Pygo2 as a novel biomarker in gastric cancer for monitoring

drug resistance by upregulating MDR1

Dongdong Zhang1, Yu Liu2, Qiuwan Wu2, Yahong Zheng3, Natasha

Kaweme4, Zhiming Zhang2, Mingquan Cai2*, Youhong Dong1*

1Department of Oncology, Xiangyang No. 1 People's Hospital, Hubei

University of Medicine, Xiangyang, Hubei 441000, China

2Department of Medical Oncology, The First Affiliated Hospital of

Xiamen University, Xiamen 361003, Fujian, China

3Xiamen Huli District Maternal and Child Health Hospital, 361005

Xiamen, Fujian, China

4Department of Hematology, Zhongnan Hospital, Wuhan University,

Wuhan, P.R. China

Correspondence

*Mingquan Cai, Department of Medical Oncology, The First

Affiliated Hospital of Xiamen University, Xiamen 361003, Fujian,

China. Email: mingquan035@163.com

*Youhong Dong, Department of Oncology, Xiangyang No. 1

People's Hospital, Hubei University of Medicine, Xiangyang, Hubei

441000, China. Email: dongyouhong2005@163.com

Abstract: Chemotherapy is the main therapy for gastric cancer (GC) both

before and after surgery, but the emergence of multidrug resistance (MDR)

often leads to disease progression and recurrence. P-glycoprotein, encoded

by MDR1, is a well-known multidrug efflux transporter involved in drug

resistance development. Pygo2 overexpression has been identified in

several cancers. Previous studies have shown that abnormal expression of

Pygo2 is related to tumorigenesis, chemoresistance, and tumor progression.

In this study, to evaluate the underlying relationship between Pygo2 and

MDR1 in GC, we constructed GC drug-resistant cell lines, SGC7901/cis-

platinum (DDP), and collected tissue from GC patients pre-and post-

chemotherapy. We found that Pygo2 was overexpressed in GC, especially

in GC drug-resistant cell lines and GC patients who underwent neoadjuvant

DDP-based chemotherapy. Pygo2 overexpression may precede MDR1 and

correlates with MDR1 in GC patients. Furthermore, knock-down of Pygo2

induced downregulation of MDR1 and restored SGC7901/DDP’s

sensitivity to DDP. Further mechanistic analysis demonstrated that Pygo2

could modulate MDR1 transcription by binding to the MDR1 promoter

region and promoting MDR1 activation. The overall findings reveal that

Pygo2 may be a promising biomarker for monitoring drug resistance in GC

by regulating MDR1.

Keywords: Pygo2, gastric cancer, biomarker, drug resistance, MDR1

1. Introduction

Gastric cancer (GC) has relatively high morbidity and mortality rate

around the world. Although surgery is the first choice of treatment,

chemotherapy also plays an important role in treating GC as GC has a low

incidence of early diagnosis. Neoadjuvant chemotherapy can diminish

tumor volume, degrade tumor stage, and increase the resection rate.

Postoperative chemotherapy can prevent tumor recurrence and metastasis,

thus prolonging the overall survival. Palliative chemotherapy can alleviate

clinical symptoms and improve the quality of life of patients. However,

multidrug resistance (MDR) can eventually result in chemotherapy failure.

Therefore, early detection of MDR in GC patient is essential.

Cancer cells can pump various chemotherapeutic drugs out of the cell

by drug efflux transporters [1]. The occurrence of MDR is accompanied by

the overexpression of multidrug efflux transporters, with the most

extensively studied being multidrug resistance protein 1 (MDR1) [2]. P-

glycoprotein, encoded by ATP-binding cassette subfamily B member 1

(ABCB1) or MDR1, can induce multidrug resistance by increasing drug

efflux and decreasing intracellular drug concentration [3]. The

overexpression of MDR1 was identified in some intrinsically drug-

resistant digestive system tumors such as colorectal carcinoma,

hepatocellular carcinoma, pancreatic cancer [4, 5], and other tumors [2].

Furthermore, MDR1 overexpression in breast cancer often indicated a

more malignant phenotype [6] and a higher recurrence rate [7]. To date, the

molecular modulation mechanism of MDR1 in gastric cancer is still

unclear.

Pygopus2 (Pygo2) was initially identified as a novel functional protein

of the Wingless pathway downstream in Drosophila [8]. Further studies

showed Pygo2 could regulate the Wnt/β-catenin pathway via linking

Pygo2 PHD domain to β-catenin [9] and activating T-cell factor

(TCF)/lymphoid-enhancing factor 1 (LEF) transcription [10]. Pygo2

played an important role in transcription regulation, tissue differentiation

and embryonic development [11, 12]. Pygo2 is usually maintained at a low

level in normal cells but has shown an abnormally high expression level in

some cancers. Overexpression of Pygo2 acted as a driver for metastatic

prostate cancer and esophageal squamous cell carcinoma by enhancing

tumor growth and invasion [13, 14]. Abnormal expression of Pygo2 also

suggested a malignant phenotype in advanced lung cancer [15]. Moreover,

Pygo2 overexpression was associated with chemoresistance and poor

prognosis in breast cancer and hepatocellular carcinoma [7, 16]. Inhibition

of Pygo2 expression increased the sensitivity of breast cancer cells to

chemotherapeutic drugs and suppressed tumor growth [17]. However, the

expression level of Pygo2 in GC and the relationship between Pygo2 and

MDR1 was undefined. In the present study, we detected the expression

level of MDR1 and Pygo2 in GC and explored the functional relationship

between them.

2. Materials and methods

2.1 Materials

Cis-platinum (DDP) was obtained from the first affiliated hospital of

Xiamen University. MDR1 (ABCB1, Cat# sc-55510) and β-actin (Cat# sc-

47778) antibodies were purchased from Santa Cruz Biotechnology. Pygo2

(Cat# 11555-1-AP) antibody was obtained from Proteintech and TIAN

pure Midi Plasmid Kit (Cat# DP107) from TIANGEN. TurboFect

Transfection Reagent (Cat# R0531) was from Thermo Scientific. E.coli

pLL3.7-hPygo2-KD (knock-down) and pGL3.3-control were a gift from

Xiamen University School of Life Sciences.

2.2 Cell culture and specimen collection

The GC cell lines, SGC7901 and SGC7901/DDP were cultured in

DMEM medium with 10% fetal bovine serum and 1%

penicillin/streptomycin. The GC tissues were collected from 40 GC

patients using gastroscopy and surgery. All the GC patients were treated

with platinum-based neoadjuvant chemotherapy, including combined with

capecitabine, tegafur gimeracil oteracil potassium capsule (S-1),

doxorubicin (ADM) and 5-fluorouracil (5-Fu). Importantly, all subjects

were given written informed consent in accordance with the

recommendations of Ethics and Scientific Committee of The First

Affiliated Hospital of Xiamen University and the Declaration of Helsinki,

the approved number from the Ethics committee of Xiamen University is

2019118.

2.3 MTT assay

Cell viability was measured by using the MTT method. Briefly,

SGC7901 and SGC7901/DDP cells (5×105/well) were seeded in 96-well

plates for 24 h, then treated with different concentrations of DDP for 24 h.

Thereafter, cells were labeled with 20 μL MTT labeling reagent, and

absorbance at 570 nm was determined with a microplate reader.

2.4 The construction of drug resistance SGC7901/DDP

The SGC7901/DDP cell was constructed by treatment with increasing

DDP concentration repeatedly and gradually. Firstly, SGC7901 cells were

seeded at plates and treated with initial DDP concentration at 0.1 μg/mL

for 24h, then the medium was removed, and the cells were transferred to

fresh medium. The above procedures were repeated, and DDP

concentration was increased gradually until the cell apoptosis rate was

above 90%. Cell morphology was observed by microscopy.

2.5 Cell apoptosis assay

Cell apoptosis rate was determined by flow cytometry analysis using

Annexin V-FITC Apoptosis Detection Kit (KEYGEN Biotech, Cat#

KGA105-KGA108). 5×105 cells were seeded in 6-well plates and treated

with 0.4 μg/mL DDP for 24 h. The collected cells were washed by PBS

twice and then labeled with 5 μL Annexin V-FITC and 5 μL Propidium

iodide for 5 minutes at 25 ℃. The stained cells were analyzed by flow

cytometry using CytExpert2.0 software.

2.6 Western blot assay (WB)

Total protein extracts were prepared, and the protein concentration was

measured as described previously [18]. Generally, 15 μg protein was

separated by 10% SDS-PAGE and transferred onto PVDF membrane, then

blocked with 5% fat-free milk and incubated with primary antibodies and

HRP- conjugated secondary antibodies. The protein levels were detected

by using the Enhanced Chemiluminescent (ECL) Detection Kit (Boster,

Cat# EK1001).

2.7 Real-time quantitative PCR

Total RNAs were homogenized in Trizol and isolated, as described in

our previous study [19]. Then cDNAs were reversely transcribed by using

PrimeScriptTM RT reagent kit with gDNA Eraser (Takara, Cat# RR047A).

The expression levels of MDR1 and Pygo2 were detected using SYBR

GREEN MIXTURE kit (Bio-Rad, Cat# 10000076382) and analyzed by

comparing to β-actin. The primers are listed below: Pygo2, Forward Primer:

5’-GTTTGGGCTGTCCTGAAAGTCTG-3’, Reserve Primer: 5’-

ATAAGGGCGCCGAAAGTTGA-3’; MDR1, Forward Primer: 5’-

AGCTCGTGCCCTTGTTAGACA-3’, Reserve Primer: 5’-

GTCCAGGGCTTCTTGGACAA-3’; β-actin, Forward Primer: 5’-

CGAGCGGGAAATCGTGCGTGACATTAAGGAGA-3’, Reserve

Primer: 5’-CGTCATACTCCTGCTTGATCCACATCTGC-3’.

2.8 Immunohistochemistry (IHC)

GC tissues were fixed and cut into slices, then processed and incubated

with primary antibodies and probed with secondary antibody. The detailed

protocol could refer to our previous work [19]. Images were captured by

using a Nikon microscope.

2.9 pLL3.7- hPygo2-knock-down (KD) transfection

SGC7901/DDP cells were transfected with pGL3.3-Control and

pLL3.7-hPygo2-KD plasmid using TurboFect Transfection Reagent

following the manufacturer’s instructions. Briefly, short hairpin targeted

Pygo2 (Pygo2 shRNA) and the scramble control sequences (SCR shRNA)

were designed based on hPygo2 sequences and further synthesized for the

construction of plasmids [20]. The detailed hPygo2 sequences could be

referred to GenBank with accession number NW_925683. The primers

were listed as follow: SCR shRNA, Forward Primer: 5’-

GATCCCCGTGGTTTCATCGCATCTGCTTCAAGAGAGCAGATGCG

ATGAAACCACTTTTTA-3’, Reserve Primer: 5’-

AGCTTAAAAAGTGGTTTCATCGCATCTGCTCTCTTGAAGCAGAT

GCGATGAAACCACGGG-3’; Pygo2 shRNA, Forward Primer: 5’-

GATCCCCTGTGAGGCCTCTTGTCAGAAATTCAAGAGATTTCTGA

CAAGAGGCCTCACATTTTTA-3’, Reserve Primer: 5’-

GGGACACTCCGGAGAACAGTCTTAAGTTCTCTAAAGACTGTTC

TCCGGAGTGTAAAAATTCGA-3’. The lentiviral pLL3.7 vector (X-Y

Biotechnology, Cat# XY2204) was used to express Pygo2 shRNA and

pGL3.3 vector (Promega, Cat# E1741) served as a control, the plasmids

were obtained by using TIAN pure Midi Plasmid Kit and the detailed

procedures were described previously [21]. The transient transfection was

observed under a fluorescence microscope and verified by WB.

2.10 Luciferase reporter analysis

The pGL6-MDR1 reporter plasmid, which contained the MDR1

promoter region was constructed in our lab and described in our previous

study [22]. The pGL6 reporter plasmid (318 bp) was designed as below:

forward primer: 5′-CAGGGTACCAGTTGAAATGTCCCCAATGAT-3′,

reverse primer: 5′-CCTAGATCTGGAAAGACCTAAAGGAAACGAAC-

3′. Briefly, SGC7901/DDP cells were transfected with the pGL6-MDR1

reporter plasmid, and cell homogenate was lysed and collected for

luciferase reporter analysis.

2.11 Chromatin immunoprecipitation (ChIP) assay

The primers for ChIP on MDR1 were designed as described previously

[22]. MDR1 primers were listed as below: forward primer: 5′-

GCGTTTCTCTACTTGCCCTTTC-3′, reverse primer: 5′-

AGCCAATCAGCCTCACCACAG-3′. ChIP assay was performed by

using a ChIP assay kit (Merck-Millipore, Cat# 17–371) per to the

manufacturer’s recommendations.

2.11 Statistical analysis

The experiments such as MTT assay, WB and RT-PCR were performed

in triplicate and data was expressed as the mean ± SD. Collective data was

then analyzed using student’s t-test and chi-square test. Correlation

analysis was processed by using GraphPad Prism 7.0. P＜0.05 was defined

as the statistical significance and represented with *. *P＜0.05, **P＜

0.01,***P＜0.001, ****P＜0.0001.

3. Results

3.1 SGC7901/DDP was insensitive to chemotherapeutic drugs

We successfully constructed GC drug resistance cell SGC7901/DDP

after six months utilizing the method described above. Comparing to

SGC7901, SGC7901/DDP had a smaller cell volume, and its cell shape had

changed from long spindle to short polygon. Furthermore, SGC7901/DDP

had a slower breeding rate and showed monoclonal colony growth (Fig.

1A). SGC7901/DDP was insensitive to a low concentration of DDP when

cells were exposed to different concentrations of DDP (Fig. 1B). The

median IC50 value of SGC7901/DDP in 24 h was 0.89 μg/mL, which was

significantly higher than SGC7901 with a median IC50 value in 24 h was

0.35 μg/mL (Fig. 1C). ADM and 5-Fu were also commonly prescribed to

treat GC, we found that SGC7901/DDP was also insensitive to 5-Fu and

ADM compared to SGC7901. The median IC50 values of 5-Fu and ADM

in SGC7901/DDP for 24 h were 109.1 μg/mL and 1.3 μg/mL, which were

higher than 20.5 μg/mL and 0.5 μg/mL in SGC7901 (Fig. 1C).

3.2 High expression of Pygo2 and MDR1 in SGC7901/DDP and GC

patients after chemotherapy

Firstly, we detected the protein and mRNA expression levels of Pygo2

and MDR1 in SGC7901/DDP by WB and RT-PCR. Our results showed

that SGC7901/DDP had higher expression levels of Pygo2 and MDR1

compared with SGC7901 (Fig 2A and 3A). Next, we analyzed Pygo2 and

MDR1 expression levels in normal-appearing tissue adjacent to GC (NaT),

GC tissue (GcT) and GC tissue after neoadjuvant chemotherapy (NeC).

Our data revealed that MDR1 and Pygo2 was low or rarely expressed in

NaT but were highly expressed in GcT and with highest expression levels

in NeC (Fig 2A, Fig 2B and 3B).

3.3 Pygo2 overexpression preceded MDR1 and Pygo2 correlated with

MDR1

We analyzed 40 GC patients in the first affiliated hospital of Xiamen

University who had undergone neoadjuvant DDP-based chemotherapy.

Our results showed that 15% (6/40) of GC patients were Pygo2

overexpression positive, and 5% (2/40) were MDR1 overexpression

positive pre-chemotherapy. While amongst the group, 62.5% (25/40) of

GC patients were Pygo2 overexpression positive, and 45% (18/40) were

MDR1 overexpression positive post-chemotherapy. The results indicated

that Pygo2 overexpression might precede MDR1 (Table 1). Furthermore,

analyzing the two genes across online data sets showed that a strong

correlation between Pygo2 and MDR1 expression levels after

chemotherapy in GC tissue (Fig 3C).

3.4 The knock-down of Pygo2 induced MDR1 downregulation and

rendered GC cell sensitive to chemotherapeutic drugs

To clarify the relationship between Pygo2 and MDR1 in GC, we

suppressed Pygo2 expression in SGC7901/DDP by transfecting pLL3.7-

hPygo2-KD plasmid. We proceeded to perform WB to determine whether

Pygo2 was successfully suppressed (Fig 4A). The results suggested that

when Pygo2 was inhibited, MDR1 expression was also downregulated (Fig

4B). In addition, GC drug resistance cell SGC7901/DDP became sensitive

to chemotherapeutic drugs when Pygo2 was knocked down (Fig 4C).

3.5 Pygo2 promoted MDR1 activation by interacting with MDR1

To illuminate the role of Pygo2 in the activation of MDR1, we

performed luciferase reporter analysis. We found that Pygo2 could promote

the activation of MDR1 promoter (Fig 4D). Further mechanism analysis

by ChIP assay verified the association of Pygo2 with the MDR1 promoter

region (Fig 4E). One other point worth emphasizing is our previous study

also demonstrated Pygo2 could modulate MDR1 activation in breast

cancer by directly binding to β-catenin, thus regulating the Wnt/β-catenin

signaling pathway [7].

Taking into consideration the obtained results; we can conclude that

the overexpression of Pygo2 promotes MDR1 activation and is involved in

DDP drug resistance in GC.

4. Discussion

Majority of GC patients are diagnosed at advanced stage disease as GC

has a relatively low early detection and diagnosis rate. Chemotherapy is an

important alternative therapeutic method for these patients. However, the

development of MDR not only causes failure of the first-line treatment

recommended by National Comprehensive Cancer Network (NCCN), but

also results in the ineffectiveness of the second-and third-line solutions

[23]. Therefore, it is important to elucidate the mechanism of

chemoresistance.

Studies exploring the mechanism of drug resistance are mainly divided

into the following categories: alterations in drug efflux [24], dysfunction

of DNA damage repair [25], disruption of apoptosis balance such as

overexpression of anti-apoptosis proteins [26] and mutation of drug targets

[27]. One of the most studied mechanism is overexpression of MDR1 and

multi-drug resistant associate protein (MRP), which serve as drug efflux

transporters leading to a decrease in intracellular drug concentration [28].

MDR1 overexpression was identified in GC cell lines and primary GC

tissue in previous studies [29]. Additionally, MDR1 overexpression was

negatively associated with chemosensitivity [30]. Studies on MDR

transporter inhibitors have been flourishing, but with little success [31].

Hence, it was essential to identify novel MDR biomarkers and drug targets.

Pygo2 is a novel effector protein, downstream of the Wnt/β-catenin

signaling pathway, that acts as a co-activator with β-catenin to promote β-

catenin/LEF/TCF activation [32]. Abnormal expression of Pygo2 has been

reported in several cancers such as breast cancer, glioma, esophageal

squamous cell carcinoma, hepatocellular carcinoma and prostate cancer [7,

13, 14, 16, 33-35]. Furthermore, Pygo2 overexpression was associated with

tumor initiation and progression, malignant phenotype, and poor prognosis

[13, 15, 16, 34]. Inhibition of Pygo2 suppressed tumor growth, invasion,

and epithelial-mesenchymal transition (EMT) [17]. Our previous study

showed that Pygo2 was associated with chemoresistance in breast cancer

by activating MDR1 [7]. MDR1 was the downstream target of the Wnt/β-

catenin signaling pathway, and it was upregulated when the Wnt/β-catenin

was activated [36]. Pygo2 not only promoted Wnt/β-catenin activation but

also modulated Wnt/β-catenin activity in tissue-and gene-dependent

manner [11, 37, 38]. Thus, whether Pygo2 regulates MDR1 in GC or not

still needs further study.

These recent findings verified that Pygo2 and MDR1 were

overexpressed in GC, especially in GC patients after chemotherapy. Pygo2

overexpression precedes MDR1 and Pygo2 strongly correlated with MDR1

in GC patients who underwent neoadjuvant chemotherapy. The Knock-

down of Pygo2 could restore the drug-resistant cell SGC/7901 sensitivity

to chemotherapeutic drugs. Further mechanism analysis indicated that

Pygo2 could promote MDR1 activation by binding to the MDR1 promoter

region. These results demonstrated that Pygo2 might be a novel biomarker

for monitoring drug resistance by upregulating MDR1. This study also

provided a potential therapeutic target in the treatment of cancers where

Pygo2 is overexpressed.

In conclusion, Pygo2 and MDR1 were overexpressed in GC patients

after chemotherapy. Pygo2 played a pivotal role in drug resistance in GC

by promoting MDR1 activation. Pygo2 may be a novel biomarker for

monitoring drug resistance and a potential therapeutic target for cancer

treatment in the future.

Acknowledgements

We appreciate the support from Professor Bo-an Li for designing the

pLL3.7-hPygo2-KD and pGL3.3-control at the Department of Biomedical

Sciences, Xiamen University School of Life Sciences, Xiang’an Campus

of Xiamen University.

Funding

This work was supported by the Natural Science Foundation of Fujian

program (grant number 2019J01575) and the Hubei Education Program

(grant number JX5B78).

Authors’ contributions

MQC and YHD provided the direction of study. DDZ performed the

major experiments, analyzed the data and wrote the manuscript, QWW

guided the experiments. YHZ contributed to the specimen collection and

contributed to the cell experiments. YL helped analyzing the ICH. NK and

ZMZ helped revise the manuscript. All authors read and approved the final

manuscript.

Conflict of interests

The authors declare that they have no competing interests

Data availability statement

The raw data supporting the conclusions of this manuscript will be

made available by the authors.

References

1. Choi YH, Yu AM. ABC transporters in multidrug resistance and pharmacokinetics, and

strategies for drug development. Current pharmaceutical design. 2014; 20: 793-807.

2. Robey RW, Pluchino KM, Hall MD, Fojo AT, Bates SE, Gottesman MM. Revisiting the role of

ABC transporters in multidrug-resistant cancer. Nature reviews Cancer. 2018; 18: 452-64.

3. Wolking S, Schaeffeler E, Lerche H, Schwab M, Nies AT. Impact of Genetic Polymorphisms of

ABCB1 (MDR1, P-Glycoprotein) on Drug Disposition and Potential Clinical Implications: Update of

the Literature. Clinical pharmacokinetics. 2015; 54: 709-35.

4. Ceballos MP, Rigalli JP, Ceré LI, Semeniuk M, Catania VA, Ruiz ML. ABC Transporters:

Regulation and Association with Multidrug Resistance in Hepatocellular Carcinoma and Colorectal

Carcinoma. Current medicinal chemistry. 2019; 26: 1224-50.

5. Adamska A, Falasca M. ATP-binding cassette transporters in progression and clinical outcome

of pancreatic cancer: What is the way forward? World journal of gastroenterology. 2018; 24: 3222-

38.

6. Levi M, Brunetti B, Sarli G, Benazzi C. Immunohistochemical Expression of P-glycoprotein and

Breast Cancer Resistance Protein in Canine Mammary Hyperplasia, Neoplasia and Supporting

Stroma. Journal of comparative pathology. 2016; 155: 277-85.

7. Zhang ZM, Wu JF, Luo QC, Liu QF, Wu QW, Ye GD, et al. Pygo2 activates MDR1 expression

and mediates chemoresistance in breast cancer via the Wnt/β-catenin pathway. Oncogene. 2016;

35: 4787-97.

8. Thompson B, Townsley F, Rosin-Arbesfeld R, Musisi H, Bienz M. A new nuclear component

of the Wnt signalling pathway. Nature cell biology. 2002; 4: 367-73.

9. Kessler R, Hausmann G, Basler K. The PHD domain is required to link Drosophila Pygopus to

Legless/beta-catenin and not to histone H3. Mechanisms of development. 2009; 126: 752-9.

10. Chen J, Luo Q, Yuan Y, Huang X, Cai W, Li C, et al. Pygo2 associates with MLL2 histone

methyltransferase and GCN5 histone acetyltransferase complexes to augment Wnt target gene

expression and breast cancer stem-like cell expansion. Molecular and cellular biology. 2010; 30:

5621-35.

11. Gu B, Sun P, Yuan Y, Moraes RC, Li A, Teng A, et al. Pygo2 expands mammary progenitor

cells by facilitating histone H3 K4 methylation. The Journal of cell biology. 2009; 185: 811-26.

12. Schwab KR, Patterson LT, Hartman HA, Song N, Lang RA, Lin X, et al. Pygo1 and Pygo2 roles

in Wnt signaling in mammalian kidney development. BMC biology. 2007; 5: 15.

13. Lu X, Pan X, Wu CJ, Zhao D, Feng S, Zang Y, et al. An In Vivo Screen Identifies PYGO2 as a

Driver for Metastatic Prostate Cancer. Cancer research. 2018; 78: 3823-33.

14. Moghbeli M, Sadrizadeh A, Forghanifard MM, Mozaffari HM, Golmakani E, Abbaszadegan

MR. Role of Msi1 and PYGO2 in esophageal squamous cell carcinoma depth of invasion. Journal

of cell communication and signaling. 2016; 10: 49-53.

15. Liu Y, Dong QZ, Wang S, Fang CQ, Miao Y, Wang L, et al. Abnormal expression of Pygopus 2

correlates with a malignant phenotype in human lung cancer. BMC cancer. 2013; 13: 346.

16. Zhang S, Li J, He F, Wang XM. Abnormal nuclear expression of Pygopus-2 in human primary

hepatocellular carcinoma correlates with a poor prognosis. Histopathology. 2015; 67: 176-84.

17. Chi Y, Wang F, Zhang T, Xu H, Zhang Y, Shan Z, et al. miR-516a-3p inhibits breast cancer cell

growth and EMT by blocking the Pygo2/Wnt signalling pathway. Journal of cellular and molecular

medicine. 2019; 23: 6295-307.

18. Zhang D, Liu Y, Luo Z, Chen Y, Xu A, Liang Y, et al. The novel thioredoxin reductase inhibitor

A-Z2 triggers intrinsic apoptosis and shows efficacy in the treatment of acute myeloid leukemia.

Free radical biology & medicine. 2020; 146: 275-86.

19. Dongdong Z, Jin Y, Yang T, Yang Q, Wu B, Chen Y, et al. Antiproliferative and

Immunoregulatory Effects of Azelaic Acid Against Acute Myeloid Leukemia via the Activation of

Notch Signaling Pathway. Frontiers in pharmacology. 2019; 10: 1396.

20. Wang ZX, Chen YY, Li BA, Tan GW, Liu XY, Shen SH, et al. Decreased pygopus 2 expression

suppresses glioblastoma U251 cell growth. Journal of neuro-oncology. 2010; 100: 31-41.

21. Xie YY, Mo CL, Cai YH, Wang WJ, Hong XX, Zhang KK, et al. Pygo2 Regulates Adiposity and

Glucose Homeostasis via β-Catenin-Axin2-GSK3β Signaling Pathway. Diabetes. 2018; 67: 2569-

84.

22. Chen S, Wang H, Li Z, You J, Wu QW, Zhao C, et al. Interaction of WBP2 with ERα increases

doxorubicin resistance of breast cancer cells by modulating MDR1 transcription. British journal of

cancer. 2018; 119: 182-92.

23. Thiels CA, Hanson KT, Habermann EB, Boughey JC, Grotz TE. Integrated cancer networks

improve compliance with national guidelines and outcomes for resectable gastric cancer. Cancer.

2020; 126: 1283-94.

24. Cui H, Zhang AJ, Chen M, Liu JJ. ABC Transporter Inhibitors in Reversing Multidrug Resistance

to Chemotherapy. Current drug targets. 2015; 16: 1356-71.

25. Özeş AR, Miller DF, Özeş ON, Fang F, Liu Y, Matei D, et al. NF-κB-HOTAIR axis links DNA

damage response, chemoresistance and cellular senescence in ovarian cancer. Oncogene. 2016;

35: 5350-61.

26. Xia H, Hui KM. Mechanism of cancer drug resistance and the involvement of noncoding RNAs.

Current medicinal chemistry. 2014; 21: 3029-41.

27. Zugazagoitia J, Guedes C, Ponce S, Ferrer I, Molina-Pinelo S, Paz-Ares L. Current Challenges

in Cancer Treatment. Clinical therapeutics. 2016; 38: 1551-66.

28. Cole SP. Multidrug resistance protein 1 (MRP1, ABCC1), a "multitasking" ATP-binding cassette

(ABC) transporter. The Journal of biological chemistry. 2014; 289: 30880-8.

29. MDR1 gene expression and its clinical relevance in primary gastric carcinomas. Cancer. 1993;

71: 667-71.

30. Li Y, Tan BB, Zhao Q, Fan LQ, Liu Y, Wang D. Regulatory mechanism of ZNF139 in multi-drug

resistance of gastric cancer cells. Molecular biology reports. 2014; 41: 3603-10.

31. Li W, Zhang H, Assaraf YG, Zhao K, Xu X, Xie J, et al. Overcoming ABC transporter-mediated

multidrug resistance: Molecular mechanisms and novel therapeutic drug strategies. Drug

resistance updates : reviews and commentaries in antimicrobial and anticancer chemotherapy.

2016; 27: 14-29.

32. Townsley FM, Cliffe A, Bienz M. Pygopus and Legless target Armadillo/beta-catenin to the

nucleus to enable its transcriptional co-activator function. Nature cell biology. 2004; 6: 626-33.

33. Moghbeli M, Abbaszadegan MR, Farshchian M, Montazer M, Raeisossadati R, Abdollahi A, et

al. Association of PYGO2 and EGFR in esophageal squamous cell carcinoma. Medical oncology

(Northwood, London, England). 2013; 30: 516.

34. Watanabe K, Fallahi M, Dai X. Chromatin effector Pygo2 regulates mammary tumor initiation

and heterogeneity in MMTV-Wnt1 mice. Oncogene. 2014; 33: 632-42.

35. Li M, Chao L, Wu J, Xu H, Shen S, Chen S, et al. Pygo2 siRNA Inhibit the Growth and Increase

Apoptosis of U251 Cell by Suppressing Histone H3K4 Trimethylation. Journal of molecular

neuroscience : MN. 2015; 56: 949-55.

36. Flahaut M, Meier R, Coulon A, Nardou KA, Niggli FK, Martinet D, et al. The Wnt receptor FZD1

mediates chemoresistance in neuroblastoma through activation of the Wnt/beta-catenin pathway.

Oncogene. 2009; 28: 2245-56.

37. Sun P, Watanabe K, Fallahi M, Lee B, Afetian ME, Rheaume C, et al. Pygo2 regulates β-

catenin-induced activation of hair follicle stem/progenitor cells and skin hyperplasia. Proceedings

of the National Academy of Sciences of the United States of America. 2014; 111: 10215-20.

38. Gu B, Watanabe K, Sun P, Fallahi M, Dai X. Chromatin effector Pygo2 mediates Wnt-notch

crosstalk to suppress luminal/alveolar potential of mammary stem and basal cells. Cell stem cell.

2013; 13: 48-61.

Table1. The expression status of Pygo2 and MDR1 in GC patient pre-and post-

operation.

Group

Pre chemotherapy

(Gastroscopy)

Post chemotherapy

(Postoperative biopsy)

χ2-test

P value

Pygo2 Overexpression 6(15%) 25(62.5%)

＜0.0001 None overexpression 34 (85%) 15(37.5%)

MDR1 Overexpression 2(5%) 18(45%)

＜0.0001 None overexpression 38(95%) 22(55%)

Figure 1. The construction of GC drug resistance cell SGC7901/DDP. (A):

SGC7901 and SGC7901/DDP was observed by using a microscopy and the images

were captured, magnification: ×40. (B): SGC7901 and SGC7901/DDP cells were

treated with different concentrations of DDP, 5-Fu and ADM for 24 h and the cell

viability was measured by MTT assay. (C): IC50 of DDP, 5-Fu and ADM in SGC7901

and SGC7901/DDP. Each experiment was repeated three times, **P＜0.01. ***P＜

0.001. DDP: cis-platinum; ADM :Adriamycin; 5-Fu:5-fluorouracil.

Figure 2. Pygo2 and MDR1 were overexpression in GC cell lines and GC patients

after chemotherapy. (A): The Pygo2 and MDR1 protein expression levels were detected

by WB. (B): The expression levels of Pygo2 and MDR1 in GC tissue measured by IHC,

magnification: ×40. IHC: immunohistochemistry; NaT: normal-appearing tissue

adjacent to GC, GcT: GC tissue; NeC: GC tissue after neoadjuvant chemotherapy.

Figure 3. Pygo2 overexpression was strong corelated with MDR1. The Pygo2 and

MDR1 RNA expression levels were detected by RT-PCR in GC cell lines (A) and GC

tissues (B). (C): The Pearson’s R correlation was analyzed between Pygo2 and MDR1

expression levels in GC patients after chemotherapy. NaT: normal-appearing tissue

adjacent to GC, GcT: GC tissue; NeC: GC tissue after neoadjuvant chemotherapy.

Figure 4. Pygo2 modulated MDR1 expression in GC. (A): The knock-down of

Pygo2 down was identified by WB after transfection. (B): The expression levels of

Pygo2 and MDR1 in SGC7901/DDP-pLL3.3-Pygo2-KD and SGC7901/DDP-pGL3.3.

(C): SGC7901/DDP-pLL3.3-Pygo2-KD and SGC7901/DDP-pGL3.3 were treated with

0.4 μg/mL DDP for 24 h, the apoptosis rate was analyzed by flow cytometry. (D):

SGC7901/DDP cells were transfected with the indicated plasmids and MDR1-reporter

gene luciferase activity was measured. (E):The interaction between Pygo2 and MDR1

promoter region using anti-Pygo2 antibody in SGC7901/DDP and GC tissue after

neoadjuvant chemotherapy (Nec) by ChIP assay. ***P＜0.001.