Purification and binding analysis of the nitrogen fixation ... · ible with nitrogen fixation (16)....

1363

Braz J Med Biol Res 31(11) 1998

A. brasilense NifA protein activityBrazilian Journal of Medical and Biological Research (1998) 31: 1363-1374ISSN 0100-879X

Purification and binding analysis of thenitrogen fixation regulatory NifA proteinfrom Azospirillum brasilense

Departamentos de 1Biotecnologia and 2Genética, Centro de Biotecnologia,Universidade Federal do Rio Grande do Sul, Porto Alegre, RS, Brasil3F.A. Janssens Laboratory of Genetics, Katholieke Universiteit Leuven,Heverlee, Belgium

L.M.P. Passaglia2,C. Van Soom3,

A. Schrank1 andI.S. Schrank1

Abstract

NifA protein activates transcription of nitrogen fixation operons bythe alternative σ54 holoenzyme form of RNA polymerase. This proteinbinds to a well-defined upstream activator sequence (UAS) located atthe -200/-100 position of nif promoters with the consensus motif TGT-N10-ACA. NifA of Azospirillum brasilense was purified in the form ofa glutathione-S-transferase (GST)-NifA fusion protein and proteolyticrelease of GST yielded inactive and partially soluble NifA. However,the purified NifA was able to induce the production of specific anti-A.brasilense NifA-antiserum that recognized NifA from A. brasilensebut not from K. pneumoniae. Both GST-NifA and NifA expressedfrom the E. coli tac promoter are able to activate transcription from thenifHDK promoter but only in an A. brasilense background. In order toinvestigate the mechanism that regulates NifA binding capacity wehave used E. coli total protein extracts expressing A. brasilense nifA inmobility shift assays. DNA fragments carrying the two overlapping,wild-type or mutated UAS motifs present in the nifH promoter regionrevealed a retarded band of related size. These data show that thebinding activity present in the C-terminal domain of A. brasilenseNifA protein is still functional even in the presence of oxygen.

CorrespondenceI.S. Schrank

Centro de Biotecnologia, Bloco IV

Av. Bento Gonçalves, 9500

Caixa Postal 15005

91501-970 Porto Alegre, RS

Brasil

Fax: +55-51-319-1079

E-mail: [email protected]

Research supported by CNPq,

FAPERGS and the Geconcerteerde

Onderzoeksactie (to J. Vanderleyden).

Received September 26, 1997

Accepted July 21, 1998

Key words• NifA protein• NifA antibodies• Azospirillum brasilense• Gel shift assay• NifA activity• Upstream activator

sequence

Introduction

In many diazotroph organisms, the nitro-gen fixation genes (nif ) are transcribed by analternative holoenzyme form of RNA poly-merase and require an activator protein, NifA.Both activity and synthesis of NifA are regu-lated in response to environmental effectors.Two major signals regulate nitrogen fixa-tion, oxygen and ammonia, and this regula-tion occurs mainly at the level of nif genetranscription mediated by NifA. NifA acts asa DNA-binding protein which recognizes

typical upstream promoter sequences (TGT-N10-ACA) showing many enhancer elementproperties located upstream of promoters ofthe -24/-12 type (1). The integration hostfactor protein (IHF) stimulates K. pneumo-niae NifA-mediated activation of nif pro-moters by facilitating DNA loop formation(2).

NifA activates nif transcription underoxygen and nitrogen-limiting conditions butbecomes inactive when levels of fixed nitro-gen or oxygen increase (3). This inactivationhas been attributed to the NifL protein, which

1364


L.M.P. Passaglia et al.

senses changes in the oxygen and/or nitro-gen status of the cell in Klebsiella pneumo-niae and Azotobacter vinelandii (4-7). In A.brasilense and members of the Rhizobiaceaefamily, where NifL has not been found, theNifA protein itself is inactivated by oxygen.The NifA protein contains a conserved motifof cysteine residues, which is absent in K.pneumoniae and A. vinelandii, involved insensitivity to oxygen in Bradyrhizobiumjaponicum and possibly in A. brasilense (8,9).

NifA proteins are structurally similar toeach other, and three independent domains,separated by two inter-linker-domains (IDL),were defined (8,10,11). The C-terminal do-main contains a helix-turn-helix DNA bind-ing motif (12,13); the central domain, in-volved in catalysis, contains the nucleotidebinding site (10,14) and the N-terminal do-main is not essential for K. pneumoniae NifAactivity. In K. pneumoniae this latter do-main, that has no homologue, appears todecrease the sensitivity to NifL (10,12,15).In A. brasilense, NifA is synthesized in aninactive form under conditions not compat-ible with nitrogen fixation (16). Moreover,its regulation differs considerably from thatfound in other free living diazotrophs. It hasbeen proposed that, in A. brasilense, the N-terminal domain plays an inhibitory rolewhich leads to the inactivation of NifA in theabsence of PII protein (17,18). PII proteinplays an essential role in the regulation ofnitrogen metabolism in E. coli by controllingthe activity of GS (19,20) and it appears thatglnB is essential for nitrogen fixation in A.brasilense (18). Another important featureof A. brasilense is the regulation of nitroge-nase activity at the post-translational levelby a �switch-off� mechanism in response toenvironmental changes in ammonia concen-tration (21). Therefore, the plant growth-promoting A. brasilense, which associateswith roots of economically important grasses,has some characteristic features at the levelof nitrogen fixation regulation.

In this paper, we report the production of

NifA from A. brasilense in E. coli cells, itspurification, the production of specific anti-serum and the analysis of the activity of therecombinant NifA protein. We also showthat the recombinant NifA proteins wereactive only in A. brasilense cells and wereable to induce transcription from the nifHpromoter. The ability of A. brasilense NifAto bind to upstream activator sequences pres-ent on nif genes even in its inactive form inresponse to oxygen is also demonstrated.

Material and Methods

Bacterial strains, plasmids and growthconditions

The bacterial strains and plasmids usedin the present study are listed in Tables 1 and2. LB medium (22) was used for growing E.coli strains at 37oC. YT medium (22) wasused to induce the glutathione-S-transferase(GST)-NifA fusion protein on E. coli BL21strains at 30oC. A. brasilense strains weregrown at 30oC in either LB medium or MMAbminimal medium (23) using 0.5% malate ascarbon source. MMAb without ammoniumchloride was used when nitrogen-free medi-um was required. The medium was supple-mented with the antibiotics tetracycline (Tc),ampicillin (Ap) or kanamycin (Km) whennecessary, at concentrations of 10, 100 or 30µg/ml, respectively.

Conjugation experiments were performedon D-plates (8 g/l Bacto nutrient broth, 0.25g/l magnesium sulfate, 1 g/l potassium chlo-ride, 0.01 g/l manganese chloride). MMAbmedium supplemented with Tc and Km wasused to select A. brasilense transconjugants.

DNA manipulations, nitrogenase assays,ß-galactosidase assays and conjugation

Plasmid DNA preparation, restrictionenzyme analysis, transformation and hybrid-ization were performed as described in refer-ence 22. Restriction endonucleases and other

1365


A. brasilense NifA protein activity

enzymes were purchased from Pharmacia(Uppsala, Sweden), Gibco/BRL (Gaithers-burg, MD) or Promega (Madison, WI) andused according to the manufacturer�s in-structions.

Nitrogenase activity was measured bythe acetylene reduction method described byBurris (24). Ethylene production was quan-tified on a Plot fused silica column (50 m x0.32 nm, 5 µm Al2O3/KCl, Chrompack) in-stalled in a Hewlett Packard 5890A gas chro-matograph. Propane was used as internalstandard.

Determination of ß-galactosidase activ-ity of the nif-lacZ promoter fusions was car-ried out according to the standard procedureof Miller (as described in reference 22) at25oC.

Plasmid mobilization from E. coli S17.1 toA. brasilense Sp7 by biparental conjugationwas performed as previously described (25).

Plasmid constructions

The strategy used to obtain the pKKAbAplasmid is shown in Figure 1A. DNA fromplasmid p10 was digested to generate the2.2-kb SmaI/SalI DNA fragment carryingthe coding region for NifA from A. brasilense.The SmaI site is located at 91 bp from theATG start codon. In the pKKAbA (pKK233-3 vector) construct the A. brasilense nifAgene is under the control of the tac promoter.

The nifA gene from A. brasilense wasalso cloned into three other plasmid vectors.Plasmid pKKAbA was digested with SalIand the entire construction, ptac-nifA, wascloned into the SalI site of the pACYC184vector (pAAbA plasmid). The pGEX 4T-1vector was used to generate a GST-NifAfusion protein. The SmaI/SalI 2.2-kb DNAfragment from plasmid p10 was also clonedinto the pGEX 4T-1 SmaI/SalI digested vec-tor. In this way the nifA gene was cloned inframe with GST and the recombinant plas-mid, pGEXAbA, was able to produce a GST-NifA fusion protein (Figure 2A).

Table 1 - Bacterial strains used in the present study.

Bacteria Strain Relevant characteristics Reference

A. brasilense Sp7 wild-type strain, ATCC 29145 37Sp7067 Sp7 mutant Nif -, nifA::Tn5 31Sp7077 Sp7 mutant Nif -, nifA::Tn5 31

E. coli MC1061 hsdR mcrB araD 139∆(araABC-leu) 387679 ∆lacX74 galU galK rpsL thi

BL21 hsdS gal (λcIts857 ind1 Sam7 nin5 39lacUV5-T7 gene1)

DH5α hsdR17 endA1 thi-1 gyrA96 relA1 22recA1 supE44 ∆lacU169(φ80lacZ∆M15)

S17.1 thi endA recA hsdR RP4-2-Tc::Mu-Kan::Tn7 40

Table 2 - Plasmids used in the present study.

Plasmid Relevant characteristics Reference

pBluescript ApR StratagenepUC18 ApR 22pKK223-3 ApR PharmaciapGEX 4T GST gene fusion vector, ApR PharmaciapLAFR3 pRK290 derivative having M13mp18 41

polylinker and λ cos sites, TcR

pCK3 pRK290 derivative having K. pneumoniae nifA gene 42pACYC184 TcR, CmR 43p10 pSUP202 derivative having 2.5-kb SalI nifA from Dr. Fabio Pedrosa,

A. brasilense, ApR UFPR, BrazilpMCH pnifH-lacZ, promoter from A. brasilense nifH, ApR 27pKKAbA pKK223-3 derivative, ptac-nifA this paper

(A. brasilense nifA gene), ApR

pAAbA pACYC184 derivative, ptac-nifA this paper(A. brasilense nifA gene), CmR

pGEXAbA pGEX 4T-1 derivative, GST-NifA fusion this paper(A. brasilense nifA gene), ApR

pLKSAbA pLAFR3 derivative, ptac-nifA this paper(A. brasilense nifA gene), TcR

pLpucNifA pLAFR3 derivative, GST-NifA fusion this paper(A. brasilense nifA gene), TcR

pKKKpA pKK223-3 derivative, ptac-nifA this paper(K. pneumoniae nifA gene), ApR

pKSKpLAB pBluescript KS+ derivative, carrying a 2.5-kb this laboratorySalI DNA fragment from K. pneumoniaenifLAB operon, ApR

pAKpA pACYC184 derivative, ptac-nifA this paper(K. pneumoniae nifA gene), CmR

pKSwt pBluescript derivative containing the 27A. brasilense nifH promoter

pKSUAS1 pBluescript derivative containing the 27A. brasilense nifH promoter UAS1 mutant

pKSUAS2 pBluescript derivative containing the 27A. brasilense nifH promoter UAS2 mutant

pGEXKpA pGEX 4T-3 derivative, GST-NifA fusion this paper(K. pneumoniae nifA gene), ApR

1366



For the complementation experiments,the nifA gene was cloned into the pLAFR3cosmid. Figure 3A depicts the steps used togenerate plasmid pLKSAbA carrying theptac-nifA construction and Figure 3B showsthe pLpucNifA derivative containing theGST-NifA fusion construction.

The nifA gene of K. pneumoniae was alsocloned into the transcriptional vectorpKK223-3 and into the translational fusionvector pGEX 4T-3. Plasmid pCRA37 (26)was digested with SalI, yielding a 2.9-kbDNA fragment carrying the K. pneumoniaenifLAB region. This fragment was cloned

into the pBluescript KS+ vector generatingthe pKSKpLAB plasmid. To remove the nifLgene, pKSKpLAB was digested with XhoIand Bal 31 deletions were carried out. Twodifferent deleted DNA fragments have beenselected and confirmed by DNA sequenc-ing. The first one, shown in Figure 1B, hasonly 91 bp upstream from the nifA ATG startcodon and was cloned into the pKK223-3vector under the control of the tac promoterto produce the recombinant plasmidpKKKpA. To construct plasmid pAKpA,the ptac-nifA region from pKKKpA was re-moved by SalI digestion and cloned into thepACYC184 SalI digested vector. The sec-ond Bal 31 deleted fragment was cloned intothe pBluescript vector, named pKS3.1(5.1),and completely sequenced. Figure 2B showsthe strategy used to clone the NifA as afusion protein with GST into the pGEX 4T-3 vector to produce the plasmid pGEXKpA.

Cell extracts and detection of NifA byWestern blot

Coupled transcription/translation in S30extracts (Promega), using either pKKAbAor pKKKpA plasmids, were prepared fol-lowing the instructions provided by the manu-facturers.

E. coli BL 21 extracts, carryingpGEXAbA or pGEXKpA plasmids, andDH5α, carrying plasmids pKKAbA orpAAbA, were prepared after growing thecells for 2 h at 30oC in YT medium supple-mented with ampicillin. The fusion proteinwas induced in aerobically grown culturesby the addition of 0.1 mM IPTG and the cellswere harvested after growing for another 3 hat the same temperature. Proteins (1/4 of theculture) were separated on 10% SDS/poly-acrylamide gels and visualized by Coomassieblue staining. Western blotting was per-formed as described in reference 22. Detec-tion was carried out using monoclonal anti-bodies against GST or A. brasilense NifAantiserum. The reaction was incubated with

A SalI SmaI SalIATG

2.5 kbnifA

Sall/SmaI

SmaI SalI

ATG

2.2 kbnifA

SmaI SalI HindIII

SmaI/HindIII

ATG nifA

SmaISalI HindIIISalI

plasmid pKKAbA

ptac

ATG nifA

Figure 1 - Cloning strategy forthe insertion of nifA, from A.brasilense (A) and from K. pneu-moniae (B), into the pKK223-3vector. The figure also showsthe restriction map of plasmidp10 containing the nifA genefrom A. brasilense (A) and plas-mid pCRA37 containing thenifLAB genes from K. pneumo-niae (B). The black boxes repre-sent the pKK223-3 vector andthe gray boxes represent thepUC18 vector in A and thepBluescript vector in B.

B XhoI SalI HindIIISalI

ATG

nifAATG

ATG nifA

HindIII

SalI

HindIII

SmaI

HindIII

BamHIFill in

BamHI SmaI

blunt end

nifLAB

HindIII

XholBal31 deletions

pKS+SmaI/HindIII

pKK223-3SmaI/HindIII

HindIIISalIATG nifA

plasmid pKKKpA

ptac

ptac

1367



anti-mouse antibody labeled with alkalinephosphatase and developed with a goat anti-mouse (IgG) secondary antibody using thesubstrate B-CIP/NBT detection system(Sigma, St. Louis, MO).

Purification of NifA protein andimmunological procedures

A. brasilense NifA protein was purifiedfrom E. coli harboring the pGEXAbA plas-mid as described in the GST Gene FusionSystem (Pharmacia 2nd edn.). The purifiedNifA protein was used as immunogen for thegeneration of mouse antiserum as follows.Five female BALB/c white mice were im-munized by intradermal injection with NifA.The purified protein (10 mg) was mixed withan equal volume of Freund�s complete adju-vant for the first injection, or with Freund�sincomplete adjuvant for the second injection12 days later. One week after the secondinjection, NifA antiserum was collected, di-luted 1:100 and used for Western immuno-blot experiments.

Gel shift motility assays

DNA-binding assays were performed asdescribed before (27).

The oligonucleotides used in the PCR re-actions were 5�TGCATCCCCCGTGCCAGTTCGCG3� and 5�CCTGACGCTGGCTCTGACGCTGG 3�. The first oligonucleotide waslabeled with digoxigenin (DIG) and the detec-tion system was that described in the DIG gelshift kit (Boehringer, Mannheim, Germany).

Results and Discussion

Detection of NifA activity on transcriptionalfusions

To demonstrate the activity of A. brasi-lense NifA protein in vitro (binding assays),we directed the synthesis of this protein froman expression vector (pKK223-3) in a

A

B

Figure 2 - Cloning strategy for the insertion of nifA from A. brasilense (A) and from K.pneumoniae (B) into the pGEX 4T vector. The nucleotide sequence from the nifA gene isindicated in bold type. The first amino acids for the coding region of NifA are indicated inbold above the nucleotide sequence. Small capital letters represent the pUC18 polylinker.The region that represents the nifA gene/NifA protein is marked by an arrow.

1368



coupled transcription-translation system (S30extracts). Two plasmids, pKKAbA andpKKKpA, carrying transcriptional fusionsof A. brasilense and K. pneumoniae nifAgenes with tac promoter were constructed(Figure 1) and tested. Induction of the ex-pression from tac promoter in strains carry-ing the plasmids resulted in no detectableproduction of the 35S-labeled proteins on10% SDS-polyacrylamide gels.

To analyze the capability of the nifAprotein to activate the nifH promoter twoother plasmid constructions were made. Plas-mids pAAbA and pAKp6 carry the sametranscriptional fusion present in pKKAbAand pKKKpA, but were cloned into a vector(pACYC184) compatible with pMCH (27),containing the A. brasilense nifH promoterfused to lacZ. Cell cultures were preparedfrom strain MC1061 carrying the pMCHplasmid and from the two different con-structs which produced NifA either from A.brasilense or from K. pneumoniae. Tran-scriptional activation of the A. brasilensenifH promoter in vivo by K. pneumoniaeNifA protein is shown in Table 3. The tran-scriptional fusion of A. brasilense nifA pro-tein failed to activate the nifH promoter.

The transcription/translation coupled sys-tem was used previously to analyze the ac-tivity of NifA protein from R. meliloti (28)and K. pneumoniae (29,30). The activitypresent in the control construction (tac-nifAfrom K. pneumoniae) is in agreement withprevious results which have shown that thisprotein is able to activate the nifH promoterfrom A. brasilense (27; Table 3). The failureof the A. brasilense tac-nifA fusion proteinto activate the nifH promoter is probably dueto its inactive form in the presence of oxygen(31).

Detection of NifA activity on translationalfusions

In order to purify A. brasilense NifA andto induce the production of antibodies we

Figure 3 - Strategy for cloning the nifA gene from A. brasilense into cosmid pLAFR3. Ashows the steps for cloning the transcriptional tac-nifA fusion construct, and B shows thesteps for cloning the translational fusion GST-NifA. Black boxes indicate the pKK223-3vector in A and the pGEX 4T-1 vector in B; striped boxes indicate the pBluescript vector in Aand the pUC18 vector in B; gray boxes indicate the pLAFR3 vector. The stippled arrowindicates the sequence of the GST protein from vector pGEX 4T-1.

ATG nifA

HindIIISalI

plasmid pKKAbA

SalI

SalIKpnI SalI HindIII

KpnI/HindIII

ATG nifA

SmaISalI

ptac

plasmid pKKAbA

HindIII

HindIII

ATG nifA

ATG nifA

plasmid pLpucNifA

Fill in pUC18SmaI

SmaI

SmaI

KpnI

KpnI

KpnI

HindIII

↓

B

↓↓

↓

↓

A

↓

HindIIISalISmaISalIKpnI

ATG nifA

EcoRV SalISmaI

ATG nifA

pGEXAbA

EcoRVSalI

SmaI

ptac

ptac

1369



cloned the coding region as a translationalfusion with GST (pGEX vector). NifA pro-tein from K. pneumoniae has been previ-ously purified as active fusion protein withMBP using the whole sequence (13), onlythe catalytic domain (15), only the N-termi-nal domain or only the C-terminal domain(32). In the present study two plasmids wereconstructed, pGEXAbA carrying the A.brasilense NifA protein fused with GST andpGEXKpA carrying the GST-NifA fusedprotein from K. pneumoniae (Figure 2). Af-ter digestion with thrombin, the A. brasilenseNifA protein has an addition of 31 aminoacids from the NifA noncoding region of A.brasilense in the N-terminal domain. TheGST-NifA fusion protein from K. pneumo-niae has a NifA deleted for the 32 first aminoacids and an insertion of 9 extra amino acidsfrom the pUC18 polylinker (Figure 2).

To verify the constructions, ß-galactosi-dase activity was determined in E. coli cellscarrying the pMCH plasmid and the activityof the truncated NifA from K. pneumoniae isshown in Table 3. The transcriptional activa-tion shows low values due to the incompat-ibility between plasmids pMCH andpGEXKpA resulting in transient expressiononly. We demonstrated that the K. pneumo-niae NifA fused with GST, partially deletedat the N-terminal domain, is in its activeform. Similar results were reported by Bergeret al. (32) using NifA fusion with MBP,showing the activity of NifA both in vivo andin vitro. However, the A. brasilense NifAfusion protein was unable to induce ß-galac-tosidase activity from the nifH promoter inE. coli extracts.

Immunological detection of A. brasilenseNifA protein

A. brasilense NifA protein was purifiedfrom E. coli extracts as a GST-NifA fusionprotein (plasmid pGEXAbA). NifA was re-leased from GST by cleavage with thrombin(Figure 4, lanes 4 and 5). Approximately

Table 3 - Activation of nifH promoter by K. pneumoniae NifA in an E.coli background.

All plasmids were transformed to E. coli and, after growth at 37oCfor 18 h, ß-gal activity was measured. Results are reported as themeans of three representative experiments. ND = Not determined.

Plasmids ß-Galactosidase activity (Miller’s units)

Activator Reporter NifA absent NifA present

pMCH 21.94 NDpCK3 pMCH ND 2383.56pGEXKpA pMCH ND 708.67pAKp6 pMCH ND 8065.01

kDa

66

4534

24

1 2 3 4 5 6

NifA

Figure 4 - Purification of NifA from E. coli BL21 (pGEXAbA). SDS-PAGE ofdenatured samples. Total E. coli extracts containing the GST-NifA fusionprotein present in the supernatant (lane 2) and pellet (lane 3). Total E. coliextracts containing the A. brasilense NifA protein, after cleavage withthrombin, present in the supernatant (lane 4) and pellet (lane 5). Lane 6, 1µg of purified NifA preparation and lane 1, molecular mass standards(Pharmacia). The position of NifA is indicated by the arrow.

50% of the NifA protein remained in thesupernatant (Figure 4, lane 5) and was puri-fied by standard procedures (Figure 4, lane6). NifA polypeptide has an apparent molec-ular mass of 51 kDa (Figure 5), whereas thepredicted NifA protein size, deduced fromthe nucleotide sequence, was 77 kDa (31).This discrepancy was also found by Arsèneet al. (33) and they suggested that it could bedue to the presence of a high proline residuecontent. Proteins rich in proline can causeanomalous migration in SDS-PAGE.

The purified NifA protein was used to

→

1370



pKKAbA or pAAbA plasmids (ptac-nifA)(Figure 5, lanes 3 and 4). The fusion GST-NifA protein was also detected with antise-rum (Figure 5, lane 2). The extra bandspresent in all extracts are cross-reactive non-specific E. coli antibodies.

Immunodetection allowed us to verifythe A. brasilense NifA constructs. We wereable to demonstrate the expression of A.brasilense NifA from the tac promoter andalso as a fusion GST-NifA protein (Figure5). The antiserum is specific for A. brasilenseNifA since it does not recognize NifA fromK. pneumoniae (Figure 6, lanes 7-12). It isknown that K. pneumoniae NifA proteinshows an intrinsic tendency to aggregate andcan only be purified as a fusion MBP-NifAprotein (13,15,30,32). Although the NifAproteins from A. brasilense and K. pneumo-niae have a high level of amino acid se-quence identity (31), they differ in nifA ex-pression patterns. We demonstrate here thatA. brasilense NifA protein can be easilypurified from aerobically grown E. coli cells,but is inactive. The present results also showthat A. brasilense NifA can be synthesized inE. coli driven by the tac promoter and, al-though the protein is unable to activate thenifH promoter in E. coli cells, it is able tobind to the UAS present in this promoter (seeBinding activity of the A. brasilense NifAprotein).

Activity of the A. brasilense NifA protein

The activity of the NifA protein was de-termined by its ability to restore nitrogenfixation to A. brasilense nifA-Tn5 mutantstrains, under nitrogen fixation conditions.For this reason, we constructed the pLAFR3derivative plasmids pLpucNifA andpLKSAbA (Figure 3). In this way, we wereable to analyze both NifA constructs, theGST-NifA fused protein and the ptac-NifAexpression system. Table 4 shows the nitro-genase activity of the wild type and mutantA. brasilense strains. The two constructs

kDa

GST-NifA →

66

45

→NifA

1 2 3 4 5Figure 5 - Immunodetectionof the A. brasilense NifAfrom E. coli cells using anti-A. brasilense NifA-antibod-ies. The E. coli strains con-tain the following plasmids:pGEXAbA (GST-NifA), lane2; pKKAbA (ptac-NifA), lane3; pAAbA (ptac-NifA), lane4, and no plasmid, lane 5.Partially purified A. brasilen-se NifA protein (1 µg) wasused as control (lane 1). Thearrows indicate the positionof the purified NifA or theGST-NifA fusion protein.

GST-NifA →

45→NifA

66

kDa1 2 3 4 5 6 7 8 9 10 11 12

Figure 6 - Immunodetection of the A. brasilense NifA from E. coli cells harboring thepGEXAbA plasmid. Lane 1, partially purified A. brasilense NifA protein; lanes 2-6, E. coliextracts carrying the pGEXAbA plasmid, and lanes 7-12, E. coli extracts carrying pGEXKpAplasmid (K. pneumoniae GST-NifA fusion protein).

elicit antibodies. To detect the presence ofNifA protein, Western blot analysis was per-formed using the anti-A. brasilense NifAantiserum. The antibodies reacted with thepurified A. brasilense NifA protein (Figure5, lane 1) and also with a related polypeptideband present in E. coli extracts harboring

1371



were able to restore a Nif+ phenotype to thenifA-Tn5 mutant strains. The reduced activ-ity, as compared to the wild-type strain, couldbe due to the structure of the NifA proteinfound in these constructions containing theextra amino acids or even the GST protein.Transcriptional regulation should be ruledout because no nifA promoter was present.

Binding activity of the A. brasilense NifAprotein

The A. brasilense nifH promoter presentstwo overlapping UASs and their role wasexamined by introducing base substitutionsin both UAS sites, generating plasmidspKSUAS1 and pKSUAS2 (27). A 630-bpSau3A DNA fragment from plasmids pKSwt,pKSUAS1 and pKSUAS2 (27) was used astarget sequence to amplify by PCR a 200-bpfragment containing the two overlappingwild-type UASs, the UAS1 mutant and theUAS2 mutant, respectively. To assay the A.brasilense NifA binding capacity, total pro-tein extracts isolated from E. coli MC1061carrying plasmids p10, pAAbA or pGEXAbAwere incubated with the DIG-labeled 200-bpDNA fragment (Figure 7A). Total proteinextracts carrying K. pneumoniae NifA pro-tein provided by plasmids pCK3, pAKpA orpGEXKpA were used as positive control.The binding reactions were carried out at30°C for 20 min in order to maintain theNifA protein in an active form (13). A re-tarded band was visualized when extractsfrom MC1061/pCK3, MC1061/pAKpA,MC1061/pGEXKpA, MC1061/p10 andMC1061/pAAbA were incubated with theUAS-carrying fragments (Figure 7A, lanes4-8). No shift was detected when an extractfrom MC1061 was used (Figure 7A, lane 2)or when an extract from MC1061/pCK3 wasincubated with a 230-bp DNA fragment,with no UAS motif (Figure 7A, lane 3). Tworetarded bands appeared when an extractfrom MC1061/pGEXAbA was used (Figure7A, lane 9). The upper new extra band was

Table 4 - Nitrogenase activity of A. brasilense.

Complementation was measured in overnight cultures. The data are the average ofthree independent assays. ND = Not determined.

Strain Nitrogenase activity (nmol C2H4 min-1 mg protein-1)

PlasmidNo. pLpucNifA pLKSAbA

Sp7 39.38 ND NDSp7067::Tn5 <0.1 17.87 16.85Sp7077::Tn5 <0.1 8.75 8.66

1 2 3 54 6 7 8 9

1 2 3 54 6 7 8 9

Figure 7 - Binding of NifA protein to the nifH UAS promoter region by gel-mobility shiftassay. A, The 200-bp DIG labeled DNA fragment was incubated with crude cell superna-tant from E. coli strains (20 µg total extract/reaction) containing the K. pneumoniae NifAprotein synthesized by plasmids pCK3 (lane 4), pAKpA (lane 5) and pGEXKpA (lane 6) orA. brasilense NifA protein synthesized by plasmids p10 (lane 7), pAAbA (lane 8) andpGEXAbA (lane 9), alone or fused with GST protein. Lane 1, control of DNA fragment;lane 2, the control of the DNA fragment was incubated with MC1061 total extract, andlane 3, a 230-bp DNA fragment with no UAS motif, used as a probe, was incubated withMC1061/pCK3 total extract (negative controls). B, Lanes 1, 4 and 7 correspond to theadded wild-type UAS region, UAS1 mutant and UAS2 mutant fragments, respectively.Lanes 2 and 3, wild-type fragment incubated with crude cell supernatant from E. colistrains (20 µg total extract/reaction): MC1061/pAAbA (lane 2) and MC1061/pGEXAbA(lane 3). Lanes 5 and 6, UAS1 mutant fragment incubated with total extracts fromMC1061/pAAbA (lane 5) and from MC1061/pGEXAbA (lane 6). Lanes 8 and 9, UAS2mutant fragment incubated with total extracts from MC1061/pAAbA (lane 8) andMC1061/pGEXAbA (lane 9). The full arrowheads represent the retarded bands and theopen arrowhead represents the free-labeled fragment.

A

B

1372



ment, and incubated with anti-A. brasilenseNifA-antibody (Figure 8). Increasing a-mounts of antibody led to the formation of ahigh molecular weight complex which wasnot visible in the control reaction (Figure 8,lane 2). Since this antibody was shown to bespecific for A. brasilense NifA protein, thesupershift effect detected when both extractswere used should be due to the formation ofthe DNA-NifA-antiNifA complex. A similarresult was also reported by Zimmer et al.(34) using extracts enriched for HoxA pro-tein in the presence of purified HoxA anti-bodies.

Up to now, only NifA from K. pneumo-niae and A. vinelandii have been purified.The K. pneumoniae NifA protein has beenpurified as a fusion protein with MBP, pro-viding a large N-terminal extension (13).The A. vinelandii NifA protein was purifiedas a soluble active protein and showed invitro control functions predicted from invivo functions (7). In these two bacteria theactivity of NifA is modulated by the negativeregulatory protein NifL in response to envi-ronmental oxygen and fixed nitrogen (6,7).The A. brasilense NifA protein belongs to aclass of proteins that are not active in thepresence of oxygen, based on the model ofregulation proposed by Fischer et al. (8,9)that involves the cysteine residues found inthe inter-linker domain. Another feature ofA. brasilense NifA is that the N-terminaldomain inhibits its own activity in the pres-ence of ammonia (33). This was explainedby the presence of two closely related PII

proteins found in A. brasilense (18) that areinvolved in different regulatory steps of ni-trogen metabolism. The PII protein, a prod-uct of the glnB gene, is required for modulat-ing NifA activity in response to changes incellular nitrogen levels (18,33).

Our work demonstrates that the NifAfrom A. brasilense can be expressed in E.coli extracts both as a fusion protein or asNifA itself but is still inactive in aerobicallygrown cells. This inactivation could be due

visualized only with E. coli harboring thisplasmid and was probably due to the highmolecular weight GST-NifA fusion protein.

When the 200-bp DNA fragments carry-ing the mutated UAS motifs were used as aprobe a gel shift band was also visualized(Figure 7B). The extra band in gel shiftassays was also detected when the UASmutant DNA fragments were mixed with A.brasilense NifA fused with GST (MC1061/pGEXAbA). Previously, we have demon-strated that the two overlapping UAS se-quences have differential effects on nifHpromoter activity using K. pneumoniae NifAprotein (27). However, the binding affinityof A. brasilense NifA protein, fused or notwith GST, revealed no specificity when wecompared wild-type or mutant UAS DNAfragments.

To further analyze the binding of NifAprotein, mobility gel shift assays were car-ried out with NifA preparations (total ex-tracts from MC1061/pAAbA and MC1061/pGEXAbA), wild-type UAS-carrying frag-

1 2 3 4 5 6 7

Figure 8 - Mobility shift assay ofE. coli extracts carrying plasmidspAAbA (A) or pGEXAbA (B) inthe presence of increasingamount of purified NifA anti-body. Standard binding reactionswere carried out with the totalextracts previously incubatedovernight with different antibodyconcentrations. Lane 1, Wild-type fragment only; lane 2, wild-type fragment and 20 µg of pro-tein. Lanes 3 to 7, different a-mounts of antibody reacting withfragment/protein as in lane 2.Lane 3, 2 µl of anti-NifA; lane 4,4 µl of anti-NifA; lane 5, 8 µl ofanti-NifA; lane 6, 16 µl of anti-NifA and lane 7, 32 µl of anti-NifA. The supershift band is indi-cated by the full arrowhead.

1 2 3 54 6 7

A

B

1373



to the lack of A. brasilense PII-like protein inE. coli cells. However, NifA activity wasobtained in A. brasilense nifA mutants. Thus,even if a different mechanism is involved inthe regulation of nitrogen fixation in thepresence of ammonia, it is possible that onemechanism of control occurs at the level ofNifA inactivation through its N-terminaldomain, mediated by PII protein (18).

The modular structure of transcriptionalactivators suggests that inactive NifA wouldbe able to bind to its target sequences (35). Ithas been shown, in the case of K. pneumo-niae NifA, that DNA binding activity can beseparated from the transcriptional activationcapacity (32). The oxygen sensitivity of theA. brasilense NifA is attributed to the con-served motif of cysteine residues which ispresent in the interdomain linker betweenthe central and carboxy-terminal domains(8,9). Upon oxygen inactivation, it can behypothesized that the conformation of thecentral domain is altered in such a way thattranscriptional activation capacity is lost,

without affecting the DNA-binding capacityof the carboxy-terminal domain. In the caseof NtrC-like transcriptional activators, wheretranscriptional activation capacity is regu-lated by phosphorylation, the inactive,unphosphorylated activator is still able tobind to its UAS (36). In this study we showthat, although A. brasilense NifA protein isunable to activate nif promoters in aerobio-sis due to its sensitivity to oxygen, the pro-tein retains the ability to bind UAS sequences.

Acknowledgments

The authors thank F. Pedrosa for the giftof plasmid p10 and H.B. Ferreira and S.S.Farias for the gift of plasmid pGEX and forhelp during the immunological experiments.We are indebted to J. Vanderleyden for pro-viding the opportunity for L.M.P. Passagliato develop part of the experiments in hislaboratory and for helpful discussions.

References

1. Buck M, Miller S, Drummond MH & DixonRA (1986). Upstream activator sequencesare present in the promoters of nitrogenfixation genes. Nature, 320: 374-378.

2. Hoover TR, Santero E, Porter SC & KustuS (1990). The integration host factorstimulates interaction of RNA polymerasewith NIFA, the transcriptional activator fornitrogen fixation operons. Cell, 63: 11-22.

3. Buchanan-Wollaston AV, Cannon MC,Beynon JL & Cannon FC (1981). Role ofthe nifA gene product in the regulation ofnif expression in Klebsiella pneumoniae.Nature, 294: 776-778.

4. Hill S, Kennedy C, Kavanagh EP, GoldbergR & Hanan R (1981). Nitrogen fixationgene (nifL) involved in oxygen regulationof nitrogenase synthesis in Klebsiellapneumoniae. Nature, 290: 424-426.

5. Merrick M, Hill S, Hennecke H, Hahn M,Dixon R & Kennedy C (1982). Repressorproperties of the nifL gene product inKlebsiella pneumoniae. Molecular andGeneral Genetics, 185: 75-81.

6. Lee H, Narberhaus F & Kustu S (1993). Invitro activity of NifL, a signal transduction

protein for biological nitrogen fixation.Journal of Bacteriology, 175: 7683-7688.

7. Austin S, Buck M, Cannon W, Eydmann T& Dixon RA (1994). Purification and invitro activities of the native nitrogen fixa-tion control proteins NifA and NifL. Jour-nal of Bacteriology, 176: 3460-3465.

8. Fischer HM, Bruderer T & Hennecke H(1988). Essential and non-essential do-mains in the Bradyrhizobium japonicumNifA protein: identification of indispen-sible cysteine residues potentially in-volved in redox reactivity and/or metalbinding. Nucleic Acids Research, 16:2207-2224.

9. Fischer HM, Fritsche S, Herzog B &Hennecke H (1989). Critical spacing be-tween two essential cysteine residues inthe interdomain linker of the Bradyrhizo-bium japonicum NifA protein. FEBS Let-ters, 255: 167-171.

10. Drummond MH, Whitty P & Wootton JC(1986). Sequence and domain relation-ships of ntrC and nifA from Klebsiellapneumoniae: homologies to other regula-tory proteins. EMBO Journal, 5: 441-447.

11. Drummond MH, Contreras A & MitchenallLA (1990). The function of isolated do-mains and chimaeric proteins constructedfrom the transcriptional activators NifAand NtrC of Klebsiella pneumoniae. Mo-lecular Microbiology, 4: 29-37.

12. Morett E, Cannon W & Buck M (1988).The DNA-binding domain of the transcrip-tional activator protein NifA resides in itscarboxy terminus, recognises the up-stream activator sequences of nif promot-ers and can be separated from the posi-tive control function of NifA. Nucleic Ac-ids Research, 16: 11469-11488.

13. Lee H, Berger DK & Kustu S (1993). Activ-ity of purified NifA, a transcriptional acti-vator of nitrogen fixation genes. Proceed-ings of the National Academy of Sciences,USA, 90: 2266-2270.

14. Cannon W & Buck M (1992). Central do-main of the positive control protein NifAand its role in transcriptional activation.Journal of Molecular Biology, 225: 271-286.

15. Berger DK, Narberhaus F & Kustu S(1994). The isolated catalytic domain of

1374



NIFA, a bacterial-binding protein, activatestranscription in vitro: Activation is inhib-ited by NIFL. Proceedings of the NationalAcademy of Sciences, USA, 91: 103-107.

16. Liang YY, de Zamaroczy M, Arsène F,Paquelin A & Elmerich C (1992). Regula-tion of nitrogen fixation genes in Azospi-rillum brasilense Sp7: Involvement of thenifA, glnB and glnA gene products. FEMSMicrobiology Letters, 100: 113-120.

17. de Zamaroczy M, Paquelin A & ElmerichC (1993). Functional organization of theglnB/glnA cluster of Azospirillum brasilen-se. Journal of Bacteriology, 175: 2507-2515.

18. de Zamaroczy M, Paquelin A, Peltre G,Forchhammer K & Elmerich C (1996). Co-existence of two structurally similar butfunctionally different PII proteins in Azos-pirillum brasilense. Journal of Bacteriol-ogy, 178: 4143-4149.

19. Magasanik B (1988). Reversible phospho-rylation of an enhancer binding proteinregulates the transcription of bacterial ni-trogen fixation genes. Trends in Biochemi-cal Sciences, 13: 475-479.

20. Stock JB, Ninfa AJ & Stock AM (1989).Protein phosphorylation and regulation ofadaptative responses in bacteria. Micro-biological Reviews, 53: 450-490.

21. Zhang Y, Burris RH, Ludden PW & Rob-erts GP (1994). Posttranslational regula-tion of nitrogenase activity in Azospirillumbrasilense ntrBC mutants: Ammoniumand anaerobic switch-off occurs throughindependent signal transduction path-ways. Journal of Bacteriology, 176: 5780-5787.

22. Sambrook J, Fritsch EF & Maniatis T(1989). Molecular Cloning: A LaboratoryManual. Cold Spring Harbor LaboratoryPress, New York.

23. Vanstockem M, Michiels K &Vanderleyden J (1987). Transposon mu-tagenesis of Azospirillum brasilense andAzospirillum lipoferum: physical analysisof Tn5 and Tn5-mob insertion mutants.Applied and Environmental Microbiology,53: 410-415.

24. Burris RH (1972). Nitrogen fixation - assaymethods and techniques. Methods in En-zymology, 248: 415-431.

25. Galimand M, Perroud B, Delorme F,Paquelin A, Vieille C, Bozouklian H &

Elmerich C (1989). Identification of DNAregions homologous to nitrogen fixationgenes nifE, nifUS and fixABC in Azospiril-lum brasilense Sp7. Journal of GeneralMicrobiology, 135: 1-13.

26. Cannon FC, Riedel GE & Ausubel FM(1979). Overlapping sequences of Kleb-siella pneumoniae nif DNA cloned andcharacterised. Molecular and General Ge-netics, 174: 59-66.

27. Passaglia LMP, Schrank A & Schrank IS(1995). The two overlapping Azospirillumbrasilense upstream activator sequenceshave differential effects on nifH promoteractivity. Canadian Journal of Microbiology,41: 849-854.

28. Beynon JL, Williams MK & Cannon FC(1988). Expression and functional analysisof the Rhizobium meliloti nifA gene.EMBO Journal, 7: 7-14.

29. Santero E, Hoover TR, Keener J & Kustu S(1989). In vitro activity of the nitrogen fixa-tion regulatory protein NifA. Proceedingsof the National Academy of Sciences,USA, 86: 7346-7350.

30. Austin S, Henderson NC & Dixon RA(1990). Characterization of the Klebsiellapneumoniae nitrogen-fixation regulatoryproteins NifA and NifL in vitro. EuropeanJournal of Biochemistry, 187: 353-360.

31. Liang YY, Kaminski PA & Elmerich C(1991). Identification of a nifA-like regula-tory gene of Azospirillum brasilense Sp7expressed under conditions of nitrogenfixation and in the presence of air andammonia. Molecular Microbiology, 5:2735-2744.

32. Berger DK, Narberhaus F, Lee H & KustuS (1995). In vitro studies of the domainsof the nitrogen fixation regulatory proteinNIFA. Journal of Bacteriology, 177: 191-199.

33. Arsène F, Kaminski PA & Elmerich C(1996). Modulation of NifA activity by PIIin Azospirillum brasilense: evidence for aregulatory role of the NifA N-terminal do-main. Journal of Bacteriology, 178: 4830-4838.

34. Zimmer D, Schwartz E, Tran-Betcke A,Gewinner P & Friedrich B (1995). Temper-ature tolerance of hydrogenase expres-sion in Alcaligenes eutrophus is conferredby a single amino acid exchange in thetranscriptional activator HoxA. Journal of

Bacteriology, 177: 2373-2380.35. North AK, Klose KE, Stedman KM & Kustu

S (1993). Prokaryotic enhancer bindingproteins reflect eukaryotic-like modular-ity: the puzzle of nitrogen regulatory pro-tein C. Journal of Bacteriology, 175: 4267-4273.

36. Van Soom C, de Wilde P & VanderleydenJ (1997). HoxA is a transcriptional regula-tor for expression of the hup structuralgenes in free-living Bradyrhizobium japo-nicum. Molecular Microbiology, 23: 967-977.

37. Tarrand JJ & Krieg NR (1978). A taxo-nomic study of the Spirillum lipoferumgroup with descriptions of a new genus,Azospirillum gen. nov. and two species,Azospirillum lipoferum (Beijerinck) comb.nov. and Azospirillum brasilense sp. nov.Canadian Journal of Microbiology, 24:967-980.

38. Casadaban MJ, Chou J & Cohen SN(1980). In vitro gene fusions that join anenzymatically active beta-galactosidasesegment to amino-terminal fragments ofexogenous proteins: Escherichia coli plas-mid vectors for the detection and cloningof translational initiation signals. Journalof Bacteriology, 143: 971-980.

39. Studier FW & Moffatt BA (1986). Use ofbacteriophage T7 RNA polymerase to di-rect selective high-level expression ofcloned genes. Journal of Molecular Biol-ogy, 189: 113.

40. Simon R, Priefer U & Pühler A (1983). Abroad host range mobilization system forin vivo genetic engineering: transposonmutagenesis in Gram negative bacteria.Bio/Technology, 1: 784-790.

41. Staskawicz B, Dahlbeck D, Keen N &Napoli C (1987). Molecular characteriza-tion of cloned avirulence genes from Oand race 1 of Pseudomonas syringe p.v.glycinea. Journal of Bacteriology, 169:5789-5794.

42. Kennedy C & Drummond MH (1985). Useof cloned nif regulatory elements fromKlebsiella pneumoniae to examine nifregulation in Azotobacter vinelandii. Jour-nal of General Microbiology, 131: 1787-1795.

43. Rose RE (1988). The nucleotide sequenceof pACYC184. Nucleic Acids Research,16: 355.

Purification and binding analysis of the nitrogen fixation ... · ible with nitrogen fixation (16)....

Documents

Transcript of Purification and binding analysis of the nitrogen fixation ... · ible with nitrogen fixation (16)....