Molecular cloning and mRNA expression analysis of interleukin-8gene in Japanese sea perch (Lateolabrax japonicus)

Lihua Qiu Æ Hanhua Zhang Æ Keng Yang ÆShigui Jiang

Received: 16 April 2008 / Accepted: 2 June 2008 / Published online: 19 June 2008

� Springer Science+Business Media B.V. 2008

Abstract Interleukin-8 (IL-8), the first known chemo-

kine, is a CXC chemokine, which is cable of attracting

neutrophils and inducing them to release lysozomal

enzymes, triggering the respiratory burst. In the present

study, the cDNA of an IL-8 was cloned from Japanese sea

perch Lateolabrax japonicus (designated LjIL-8) by

homology cloning and rapid amplification of cDNA ends

(RACE) approaches. The full-length cDNA of LjIL-8

consisted of 803 nucleotides with a canonical polyadenyl-

ation signal sequence AATAAA and a poly(A) tail, and an

open reading frame (ORF) of 300 bp encoding a poly-

peptide of 99 amino acid residues with a predicted

molecular weight of 6.6 kDa. The high identity of LjIL-8

with IL-8 in other organisms indicated that LjIL-8 should

be a new member of the IL-8 family. By fluorescent

quantitative real-time PCR, mRNA transcript of LjIL-8

was detectable in all the examined tissues with higher level

in spleen and head-kidney. The temporal expression of

LjIL-8 mRNA in the spleen was up-regulated by lipop-

olyssacharide (LPS) stimulation and reached the maximum

level at 6 h post-stimulation, and then dropped back to the

original level gradually. These results indicated that LjIL-8

was a constitutive and inducible acute-phase protein that

perhaps involved in the immune defense of L. japonicus.

Keywords Interleukin-8 � Molecular cloning �mRNA expression � Lateolabrax japonicus

Introduction

Cytokines are low molecular weight proteins that serve as

chemical messengers within the innate and adaptive immune

systems. Closely related pro-inflammatory chemotactic

cytokines, called chemokines, attract and activate specific

types of leukocytes, such as lymphocytes and neutrophils [1].

The chemokines are a superfamily of approximately 40

different small secreted cytokines that direct the migration of

immune cells to sites of infection [2].

To date, four different subfamilies of chemokines have

been identified, based on highly conserved amino-terminal

cysteine residues. The two major subfamilies, CC and CXC,

are distinguished by the separation of the first two cysteines in

their amino acid sequences by a single amino acid [3]. Inter-

leukin-8 (IL-8) is a CXC chemokine, and the first known

chemokine, produced by monocytes/macrophages, fibro-

blasts, vascular endothelial cells, mast cells, epithelial cells,

and a wide variety of tissue cells, upon exposure to inflam-

matory stimulants [4]. IL-8 mainly attracts neutrophils and

induces them to release lysozomal enzymes [5], undergo a

change in shape, triggers the respiratory burst [6–7], and

increases the expression of adhesion molecules on the cell

surface [8]. IL-8 contains four cysteines, the first two of which

are separated by one amino acid. Cysteine residues have an

important role in the tertiary structure of proteins [9]. The

neutrophil-attracting ability of IL-8 can be attributed to the

presence of a Glu-Leu-Arg (ELR) motif adjacent to the CXC

motif at its N-terminus, presumably by affecting its binding to

specific receptors. CXC chemokines lacking an ELR motif, in

contrast, specifically attract lymphocytes and not neutrophils.

L. Qiu � H. Zhang � K. Yang � S. Jiang (&)

Biotechnology and aquiculture Laboratory, The South China Sea

Fisheries Research Institute, Chinese Academy of Fishery

Sciences, 231 Xingangxi Road, Guangzhou 510300,

People’s Republic of China

e-mail: Jiangsg@21cn.com

L. Qiu

The Centre for Applied Aquatic Genomics, Chinese Academy

of Fishery Sciences, Beijing 100039,

People’s Republic of China

123

Mol Biol Rep (2009) 36:1099–1105

DOI 10.1007/s11033-008-9284-6

With the development of the technique of gene cloning,

molecular techniques have recently enabled the identifi-

cation of fish cytokine genes. Till now, the molecular

structure of IL-8 has been determined in many fish since its

initial isolation from humans, including rainbow trout

(Oncorhynchus mykiss) [10], flounder (Paralichthys oli-

vaceus) [11], lamprey (Lampreta fluviatilis) [12], dogfish

(Triakis scyllia) [13], black seabream (Acanthopag-

rus schlegeli) (GenBank No. DQ000611).

Japanese sea perch is an important cultured marine fish

species in china. The main objectives of this study are (1)

to clone the full length cDNA of IL-8 from Japanese sea

perch and compare it to other known IL-8 genes to prove

the existence of IL-8 in sea perch, (2) to investigate the

expression pattern of IL-8 gene in the tissues, (3) to provide

information about if LPS could induce the expression of

IL-8 in Lateolabrax japonicus.

Materials and methods

Animals and immune challenge

The healthy Japanese sea perch fish (L. japonicus),

weighing about 200 g, were purchased from Guangzhou,

Guangdong province, P. R. China. Fifty fish were main-

tained in aerated seawater (salinity 30) at 24–25�C for

3 days before processing.

For gene cloning, three fish weighing about 200 g were

employed and kept in the tank. Two hundred microlitres of

LPS (10 lg ml-1, resuspended in water) was injected into

the muscle of each fish. Six hours later, the spleen from the

three fish was collected, mixed, and subjected to total RNA

extraction.

For the challenge experiment, 40 fish were employed.

Two hundred microlitres LPS (10lg ml-1) were injected

into the muscle of each fish and they were used as the

stimulated group. The untreated fish and fish injected with

200 ll water were used as the blank and the control

group, respectively. The injected fish were returned to

seawater tanks, and three individuals from the blank,

control, and stimulated group, respectively, were ran-

domly collected at 2, 4, 6, 8, and 10 h post-injection. At

each time point, the spleen from the three individuals

were collected and mixed. They were subjected to total

RNA extraction.

Total RNA isolation

Total RNA was isolated from the tissues of the fishes using

Trizol (Invitrogen, Japan) reagent following the protocol of

the manufacturer, and resuspended in DEPC-treated water

and stored at -80�C.

Synthesis of the cDNA first strand

cDNA was synthesized from 2 lg of mRNA by Moloney

Murine Leukemia Virus reverse transcriptase (M-MLV,

Promega, USA) at 42�C for 50 min with oligo-dT adaptor

primer (Table 1) following the protocol of the manufac-

turer. The cDNA was used as template for PCR reactions.

IL-8 gene cloning and sequencing

Initially, PCR was performed using the cDNA prepared

above as template, with the degenerated primers of Fe and

Re (Table 1) designed according to the conserved regions

of other known IL-8 gene sequences, in order to obtain

the partial fragment of IL-8 gene from sea perch. The

obtained PCR products were separated by 1.5% agarose

gel, and then purified by PCR purification kit. The puri-

fied PCR product was ligated with the PMD18-T vector

(TaKaRa, Japan), and transformed into the competent

Escherichia coli cells. The recombinants were identified

through blue–white color selection and screened with

M13 forward and reverse primers. Three of the positive

clones were sequenced on an ABI3730 Automated

Sequencer (Applied Biosystem). Sequences generated

were analyzed for similarity with other known sequences

using the BLAST programs (http://www.ncbi.nim.nih.

gov/).

Having isolated a partial sea perch IL-8 sequence, the

50and 30ends of mRNA were obtained by rapid amplifica-

tion of cDNA ends (RACE) methods, using gene-specific

primers shown in Table 1. In 30 RACE-PCR, PCR reaction

was performed with primer F1 and adaptor primer

(Table 1), while a second semi-nested PCR was carried out

with primer F2 and the adaptor primer. In 50 RACE –PCR,

Table 1 Oligonucleotide primers used in experiments

Primer name (50 ? 30) Nucleotide sequence

Fe TGCCRCTGCATHGARAC

Re ACTTGTTVATGACYHTCTTVACCCA

F1 CAGAGAATCGGCACAGACAG

F2 GGCACAGACAGCAGATAAGG

R1 CTGTCTGTGCCGATTCTCTG

R2 CACATCACCTGTCTTTTGGC

oligo-dT adaptor GGCCACGCGACTAGTAC(T)16

Adaptor GGCCACGCGACTAGTAC

oligo-dG GGGGGGGGGGGGGGGH

RactinF CAACTGGGATGACATGGAGAAG

RactinR TTGGCTTTGGGGTTCAGG

rIL8F GTGGTGCTCCTGGCTTTCTT

rIL8R ATGGGTTTGCTCTCCGTCTC

1100 Mol Biol Rep (2009) 36:1099–1105

123

the first strand cDNA obtained was tailed with poly (C) at

the 50 ends using terminal deoxynucleotidyl transferase

(TdT, TaKaRa, Japan). PCR was performed initially with

primer R1 and Oligo-dG, followed by semi-nested PCR

with R2 and Oligo-dG. The PCR products were gel-puri-

fied, sequenced, and the resulted sequences were subjected

to be analyzed.

Generated sequences were analyzed for similarity with

other known sequences using the BLAST program (http://

www.ncbi.nlm.nih.gov/BLAST/). Multiple sequence

alignments were performed using the CLUSTAL W pro-

gram at the European Bioinformatics Institute (http://www.

ebi.ac.uk). Analyses of the deduced amino acid sequences

utilized the programs PSORT (Kenta Nakai, National

Institute Basic Biology), Scan Prosite (EXPASy Molecular

Biology Server), and Predict Protein (EMBL-Heidelberg).

The phylogenetic tree was constructed by the neighbor-

joining (NJ) method using the Treecon program (Van de

Peer and De Wachter 1994).

Quantification of PmcathepsinC expression by

quantitative real time PCR

Real-time quantitative PCR (qRT-PCR) was performed

with the SYBR Green 2 9 Supermix (Applied Biosystems,

USA) on an ABI 7300 Real-Time Detection System

(Applied Biosystems, USA) to investigate the expression

of LjIL-8. Two specific primers, rIF and rIR (Table 1) were

used to amplify a PCR product of 118 bp. b-actin was

chosen as the reference gene for internal standardization.

Two b-actin primers ractinF and ractinR (Table 1) were

used to amplify a b-actin gene fragment of 110 bp as the

internal control for qRT-PCR. The qRT-PCR amplifica-

tions were carried out in triplicates in a total volume of

20 ll containing 10 ll of 2 9 Supermix (Applied Biosys-

tems, USA), 5 ll of the 1:5 diluted cDNA, 1 ll each of

forward and reverse primer and 3 ll PCR grade water, The

qRT-PCR program was 50�C for 2 min, 95�C for 10 min,

followed by 40 cycles of 94�C for 15 s, 61�C for 30 s,

72�C 30 s. Melting curve analysis of amplification prod-

ucts was performed at the end of each PCR reaction to

confirm that only one PCR product was amplified and

detected. After the PCR program, qRT-PCR data from

three replicate samples were analyzed with a 7300 System

SDS Software v1.3.0 (Applied Biosystems, USA) to esti-

mate transcript copy numbers for each sample. To maintain

consistency, the baseline was set automatically by the

software. The comparative CT method was used to analysis

the expression level of LjIL-8. The CT for the target

amplification of IL-8 and the CT for the internal control

b-actin were determined for each sample. Differences

between the CT for the target and the internal control,

called DCT, were calculated to normalize the differences in

the amount of total nucleic acid added to each reaction and

the efficiency of the RT-PCR. The blank group was used as

the reference sample, called the calibrator. The DCT for

each sample was subtracted from the DCT of the calibrator;

the difference was called DDCT value. The expression level

of LjIL-8 could be calculated by 2-DDCT, and the value

stood for an n-fold difference relative to the calibrator. The

average cycle threshold (CT) measurement for the three

determinations were used in calculations of relative

expression using b-actin as the internal control. The data

obtained from RT-PCR analysis were subjected to one-way

analysis of variance (one-way ANOVA) followed by an

unpaired, two-tailed t-test. Differences were considered

significant at P \ 0.05.

Results

Cloning and sequence of LjIL-8 gene

Three overlapping products were obtained by RT-PCR

amplification (Fig. 1), which comprised the full-length sea

perch IL-8 cDNA. The sequence consisted of 803 nucleo-

tides including a 300 bp single open reading frame (ORF),

a 159 bp 50 untranslated region (50 UTR) and a 359 bp 30

UTR. In the 30 UTR, there were five RNA instability motifs

(ATTTA), a 15 bp poly (A) tail and a putative polyade-

nylation signal (AATAAA) which located 17 bp upstream

of the poly (A)+ tail. The open reading frame encoded a 99

amino acids precursor peptide with a molecular weight

about 6.6 kDa, and theoretical point of 5.51.

Four cysteine residues were present in the peptide at

positions 34, 36, 61, and 78, conforming to the CXC pat-

tern. Preceding the CXC motif were the residues Glu-Leu-

His

(ELH). Using the signal program, a putative signal

peptide was predicted at the N-terminus of the sea perch

peptide that would cleave between Gly22 and Met23.

Homology analysis

Comparison of the trout sequence with some published

CXC chemokine sequences using the BLAST program

showed that this molecule was closest in identity to ver-

tebrate IL-8 molecules (Table 2). The sea perch chemokine

shared 39% amino acid identity to human IL-8, whereas

identity to other human CXC chemokines was lower.

Identity shared between the sea perch molecule and

chicken IL-8 was also high relative to the chicken CXC

chemokine. When compared to other fish chemokines, the

sea perch molecule showed high identity to the fugu

rubripes (85%) and black sea bream IL-8 (86%).

Mol Biol Rep (2009) 36:1099–1105 1101

123

Multiple alignments shows the predicted sea perch sig-

nal sequence aligns exactly with confirmed signal peptide

cleavage positions within vertebrate IL-8 molecules. And

all the four cysteine residues are in conserved positions

with respect to vertebrate IL-8 (Fig. 2).

Based on the nucleotide acid sequence of IL-8 genes, a

phylogenetic tree was constructed (Fig. 3). All the piscine

IL-8, such as those of flounder, black seabream, sea perch,

and carp, were clustered together and formed a group apart

from other animals’ IL-8 including the chicken, and other

mammalians. The relationships displayed in the phylogenic

tree were corresponded to their classification position.

Tissue distribution of the LjIL-8 transcripts

Real-time quantitative PCR was employed to quantify the

LjIL-8 expression in the tissues of heart, gill, head-kidney,

spleen, liver, and brain. The amplification specificity for

LjIL-8 and b-actin was determined by analyzing the dis-

sociation curves. Only one peak presented in the

dissociation curves for both the LjIL-8 and b-actin gene

(data not shown), indicating that the amplifications were

specific.

LjIL-8 mRNA was found to be constitutively expressed

in all the examined tissues with significant variation of

expression level. There was a high-level expression of

LjIL-8 in spleen and head-kidney, while a low-level

expression in gill, liver, heart, and brain. The highest level

of IL-8 expression was detected in spleen (Fig. 4).

Quantification of LjIL-8 mRNA expression after LPS

stimulation

The temporal expression of the LjIL-8 transcript in spleen

of fish after LPS stimulation was shown in Fig. 5. During

the first 2 h after LPS stimulation, the IL-8 mRNA

remained at a low level. At 4 h after stimulation, the

expression of the LjIL-8 was up regulated and there was a

significant increase in the relative abundance of LjIL-8

mRNA. At 4 and 6 h post-LPS stimulation, the LjIL-8 gene

expression level was 7.5- and 9.1-fold higher than that

observed in the control group, respectively. As time

Fig. 1 The Japanese sea perch IL8 sequence. The arrow indicated the

signal peptide cut site, and the signal peptide was in box; the CXC

motif was in the highlighted; the RNA instability motif were

underline and the polyadenylation signal sequence was highlighted

and underlined; the spark showed the stop code

Table 2 Homology of IL-8

protein of sea perch with other

known chemokines amino acids

Species Similarity (%) Identity (%) E-value Accession number

Human IL-8 59 39 6e-11 Z11686

Human CXCL1 55 36 6e-10 J03561

Human CXCL2 56 37 5e-10 M57731

Sheep IL-8 58 38 6e-11 X78361

Chicken IL-8 69 46 1e-13 NM205498

Chicken K60 62 45 5e-14 Y14971

Zebrafish IL-8 77 58 9e-27 AY340959

Rainbow trout IL-8 78 63 2e-28 AY160981

Common carp IL-8 80 62 2e-29 DQ453125

Common carp CXC 79 63 1e-27 AJ550164

Flounder IL-8 88 72 8e-34 AF216646

Flounder CXC 87 72 2e-34 AB070837

Black sea bream IL-8 89 86 1e-36 DQ000611

Fugu rubripes IL-8 92 85 2e-38 AB125645

1102 Mol Biol Rep (2009) 36:1099–1105

123

progressed, the expression of LjIL-8 mRNA decreased and

almost recovered to the original level at 10 h post-stimu-

lation. The expression of LjIL-8 in control and blank

groups did not significantly change at all time point. An

unpaired, two-tailed t-test with blank and challenged

groups showed statistically significant difference in LjIL-8

gene expression at 1, 6, and 8 h (P \ 0.05) post-stimula-

tion. However, no significant difference was observed in

other time point in challenge group (Fig. 5).

Discussion

This study presents the cloning of IL-8 in the Japanese sea

perch (L. japonicus) stimulated with LPS using the tech-

nique of homology. This cDNA contained an open reading

Fig. 2 Multiple alignments of

Japanese sea perch IL8 with

other known IL8 amino acids

sequences, residues aligned by

the CLUSTAL W program.

Identical and similar sites were

shown with sparks (*) and dots

(. Or : ) , respectively; the arrow

indicated the signal peptide cut

site; the conserved cysteines

were highlighted, and ELR

motif which associated with

neutrophil attracting in

mammalian was in the box

Black sea bream8176

Sea perch64

Fugu rubripes60 Flounder

100 Atlantic cod

Common carp

Common carp CXC100

Chicken

Human

Cat100

Sheep86Pig59

0.1

Fig. 3 A molecular phylogenetic tree of IL-8 proteins based on the

NJ method with values for each internal branch determined by

bootstrap analysis with 1,000 replications. The values indicate

percentages along the branch

0

10

20

30

40

50

60

70

Heart Gill Brain Liver HK Spleen

Tissues

The

rel

ativ

e ex

pres

sion

leve

l of L

j IL-

8

Fig. 4 qRT-PCR analysis of IL-8 expression in various tissues of

Japanese sea perch. HK: head-kidney

*

**

**

**

0

1

2

3

4

5

6

7

8

9

10

blank control 1 2 4 6 8 10

Stimulated time(h)

The

rel

ativ

e ex

pres

sion

leve

l of L

j IL-

8

Fig. 5 qRT-PCR analysis of IL-8 expression in different stimulated

time point

Mol Biol Rep (2009) 36:1099–1105 1103

123

frame (ORF) of 300 nucleotides that translated into a

predicted 99 amino acid protein.

Several characteristics within the putative sea perch

peptide sequence ratify it as a CXC chemokine. First, in the

deduced amino acid sequence, four cysteine residues that

are essential for the formation of the tertiary structure and

consequently function [14] were identified at position 35,

37, 61, and 78, which lie in conserved positions when

compared to other CXC chemokines. Importantly, a single

arginine residue (Arg36) separated the first and second

cysteines, creating the classical CXC motif. Second, the

first 23 amino acid of sea perch IL-8 were predicted, using

the signal program, to represent a signal sequence that is

cleaved following Gly23. A high percentage of hydrophobic

residues in the N-terminal portion of sea perch IL-8, an

attribute of signal sequences, reinforce this finding and is

consistent with sea perch IL-8 being a secreted molecule,

as observed with other chemokines [15]. The IL-8 pre-

cursors of other vertebrates also have defined signal

peptides, whose cleavage points appear to align exactly

[16] with the predicted signal cleavage point of LjIL-8

(Fig 2). An ELR motif immediately upstream from the

CXC sequence is characteristic of chemokines that attract

neutrophils and have angiogenic effects [17–18]. In con-

trast to IL-8 molecules of mammals and chicken, LjIL-8, in

common with other fish sequences such as flounder [11]

and trout [10], does not possess this motif. Instead, the sea

perch sequence contains an ELH motif representing a

conservative substitution, the flounder containing SLR,

black seabream containing ELH, carp containing DPR,

trout containing DLR (Fig. 2). Whether this change will

affect the functionality of the protein will require further

investigation. But when the ELR motif was mutated to

DLR, a 100-fold decrease in biological activity was

observed during studies with synthetic mammalian IL-8

peptides [19]. It suggests that although a DLR motif is

functional, it is significantly less potent than an ELR motif.

We postulate that the lack of an ELR motif may be char-

acteristics of IL-8 genes in fish. An additional feature

supporting the sea perch sequence as a chemokine is the

presence of AU-rich motifs within its 30 UTR. Messenger

RNA containing AU-rich sequences such as ATTTA motif,

has been shown to have reduced stability in comparison to

those lacking AU-rich sequences. Transiently expressed

genes, such as cytokines, often contain AU-rich elements

repeated within the 30 UTR of their mRNAs [20–22]. Five

ATTTA motifs are located within the 30 UTR of LjIL-8

suggesting that this transcript is unstable and agreeing with

observations of mammalian chemokines.

The LjIL-8 precursor, when compared to mammalian

CXC chemokines shows higher similarity to IL-8 mole-

cules. Relative to other available fish chemokine

sequences, high identity is observed with the IL-8 molecule

of the Fugu rubripes supporting the view these are related

molecules. Phylogenetic analysis of CXC chemokines

shows that LjIL-8 groups with other fish IL-8 sequences

supported with bootstrapping. This finding support the

conclusion that the CXC chemokine isolated during this

study is an IL-8 equivalent in sea perch.

IL-8 mRNA could be detected in various tissues of

unchallenged sea perch using qRT-PCR, indicating that

constitutive IL-8 expression occurs in many sea perch tis-

sues. However, there is some degree of tissue specific

expression for this gene because the IL-8 transcript in the

brain of the unchallenged fish is very weak and almost could

not be detected directly. This result is same as the report of

rainbow trout [10]. Constitutive expression of IL-8 has been

reported in mammalian macrophages, although expression

was induced with bacteria and LPS [23–25]. LPS acts as a

powerful stimulator of innate immunity in diverse eukaryotic

species [26–27]. In the present study, after LPS treatment,

the expression level of LjIL-8 was not changed significantly

during the first 2 h after LPS stimulation, and then up-reg-

ulated and increased significantly at 4 h after LPS

stimulation. The expression level of LjIL-8 at 6 h post-LPS

stimulation was the highest, and from the 6 h post-LPS

stimulation the expression level became to decrease. The

result indicted that LjIL-8 was a constitutive and inducible

acute-phase protein. Because an inflammatory insult in a

cytokine cascade, so the function of IL-8 is in the limitation

of the time [2]. Less is known about the role of IL-8 in viral

infections, although many of its known biological effects

would be expected to impact on antiviral defences [17].

Characterisation of the biological effects of IL-8 in sea perch

awaits production of the recombinant molecule, which will

establish the requirement for an ELR motif for attraction and

activation of neutrophils at this level of phylogeny.

Acknowledgments This work was supported by a grant from the

GuangDong Province of China (2005B20301023), Agriculture

Department Project of China (06-05-01B) and National Project of

China (2006BAD01A13)

References

1. Baggiolini M (1998) Chemokines and leukocyte traffic. Nature

392:565–568. doi:10.1038/33340

2. Secombes CJ, Wang T, Hong S et al (2001) Cytokines and innate

immunity of fish. Dev Comp Immunol 25:713–723. doi:

10.1016/S0145-305X(01)00032-5

3. Ahuja SK, Murphy PM (1996) The CXC chemokines growth-

regulated oncogene (GRO) alpha, GRObeta, GROgamma, neu-

trophil-activating peptide-2, and epithelial cell-derived neutrophil

activating peptide-78 are potent agonists for the type B, but not

the type A, human interleukin-8 receptor. J Biol Chem

271:20545–20550. doi:10.1074/jbc.271.34.20545

4. Baggiolini M, Clark-Lewis I (1992) Interleukin-8, a chemotactic

and inflammatory cytokine. FEBS Lett 307:97–101. doi:

10.1016/0014-5793(92)80909-Z

1104 Mol Biol Rep (2009) 36:1099–1105

123

5. Peveri P, Walz A, Dewald B, Baggiolini M (1988) A novel

neutrophil-activating factor produced by human mononuclear

phagocytes. J Exp Med 167:1547–1559. doi:10.1084/jem.

167.5.1547

6. Schroder JM, Mrowietz U, Morita E, Christophers E (1987)

Purification and partial biochemical characterization of a human

monocytes-derived, neutrophil-activating peptide that lacks

interleukin 1 activity. J Immunol 139:3474–3483

7. Thelen M, Peveri P, Kernen P, von Tscharaner V, Walz A,

Baggiolini M (1988) Mechanism of neutrophil activation by

NAF, a novel monocytes-derived peptide agonist. FASEB J

2:2702–2706

8. Paccaud JP, Shifferli JA, Baggiolini M (1990) NAP-1/IL-8

induces upregulation of CR1 receptors in human neutrophil leu-

kocytes. Biochem Biophys Res Commun 166:187–192. doi:

10.1016/0006-291X(90)91929-M

9. Schmid J, Weissmann C (1987) Induction of mRNA for a serine

protease and a b-thromboglobulin-like protein in mitogen-stim-

ulated human leukocytes. J Immunol 139:250–256

10. Kerry L, Zou J, Wang T, Bols N, Hirono I, Aoki T et al (2002)

Identification and analysis of an interleukin 8-like molecule in

rainbow trout Oncorhynchus mykiss. Dev Comp Immunol

26:433–444. doi:10.1016/S0145-305X(01)00092-1

11. Eun-Young L, Hyoun-Hyang P, Young-Taae K, Tae-Jin C (2001)

Cloning and sequence analysis of the Interleukin-8 gene from

flounder (Paralichthys olivaceous). Gene 274:237–243. doi:

10.1016/S0378-1119(01)00600-X

12. Najakshin AM, Mechetina LV, Alabyev BY, Taranin AV (1999)

Identification of an IL-8 homolog in lamprey (Lampetra fluvia-tilis): early volutionary divergence of chemokines. Eur J

Immunol 29:375–382. doi :10.1002/(SICI)1521-4141(199902)

29:02\375::AID-IMMU375[3.0.CO;2-6

13. Yuuki I, Chiaki H, Kazushige U, Tadaaki M, Teruyuki N (2003)

Molecular cloning and sequenceing if the banded dogfish (Triakisscyllia) interleukin-8 cDNA. Fish Shellfish Immunol 14:275–281.

doi:10.1006/fsim.2002.0432

14. Rajarathnam K, Sykes BD, Dewald B, Baggiolini M, Clark I

(1999) Disulphide bridge in interleukin-8 probed using nonnat-

ural disulphide analogues:dissociation of roles in structure from

function. Biochemistry 38:7653–7658. doi:10.1021/bi990033v

15. Vaddi K, Keller M, Newton RC (1997) The chemokine facts-

book. Academic Press, London

16. Goodman RB, Foster DC, Mathewes SL, Osborn SG, Kuijper JL,

Forstorm JW et al (1992) Molecular cloning of porcine alveolar

macrophage-derived neutrophil chemotactic factorsIand II:

identification of porcine IL-8 and another intercrine-aprotein.

Biochemistry 31:10483–10490. doi:10.1021/bi00158a011

17. Wuyts A, Proost P, Van Damme J (1998) Interleukin-8 and other

CXC chemokines. In: Thomson A (eds) The cytokine handbook,

3rd edn. Academic Press, London, pp 271–311

18. Strieter RM, Polverini PJ, Kunkel SL, Arenberg DA, Burdick

MD, Kasper J et al (1995) The functional role of the ELR motif

in CXC chemokines-mediated angiogenesis. J Biol Chem

270:27348–27357. doi:10.1074/jbc.270.45.27348

19. Hebert CA, Vitangcol RV, Baker JB (1991) Scanning mutagen-

esis of interleukin-8 identifies a cluster of residues required for

receptor binding. J Biochem 266:18989–18994

20. Caput D, Beutler B, Hartog K, Thayer R, Brown-Shimer S,

Cerami A (1986) Identification of a common nucleotide sequence

in the 30-untranslated region of mRNA molecules specifying

inflammatory mediators. Proc Natl Acad Sci USA 83:1670–1674.

doi:10.1073/pnas.83.6.1670

21. Shaw G, Kamen R (1986) A conserved AU sequence from the 30

untranslated region of GM-CFS mRNA mediates selective

mRNA degradation. Cell 46:659–667. doi:10.1016/0092-

8674(86)90341-7

22. Roca FJ, Cayuela ML, Secombes CJ, Meseguer J, Mulero V

(2007) Post-transcriptional regulation of cytokine genes in fish: a

role for conserved AU-rich elements located in the 30-untrans-

lated region of their mRNAs. Mol Immunol 44(4):472–478. doi:

10.1016/j.molimm.2006.02.015

23. Morsey MA, Popowych Y, Kowalski J, Gerlach G, Godson D,

Campos M et al (1996) Molecular cloning and expression of

bovine interleukin-8. Microb Pathog 20:203–212. doi:

10.1006/mpat.1996.0019

24. Nakamura H, Yoshimura K, Jaffe HA, Crystal RG (1991) Inter-

leukin-8 gene expression in human bronchial epithelial cells. J

Biol Chem 266:19611–19617

25. Lin G, Pearson AE, Scamurra RW, Zhou Y, Baarsch MJ, Weiss

DJ et al (1994) Regulation of interleukin-8 expression in porcine

alveolar macrophages by bacterial lipopolysaccharide. J Biol

Chem 269:77–85

26. Ulevitch RJ, Tobias PS (1995) Receptor-dependent mechanisms

of cell stimulation by bacterial endotoxin. Annu Rev Immunol

13:437–457. doi:10.1146/annurev.iy.13.040195.002253

27. Lemaitre B, Nicolas E, Michaut L, Reichhart JM, Hoffmann JA

(1996) The dorsoventral regulatory gene cassette spatzle/Toll/

cactus controls the potent antifungal response in Drosophila

adults. Cell 86:973–983. doi:10.1016/S0092-8674(00)80172-5

Mol Biol Rep (2009) 36:1099–1105 1105

123