Republic of the Philippines

Department of Education

Regional Office IX, Zamboanga Peninsula

10

SCIENCE

Quarter 3 - Module 4

PROTEINS and GENETIC MUTATION

Name of Learner: ___________________________

Grade & Section: ___________________________

Name of School: ___________________________

Science – Grade 10 Suppoert Materail for Independent Learning Engagement (SMILE) Quarter 3 – Module 4: Proteins and Genetic Mutation First Edition, 2021 Republic Act 8293, section 176 states that: No copyright shall subsist in any work of the Government

of the Philippines. However, prior approval of the government agency or office wherein the work is created shall be necessary for exploitation of such work for profit. Such agency or office may, among other things, impose as a condition the payment of royalties. Borrowed materials (i.e., songs, stories, poems, pictures, photos, brand names, trademarks, etc.) included in this module are owned by their respective copyright holders. Every effort has been exerted to locate and seek permission to use these materials from their respective copyright owners. The publisher and authors do not represent nor claim ownership over them.

Printed in the Philippines by

Department of Education – Region IX– Dipolog City Schools Division Office Address: Purok Farmers, Olingan, Dipolog City

Zamboanga del Norte, 7100

Telefax: (065) 212-6986 and (065) 212-5818

E-mail Address: dipolog.city@deped.gov.ph

Development Team of the Module

Writers: Eve M. Aleta, Andrea Marie Romero

Editor: Noel G. Solis

Reviewers: Noel G. Solis, Zyhrine P. Mayormita

Layout Artist: Chris Raymund M. Bermudo

Management Team: Virgilio P. Batan Jr. - Schools Division Superintendent

Lourma I. Poculan - Asst. Schools Division Superintendent

Amelinda D. Montero - Chief Education Supervisor, CID

Nur N. Hussien - Chief Education Supervisor, SGOD

Ronillo S. Yarag - Education Program Supervisor, LRMS

Zyhrine P. Mayormita - Education Program Supervisor, Science

Leo Martinno O. Alejo - Project Development Officer II, LRMS

Maria Lisa E. Valdehueza - School Principal, Dipolog City NHS

1

What I Need to Know

This module was designed and written in a way that suits your understanding

and needs. It was developed to help you master explaining how protein is made from

DNA. The language used recognizes the diverse vocabulary level of students. The lessons are arranged to follow the standard sequence of the course.

After going through this module, you are expected to:

1. Explain how protein is made using information from DNA. (S10LT-IIId-37)

2. Explain how mutations may cause changes in the structure and function of a protein. (S10LT-IIIe-38)

Furthermore, you should be able to accomplish the following subtasks:

1. describe DNA replication; 2. relate DNA replication to its complementary structure; and

3. describe transcription and translation.

What's In

Take a moment to look at your hands. The bone, skin, and muscle you see are made up of

cells. And each of those cells contains many millions of proteins. As a matter of fact, proteins are key molecular "building blocks" for every organism on Earth! Answer the activity below.

In this module, you will learn about how protein is made from DNA. But before getting into the topic, do you still remember your previous lesson about how the nervous system coordinates and regulates these feedback mechanisms to maintain homeostasis? If so, let us test your prior knowledge.

Activity 1: What Am I? Directions: Read each statement carefully. Select the correct answer from the word bank and write your answer on the blank space provided.

Word Bank gene genetics DNA RNA Gregor Mendel allele

1. The father of Genetics. ____________________ 2. A double-stranded molecule that carries genetic information. ____________________ 3. Responsible for the expression of genes. ____________________ 4. Functional unit of heredity. ____________________ 5. The study of genes, genetic variation and heredity. ____________________

Gregor Mendel, the Father of Genetics, explained in the year 1865 that traits are passed on

from parent to offspring through "hereditary factors." In the early 20th century, scientists established that Mendel's "hereditary factors" are called genes. The gene is the functional unit of heredity. But the individual gene makes up a bigger whole. All these genes are found in very long genetic material called the DNA or Deoxyribonucleic Acid, a double-stranded molecule. There is also another molecule that contains genetic material called Ribonucleic Acid, or RNA. On the other hand, the "allele" is responsible for gene expression. The science that deals with the study of genes, genetic variation, and heredity is called Genetics.

Did you get all answers correctly in Activity 1? In the next activity, you will learn more about the different processes of DNA and RNA.

2

What's New All living things have DNA (deoxyribonucleic acid) within their cells. DNA does

more than specify the structure and function of living things; it also serves as the primary unit of heredity in organisms of all types. In other words, whenever organisms reproduce, a portion of the

DNA is passed along to their offspring. This transmission of DNA helps ensure a certain level of continuity from one generation to the next while still allowing for slight changes that contribute to the diversity of life. The two main types of nucleic acids are deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) that carry the genetic information. Genes specify the kinds of proteins that are made by the cells, but DNA is not the direct template for protein synthesis, rather, the RNA molecules.

Image source: Central Dogma - An Inheritance Mechanism.

Retrieved from https://byjus.com/biology/central-dogma-inheritance-mechanism/January 7, 2021

The Central Dogma describes the flow of genetic information in cells from DNA to RNA to protein. It shows that DNA contains instructions for making protein, copied by RNA; RNA then uses this instruction to make proteins. A. DNA Replication

DNA is the genetic material that defines every cell. Before a cell duplicates and is divided

into new daughter cells either through mitosis or meiosis, biomolecules and organelles must be copied to be distributed among the cells. DNA found within the nucleus must be replicated in order to ensure that each new cell receives the correct number of chromosomes. The process of DNA duplication is called DNA replication.

Several steps happen for the DNA to replicate. The following are:

1. Enzymes called helicase split apart base pairs and unwind the double helix to form a pair of replication forks.

2. Free nucleotides in the cell find their complementary bases along the new strand by another enzyme DNA polymerase to form a new strand.

3. The sugar-phosphate backbone is assembled to complete the DNA strand. Two new DNA molecules, each with a parent strand and each with a new strand, are formed.

Replication uses a semi-conservative method that results in a double-stranded DNA with

one parental strand and a new daughter strand. The specificity of base pair in DNA, that is, adenine with thymine and cytosine with guanine, allows DNA to replicate itself with accuracy.

3

Image Source: Chromosomes and DNA Replication. Retrieved from https://www.quia.com/files/quia/users/napham/BIO_100/Ch_12_DNA_and_RNA/12.2_-

_DNA_Replication.pdf/ January 7, 2021

Activity 2: Match me! Directions: Below are the steps in DNA replication. Study the diagram and match it to the correct step. Write only the number of the correct sequence. Steps in DNA Replication:

1 The enzyme called helicase breaks the bond between nitrogenous bases then the two DNA strands split

2 Each strand of DNA acts as a template for the synthesis of a new complementary strand. The complementary nucleotides are added to each strand by DNA polymerase to form a new strand from the cytoplasm.

3 Replication produces two new DNA molecules, each with a parent strand and each with a new strand.

Recall the four different bases associated with DNA: A = Adenine G = Guanine T = Thymine C = Cytosine

1. Sequence No. ______

2. Sequence No. ______

3. Sequence No. ______

Image source: DNA as the Genetic Material. Retrieved from https://www.khanacademy.org/science/biology/dna-as-the-genetic-material/January 7, 2021

4

How do cells make proteins? Let's find out.

Have you ever had to transcribe something? Maybe someone left a message on your messenger, and you had to write it down quickly and roughly on paper then rewrite it down on paper neatly? As this example shows, transcription is a process in which information is rewritten. In biology, it is the process of copying the DNA sequence of a gene in a similar alphabet of RNA.

The table below summarizes the key differences between DNA and RNA. Composition DNA RNA

Name Deoxyribonucleic Acid Ribonucleic Acid

Function Long-term storage of genetic information; transmission of genetic information to make other cells and new organism.

Used to transfer the genetic code from the nucleus to the ribosomes to make proteins.

Composition of Bases and Sugar

Deoxyribose sugar, phosphate backbone Adenine (A), Guanine (G), Cytosine (C), Thymine (T) bases.

Ribose sugar, phosphate backbone, Adenine (A), Guanine(G), Cytosine (C), Uracil (U) bases

Base pairing A-T and G-C A-U and G-C Source: Differences between DNA and RNA.

Retrieved from https://microbiologyinfo.com/differences-between-dna-and-rna/ January 8, 2021

Ribonucleic acids or RNA are nucleic acids involved in the translation and transcription of genetic information from DNA. RNA contains uracil instead of thymine. There are three kinds of RNA involved in the synthesis of proteins.

A. Transcription The next event in building protein is transcription. It is the process of converting

the genetic information in DNA to synthesize protein. RNA polymerase produces a complementary RNA strand called a primary transcript.

Central Dogma Image Source: Translation (Protein Synthesis)- Definition, Enzymes and Steps.

Retrieved from https://microbenotes.com/translation-protein-synthesis/

5

Transcription (making of mRNA from DNA) involves the following steps: 1. DNA double helix unwinds to express the nucleotide bases. 2. RNA polymerase identifies the start sequence and unwinds and matches

RNA nucleotide bases to DNA, using one side as a template. 3. The mRNA strand is created. It now compliments the original DNA strand

(G-C and A-U). Hence if the sequence of bases on the DNA strand were CCG TTA CAT, the sequence of bases on the mRNA strand would be GGC AAU GUA.

4. Ligase helps the strand of DNA to close again. 5. The mRNA strand moves out of the nucleus to ribose, and DNA rejoin. The following illustrates the transcription process.

The Transcription Process.

Image Source: Transcription. Retrieved from https://www.onlinebiologynotes.com/transcription-in-prokaryotes/ last January 7, 2021.

Image Source: Complementary base pair from DNA to mRNA

Retrieved from www.microbenotes.com/translation-protien-synthesis last January 7, 2021

B. Translation

The DNA molecule directs the synthesis of protein and determines the formation of

mRNA. The order of bases of mRNA determines the protein synthesized. During translation, the mRNA is "read" according to the genetic code, which relates

the DNA sequence to the amino acid sequence in proteins. Each group of 3 bases in mRNA constitutes a codon, and each codon specifies a particular amino acid (hence, it is a triplet code). The mRNA sequence is thus used as a template to assemble—in order—the chain of amino acids that form a protein. Translation occurs in a structure called the ribosome, which is a factory for the synthesis of proteins. The ribosome has a small and a large subunit and is a complex molecule composed of several ribosomal RNA molecules and a number of proteins.

6

Translation of an mRNA molecule by the ribosome occurs in three stages: initiation, elongation, and termination.

1. During initiation, the small ribosomal subunit binds to the start of the mRNA sequence. Then a transfer RNA (tRNA) molecule carrying the amino acid methionine binds to what is called the start codon of the mRNA sequence. The start codon in all mRNA molecules has the sequence AUG and codes for methionine. Next, the large ribosomal subunit binds to form the complete

initiation complex. 2. During the elongation stage, the ribosome continues to translate each codon in

turn. Each corresponding amino acid is added to the growing chain and linked via a bond called a peptide bond. Elongation continues until all of the codons are read.

3. Lastly, termination occurs when the ribosome reaches a stop codon (UAA, UAG, and UGA). Since there are no tRNA molecules that can recognize these codons, the ribosome recognizes that translation is complete. The new protein is then released, and the translation complex comes apart.

The figure below summarizes the translation process.

In the next activity you will copy the information of a strand of DNA into a new RNA

molecule. Let us do it!

Activity 3: What's the Message? Directions: For each of the following sequence of DNA, supply the correct mRNA. You can get them from the box. Write your answer on the blank below the DNA strand.

1. DNA TAC TAG GGC CTG CCA ATA ATG GCA ACG TGA

mRNA _______________________________________________________________

The DNA directs the production of proteins and determines the formation of mRNA. The order of bases of mRNA determines the protein synthesized.

Would you like to find out how the message of mRNA is translated to proteins?

Let's do the next activity.

DNA transcription and translation. Retrieved from https://www.scq.ubc.ca/a-monks-flourishing-garden-the-basics-of-molecular-

biology-explained/ last January 8, 2021

UAC AUG CCG AUC UAU GAC CGU UGC GGU ACU

7

Activity 4: Relay the Message Direction: Fill in the blanks the correct triplet codon to form the sequence of tRNA.

Select them from the box.

1. DNA TAC TCT CCC AAA AAA TAC CAC CCC ATC

mRNA AUG AGA GGG UUU UUU AUG GUG GGG UAG

tRNA ________________________________________________________________

Proteins such as enzymes are amino acids chained together in a certain order. Each group of three nucleotide bases represents a codon in a DNA or mRNA that corresponds to a specific amino acid or a start/stop signal. The codon has its complement anticodon in tRNA. Each amino acid that will form the protein molecule to be synthesized is determined by the triplet codon on the mRNA.

In the next activity, you will finally encode for a certain kind of amino acid using the information in the Genetic Code table.

Activity 5: Trace the Code

Direction: 1. Complete the table. 2. Refer to the Genetic Code Table to identify the amino acid. 3. To identify the amino acid, look at the bases in the mRNA codon, e.g., AUG 4. Using the Genetic Code Table below, you can find three encircled letters to show how it

is used. Look for the first encircled letter of the mRNA codon on the left side of the genetic code table (A), the second encircled letter of the mRNA on the second letter column (U), and the third encircled letter on the right side (G). AUG codes for the amino acid Met or methionine.

5. Do the same with the other codons in the table.

Order of bases in

DNA Order of bases in the mRNA (codon)

Order of bases in tRNA

Amino Acid Coded in Proteins

TAC AUG UAC Met

CAC GUG CAC

CCC GGG CCC

CGT GCA CGU

ATG UAC AUG

GCT CGA GCA

UCU CCC UAC AAA CAC UAC CCC AUC AAA

1 Source:eweb.furman.edu/bio111/code.htm 2 Source: https://www.pinterest.ca/pin/774124920419869/

20 primary Amino Acids in the Genetic Code

8

DNA replication takes place whenever new cells are made, like during growth or every time a wound heals. Although DNA replication is tightly regulated and remarkably accurate, errors do occur. These errors are called mutations—and when they happen in cells that give rise to eggs and sperm, they are a source of new genetic variations that can be passed on to offspring. What is a mutation? What are the types of mutation? Let's find out with the following

activities.

Activity 6: Mr. Tiger Directions: The questions for this activity relate to the tiger shown in this photograph. 1. Describe the color of the tiger. What

determines the color of the tiger’s coat? ________________________________________ _______________________________________

2. If the DNA sequence for the tiger’s coat color were to change, what would this be called?______________________________________________________________________________

____________________________________________________________________________. 3. In rare occasion a white tiger is born in the wild. Explain how a mutation could cause

this tiger to have a white coat instead of an orange coat. __________________________________________________________________________________________________________________________________________________________

Adapted from: All Sorts of Mutations: Changes in the Genetic Code. Retrieved from https://www.teachengineering.org

/lessons/view/uoh_mutations_lesson01.

What is it

Mutations are heritable changes in the genetic coding instructions of DNA. They are essential to the study of genetics and are useful in many other biological fields.

Types of Mutations

In multicellular organisms, we can distinguish between two broad categories of mutations: somatic mutations and germline mutations. Somatic mutations arise in somatic tissues, which do not produce gametes. These mutations are passed on to other cells through the process of mitosis, which leads to a population of genetically identical cells (a clone). The effect of these mutations depends on many factors, including the type of cell in which they occur and the developmental stage at which they arise. Many somatic mutations have no obvious effect on the phenotype of the organism because the function of the mutant cell (even the cell itself) is replaced by that of normal cells. However, cells with a somatic mutation that stimulates cell division can increase in number and spread; this type of mutation can give rise to cells with a selective advantage and is the basis for all cancers. Germline mutations arise in cells that ultimately produce gametes. These mutations can be passed to future generations, producing individual organisms that carry the mutation in all their somatic and germline cells (Al-Nuaimi, 2020).

Point mutation occurs when one DNA base is replaced by another, resulting in a change of codon in the RNA sequence. It can be classified either as transition or transversion.

o Transition happens when adenine is replaced by guanine or vice versa. This also happens when cytosine is replaced by thymine or vice versa.

o Transversion occurs when either adenine or guanine is replaced by thymine or cytosine, respectively.

Image source: There Are More “Pet” Tigers Than There Are in the Wild. How

Did That Happen? (2018). Retrieved from https://www.livescience.com/62863-more-tigers-pets-than-wild-

9

A point mutation can also be classified as nonsense, missense, and silent mutation.

Frameshift mutation occurs when the mutation changes a reading frame of RNA. Insertion and deletion are both frameshift mutations.

Let us learn more about the types of mutations and how it affects the structure and function of proteins.

What's More

Activity 7- Part A: You Complete Me! Complete the boxes below. Classify each case as deletion, insertion or substitution and as frameshift, missense, silent or nonsense. (Hint: deletion or insertion will always be frameshift.)

Original DNA Sequence mRNA Sequence Amino Acid Sequence:

T A C A C C T T G G C G A C G A C T

Mutated DNA Sequence #1

What's the mRNA Sequence? What will be the Amino Acid Sequence? Will there likely be effects?

T A C A T C T T G G C G A C G A C T

What kind of mutation is this?

Mutated DNA Sequence #2 What's the mRNA Sequence? What will be the Amino Acid Sequence? Will there likely be effects?

T A C G A C C T T G G C G A C G A C T What kind of mutation is this?

Deletion occurs when one or more DNA pairs are lost.

Insertion occurs when one or more DNA pairs are added.

10

Mutated DNA Sequence #3 What's the mRNA Sequence? What will be the Amino Acid Sequence? Will there likely be effects?

T A C A C C T T A G C G A C G A C T What kind of mutation is this?

Mutated DNA Sequence #4

What's the mRNA Sequence? What will be the Amino Acid Sequence? Will there likely be effects?

T A C A C C T T G G C G A C T A C T

What kind of mutation is this?

Mutated DNA Sequence #5 What's the mRNA Sequence? What will be the Amino Acid Sequence? Will there likely be effects?

T A C A C C T T G G C G A C T A C T What kind of mutation is this?

Adapted from: https://www.cs.allegheny.edu/sites/jjumadinova/teaching/300/DNAMutationWorksheetKey.pdf

1. A type of mutation that can cause new variations of a protein. __________________________________ 2. A type of mutation that results in abnormal amino acid sequence. __________________________________ 3. A type of mutation that stops the translation of the mRNA. __________________________________

Activity 7 - Part B: Chromosome Mutations For each diagram below, indicate what type of chromosome mutation is illustrated. Choose from: deletion, insertion/duplication, inversion, and translocation

What I Have Learned

Activity 8: My mRNA! Direction: Suppose a template strand of DNA is copied into mRNA. What would be the complementary strand of mRNA? Write your answer on the blank provided.

DNA TAC GGA TAA CTA CCG GGT ATT CAA

mRNA ___________________________________________________

Answers:

A: ____________________________

B: ____________________________

C: ____________________________

D: ____________________________

11

What I Can Do

Activity 9: What's My Amino Acid Direction: Read the instruction given for each step and write the correct answer in the box.

Gene 1 TACTTGTTTACATAACTTTGAATT Step 1. Transcribe the DNA to mRNA Step 2. Draw lines to separate the mRNA into codons (3 bases). Step 3. Using the newly made mRNA, translate it into its corresponding protein fragment. Refer

to Figure 1 (The Genetic Code Table). Don't forget to look for the start and stop codon.

Assessment Direction: Circle the letter of the best answer.

1. Which of the following refers to the process of copying a DNA molecule into two identical copies?

A. Replication B. Reverse Transcription C. Transcription D. Translation

2. What will be the complementary DNA strand of GAATCT during DNA replication? A. CTATGA B. CTTAGA C. GTACTT D. TCTAAG

3. Which of the following events happens during transcription? A. Amino acid sequence forms into a protein.

B. DNA nucleotide sequences are changed into amino acids. C. RNA gets translated into DNA. D. RNA polymerase adds RNA nucleotides to the DNA template.

4. What process makes a copy of mRNA from the DNA molecule? A. Replication B. Transformation C. Transcription D. Translation

5. Which of the following represents the flow of genetic information in the cells? A. DNA to Protein to RNA B. DNA to RNA to Protein C. Protein to DNA to RNA D. RNA to Protein to DNA

6. What is the work of tRNA during protein synthesis? A. Bring information from the DNA to protein. B. Block the process of translation. C. Deliver Amino acid to the mRNA strand. D. Send the mRNA out in the cytoplasm.

12

7. A type of mutation that occurs when one DNA base is replaced by another. It results in a change of codon in the RNA sequence.

A. point mutation B. frameshift mutation C. deletion D. insertion

8. It occurs when the mutation changes a reading frame of RNA.

A. frameshift mutation B. point mutation C. substitution D. DNA mutation

9. What is common between transversion and transition? A. base substitution B. base deletion C. base insertion D. base addition

10. A base substitution mutation in a gene sometimes has no effect on the protein the gene codes for. Which of the following factors could account for this?

A. the rarity of such mutations B. some amino acids have more than one codon C. a correcting mechanism that is part of the mRNA molecule

D. A and B

Additional Activities

Activity 10: Sickle Cell Anemia Sickle cell anemia is the result of a type of mutation in the gene that codes for part of the hemoglobin molecule. Recall that hemoglobin carries oxygen in your red bloods cells. The mutation causes these red blood cells to become stiff and sickle-shaped when they release their oxygen. The sickled cells tend to get stuck in blood vessels, causing pain and increased risk of stroke, blindness, damage to the heart and lungs, and other conditions. Direction: Analyze the DNA strands below to determine what amino acid is changed and what type of mutation occurred.

Normal hemoglobin DNA C A C G T A G A C T G A G G A C T C

Normal hemoglobin mRNA

Normal hemoglobin AA sequence

Sickle cell hemoglobin DNA C A C G T A G A C T G A G G A C A C

Sickle cell hemoglobin mRNA

Single-cell hemoglobin AA sequence

Type of mutation: Adapted from: DNA Mutation Worksheet. Retrieved from https://www.cnhs.org/ourpages/auto/2018/3/19/43135176/DNA%20Mutations%20Worksheet.pdf

13

Answer Key Gr10Q3 Module 4 Activity 1: What Am I 1. Gregor Mendel; 2. DNA; 3. RNA; 4. Gene; and 5. Genetics Activity 2: Arrange and Match 1. 1; 2. 3; and 3. 2 Activity 3: What’s the Message Box 1: AUG AUC CCG GAC GGU UAU UAC CGU UGC ACU Activity 4: Relay the Message Box 1: UAC UCU CCC AAA AAA UAC CAC CCC AUC

Activity 5: Trace the Code 1. Val; 2. Gly; 3. Ala; 4. Tyr; and 5. Arg Activity 6: Mr. Tiger 1. Genes, DNA 2. MUTATION 3. A mutation to the gene that codes for the coat color to be orange could cause the coat to change to white. Activity 7 – Part A: You Complete Me! ORIGINAL DNA SEQUENCE: T A C A C C T T G G C G A C G A C T mRNA sequence: A U G U G G A A C C G C U G C U G A Amino Acid Sequence: MET -TRP-ASN - ARG- CYS - (STOP) Mutated DNA Sequence #1: T A C A T C T T G G C G A C G A C T What’s the mRNA sequence? A U G U A G A A C C G C U G C U G A What will be the amino acid sequence? MET-STOP Will there likely be effects? YES What kind of mutation is this? POINT MUTATION- NONSENSE

Mutated DNA Sequence #2: T A C G A C C T T G G C G A C G A C T What’s the mRNA sequence? A U G C U G G A A C C G C U G C U G A What will be the amino acid sequence? MET - LEU -GLU– PRO-LEU-LEU Will there likely be effects? YES What kind of mutation is this? INSERTION - FRAME SHIFT Mutated DNA Sequence #3: T A C A C C T T A G C G A C G A C T What’s the mRNA sequence? A U G U G G A A U C G C U G C U G A What will be the amino acid sequence? MET-TRP-ASN- ARG- CYS (STOP) Will there likely be effects? NO What kind of mutation is this? POINT MUTATION- SILENT Mutated DNA Sequence #4: T A C A C C T T G G C G A C T A C T What’s the mRNA sequence? A U G U G G A A C C G C U G A U G A What will be the amino acid sequence? MET-TRP- ASN- ARG- (STOP) Will there likely be effects? YES What kind of mutation is this? POINT MUTATION- NONSENSE Mutated DNA Sequence #5: T A C A C C T T G G G A C G A C T What’s the mRNA sequence? A U G U G G A A C C C U G C U G A What will be the amino acid sequence? METHIONINE-TRYPTOPHAN-ASPARAGINE- PROLINE - ALANINE Will there likely be effects? YES What kind of mutation is this? DELETION – FRAME SHIFT

1. FRAMESHIFT AND MISSENSE 2. FRAME SHIFT, NONSENSE, AND MISSENSE 3. NONSENSE

Activity 8: My mRNA 1. AUG; 2. CCU; 3. AUU; 4. GAU; 5. GGC; 6. CCA; 7. UAA; and 8. GUU

Activity 9: What’ my Amino Acid 2. Box 1: AUGAACAAAUGUAUUGAAACUUAA 3. Box 2: 4. AUG-AAC-AAA-UGU-AUU-GAA-ACU-UAA 5. Box 3: 6. Met-Asn-Lys-Cys-Ile-Glu-Thr-Stop

Assessment: 1.A; 2. B; 3. D; 4. C; 5. B; 6. A; 7. A; 8. A; 9. A; and 10. B Activity 10: Sickle Cell Anemia Normal hemoglobin DNA - C A C G T A G A C T G A G G A C T C Normal hemoglobin mRNA - G U G C A U C U G A C U C C U G A G Normal hemoglobin AA sequence - VAL-HIS-LEU-THR-PRO-GLU Sickle cell hemoglobin DNA - C A C G T A G A C T G A G G A C A C Sickle cell hemoglobin mRNA - G U G C A U C U G A C U C C U G U G Single cell hemoglobin AA sequence - VAL-HIS-LEU-THR-PRO-VAL Type of Mutation: Point Mutation

14

References Al-Nuaimi, Bareq. (2020). Gene Mutations. 10.13140/RG.2.2.15494.32323. Retrieved from https://www.researchgate.net /publication/340091209_Gene_Mutations last January 5 (Dotpound). July 7, 2017. Transcription and Translation. Retrieved from

http://www.dotpound.Blogspot.coml2017/07/31 /transcription-and-translation.html/ (Jagranjosh). (no date). What is the difference between DNA and RNA.Retrieved from http: www.Jagranjosh.com/general -knowledge-what-is-the-difference-between-dna-rna1486384100-1 (Khan Academy). (no date).Gene expression and regulation. Retrieved from http://www.Khanacademy.org/science/ap-biology /gene-expression-and-regulation/molecules-Mechanism-of-dna-replication Shona Cox. (modified 5 years ago). Protein Synthesis Notes. Retrieved from http://www.Slideplayer.com/slide/7815744' protein Synthesis Notes 409-410

Department of Education (2015). Science 10 Learner's Material. First Edition. Department of Education-Bureau of Learning Resources (DepEd-BLR) Unit 17: The DNA and Protein Synthesis, Science 10Retrieved from https://link.quipper.com/en/organizations /5468b5cb2294ee080200005e/curriculum#curriculum last January 7, 2021 Mutate a DNA Sequence Activity. Retrieved from https://teach.genetics.utah.edu/content/genetics/files/mutation-instructions.pdf last January 7, 2021 DNA Mutation Worksheet. Retrieved from https://www.cnhs.org/ourpages/auto/2018/3/19/43135176/ DNA%20Mutations%20Worksheet.pdf