Quick-Neuron™ Dopaminergic mRNA Complete Kit · Preparation steps are as follows: - Dissolve 10...

-- Quick-NeuronTM Dopaminergic - mRNA Complete Kit v. 2February 28, 2020

Quick-Neuron™ DopaminergicmRNA Complete Kit

This kit (EXGS-QND) contains 1 set of reagents for use witha total of 4 wells of a 24-well plate

User Manual

Catalog Number: EXGS-QND

Elixirgen Scientific, LLC855 N. Wolfe St., Suite 619Baltimore, MD 21205Phone: (443) 869-5420Email: [email protected]

Table of Contents:I. Introduction 2II. Kit Contents 2III. Additional Materials Required 2IV. Pre-Protocol Preparation 3V. Protocol 4

VI. Appendix A: Reference Pictures and Figures 9VII. Appendix B: Literature References 11


I. IntroductionThank you for purchasing the Quick-Neuron™ Dopaminergic - mRNA Complete Kit. This kit allows users to differentiate human pluripotent stem cells (hPSCs), including embryonic stem cells (ESCs) and induced pluripotent stem cells (iPSCs), into tubulin beta 3 class III (TUBB3), tyrosine hydroxylase (TH), and dopamine (DA)-positive neurons within 10 days. These neurons are committed to becoming dopaminergic neurons.

II. Kit Contents

NOTE: EXPERIMENT SCALEThis kit contains enough reagents to differentiate 4 wells of a 24-well plate. If you are unfamiliar with our kits, we recommend differentiating 4 wells at a time; our protocol instructions are written for a 4-well experiment. For the use in a 6-well format, simply multiply the recipe by four.

Upon receipt of this kit, immediately store all reagents at their proper storage temperatures as described in the table below. All reagents are shipped on dry ice.

* This kit contains StemFit® Basic02 (Ajinomoto Co., Inc.), iMatrix-511 silk (Nippi, Inc.), and Viromer® (Lipocalyx GmbH).

III. Additional Materials Required

List of Components

Reagents Amount Storage Conditions

QN1 220 µl x 2 -80°C

QN2 220 µl x 2 -80°C

Medium S 21 ml -20°C

Component P 14 μl -20°C

Component N 840 µl -20°C

Component D4 20 µl -20°C



Solution D1 1 ml -20°C

Coating Material A 15.7 µl -20°C

Coating Material B 1.3 ml -20°C

Coating Material C 16.5 µl -20°C

The following materials are needed but not supplied with this kit:

• 24-well tissue-culture-treated polystyrene plate

• DMEM/F12 (e.g., ThermoFisher, Catalog Number: 21331-020)

• Neurobasal (e.g., ThermoFisher, Catalog Number: 21103049)

• Glutamax (100x) (e.g., ThermoFisher, Catalog Number: 35050061)

• Penicillin-Streptomycin (e.g., ThermoFisher, Catalog Number: 15140-122)


IV. Pre-Protocol Preparation

• Prepare a neural differentiation medium by mixing the following reagents after thawing Component N at 4°C overnight. The medium is called Medium N and it is stable for up to 2 weeks when stored at 4°C.

NOTE: SOURCE hPSC CULTURE CONDITIONS• The Quick-Neuron™ Dopaminergic - mRNA Complete Kit gives its best differentiation results when source

hPSCs have been maintained in StemFit® Basic02 (StemFit®, Catalog Number: EXGS-ASB02), StemFlex™ (ThermoFisher, Catalog Number: A3349401), or other similar culture media which enable single-cell passaging.

- The protocol and reagents for StemFit® culture conditions are available at https://elixirgenscientific.com/store/ (Catalog Number: EXGS-ASB02, EXGS-NI511S).

- If source hPSCs are not routinely maintained by passaging them in a single-cell format, we strongly recommend adapting the hPSCs to one of the media mentioned above. We provide the Quick- Tissue™ Adaptation Kit (Catalog Number: EXGS-QTA1) that allows user to adapt their hPSC cultures to StemFit® culture conditions.

• The recipe in the Quick-Neuron™ Dopaminergic - mRNA Complete Kit protocol assumes that the undifferentiated hPSCs (starting materials) are cultured in a 35-mm culture dish (or one well of a 6-well plate).

• Phosphate-buffered saline (PBS without Ca++ Mg++)

• ROCK inhibitor Y27632 (e.g., Selleckchem, Catalog Number: s1049)

• Dimethyl sulfoxide (DMSO; e.g., Sigma-Aldrich, Catalog Number: D8418)

• Optional items for passaging to glass coverslips

- 12-mm glass coverslips (Glass coverslips from different brands might have different effects on the growth of neural cells. We recommend using glass coverslips from Chemglass (VWR, Cat# 89167-106) for the best results.)

- 100% Ethanol

- Forceps

• Prepare a 10 mM ROCK inhibitor Y27632 stock solution in DMSO to prepare for Medium iS on Day 0. Preparation steps are as follows:

- Dissolve 10 mg ROCK inhibitor Y27632 in 3.1225 ml DMSO.

- Make aliquots of a convenient volume (e.g., 100 μl) and store at -20°C.

• We do not recommend additional freeze-thaw cycles of any reagents.

• Taking 4x and/or 10x images of cultures every day (or even after every medium change) is a good way to monitor your experiment.

• Customer service on the phone (+1-443-869-5420) and through email ([email protected]) is available to assist users in troubleshooting and interpretation of results.

No. Reagent Volume

1 DMEM/F12 12 ml

2 Neurobasal 12 ml

3 200 mM Glutamax (100x) 125 µl

4 Penicillin-Streptomycin (10000 units/ml; 100x) 250 µl

5 Component N 775 µl

https://elixirgenscientific.com/store/



V. Protocol

Day 0 - Plating

New Plate Preparation

1. Start thawing Solution D1 and warm Medium S at room temperature. Make sure that Solution D1 and Medium S are at room temperature for at least 1 hour before use.

2. Thaw Coating Material A on ice for 20-30 minutes (or at 4°C overnight one day before Day 0).

3. Take 2 ml ice-cold PBS into a new 15 ml conical tube and add 6.6 µl Coating Material A to it. Mix them well.

4. Add 400 µl diluted Coating Material A to each new well.

5. Incubate the plate at 37°C, 5% CO₂ for 2 hours (or 4°C overnight one day before Day 0).

6. Aspirate the supernatant from each well and add 500 µl PBS to it.

7. Incubate the plate at 37°C, 5% CO₂ until user ’s hPSCs are ready for plating.

Plating

1. Take 3.3 ml Medium S into a new 15 ml conical tube and add 3.3 μl 10 mM ROCK inhibitor Y27632 to it. Mix them well. This medium is referred to as Medium iS. The rest of Medium S should be stored at 4°C for later use.

2. Aspirate old medium from user’s hPSC culture and add 2 ml PBS to it.

3. Rock the plate 3 times, aspirate PBS from the culture, and add 300 μl Solution D1 to it. Keep the rest of Solution D1 at 4°C for its use on Day 3.

4. Incubate the culture at 37°C, 5% CO₂ for 5-7 minutes.

5. Carefully pipet out Solution D1 from the culture using a P1000 pipettor and add 1 ml Medium iS to it.

6. Disperse the medium over the well bottom surface by pipetting 8-15 times to detach cells.

7. Collect the cell suspension in a tube.

8. Count cells to determine the volume of cell suspension needed for 5 wells to achieve 70-90% confluency on Day 1.

9. Take out the determined volume of the cell suspension from the previous step in a tube and bring up the volume to 2.5 ml with Medium iS.

10. Aspirate PBS from each coated well and add 500 µl cell suspension to it.

NOTE: CELL DENSITY• In this protocol, users will plate the hPSCs into 4 wells with 500 µl Medium iS per well. However, we

recommend preparing a suspension for 5 wells to avoid insufficiency.

• We recommend aiming for 70-90% initial cell confluency on Day 1, with 20-50 cells per colony.

- Our data indicate that cell counts ranging from 1.0 - 2.4 x 105 cells per well are suitable.

- Cell count may vary based on cell health, the method, and instrument used for cell counting.

- If the confluency on Day 1 is

▪ above the target range, the differentiation efficiency will decrease.

▪ below the target range, more cell death will be observed.

Day 0 Day 1 Day 2 Day 3 Day 4 Day 5 Day 6 Day 7 Day 8 Day 9 Day 10

Plating QN1 QN1 QN2 QN2 Passaging Assay

Medium iS Medium S Medium N(D4D5P) Medium N(D4D6P)


11. Incubate the cultures at 37°C, 5% CO₂ for 1 hour.

12. Observe each well under a microscope to make sure that the cells are evenly distributed in the well.

13. Incubate the cultures at 37°C, 5% CO₂ overnight.

Day 1 - First Two Treatments

1. In the morning, thaw one vial of QN1 on ice for 20-30 minutes. Do not centrifuge it once thawed.

2. Warm Medium S at room temperature for 20-30 minutes.

3. Aspirate the old medium from each well and add 450 μl Medium S to it.

4. Incubate the cultures at 37°C, 5% CO₂ for 10 minutes.

5. Incubate QN1 at room temperature for 5 minutes. Simply tap the side of the vial or gently pipet up and down to mix it well.

6. Add 50 µl QN1 to each culture by adding QN1 dropwise with one hand and simultaneously gently shaking the plate using the other hand.

7. Rock the plate front to back and side to side for 15 seconds to make sure that QN1 is evenly distributed in the cultures. Do not swirl.

8. Incubate the cultures at 37°C, 5% CO₂ for 2.5-3 hours.

9. Pipet out the old medium with QN1 from each well using a P1000 pipettor and add 450 μl Medium S to it

10. Incubate the cultures at 37°C, 5% CO₂ for 2 hours.

11. Thaw another vial of QN1 on ice for 20-30 minutes. Do not centrifuge it once thawed.


13. Repeat Steps 6-8 with 50 µl QN1 for each culture.

14. Pipet out the medium from each well using a P1000 pipettor and add 500 μl Medium S to it.


Day 2 - Last Two Treatments

1. In the morning, thaw one vial of QN2 on ice for 20-30 minutes. Do not centrifuge it once thawed.

2. Warm Medium S at room temperature for 20-30 minutes.




6. Add 50 µl QN2 to each culture by adding QN2 dropwise with one hand and simultaneously gently shak-ing the plate using the other hand.

7. Rock the plate front to back and side to side for 15 seconds to make sure that QN2 is evenly distributed in the cultures. Do not swirl.

8. Incubate the cultures at 37°C, 5% CO₂ for 2.5-3 hours.


10. Incubate the cultures at 37°C, 5% CO₂ for 2 hours.

11. Thaw another vial of QN2 on ice for 20-30 minutes. Do not centrifuge it once thawed.


13. Repeat Steps 6-8 with 50 µl QN2 for each culture.




A. New Well/Glass Coverslip Preparation

A1. Well Preparation

1. Add 300 μl Coating Material B to each well in a new 24-well plate.

2. Incubate the plate at 37°C, 5% CO₂ for at least 2 hours (or at 4°C overnight one day before Day 3).

3. Thaw Coating Material C on ice for 20-30 minutes. Do not thaw it at room temperature.

4. Take 1.5 ml ice-cold PBS into a tube and add 15 µl Coating Material C to it. Mix them well.

5. Aspirate the supernatant from each well and add 500 μl PBS to it.

6. Repeat step 5.

7. Aspirate PBS from each well and add 300 μl diluted Coating Material C to it.

8. Incubate the plate at 37°C, 5% CO₂ for at least 2 hours.

9. Repeat step 5 twice.

10. Aspirate PBS from each well and add 250 μl Medium N(D4D5P) to it.

A2. Glass Coverslip Preparation

1. Soak 12-mm glass coverslips in 100% ethanol for 5 minutes.

2. Dry the coverslips with air and place one glass coverslip to each well in a new 24-well plate with sterilized forceps. Note: Coverslips should be fully submerged under solutions from step 3 and onwards.

3. Add 300 μl Coating Material B to the surface of each glass coverslip.

4. IIncubate the plate at 37°C, 5% CO₂ for at least 2 hours (or at 4°C overnight one day before Day 3).

5. Thaw Coating Material C on ice for 20-30 minutes. Do not thaw it at room temperature.

Day 3 - Feeding

1. Warm Medium N at room temperature for 20-30 minutes.

2. Thaw Components D5 and P at room temperature and Component D4 on ice for 20-30 minutes.

3. Take 15 ml Medium N into a tube and add 7.5 μl Component D4 to it. Mix them well. The medium is referred to as Medium N(D4) and is stable for up to 2 weeks at 4°C.

4. Take 8.25 ml Medium N(D4) into a tube and add 8.25 μl Component D5 and 4.125 μl Component P to it. Mix them well. The medium is referred to as Medium N(D4D5P) and is stable for up to 2 weeks at 4°C. Keep the rest Medium N(D4) at 4°C for its use on Day 7.

5. Pipet out the old medium from each well using a P1000 pipettor and add 500 μl Medium N(D4D5P) to it.


Day 4 - Passaging

1. Warm Medium N(D4D5P) at room temperature for 20-30 minutes.

2. Thaw Coating Material B at room temperature for 20-30 minutes.

NOTE: PASSAGING CELLS TO WELLS OR GLASS COVERSLIPS• Day 4 involves a passaging step. Cells can be passaged to either wells or glass coverslips depending

on user’s preferences and needs. Wells can be used for functional assays and post-kit work, whereas coverslips will provide a better environment for immunostaining and imaging.

- If passaging to new wells, follow directions for “A1. New Well Preparation” and “B. Passaging Cells”.

- If passaging to glass coverslips, follow directions for “A2. Glass Coverslip Preparation” and “B. Passaging Cells”.


NOTE: DIFFERENTIATING CELLS ARE DELICATE

NOTE: CRITICAL PASSAGING STEPS

• For the following steps, please pipet and add solutions gently. Differentiating cells are delicate and should be handled with great care.

6. Take 1.5 ml ice-cold PBS into a tube and add 15 µl Coating Material C to it. Mix them well.

7. Aspirate the supernatant from each well and add 500 μl PBS to it.

8. Repeat step 7.

9. Aspirate PBS from each well and add 300 μl diluted Coating Material C to the surface of each glass coverslip.

10. Incubate the plate at 37°C, 5% CO₂ for at least 2 hours.

11. Repeat step 7 twice.

12. Aspirate PBS from each well and add 250 μl Medium N(D4D5P) to it.

B. Passaging Cells

1. Warm Solution D1 at room temperature for 20-30 minutes.

2. Pipet out the old medium from each well using a P1000 pipettor and add 500 μl PBS to it.

3. Pipet out PBS from each well using a P1000 pipettor and add 80 μl Solution D1 to it.


5. Carefully pipet out Solution D1 from each well using a P1000 pipettor and add 250 µl Medium N(D4D5P).

6. Disperse the medium quickly over the well bottom surface by pipetting 6-8 times to detach cells using a P200 pipettor.

7. Observe cells and/or cell aggregates floating in the well under a microscope. It is normal that 10-20% of cells remain attached to the well bottom after pipetting. The clusters of cells are not supposed to be lifted. Do not attempt to detach all of the cells remaining on the well bottom.

8. Gently pipet up and down the cell suspension in the well up to 5 times to break the cell aggregates using a P200 pipettor. Excessive pipetting can damage the already-suspended neuronal cells.

• Steps 6-8 below are critical. Perform these steps one well at a time.

• Refer to the images below to successfully manage cell treatment and dissociation.

Before Solution D1 treatment During Solution D1 treatment Cell leftover on original wells

Clusters of cells could remain on the original well after cell treatment and dissociation

The clusters could be identified on the well and attached to the plate stronger than individualized cells

After optimal cell treatment and dissociation, there are some cell leftovers mainly from the clusters of cells


NOTE: OBSERVING NEURONS AND ASSAYING• Differentiated neurons can be observed on Day 5 under the microscope. For more mature neurons, we

recommend culturing cells until Day 10. From Day 10, users may maintain differentiated neurons in the maintenance medium best suited for their needs, though we recommend Quick-Neuron™ Dopaminergic Maintenance Medium, available at https://elixirgenscientific.com/store/ (Catalog Number: EXGS-QNDM).

• Differentiation into dopaminergic neurons after using Quick-Neuron™ Dopaminergic - mRNA Complete Kit can be confirmed with anti-TUBB3 (tubulin beta 3 class III, a global marker for neurons), anti-TH (tyrosine hydroxylase, a dopaminergic neuron marker), and anti-DA (dopamine, a neurotransmitter of dopaminergic neurons) antibodies. Typical immunostaining images of TUBB3-positive and TH-positive neurons on Day 10 following Quick-Neuron™ Dopaminergic - mRNA Complete Kit treatment are shown in Appendix A.

9. Collect 250 μl cell suspension from each well with a P1000 pipettor and transfer it to each new well or glass coverslip coated with Coating Materials B and C.

- When transferring the cell suspension to a coverslip, bring the tip very close to the coverslip and pipet slowly to mount cells right at the center of the coverslip.

- If cultures are >70% confluent on Day 4, transfer only half of the cell suspension (125 μl) to each new well or glass coverslip to avoid excessively high cell density. Add 125 μl of Medium N(D4D5P) after cell suspension is transferred to bring volume up to 250 μl.

10. Incubate the cultures at 37°C, 5% CO₂ for 1 hour.

11. Observe each well under the microscope to make sure that the cells are attached to the well or glass coverslip.


Day 5-6 - Feeding


2. Pipet out the old medium from each well using a P1000 pipettor and add 1 ml Medium N(D4D5P) to it.

3. Incubate the cultures at 37°C, 5% CO₂ for 2 days.

Day 7 - Feeding

1. Warm Medium N(D4) at room temperature for 20-30 minutes.

2. Thaw Components D6 and P at room temperature for 20-30 minutes.

3. Take 6.25 ml Medium N(D4) into a tube and add 6.25 μl Component D6 and 3.1 μl Component P to it. Mix them well. The medium is referred to as Medium N(D4D6P) and is stable for up to 2 weeks at 4°C.



Day 8-9 - Feeding




4. Repeat steps 1-3 every day until Day 10.

Day 10 - Ready for Assay



Figure 1. Phase contrast images of a Quick-Neuron™ Dopaminergic - mRNA Complete Kit culture on Days 1-10 (10x objective, respectively).

VI. Appendix A: Reference Pictures and Figures

Day 1 Day 2 Day 4

Day 9 Day 10


Figure 3. Immunostaining images of differentiated neurons in a Quick-Neuron™ Dopaminergic - mRNA Complete Kit culture on Day 10.

Figure 2. Immunostaining images of differentiated neurons in a Quick-Neuron™ Dopaminergic - mRNA Complete Kit culture on Day 10.

Staining conditions: Anti-MAP2 monoclonal antibody (Thermo Fisher Scientific, Cat#13-1500, 1:1000 dilution) in combination with a secondary antibody (Invitrogen, Cat#A21424, Alexa 555 goat anti-mouse, 1:500 dilution). Anti-DA primary antibody (Abcam, Cat#AB6427, 1:1000 dilution) in combination with a secondary antibody (Invitrogen, Cat#A11034, Alexa 488 goat anti-rabbit, 1:500 dilution).

Staining conditions: Anti-MAP2 monoclonal antibody (Thermo Fisher Scientific, Cat#13-1500, 1:1000 dilution) in combination with a secondary antibody (Invitrogen, Cat#A21424, Alexa 555 goat anti-mouse, 1:500 dilution). Anti- Tyrosine Hydroxylase primary antibody (GeneTex, Cat#GTX102424, 1:300 dilution) in combination with a secondary antibody (Invitrogen, Cat#A11034, Alexa 488 goat anti-rabbit, 1:500 dilution).

DAPI

10x

MAP2 DA Merged

DAPI MAP2 DA Merged

40x

10x

40x

10x

40x

10x

40x

DAPI MAP2 TH Merged

DAPI MAP2 TH Merged

40x 40x 40x 40x

40x 40x 40x 40x


VII. Appendix B: Literature References1. Goparaju SK, Kohda K, Ibata K, Soma A, Nakatake Y, Akiyama T, Wakabayashi S, Matsushita M, Sakota

M, Kimura H, Yuzaki M, Ko SB & Ko MS (2017). Rapid differentiation of human pluripotent stem cells into functional neurons by mRNAs encoding transcription factors. Scientific Reports 7, 42367.

2. This kit is based on the technology published in (1) and licensed from Keio University and ID Pharma Co., Ltd.

Figure 4. Quantitative RT-PCR analysis of dopaminergic neuronal markers on Day 10. Strong up-regulation of tyrosine hydroxylase (TH), and LIM homobox transcription factor 1 alpha (LMX1A) indicates that hPSCs are differentiating into dopaminergic neurons using Quick-Neuron™ Dopaminergic – mRNA Complete Kit. The relative gene expression is normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH), and then calculated as a fold induction relative to undifferentiated hPSCs as a control. Primers used in real-time PCR experiments were listed below in Table 1.

Gene Forward primer Reverse primer Primer concentration

TH TCATCACCTGGTCACCAAGTT GGTCGCCGTGCCTGTACT 250 nM

LMX1 TCAGAAGGGTGATGAGTTTGTCC GGGGCGCTTATGGTCCTTG 300 nM

GAPDH GTCATACCAGGAAATGAGCT TGACCACAGTCCATGCCATC 200 nM

1

10

100

TH LMX1A

10,000

1,000

Rela

tive

gene

exp

ress

ion

leve

ls

Table 1 . List of PCR primers

Find more products and services available at ElixirgenScientific.com!

Live or frozenhiPS/ES cells

Livemature cells

Mon Sat - Mon

Ship Ship

as short as 1 week

Fri

1 ~3 days afterthawingFri

Live differenti-ating cells

Tue - Thu

Differentiation withQuick-TissueTM Series

Keep

Plating

Livemature cellsFrozen cells

Based on preference

Thaw, then

Freeze & Ship Plating

Quick-Tissue™ Stem Cell Differentiation Services

* This kit provides 2 wells per each tissue (total 6 wells of 24-well plate) ** This kit is for 48 wells of a 96-well microplate format

Elixirgen Scientific provides pluripotent stem cell differentiation services with the world’s fastest turnaround time. Customers can simply ship live iPS/ES cells in a T-25 flask and will receive live or fronzen cells in a week (express service) or two weeks (regular service). Contact [email protected] for more details to customize for your project.Currently Elixirgen Scientific offers all tissue types from kits for cell differentiation services. More tissue types are coming soon!

Quick-Tissue™SeriesDifferentiation Kit(mainly for 4 wells of 24-well plate)

Quick-Tissue™SeriesDifferentiationSupport

Category Product Size Request Quote (Catalog number)

Quick-Tissue™ Mesendoderm Booster 8 wells of 24-well plate $99 (EXGS-QTMB)

Quick-Tissue™ Adaptation Kit a 35-mm dish or 1 well of 6-well plate $169 (EXGS-QTA1)

New product coming soon!

Ajinomoto StemFit® Basic02 500 mL Ask (EXGS-ASB02)

Nippi iMatrix-511 silk 175 µg x 6 tubes Ask (EXGS-NI511S)

Nippi iMatrix-511 175 µg x 6 tubes $690 (EXGS-NI511)

Request Quote (Catalog number)Category Product SeV Complete Kit mRNA Complete Kit Maintenance Medium

Quick-Endothelium™ Vascular with Optional Drug Selection $399 (EXGS-QEV) $229 (EXGS-QEVM)

Quick-Trilineage™ Differentiation Kit* $549 (EXGS-Q3D)

Quick-Neuron™ Mixed $349 (EXGS-QNMSV) $129 (EXGS-QNMM)

Quick-Neuron™ Cholinergic $349 (EXGS-QNCSV) $299 (EXGS-QNC) $129 (EXGS-QNCM)

$999 (EXGS-QNCSV96)**

Quick-Neuron™ Dopaminergic $399 (EXGS-QNDSV) $399 (EXGS-QND) $169 (EXGS-QNDM)

Quick-Neuron™ GABAergic $399 (EXGS-QNGSV) $399 (EXGS-QNG) $149 (EXGS-QNGM)

Quick-Muscle™ Skeletal $349 (EXGS-QMSSV) $129 (EXGS-QMSM)

Quick-Hepatocyte™ $499 (EXGS-QHSV) $149 (EXGS-QHM)

Quick-miniBrain™ $999 (EXGS-QMBSVMR)

Reagents forMaintainingUndifferentiatedStem Cells

Elixirgen Scientific, LLC855 N. Wolfe St., Suite 619Baltimore, MD 21205Phone: (443) 869-5420Email: [email protected]

15% off for 3 or more kit

purchasesper order

15% off for 3 or more kit

purchasesper order

Quick-Neuron™ Dopaminergic mRNA Complete Kit · Preparation steps are as follows: - Dissolve 10...

Documents

Transcript of Quick-Neuron™ Dopaminergic mRNA Complete Kit · Preparation steps are as follows: - Dissolve 10...