. 6. Determination of the Kds for ATP and ADP binding of TraG�2. (A and B) Saturation curves obtained by titration of TraG�2 (7 �M)with TNP-ATP and TNP-ADP, respectively. Binding of TNP-nucleotides was monitored by measuring the fluorescence enhancement, i.e., thedifference between the intrinsic TNP-nucleotide fluorescence and the fluorescence of bound TNP-nucleotides. The curves represent the best fitobtained with equation 3 (Materials and Methods), which determined the Kds for TNP-nucleotide binding. (C and D) Displacement of boundTNP-nucleotides by unlabeled nucleotides, causing a decrease in fluorescence. (C) ATP was added to a mixture of TraG�2 (7 �M) and TNP-ATP(50 �M). (D) ADP was added to a mixture of TraG�2 (7 �M) and TNP-ADP (70 �M). The curves were calculated by using equation 4, whichcontains constants for minimal and maximal fluorescence (Fmin and Fmax). The calculated Kds are listed in Table 4.

FIG. 7. The TraG�2K187T point mutation derivative has a de-creased nucleotide-binding ability. The Kds for ATP and ADP bindingof TraG�2K187T were determined by monitoring the displacement ofprotein-bound TNP-nucleotides by unlabeled nucleotides. Displace-ment manifested itself as a decrease in fluorescence. (A) ATP wasadded to a mixture of TraG�2K187T (7 �M) and TNP-ATP (50 �M).(B) ADP was added to a mixture of TraG�2K187T (7 �M) andTNP-ADP (70 �M). The curves were calculated by using the best fit toequation 4 (Materials and Methods), yielding Kds for ATP and ADPbinding (Table 4).

TABLE 4. Kd for binding of ATP, ADP, and fluorescentTNP-nucleotides

Protein KdTNP-ATP

(�M)Kd

TNP-ADP

(�M)Kd

ATP

(mM)Kd

ADP

(mM)

TraG�2 4.1 5.1 0.34 0.37TrwB�1 4.5 3.9 0.13 0.17TraG�2K187T 6.0 7.2 0.81 1.64



EN

N S

TA

TE

UN

IVhttp://jb.asm

.org/D

ownloaded from

http://jb.asm.org/

TraG and TrwB derivatives bind dsDNA. The DNA-bindingability of TraG was unaffected by the removal of the membraneanchor, as was seen in fragment shift experiments with TraG�2(Fig. 9). Here, addition of protein to a 0.8-kbp DNA fragment

caused a mobility shift of the fragment. Protein-dsDNA com-plexes did not produce a discrete band but accumulated in thewells of the gel. The apparent Kds (Kd

app) of TraG�2 andTrwB�1 for binding of the 0.8-kb fragment were determined as75 and 24 nM, respectively. Comparable dsDNA binding af-finities were also found for TraG and TraGK187T (data notshown). We conclude that dsDNA binding requires neither theN-terminal membrane anchor nor the conserved residue K187of the putative nucleotide-binding site.

dsDNA binding is competed for by ssDNA and is weaklyinhibited by the presence of Mg2� and nucleotides. In frag-ment shift experiments, ssDNA was observed to displacebound dsDNA from dsDNA-protein complexes (Fig. 10). Sub-molar ratios of ssDNA were sufficient to chase 50% of bound

FIG. 8. Displacement of bound TNP-ATP by other nucleotides, DNA, and inorganic salts. The fluorescence of TNP-ATP–protein mixtures wasmeasured before and after addition of the indicated compounds. The percent fluorescence reduction was set as a measure of the displacement ofbound TNP-ATP, i.e., as a measure of competition for the binding site or inhibition of nucleotide binding. Concentrations were as follows: TraG�2or TrwB�1, 10 �M; TNP-ATP, 50 �M; nucleotides, KxHyPO4, AppNp, Na2SO4, MgSO4, and MgCl2, 5 mM; Na4P2O7 and ATP�S, 2.5 mM; ssDNA,18 nM; dsDNA, 15 nM.

FIG. 9. TraG�2 and TrwB�1 bind dsDNA. (A) Fragment shiftexperiment of TraG�2 and TrwB�1 incubated with a 32P-labeleddsDNA fragment and electrophoresed on a nondenaturing polyacryl-amide gel. Addition of increasing amounts of protein (in picomoles) tothe 0.8-kb dsDNA fragment (36 fmol) led to accumulation of protein-DNA complexes in the wells of the gel. (B) Bjerrum plot of free DNAas a function of protein concentration. Complex formation withTraG�2 (filled circles) or with TrwB�1 (open circles) was determinedby quantifying the fraction of free DNA. The amount of protein nec-essary to bind half of the DNA was calculated by using the Hill-typeequation that describes a symmetrical hyperbola ([A] � 1.5 pmol ofTraG�2; [B] � 0.47 pmol of TrwB�1).

FIG. 10. Displacement of protein-bound dsDNA by ssDNA, Mg2�,or nucleotides. 32P-labeled dsDNA fragments (75 fmol each) wereincubated with TraG�2 (10 pmol) (lanes 1 to 8) or TrwB�1 (3 pmol)(lanes 9 to 16) and then supplemented with a competitor or inhibitor.Complexes were separated from free DNA by electrophoresis on anondenaturing polyacrylamide gel. DNA fragments (sizes indicated inkilobase pairs) and complexes were visualized by autoradiography.Lanes 1 and 9, protein plus dsDNA; lanes 2 to 5, ssDNA added at 6,9, 12, and 18 fmol, respectively; lanes 10 to 13, ssDNA added at 3, 6,9, and 18 fmol, respectively; lanes 6 and 14, MgCl2 (10 mM) added;lanes 7 and 15, ATP (10 mM) added; lanes 8 and 16, ADP (10 mM)added.



EN

N S

TA

TE

UN

IVhttp://jb.asm

.org/D

ownloaded from

http://jb.asm.org/

dsDNA, indicating that ssDNA was preferentially bound. Themolar ratios (expressed in bases) necessary for 50% displace-ment were determined to be 1:5.4 (for TraG�2) and 1:8.7 (forTrwB�1). Electron microscopy confirmed that ssDNA is thepreferred substrate: when equal amounts of ssDNA anddsDNA were incubated with TraG, complexes were formedexclusively with ssDNA (Fig. 3). In contrast, dsDNA-TraGcomplexes were abundantly seen in the absence of ssDNA(data not shown). Since nucleotide binding of TraG and TrwBwas observed to be inhibited by the presence of DNA (seeabove), we tested whether nucleotides could reversibly inhibitDNA binding. DNA fragment shifts were thus performed inthe presence or absence of ATP and ADP. Additionally, theeffect of Mg2� was tested (Fig. 10, lanes 6 to 8 and 14 to 16).With TraG�2, inhibition by Mg2� was significant (24% com-plex resolution) but inhibition by ATP and ADP was very low.With TrwB�1, ATP was the strongest inhibitor (37% complexresolution), followed by ADP and Mg2� (13 and 16% complexresolution, respectively). Thus, inhibition by nucleotides wasobserved only for TrwB�1, whereas inhibition by Mg2� ap-plied to both proteins, although at a much lower degree thanhad been observed in the case of nucleotide binding.

DISCUSSION

Type IV secretion is a common secretory pathway which hasbecome increasingly important since the discovery of its in-volvement in the pathogenicity of a growing number of bacte-rial species. The detailed mechanisms of type IV secretionmachineries remain unclear despite extensive investigation bymany research groups (reviewed in reference 8). A set of pro-teins that participate in the formation of a membrane-spanningcomplex and in pilus synthesis is conserved in these secretionsystems (7, 35, 43). Additionally, a membrane protein that doesnot directly join in the latter functions is required: the TraG-like protein (coupling protein). This protein seems to functionin actively transporting the substrate to be secreted throughthe inner membrane. Several observations have led to thismodel, which was originally proposed by Willetts and Wilkins(42). TraG-like proteins were seen to bind DNA (27, 29, 38)and to interact with protein components associated with DNA(10, 38). The crystal structure of a truncated TraG-like protein(TrwB�N70) suggested that the cytoplasmic domain of TrwBforms a hexameric channel structure that probably protrudesthrough the inner membrane (13). The energy for the postu-lated DNA-protein transport mechanism might be provided byhydrolysis of nucleotides, since sequence analysis identified thefamily of TraG-like proteins as putative NTPases (23). Geneticexperiments have confirmed this view. Amino acid substitu-tions in the conserved nucleotide-binding motifs, as in theTraG derivatives TraGK187T and TraGD449N, produced atransfer-defective phenotype (2). However, the model lacksdefinite proof. NTPase assays with four different purifiedTraG-like proteins failed to detect such an activity (27, 38). Aspecific conformation or an additional factor may be requiredfor these proteins to induce NTPase activity. Nonetheless,TraG-like proteins were shown, if not to hydrolyze, at least tobind nucleotides (27; this work).

The present study focuses on the nucleotide-binding prop-erties of two TraG-like proteins, TraG and TrwB, and attempts

to dissect the multiple functions of TraG. Deletion derivativeslacking the membrane anchor (TraG�2 and TrwB�1) andpoint mutation derivatives with a mutation in the putativenucleotide-binding site (TraGK187T and TraG�2K187T) wereconstructed and purified (Fig. 1 and 2). Nucleotide binding wasassayed by measuring the fluorescence increase in fluorescentnucleotide derivatives (TNP-nucleotides) upon binding. Apartfrom binding to ATP, TraG�2 and TrwB�1 were therebyshown to bind ADP (Fig. 5). Compared to TraG�2, mutantTraG�2K187T had a significantly reduced nucleotide-bindingability (Fig. 7), which may account for the transfer-defectivephenotype of TraGK187T reported earlier (2). Competitionexperiments revealed that other NTPs were able to displaceprotein-bound ATP and that the diphosphate moiety of nucle-otides was the core structure required for binding (Fig. 8). Thepresence of DNA markedly reduced the ATP binding ofTrwB�1, and conversely, DNA binding was inhibited by thepresence of ATP. This effect was less pronounced withTraG�2, whose DNA-binding capacity was merely lowered bythe presence of nucleotides. Both proteins, however, re-sponded strongly to the presence of Mg2�, which significantlyinhibited ATP and ADP binding as well as DNA binding (Fig.8 and 10). Inhibition of ATP binding by Mg2� (more specifi-cally, inhibition of TNP-ATP binding) has been reported pre-viously for cation pumps KATP (41) and Ca2�-ATPase (28).

Full-length TraG was recently reported to form large oli-gomers that interact with relaxase, which is an RP4-encodedprotein that covalently associates with the nic site of the originof transfer (32, 38). Analysis of the truncated derivativeTraG�2 revealed that removal of its membrane anchor pre-vented the interaction with relaxase. Gel filtration, electronmicroscopy, and protein interaction analysis also showed that,unlike TraG, TraG�2 is a monomer in solution (Table 3; Fig.3 and 4). We conclude that the N-terminal membrane anchorof TraG (residues 1 to 102) is essential for TraG-TraG andTraG-relaxase interactions. Whereas TraG-TraG interactionslead to aggregation in vitro, they are probably important forthe self-assembly of TraG in the cell membrane in vivo. Similarconclusions can be drawn from the observations with TrwB.While full-length TrwB forms hexamers, at least partially(16), the truncated derivatives TrwB�N70 and TrwB�1 arestrictly monomeric (27) (Table 3). The hexameric nature ofTrwB�N70 in its crystal structure, however, indicates that thetruncated protein may still form multimers under the restric-tive conditions imposed by crystal growth (i.e., high concentra-tion and dehydration).

The failure of TraG�2 to oligomerize may be related to itsfailure to interact with relaxase. It is indeed conceivable thatTraG assembly should occur prior to relaxase binding, sincethe protein needs first to be properly inserted into the mem-brane and to build its final putative pore-like architecture be-fore binding to another bulky protein such as relaxase. An-other possible explanation for the defect in the relaxasebinding of TraG�2 is the assumption that the relaxase-inter-acting domain is situated in the deleted N terminus. This Nterminus consists of a short cytoplasmic tail (residues 1 to 23)followed by a transmembrane segment, a periplasmic domain(residues 44 to 82), and a second transmembrane segment.After exclusion of the transmembrane segments, the periplas-mic and cytoplasmic regions of the membrane anchor remain



EN

N S

TA

TE

UN

IVhttp://jb.asm

.org/D

ownloaded from

http://jb.asm.org/

as possible domains for relaxase interaction. Since relaxase is acytoplasmic protein, the periplasmic domain of TraG is un-likely to play a role in relaxase-interaction. Thus, apart fromthe possibility that oligomerization of the protein per se is arequirement for relaxase interaction, the short cytoplasmic do-main preceding the first membrane segment may be requiredfor this interaction, although it is probably too short to be adomain of its own.

T4SS function as active transporters for delivery of sub-strates destined for secretion. A question of central interest ishow the energy for this transport is provided. Sequence anal-ysis of T4SS-encoded proteins indicated that NTP hydrolysismay be the motor for type IV secretion, since three proteinswith putative NTPase activity were identified. Apart from theTraG-like proteins, these include the VirB4-like and theVirB11-like proteins. Each of these proteins is an essentialcomponent of the T4SS studied. The proposed NTPase activitywas confirmed in vitro for three proteins of the VirB11 familythat were also seen to form hexamers (18, 19, 34). Further-more, the crystal structures of HP0525 (H. pylori) and its nu-cleotide-bound form suggested a role in the export of sub-strates and/or in the assembly of the type IV secretionapparatus itself (37, 44). In contrast, purified forms of theVirB4-like proteins TrbE (RP4) and TrwK (R388) were foundto lack NTPase activity. However, a mutation in the putativenucleotide-binding site produced a transfer-deficient pheno-type (33). The same effect was observed for TraG-like proteins,which equally lack NTPase activity in vitro. Two TraG-likeproteins, TraG and TrwB, were now shown to bind ATP as wellas ADP, supporting the view that these proteins are somehowinvolved in an energy-driven transport process fueled by hy-drolysis of nucleotides. Comparison of the crystal structures ofTrwB�N70 and the protein bound to the ATP analogueAppNp or GppNp has indicated that TrwB undergoes confor-mational changes upon NTP binding (12). Our results indicatethat nucleotide binding of TraG and TrwB is inhibited byMg2�. In this context, it is worth noting that no Mg2� ion couldbe assigned in the structures of AppNp- or GppNp-boundTrwB�N70, although the crystals were purposely grown in thepresence of Mg2�. Thus, in agreement with our finding, Mg2�

did not contribute to nucleotide binding in these complexes;rather, the contrary should probably apply. In conclusion, wepropose that TraG-like proteins either hydrolyze nucleotidesthemselves under inducing in vivo conditions that are not ful-filled in vitro or regulate the activity of a different NTPase(such as VirB11) by feeding it with nucleotides and/or dis-charging the products of hydrolysis. The fact that purifiedTraG proteins do not hydrolyze nucleoside triphosphates butdo bind ATP as well as the product of its hydrolysis, ADP,supports the latter hypothesis. In this mechanism, release andbinding of nucleotides could be triggered by Mg2�. Thus,TraG-like proteins, which are known to bind to substrates oftype IV secretion, are likely also to be involved in their activeexport.

In the present work, it was shown that the TraG-like pro-teins TraG and TrwB bind ATP as well as ADP in the 10�1

mM range and that this binding activity is strongly reduced byMg2�. Apart from characterizing the nucleotide-binding prop-erties of TraG and TrwB in detail, we have functionally andstructurally dissected several of their functions. Removal of the

membrane anchor destroyed transfer activity. This was attrib-uted to a defect in protein multimerization and in protein-relaxase interaction. In contrast, the DNA- and nucleotidebinding activities of TraG and TrwB were functionally inde-pendent of oligomerization or relaxase binding and could bestructurally localized to the cytoplasmic C-terminal domain.

ACKNOWLEDGMENTS

We thank Gerhild Luder and Rudi Lurz for carrying out electronmicroscopic experiments. We extend thanks to Nicole Lorenz for prac-tical help and Franca Blaesing for critical reading of the manuscript.

We thank Hans Lehrach for generous support. This work was sup-ported by the Deutsche Forschungsgemeinschaft.

REFERENCES

1. Achtman, M., P. A. Manning, C. Edelbluth, and P. Herrlich. 1979. Exportwithout proteolytic processing of inner and outer membrane proteins en-coded by F sex factor tra cistrons in Escherichia coli minicells. Proc. Natl.Acad. Sci. USA 76:4837–4841.

2. Balzer, D., W. Pansegrau, and E. Lanka. 1994. Essential motifs of relaxase(TraI) and TraG proteins involved in conjugative transfer of plasmid RP4. J.Bacteriol. 176:4285–4295.

3. Balzer, D., G. Ziegelin, W. Pansegrau, V. Kruft, and E. Lanka. 1992. KorBprotein of promiscuous plasmid RP4 recognizes inverted sequence repeti-tions in regions essential for conjugative plasmid transfer. Nucleic Acids Res.20:1851–1858.

4. Bolland, S., M. Llosa, P. Avila, and F. de la Cruz. 1990. General organizationof the conjugal transfer genes of the IncW plasmid R388 and interactionsbetween R388 and IncN and IncP plasmids. J. Bacteriol. 172:5795–5802.

5. Boyer, H. W., and D. Roulland-Dussoix. 1969. A complementation analysisof the restriction and modification of DNA in Escherichia coli. J. Mol. Biol.41:459–472.

6. Cheng, Y., and W. H. Prusoff. 1973. Relationship between the inhibitionconstant (Ki) and the concentration of inhibitor which causes 50 per centinhibition (I50) of an enzymatic reaction. Biochem. Pharmacol. 22:3099–3108.

7. Christie, P. J. 1997. Agrobacterium tumefaciens T-complex transport appa-ratus: a paradigm for a new family of multifunctional transporters in eubac-teria. J. Bacteriol. 179:3085–3094.

8. Christie, P. J. 2001. Type IV secretion: intercellular transfer of macromol-ecules by systems ancestrally related to conjugation machines. Mol. Micro-biol. 40:294–305.

9. Covarrubias, L., and F. Bolivar. 1982. Construction and characterization ofnew cloning vehicles. VI. Plasmid pBR329, a new derivative of pBR328lacking the 482-base-pair inverted duplication. Gene 17:79–89.

10. Disque-Kochem, C., and B. Dreiseikelmann. 1997. The cytoplasmic DNA-binding protein TraM binds to the inner membrane protein TraD in vitro. J.Bacteriol. 179:6133–6137.

11. Furste, J. P., W. Pansegrau, G. Ziegelin, M. Kroger, and E. Lanka. 1989.Conjugative transfer of promiscuous IncP plasmids: interaction of plasmid-encoded products with the transfer origin. Proc. Natl. Acad. Sci. USA 86:1771–1775.

12. Gomis-Ruth, F. X., G. Moncalian, F. de la Cruz, and M. Coll. 2002. Conju-gative plasmid protein TrwB, an integral membrane type IV secretion systemcoupling protein. Detailed structural features and mapping of the active sitecleft. J. Biol. Chem. 277:7556–7566.

13. Gomis-Ruth, F. X., G. Moncalian, R. Perez-Luque, A. Gonzalez, E. Cabezon,F. de la Cruz, and M. Coll. 2001. The bacterial conjugation protein TrwBresembles ring helicases and F1–ATPase. Nature 409:637–641.

14. Hiratsuka, T. 1976. Fluorescence properties of 2� (or 3�)-O-(2,4,6-trinitro-phenyl)adenosine 5�-triphosphate and its use in the study of binding to heavymeromyosin ATPase. Biochim. Biophys. Acta 453:293–297.

15. Hiratsuka, T. 1982. Biological activities and spectroscopic properties ofchromophoric and fluorescent analogs of adenine nucleosides and nucleo-tides, 2�,3�-O-(2,4,6-trinitrocyclohexadienylidene)adenosine derivatives. Bio-chim. Biophys. Acta 719:509–517.

16. Hormaeche, I., I. Alkorta, F. Moro, J. M. Valpuesta, F. M. Goni, and F. dela Cruz. 2002. Purification and properties of TrwB, a hexameric, ATP-binding integral membrane protein essential for R388 plasmid conjugation.J. Biol. Chem. 277:46456–46462.

17. Hulme, E. C., and N. J. M. Birdsall. 1992. Strategy and tactics in receptor-binding studies, p. 63–174. In E. C. Hulme (ed.), Receptor-ligand interac-tions, a practical approach. Oxford University Press, Inc., New York, N.Y.

18. Krause, S., M. Barcena, W. Pansegrau, R. Lurz, J. M. Carazo, and E. Lanka.2000. Sequence-related protein export NTPases encoded by the conjugativetransfer region of RP4 and by the cag pathogenicity island of Helicobacterpylori share similar hexameric ring structures. Proc. Natl. Acad. Sci. USA97:3067–3072.



EN

N S

TA

TE

UN

IVhttp://jb.asm

.org/D

ownloaded from

http://jb.asm.org/

19. Krause, S., W. Pansegrau, R. Lurz, F. de la Cruz, and E. Lanka. 2000.Enzymology of type IV macromolecule secretion systems: the conjugativetransfer regions of plasmids RP4 and R388 and the cag pathogenicity islandof Helicobacter pylori encode structurally and functionally related nucleosidetriphosphate hydrolases. J. Bacteriol. 182:2761–2770.

20. Kubala, M., K. Hofbauerova, R. Ettrich, V. Kopecky, R. Krumscheid, J.Plasek, J. Teisinger, W. Schoner, and E. Amler. 2002. Phe(475) andGlu(446) but not Ser(445) participate in ATP-binding to the alpha-subunitof Na�/K�-ATPase. Biochem. Biophys. Res. Commun. 297:154.

21. Kyte, J., and R. F. Doolittle. 1982. A simple method for displaying thehydropathic character of a protein. J. Mol. Biol. 157:105–132.

22. Lee, M. H., N. Kosuk, J. Bailey, B. Traxler, and C. Manoil. 1999. Analysis ofF factor TraD membrane topology by use of gene fusions and trypsin-sensitive insertions. J. Bacteriol. 181:6108–6113.

23. Lessl, M., W. Pansegrau, and E. Lanka. 1992. Relationship of DNA-trans-fer-systems: essential transfer factors of plasmids RP4, Ti and F share com-mon sequences. Nucleic Acids Res. 20:6099–6100.

24. Llosa, M., S. Bolland, and F. de la Cruz. 1994. Genetic organization of theconjugal DNA processing region of the IncW plasmid R388. J. Mol. Biol.235:448–464.

25. Miller, J. H. 1972. Experiments in molecular genetics, p. 431–433. ColdSpring Harbor Laboratory Press, Cold Spring Harbor, N.Y.

26. Moczydlowski, E. G., and P. A. Fortes. 1981. Characterization of 2�,3�-O-(2,4,6-trinitrocyclohexadienylidine)adenosine 5�-triphosphate as a fluores-cent probe of the ATP site of sodium and potassium transport adenosinetriphosphatase. Determination of nucleotide binding stoichiometry and ion-induced changes in affinity for ATP. J. Biol. Chem. 256:2346–2356.

27. Moncalian, G., E. Cabezon, I. Alkorta, M. Valle, F. Moro, J. M. Valpuesta,F. M. Goni, and F. de la Cruz. 1999. Characterization of ATP and DNAbinding activities of TrwB, the coupling protein essential in plasmid R388conjugation. J. Biol. Chem. 274:36117–36124.

28. Moutin, M. J., M. Cuillel, C. Rapin, R. Miras, M. Anger, A. M. Lompre, andY. Dupont. 1994. Measurements of ATP binding on the large cytoplasmicloop of the sarcoplasmic reticulum Ca2�-ATPase overexpressed in Esche-richia coli. J. Biol. Chem. 269:11147–11154.

29. Panicker, M. M., and E. G. Minkley, Jr. 1992. Purification and properties ofthe F sex factor TraD protein, an inner membrane conjugal transfer protein.J. Biol. Chem. 267:12761–12766.

30. Pansegrau, W., D. Balzer, V. Kruft, R. Lurz, and E. Lanka. 1990. In vitroassembly of relaxosomes at the transfer origin of plasmid RP4. Proc. Natl.Acad. Sci. USA 87:6555–6559.

31. Pansegrau, W., E. Lanka, P. T. Barth, D. H. Figurski, D. G. Guiney, D. Haas,D. R. Helinski, H. Schwab, V. A. Stanisich, and C. M. Thomas. 1994.Complete nucleotide sequence of Birmingham IncP alpha plasmids. Com-pilation and comparative analysis. J. Mol. Biol. 239:623–663.

32. Pansegrau, W., G. Ziegelin, and E. Lanka. 1990. Covalent association of thetraI gene product of plasmid RP4 with the 5�-terminal nucleotide at therelaxation nick site. J. Biol. Chem. 265:10637–10644.

33. Rabel, C., A. M. Grahn, R. Lurz, and E. Lanka. 2003. The VirB4 family ofproposed traffic nucleoside triphosphatases: common motifs in plasmid RP4TrbE are essential for conjugation and phage adsorption. J. Bacteriol. 185:1045–1058.

34. Rivas, S., S. Bolland, E. Cabezon, F. M. Goni, and F. de la Cruz. 1997. TrwD,a protein encoded by the IncW plasmid R388, displays an ATP hydrolaseactivity essential for bacterial conjugation. J. Biol. Chem. 272:25583–25590.

35. Salmond, G. P. C. 1994. Secretion of extracellular virulence factors by plantpathogenic bacteria. Annu. Rev. Phytopathol. 32:181–200.

36. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: alaboratory manual, 2nd ed. Cold Spring Harbor Laboratory, Cold SpringHarbor, N.Y.

37. Savvides, S. N., H. J. Yeo, M. R. Beck, F. Blaesing, R. Lurz, E. Lanka, R.Buhrdorf, W. Fischer, R. Haas, and G. Waksman. 2003. VirB11 ATPases aredynamic hexameric assemblies: new insights into bacterial type IV secretion.EMBO J. 22:1969–1980.

38. Schroder, G., S. Krause, E. L. Zechner, B. Traxler, H. J. Yeo, R. Lurz, G.Waksman, and E. Lanka. 2002. TraG-like proteins of DNA transfer systemsand of the Helicobacter pylori type IV secretion system: inner membrane gatefor exported substrates? J. Bacteriol. 184:2767–2779.

39. Spiess, E., and R. Lurz. 2001. Electron microscopic analysis of nucleic acidsand nucleic acid-protein complexes. Methods Microbiol. 20:293–323.

40. Strack, B., M. Lessl, R. Calendar, and E. Lanka. 1992. A common sequencemotif, -E-G-Y-A-T-A-, identified within the primase domains of plasmid-encoded I- and P-type DNA primases and the � protein of the Escherichiacoli satellite phage P4. J. Biol. Chem. 267:13062–13072.

41. Vanoye, C. G., G. G. MacGregor, K. Dong, L. Tang, A. S. Buschmann, A. E.Hall, M. Lu, G. Giebisch, and S. C. Hebert. 2002. The carboxyl termini ofK(ATP) channels bind nucleotides. J. Biol. Chem. 277:23260–23270.

42. Willetts, N., and B. M. Wilkins. 1984. Processing of plasmid DNA duringbacterial conjugation. Microbiol. Rev. 48:24–41.

43. Winans, S. C., D. L. Burns, and P. J. Christie. 1996. Adaptation of a conjugaltransfer system for the export of pathogenic macromolecules. Trends Mi-crobiol. 4:64–68.

44. Yeo, H. J., S. N. Savvides, A. B. Herr, E. Lanka, and G. Waksman. 2000.Crystal structure of the hexameric traffic ATPase of the Helicobacter pyloritype IV secretion system. Mol. Cell 6:1461–1472.

45. Zechner, E. L., F. de la Cruz, R. Eisenbrandt, A. M. Grahn, G. Koraimann,E. Lanka, G. Muth, W. Pansegrau, C. M. Thomas, B. M. Wilkins, and M.Zatyka. 2000. Conjugative DNA transfer processes, p. 87–173. HarwoodAcademic Publishers, Amsterdam, The Netherlands.

46. Ziegelin, G., W. Pansegrau, B. Strack, D. Balzer, M. Kroger, V. Kruft, andE. Lanka. 1991. Nucleotide sequence and organization of genes flanking thetransfer origin of promiscuous plasmid RP4. DNA Sequence 1:303–327.

47. Ziegelin, G., E. Scherzinger, R. Lurz, and E. Lanka. 1993. Phage P4 �protein is multifunctional with origin recognition, helicase and primase ac-tivities. EMBO J. 12:3703–3708.



EN

N S

TA

TE

UN

IVhttp://jb.asm

.org/D

ownloaded from

http://jb.asm.org/

(R388) Multiple Activities of TraG (RP4) and TrwB Systems ...

Documents

Transcript of (R388) Multiple Activities of TraG (RP4) and TrwB Systems ...