pure.uva.nl · Complement in neuroinﬂ ammation: Studies in leprosy and Amyotrophic Lateral...

UvA-DARE is a service provided by the library of the University of Amsterdam (http://dare.uva.nl)

UvA-DARE (Digital Academic Repository)

Complement in neuroinflammationStudies in leprosy and Amyotrophic Lateral SclerosisBahia El Idrissi, N.

Link to publication

Creative Commons License (see https://creativecommons.org/use-remix/cc-licenses):Other

Citation for published version (APA):Bahia El Idrissi, N. (2017). Complement in neuroinflammation: Studies in leprosy and Amyotrophic LateralSclerosis.

General rightsIt is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s) and/or copyright holder(s),other than for strictly personal, individual use, unless the work is under an open content license (like Creative Commons).

Disclaimer/Complaints regulationsIf you believe that digital publication of certain material infringes any of your rights or (privacy) interests, please let the Library know, statingyour reasons. In case of a legitimate complaint, the Library will make the material inaccessible and/or remove it from the website. Please Askthe Library: https://uba.uva.nl/en/contact, or a letter to: Library of the University of Amsterdam, Secretariat, Singel 425, 1012 WP Amsterdam,The Netherlands. You will be contacted as soon as possible.

Download date: 12 Nov 2020

https://dare.uva.nl/personal/pure/en/publications/complement-in-neuroinflammation(6455df2c-f9a6-403a-8061-7260d7446e3b).html

Com

plement in neuroinfl am

mation: Studies in leprosy and Am

yotrophic Lateral Sclerosis N

awal Bahia El Idrissi

Complement in neuroinfl ammation: Studies in leprosy and Amyotrophic

Lateral Sclerosis

Nawal Bahia El Idrissi

UITNODIGING

U bent van harte welkom bij de openbare verdediging

van het proefschrift

Complement in neuroinfl ammation:

Studies in leprosy and Amyotrophic Lateral

Sclerosis

Dinsdag 24 januari 2017

Agnietenkapel,Universiteit van AmsterdamOudezijds Voorburgwal 231,

Amsterdam

Nawal Bahia El [email protected]

ParanimfenZineb Bahia el [email protected]

Iliana [email protected]

Complement in neuroinflammation: Studies in leprosy and

Amyotrophic Lateral Sclerosis


Cover design by Georgia Michailidou

Layout and printing by Ridderprint B.V.

The work described in this thesis was performed at the Department of Genome

Analysis, Academic Medical Center Amsterdam, University of Amsterdam in The

Netherlands.

None of the sponsors had a role in the design, measurements or presentation of the

results discussed in this thesis.

Financial support for printing this thesis: Derphartox, Q.M. Gastmann Wichers

stichting and Leprastichting

ISBN: 978-94-6299-507-9

Complement in neuroinflammation:

Studies in leprosy and Amyotrophic Lateral Sclerosis

ACADEMISCH PROEFSCHRIFT

ter verkrijging van de graad van doctor

aan de Universiteit van Amsterdam

op gezag van de Rector Magnificus

prof. dr. ir. K.I.J. Maex

ten overstaan van een door het College voor Promoties ingestelde commissie,

in het openbaar te verdedigen in de Agnietenkapel

op dinsdag 24 januari 2017, te 10:00 uur

door


geboren te Amsterdam

Promotiecommissie:

Promotor: Prof. Dr. F. Baas Universiteit van Amsterdam

Copromotores: Dr. P.K. Das Universiteit van Amsterdam

Dr. V. Ramaglia Universiteit van Amsterdam

Overige leden: Prof. dr. M. de Visser Universiteit van Amsterdam

Prof. dr. C.J.F. van Noorden Universiteit van Amsterdam

Prof. dr. T. van der Poll Universiteit van Amsterdam

Prof. dr. T.H.M. Ottenhoff Universiteit Leiden

Dr. B. Naafs Leids Universitair Medisch

Centrum

Faculteit der Geneeskunde

Contents

Chapter 1 General introduction 7

Chapter 2 M. leprae components induce nerve damage by complement

activation: Identification of lipoarabinomannan as the dominant

complement activator 43

Chapter 3 Complement Activation In Leprosy: A Retrospective Study

Shows Elevated Circulating Terminal Complement Complex

In Reactional Leprosy 89

Chapter 4 In Situ complement activation and T-cell immunity in leprosy

spectrum: An Immunohistological Study on Leprosy skin 117

Chapter 5 Complement upregulation and activation on motor neurons

and neuromuscular junctions in the SOD1G93A mouse model

of familial amyotrophic lateral sclerosis 153

Chapter 6 Complement activation at the motor end-plates in

amyotrophic lateral sclerosis 173

Chapter 7 Complement component C6 inhibition decreases neurological

disability in female transgenic SOD1G93A mouse model of

amyotrophic lateral sclerosis 211

Chapter 8 Discussion & Summary 239

Nederlandse Samenvatting 259

List of publications 266

About the Author 267

Dankwoord 268

Portfolio 273

General introduction

The role of the complement system in neuroinflammation

N. Bahia el Idrissi

General introduction

The role of the complement system in neuroinflammation

N. Bahia el Idrissi

1

Chapter 1

8

1. The nervous system

The nervous system can be divided in the central nervous system (CNS) and the

peripheral nerve system (PNS). The CNS consists of the brain and the spinal cord,

while the PNS consists of all the nerves and ganglia outside the brain and spinal

cord. The PNS connects the CNS to the organs and limbs and is a channel through

which neural signals are transmitted from and to the CNS.

The basic unit of the peripheral nerve is the axon. Axons are surrounded by

myelinating Schwann cells forming the myelin sheath. Myelin provides protection for

the axon, but it also has another function which is increasing the conduction velocity

of the electrical stimulus. Nodes of Ranvier are gaps between intervals in the myelin

sheath. These structures are exposed to the extracellular space and highly enriched

in ion channels allowing the saltatory conduction of the action potential from one

node to the next. The individual nerve fiber that consists of axons and Schwann cells

is held together by connective tissue also known as the endoneurium. Individual

nerve fibers vary in diameter and may be myelinated or unmyelinated [1].

Unmyelinated nerve fibers in the skin usually have a sensory function in the body.

The axons, Schwann cells, and endoneurium are bundled together into fascicles by

the perineurium (Figure 1). The outermost layer of connective tissue, that bundles the

peripheral nerve fascicles and blood vessels, is called the epineurium.

Figure 1. Schematic representation of the peripheral nerve consisting of perineurium containing

myelinated and unmyelinated axons supported by loose endoneurial connective tissue (Graeber et

al., 1998).

1

Introduction

9

1. The nervous system

The nervous system can be divided in the central nervous system (CNS) and the

peripheral nerve system (PNS). The CNS consists of the brain and the spinal cord,

while the PNS consists of all the nerves and ganglia outside the brain and spinal

cord. The PNS connects the CNS to the organs and limbs and is a channel through

which neural signals are transmitted from and to the CNS.

The basic unit of the peripheral nerve is the axon. Axons are surrounded by

myelinating Schwann cells forming the myelin sheath. Myelin provides protection for

the axon, but it also has another function which is increasing the conduction velocity

of the electrical stimulus. Nodes of Ranvier are gaps between intervals in the myelin

sheath. These structures are exposed to the extracellular space and highly enriched

in ion channels allowing the saltatory conduction of the action potential from one

node to the next. The individual nerve fiber that consists of axons and Schwann cells

is held together by connective tissue also known as the endoneurium. Individual

nerve fibers vary in diameter and may be myelinated or unmyelinated [1].

Unmyelinated nerve fibers in the skin usually have a sensory function in the body.

The axons, Schwann cells, and endoneurium are bundled together into fascicles by

the perineurium (Figure 1). The outermost layer of connective tissue, that bundles the

peripheral nerve fascicles and blood vessels, is called the epineurium.

Figure 1. Schematic representation of the peripheral nerve consisting of perineurium containing

myelinated and unmyelinated axons supported by loose endoneurial connective tissue (Graeber et

al., 1998).

Chapter 1

10

2. The neuromuscular junction

The CNS communicates with the rest of the body by sending messages from the

upper motor neurons to the lower motor neurons via the axons that run through the

spinal cord and reach the muscles. The neuromuscular junction is the site of

communication between the motor nerve axons and muscle fibers. The function of

the neuromuscular junction is to transmit electrical impulses from the motor neuron to

the motor nerve terminal and hence to the muscle. Synapses are the junctions

where neurons pass signals to different cells: neurons, muscle or gland cells. Almost

all the nerve to nerve, muscle and gland signaling relies on chemical synapses at

which the presynaptic neuron releases chemicals, called neurotransmitters, that act

on the postsynaptic target cell. At the end of each motor neuron there are synaptic

vesicles containing the neurotransmitter acetylcholine (ACh). Once the impulse

reaches the neuromuscular junction, voltage-sensitive Ca2+ channels are opened

which allow for the influx of Ca2+ into the nerve terminal. Ca2+ entry into the nerve

terminal initiates the fusion of acetylcholine containing vesicles with the presynaptic

membrane. During this communication acetylcholine is released into the synaptic

cleft, to bind the post-synaptic acetylcholine receptors on the muscle cell a process

called exocytosis. When acetylcholine binds to receptors on the muscle cell it triggers

muscle contraction. The time period from the release of acetylcholine to receptor

channel binding is less than a millionth of a second.

Figure 2. Schematic representation of a myelinated nerve fiber that ends at the neuromuscular

junction.

Modified figure, original from: http://www.neuroanatomy.wisc.edu/ SClinic/Weakness/Weakness.htm

Neuromuscular junction

1

Introduction

11

2. The neuromuscular junction

The CNS communicates with the rest of the body by sending messages from the

upper motor neurons to the lower motor neurons via the axons that run through the

spinal cord and reach the muscles. The neuromuscular junction is the site of

communication between the motor nerve axons and muscle fibers. The function of

the neuromuscular junction is to transmit electrical impulses from the motor neuron to

the motor nerve terminal and hence to the muscle. Synapses are the junctions

where neurons pass signals to different cells: neurons, muscle or gland cells. Almost

all the nerve to nerve, muscle and gland signaling relies on chemical synapses at

which the presynaptic neuron releases chemicals, called neurotransmitters, that act

on the postsynaptic target cell. At the end of each motor neuron there are synaptic

vesicles containing the neurotransmitter acetylcholine (ACh). Once the impulse

reaches the neuromuscular junction, voltage-sensitive Ca2+ channels are opened

which allow for the influx of Ca2+ into the nerve terminal. Ca2+ entry into the nerve

terminal initiates the fusion of acetylcholine containing vesicles with the presynaptic

membrane. During this communication acetylcholine is released into the synaptic

cleft, to bind the post-synaptic acetylcholine receptors on the muscle cell a process

called exocytosis. When acetylcholine binds to receptors on the muscle cell it triggers

muscle contraction. The time period from the release of acetylcholine to receptor

channel binding is less than a millionth of a second.

Figure 2. Schematic representation of a myelinated nerve fiber that ends at the neuromuscular

junction.

Modified figure, original from: http://www.neuroanatomy.wisc.edu/ SClinic/Weakness/Weakness.htm

Neuromuscular junction

Chapter 1

12

3. Degeneration of the peripheral nerve

Degeneration of the axon distal to the site of trauma is a process called Wallerian

degeneration. [2]. This process happens both in the CNS and the PNS, but the repair

process is different. After injury of the nerve, Wallerian degeneration occurs within 12

hours, leading to physical fragmentation of both axons and myelin. Myelin breaks

down into ellipsoids in the distal stump onwards to the first intact node of Ranvier.

Schwann cells play a key role in this process, together with phagocytic macrophages/

mast cells. In the PNS Schwann cells dedifferentiate, multiply within their basal

lamina tubes and downregulate myelin protein synthesis [3]. The myelin ellipsoids

are degraded into neutral fat which is removed by macrophages. Starting at 24 hours

after injury, endoneurial macrophages proliferate, become activated and participate

in myelin removal. The Schwann cell also helps to remove the degenerated axonal

and myelin debris and the presentation to macrophages. However, resident

macrophages cannot efficiently complete myelin clearance. Monocyte/macrophages,

recruited to the injured site through the blood stream, are responsible for the rapid

and efficient clearance of myelin debris [4]. The macrophages migrate to the site of

damage, passing through the walls of capillaries, which have become permeable in

the damaged area. As the degradation of the distal nerve segment continues,

connection with the target muscle can get lost, leading to muscle atrophy and

fibrosis. Schwann cells and macrophages phagocytose and clear the site of injury

together. In general this process requires 1 week up to several months.

4. Regeneration of the peripheral nerve

Peripheral nerves have the ability to regenerate [5;6]. This process usually starts

early in the injury process (hours after injury), but can take several days and at least

4 weeks before all the axons grow back and restore their connection. As described

before, effective regeneration is associated with the activation of Schwann cells and

macrophages, along with the inflammatory reaction in the injured nerve [7-9]. After

the inflammation, degeneration and clearance of the debris, only collapsed Schwann

cells persist at the injury site. Axon sprouts grow towards the injury site and need to

re-enter the Schwann cell tubes or basal lamina tubes at the injury site. During this

process axonal branches emerging from the tip of the proximal undamaged nerve

stump use Schwann cells as guides to re-enter the tubes which hold together the

other axons. Once within the distal stump, the axons need to find their way and

generate specific synapses connected to the same muscle fibers they innervated

pre-injury. Motor and sensory axons have little ability to identify Schwann cell tubes

and could be redirected to the wrong target, this process is called misdirection. A

single neuron could send axonal processes to multiple antagonistic muscles a

process called hyperinnervation, impairing functional recovery. In the regeneration

process both repulsive and attractive molecular and physical signals play an

important role, to make sure the axons find their proper target [10-12]. Histological

characterization of regeneration is marked by regenerative clusters of axons within

adjacent Schwann cells as groups of small diameter and thinly myelinated axons.

The axons grow at a rate of approximately 2.5 mm per day, leading to the connection

of the axon to its prior target. After reinnervation, the newly connected axon matures

its function is restored slowly and the remaining branches are eliminated while the

1

Introduction

13

3. Degeneration of the peripheral nerve

Degeneration of the axon distal to the site of trauma is a process called Wallerian

degeneration. [2]. This process happens both in the CNS and the PNS, but the repair

process is different. After injury of the nerve, Wallerian degeneration occurs within 12

hours, leading to physical fragmentation of both axons and myelin. Myelin breaks

down into ellipsoids in the distal stump onwards to the first intact node of Ranvier.

Schwann cells play a key role in this process, together with phagocytic macrophages/

mast cells. In the PNS Schwann cells dedifferentiate, multiply within their basal

lamina tubes and downregulate myelin protein synthesis [3]. The myelin ellipsoids

are degraded into neutral fat which is removed by macrophages. Starting at 24 hours

after injury, endoneurial macrophages proliferate, become activated and participate

in myelin removal. The Schwann cell also helps to remove the degenerated axonal

and myelin debris and the presentation to macrophages. However, resident

macrophages cannot efficiently complete myelin clearance. Monocyte/macrophages,

recruited to the injured site through the blood stream, are responsible for the rapid

and efficient clearance of myelin debris [4]. The macrophages migrate to the site of

damage, passing through the walls of capillaries, which have become permeable in

the damaged area. As the degradation of the distal nerve segment continues,

connection with the target muscle can get lost, leading to muscle atrophy and

fibrosis. Schwann cells and macrophages phagocytose and clear the site of injury

together. In general this process requires 1 week up to several months.

4. Regeneration of the peripheral nerve

Peripheral nerves have the ability to regenerate [5;6]. This process usually starts

early in the injury process (hours after injury), but can take several days and at least

4 weeks before all the axons grow back and restore their connection. As described

before, effective regeneration is associated with the activation of Schwann cells and

macrophages, along with the inflammatory reaction in the injured nerve [7-9]. After

the inflammation, degeneration and clearance of the debris, only collapsed Schwann

cells persist at the injury site. Axon sprouts grow towards the injury site and need to

re-enter the Schwann cell tubes or basal lamina tubes at the injury site. During this

process axonal branches emerging from the tip of the proximal undamaged nerve

stump use Schwann cells as guides to re-enter the tubes which hold together the

other axons. Once within the distal stump, the axons need to find their way and

generate specific synapses connected to the same muscle fibers they innervated

pre-injury. Motor and sensory axons have little ability to identify Schwann cell tubes

and could be redirected to the wrong target, this process is called misdirection. A

single neuron could send axonal processes to multiple antagonistic muscles a

process called hyperinnervation, impairing functional recovery. In the regeneration

process both repulsive and attractive molecular and physical signals play an

important role, to make sure the axons find their proper target [10-12]. Histological

characterization of regeneration is marked by regenerative clusters of axons within

adjacent Schwann cells as groups of small diameter and thinly myelinated axons.

The axons grow at a rate of approximately 2.5 mm per day, leading to the connection

of the axon to its prior target. After reinnervation, the newly connected axon matures

its function is restored slowly and the remaining branches are eliminated while the

Chapter 1

14

remaining axon thickens. Although peripheral axons often achieve a good

morphological regeneration, the regain of function is incomplete [13;14].

Figure 3. Illustration of axonal growth, presenting the neural function rejoining with the skeletal

muscle fibers. Modified figure, original from:

http://chen2820.pbworks.com/w/page/11951452/Biomaterials%20for%20nerve%20regeneration

5. Inflammation during degeneration of the peripheral nerve

After injury, inflammation is one of the first events that occurs. This event starts

before any structural changes are observed in the distal axons. Insight into the

mechanisms of the inflammatory boost after injury are important to understand the

damage to local cells, surrounding tissue and the regeneration process of the

peripheral nerve. Inflammation in the axons is an event that involves different

inflammatory mediators and cells [15-17]. In the recent years an important role for

both the innate and adaptive immune system in neurodegeneration has been

suggested and it has become a major focus of neuroimmunologists.

Traumatic injury to the nerve triggers a cascade of events which results in activation

of the immune system and, consequently, in a robust inflammatory reaction at the

site of injury. The role of inflammation in the course of degeneration and regeneration

is not completely understood. Inflammation in the PNS has been associated with

tissue damage, but is also proposed to be beneficial for Wallerian degeneration and

regeneration.

Wallerian degeneration has been originally described as a process which occurs

after a traumatic injury, but it is also observed in neurodegenerative diseases. In

disease, axons express pathological signs and changes in immune cell behaviour

similar to Wallerian degeneration triggered by traumatic injury [15;16;18]. These

changes influence patterning of axonal degeneration and regeneration.

Uninjured peripheral nerves consist of resident macrophages, fibroblasts and

Schwann cells. Schwann cells outnumber macrophages, and they are the front line

population of cells to react after axonal injury. Under normal physiological conditions,

macrophages and Schwann cells ‘’sense’’ the tissue environment for pathogens,

phagocytoses, dead and dying cells and maintain tissue homeostasis. After axonal

1

Introduction

15

remaining axon thickens. Although peripheral axons often achieve a good

morphological regeneration, the regain of function is incomplete [13;14].

Figure 3. Illustration of axonal growth, presenting the neural function rejoining with the skeletal

muscle fibers. Modified figure, original from:

http://chen2820.pbworks.com/w/page/11951452/Biomaterials%20for%20nerve%20regeneration

5. Inflammation during degeneration of the peripheral nerve

After injury, inflammation is one of the first events that occurs. This event starts

before any structural changes are observed in the distal axons. Insight into the

mechanisms of the inflammatory boost after injury are important to understand the

damage to local cells, surrounding tissue and the regeneration process of the

peripheral nerve. Inflammation in the axons is an event that involves different

inflammatory mediators and cells [15-17]. In the recent years an important role for

both the innate and adaptive immune system in neurodegeneration has been

suggested and it has become a major focus of neuroimmunologists.

Traumatic injury to the nerve triggers a cascade of events which results in activation

of the immune system and, consequently, in a robust inflammatory reaction at the

site of injury. The role of inflammation in the course of degeneration and regeneration

is not completely understood. Inflammation in the PNS has been associated with

tissue damage, but is also proposed to be beneficial for Wallerian degeneration and

regeneration.

Wallerian degeneration has been originally described as a process which occurs

after a traumatic injury, but it is also observed in neurodegenerative diseases. In

disease, axons express pathological signs and changes in immune cell behaviour

similar to Wallerian degeneration triggered by traumatic injury [15;16;18]. These

changes influence patterning of axonal degeneration and regeneration.

Uninjured peripheral nerves consist of resident macrophages, fibroblasts and

Schwann cells. Schwann cells outnumber macrophages, and they are the front line

population of cells to react after axonal injury. Under normal physiological conditions,

macrophages and Schwann cells ‘’sense’’ the tissue environment for pathogens,

phagocytoses, dead and dying cells and maintain tissue homeostasis. After axonal

Chapter 1

16

injury, damage- associated molecular patterns are accumulated at the site of injury,

resulting in changes in the nerve homeostatis [19;20]. Resident macrophages begin

to divide [21;22] and Schwann cells are phagocytic at the injury site. As next step,

activated macrophages enter the nerve, accumulate at the site of injury and start

proliferating 2 to 3 days after injury as a result of inflammation [15;18;23]. Schwann

cells can ‘’sense’’ these changes in the nerve and keep the inflammation in motion

[24], by upregulating inflammatory-related genes via TLR-2 and TLR-3 signaling [25]

and acting as antigen presenting cells [26;27]. Knock out mice for TLR-2 and TLR-4

showed an impaired Wallerian degeneration and regeneration process after sciatic

crush injury [28], while intraneural injections of wild type mice with TLRs ligands after

crush resulted in macrophage influx, myelin clearance and enhanced motor recovery,

suggesting a role for TLRs in the regeneration process.

After the distal stump undergoes structural changes leading to its total disintegration

[29;30], injured axons trigger pathways for self-distruction [31;32] and cytokines,

chemokines and inflammatory cells trigger inflammation that helps the fragmentation

process. The endogenous autoantibodies directed against degenerating PNS myelin

is critical to induce phagocytosis process in macrophages, resulting in robust and

rapid clearance of inhibitory myelin debris and thereby facilitating axon regeneration

in the PNS [33].

After macrophages enter the nerve they start clearing cellular debris in the distal

nerve stump [34;35]. The macrophages can polarize into M1 or M2 macrophages

[36]. M1 macrophages inhibit cell proliferation and causes tissue damage while M2

macrophages promote cell proliferation and tissue repair. Schwann cells start over-

expressing inflammatory cytokines and chemokines including IL-1β, TNF-α, IL-1α,

MCP-1, MIP-1, IL-10, TGF-β, and galectin [2;15;16;37-39], and thereby turn on the

inflammatory response. IL-1β plays an important role early after nerve injury in

inducing myelin collapse, through a cascade which includes phospholipase A2

(PLA2) and lysophosphatidylcholine (LPC) activation in Schwann cells [40;41]. PLA2

triggers myelin breakdown after hydrolyzing the lipid phosphatidylcholine. This lipid is

located in high levels in the myelin sheath. Hydrolysis of this lipid results in the

generation of large amounts of LPC, a molecule with a natural myelinolytic action

[42]. PLA2 expression in Schwann cells and macrophages can increased by the

inflammatory molecules TNF-α, IL-1α, and MCP-1. This process is important to reach

all compact myelin that surrounds severed axons will be fully fragmented into ovoids.

The injury is also affecting the nerve at distance from the lesion (10mm- 15 mm). It is

suggested that Schwann cells can ‘’sense’’ the damage although there is no

morphological alterations at distance from the injury site. A possible mechanism

involved in this process is that Schwann cells can sense the lack of survival factors

such as NMNAT2, transport from the neuronal cell body to the distal axon because of

the damage [43].

Overall, proinflammatory signals that are released during the first week after injury,

trigger tissue damage, Schwann cell proliferation, activate resident nonneuronal cells

to produce a high amount of inflammatory mediators, and recruit circulating

leukocytes to the degenerated nerves [15;18]. These events keep the nerve

inflammation ongoing for long after the nerve injury.

1

Introduction

17

injury, damage- associated molecular patterns are accumulated at the site of injury,

resulting in changes in the nerve homeostatis [19;20]. Resident macrophages begin

to divide [21;22] and Schwann cells are phagocytic at the injury site. As next step,

activated macrophages enter the nerve, accumulate at the site of injury and start

proliferating 2 to 3 days after injury as a result of inflammation [15;18;23]. Schwann

cells can ‘’sense’’ these changes in the nerve and keep the inflammation in motion

[24], by upregulating inflammatory-related genes via TLR-2 and TLR-3 signaling [25]

and acting as antigen presenting cells [26;27]. Knock out mice for TLR-2 and TLR-4

showed an impaired Wallerian degeneration and regeneration process after sciatic

crush injury [28], while intraneural injections of wild type mice with TLRs ligands after

crush resulted in macrophage influx, myelin clearance and enhanced motor recovery,

suggesting a role for TLRs in the regeneration process.

After the distal stump undergoes structural changes leading to its total disintegration

[29;30], injured axons trigger pathways for self-distruction [31;32] and cytokines,

chemokines and inflammatory cells trigger inflammation that helps the fragmentation

process. The endogenous autoantibodies directed against degenerating PNS myelin

is critical to induce phagocytosis process in macrophages, resulting in robust and

rapid clearance of inhibitory myelin debris and thereby facilitating axon regeneration

in the PNS [33].

After macrophages enter the nerve they start clearing cellular debris in the distal

nerve stump [34;35]. The macrophages can polarize into M1 or M2 macrophages

[36]. M1 macrophages inhibit cell proliferation and causes tissue damage while M2

macrophages promote cell proliferation and tissue repair. Schwann cells start over-

expressing inflammatory cytokines and chemokines including IL-1β, TNF-α, IL-1α,

MCP-1, MIP-1, IL-10, TGF-β, and galectin [2;15;16;37-39], and thereby turn on the

inflammatory response. IL-1β plays an important role early after nerve injury in

inducing myelin collapse, through a cascade which includes phospholipase A2

(PLA2) and lysophosphatidylcholine (LPC) activation in Schwann cells [40;41]. PLA2

triggers myelin breakdown after hydrolyzing the lipid phosphatidylcholine. This lipid is

located in high levels in the myelin sheath. Hydrolysis of this lipid results in the

generation of large amounts of LPC, a molecule with a natural myelinolytic action

[42]. PLA2 expression in Schwann cells and macrophages can increased by the

inflammatory molecules TNF-α, IL-1α, and MCP-1. This process is important to reach

all compact myelin that surrounds severed axons will be fully fragmented into ovoids.

The injury is also affecting the nerve at distance from the lesion (10mm- 15 mm). It is

suggested that Schwann cells can ‘’sense’’ the damage although there is no

morphological alterations at distance from the injury site. A possible mechanism

involved in this process is that Schwann cells can sense the lack of survival factors

such as NMNAT2, transport from the neuronal cell body to the distal axon because of

the damage [43].

Overall, proinflammatory signals that are released during the first week after injury,

trigger tissue damage, Schwann cell proliferation, activate resident nonneuronal cells

to produce a high amount of inflammatory mediators, and recruit circulating

leukocytes to the degenerated nerves [15;18]. These events keep the nerve

inflammation ongoing for long after the nerve injury.

Chapter 1

18

6. The role of the complement system during neurodegeneration

6.1 Complement activation

The complement system is a key component of the innate immunity. It counts more

than 30 soluble and membrane bound proteins. Complement has many physiological

roles such as eliminating pathogens, clearing apoptotic cells, protecting healthy self-

cells, disposing immune complexes [44] and it is also involved in synapse remodeling

during development [45]. Another important role for the complement system is

bridging the innate and adaptive immunity. Activation of the complement system

occurs via three pathways (Figure 4): the classical pathway, triggered by antigen-

antibody complexes; the alternative pathway, triggered by foreign surfaces; and the

lectin pathway, triggered by bacterial sugars. The classical pathway is activated by

the recognition of an antigen-antibody complex by C1q, this process activates C1s

and C1r. C1r cleaves C1s which in turn cleaves C2 and C4 into the two fragments;

C2b, C4a and C2a, C4b.The cleavage of the two serum proteins C4 and C2 to

generate C4b2a, the C3 convertase of the classical pathway. The Lectin pathway is

initiated by binding of carbohydrate antigens by mannose-binding lectin (MBL). MBL-

associated serine proteases (MASPs) then cleave C4 and C2 to generate the C3

convertase (C4b2a). In contrast, the alternative pathway is activated through

spontaneous hydrolysis of plasma C3. This event generates a second C3

convertase, C3(H2O)Bb. Eventually all the three pathways lead to the generation of

the C3a and C3b fragments by the C3 convertase that cleaves C3. C3b has the

ability to bind to nearby membranes with exposed amino or hydroxyl groups and

thereby amplify the deposition of C3b on the surface of a cell. Factor B gets cleaved

by factor D after it binds C3b, which generates the membrane bound C3 convertase

[46]. Binding of an additional C3b to the C3 convertase creates a C5 convertase, an

essential step for activation of the common terminal pathway. After the cleavage of

C5, C5a and C5b is formed. The C5b fragment binds C6, C7, C8 and C9 to generate

the cell-bound membrane attack complex (MAC) or the soluble Terminal

Complement Complex (TCC). The MAC participates in clearing diseased or infected

cells by punching holes into their membranes. There are also other activation routes

that result in the pore forming molecule MAC; the ‘’C2 bypass’’ pathway and the

‘’Extrinsic pathway’’. The C2 bypass pathway, is activated by the direct cleavage of

C3 by MASP-2 of the lectin pathway, bypassing the formation of the C3 convertase

[47]. The extrinsic pathway involves non-complement proteins such as thrombin,

which can directly cleave C3 and C5.

1

Introduction

19

6. The role of the complement system during neurodegeneration

6.1 Complement activation

The complement system is a key component of the innate immunity. It counts more

than 30 soluble and membrane bound proteins. Complement has many physiological

roles such as eliminating pathogens, clearing apoptotic cells, protecting healthy self-

cells, disposing immune complexes [44] and it is also involved in synapse remodeling

during development [45]. Another important role for the complement system is

bridging the innate and adaptive immunity. Activation of the complement system

occurs via three pathways (Figure 4): the classical pathway, triggered by antigen-

antibody complexes; the alternative pathway, triggered by foreign surfaces; and the

lectin pathway, triggered by bacterial sugars. The classical pathway is activated by

the recognition of an antigen-antibody complex by C1q, this process activates C1s

and C1r. C1r cleaves C1s which in turn cleaves C2 and C4 into the two fragments;

C2b, C4a and C2a, C4b.The cleavage of the two serum proteins C4 and C2 to

generate C4b2a, the C3 convertase of the classical pathway. The Lectin pathway is

initiated by binding of carbohydrate antigens by mannose-binding lectin (MBL). MBL-

associated serine proteases (MASPs) then cleave C4 and C2 to generate the C3

convertase (C4b2a). In contrast, the alternative pathway is activated through

spontaneous hydrolysis of plasma C3. This event generates a second C3

convertase, C3(H2O)Bb. Eventually all the three pathways lead to the generation of

the C3a and C3b fragments by the C3 convertase that cleaves C3. C3b has the

ability to bind to nearby membranes with exposed amino or hydroxyl groups and

thereby amplify the deposition of C3b on the surface of a cell. Factor B gets cleaved

by factor D after it binds C3b, which generates the membrane bound C3 convertase

[46]. Binding of an additional C3b to the C3 convertase creates a C5 convertase, an

essential step for activation of the common terminal pathway. After the cleavage of

C5, C5a and C5b is formed. The C5b fragment binds C6, C7, C8 and C9 to generate

the cell-bound membrane attack complex (MAC) or the soluble Terminal

Complement Complex (TCC). The MAC participates in clearing diseased or infected

cells by punching holes into their membranes. There are also other activation routes

that result in the pore forming molecule MAC; the ‘’C2 bypass’’ pathway and the

‘’Extrinsic pathway’’. The C2 bypass pathway, is activated by the direct cleavage of

C3 by MASP-2 of the lectin pathway, bypassing the formation of the C3 convertase

[47]. The extrinsic pathway involves non-complement proteins such as thrombin,

which can directly cleave C3 and C5.

Chapter 1

20

Figure 4. Schematic overview of the complement pathways and proteins involved.

6.2 Complement regulation

Activation products of the complement system such as C3a, C5a and MAC could

have numerous potentially harmful effects on the human immune system and can

lead to tissue damage. The propensity of the MAC to “drift” from the site of activation

and deposit on self-cells puts these cells at risk [48-53]. The complement system is

controlled by many regulators to protect self-tissue e.g.; the alternative pathway

regulator Factor H binds and inactivates the C3bBb convertase and Clusterin blocks

the terminal pathway by binding the C5b, 6, 7 complex and preventing its binding to

surfaces (Figure 4).

C1 inhibitor is an inhibitor of the classical pathway that induces dissociation of the C1

components. It inactivates C1r and C1s proteases in the C1 complex of the classical

pathway and MASP-1 and MASP-2 proteases in MBL complexes of the lectin

pathway. Hereby, the C1 inhibitor prevents cleavage of the components C4 and C2

by C1 and MBL. C4b-binding protein (C4BP) blocks the classical and the lectin

pathways on the level of C4. C4BP accelerates decay of C3- convertase. It is also a

cofactor for serine protease factor I that cleaves C4b and C3b and has the ability to

bind C3b.

Membrane bound regulators include complement receptor 1 (CD35), Membrane

cofactor protein, Decay accelerating factor (also known as CD55) and protectin (also

known as CD59). Complement receptor 1 and Decay accelerating factor displace a

component of the C3 convertase in the classical pathway, while CD59 prevents final

assembly of the membrane attack complex. In addition, Vitronectin and complement

factor H related protein 1 are soluble inhibitors of the terminal pathway of

complement. Another component with regulatory function in all the complement

1

Introduction

21

Figure 4. Schematic overview of the complement pathways and proteins involved.

6.2 Complement regulation

Activation products of the complement system such as C3a, C5a and MAC could

have numerous potentially harmful effects on the human immune system and can

lead to tissue damage. The propensity of the MAC to “drift” from the site of activation

and deposit on self-cells puts these cells at risk [48-53]. The complement system is

controlled by many regulators to protect self-tissue e.g.; the alternative pathway

regulator Factor H binds and inactivates the C3bBb convertase and Clusterin blocks

the terminal pathway by binding the C5b, 6, 7 complex and preventing its binding to

surfaces (Figure 4).

C1 inhibitor is an inhibitor of the classical pathway that induces dissociation of the C1

components. It inactivates C1r and C1s proteases in the C1 complex of the classical

pathway and MASP-1 and MASP-2 proteases in MBL complexes of the lectin

pathway. Hereby, the C1 inhibitor prevents cleavage of the components C4 and C2

by C1 and MBL. C4b-binding protein (C4BP) blocks the classical and the lectin

pathways on the level of C4. C4BP accelerates decay of C3- convertase. It is also a

cofactor for serine protease factor I that cleaves C4b and C3b and has the ability to

bind C3b.

Membrane bound regulators include complement receptor 1 (CD35), Membrane

cofactor protein, Decay accelerating factor (also known as CD55) and protectin (also

known as CD59). Complement receptor 1 and Decay accelerating factor displace a

component of the C3 convertase in the classical pathway, while CD59 prevents final

assembly of the membrane attack complex. In addition, Vitronectin and complement

factor H related protein 1 are soluble inhibitors of the terminal pathway of

complement. Another component with regulatory function in all the complement

Chapter 1

22

pathways is Carboxypeptidase N. Carboxypeptidase N regulates the complement

system by controlling the inflammatory response by inactivation of anaphylatoxins

such as C3a and C5a.

Although there are complement regulators to protect the normal tissue against

complement-mediated damage, excessive activation of the complement system,

which breaks through the protective effect of the regulators, can occur. This will

result in tissue damage and drives inflammation.

6.3 Complement and nerve degeneration

The complement system has long been recognized to play a crucial role in peripheral

nerve degeneration. Traumatic injury focally damages the nerve exposing axonal and

myelin epitopes. Myelin proteins can activate the classical and alternative pathways

of complement in an antibody-independent manner [54;55]. The complement

cascade is activated within 1 hour at the side of injury [56]. Activation of the

complement system generates opsonins C3b, C5b and the terminal complement

component MAC. The opsonins target membranes of cells for disposal by

phagocytes and for the anchoring of the MAC. The small cleaved products, C3a and

C5a, have the ability to recruit and activate macrophages. The macrophges start

phagocytosis of myelin, this process is mediated by complement via Complement

Receptor 3 [57;58].

C3 depletion in rats reduced macrophage recruitment into the distal stump of the

degenerating nerve and they failed to acquire the enlarged and vacuolated

morphology, typical of the activated phenotype [59]. Similarly, C5 deficient mice

showed delayed macrophage recruitment as well as axonal and myelin degradation

from one to twenty one days post-injury [60].

We previously showed that MAC damages axons in the acute peripheral nerve crush

model [61]. Deficiency of the natural regulator of the MAC, CD59a, in mice was

shown to exacerbate Wallerian degeneration[62], while inhibition of complement with

soluble complement receptor 1 protected the peripheral nerve from early axon loss

after injury [63]. This suggests that complement therapy accelerates nerve

regeneration and functional recovery after mechanical nerve injury [64]. Formation of

the MAC, was shown to cause nerve damage also after traumatic injury of the brain

1

Introduction

23

pathways is Carboxypeptidase N. Carboxypeptidase N regulates the complement

system by controlling the inflammatory response by inactivation of anaphylatoxins

such as C3a and C5a.

Although there are complement regulators to protect the normal tissue against

complement-mediated damage, excessive activation of the complement system,

which breaks through the protective effect of the regulators, can occur. This will

result in tissue damage and drives inflammation.

6.3 Complement and nerve degeneration

The complement system has long been recognized to play a crucial role in peripheral

nerve degeneration. Traumatic injury focally damages the nerve exposing axonal and

myelin epitopes. Myelin proteins can activate the classical and alternative pathways

of complement in an antibody-independent manner [54;55]. The complement

cascade is activated within 1 hour at the side of injury [56]. Activation of the

complement system generates opsonins C3b, C5b and the terminal complement

component MAC. The opsonins target membranes of cells for disposal by

phagocytes and for the anchoring of the MAC. The small cleaved products, C3a and

C5a, have the ability to recruit and activate macrophages. The macrophges start

phagocytosis of myelin, this process is mediated by complement via Complement

Receptor 3 [57;58].

C3 depletion in rats reduced macrophage recruitment into the distal stump of the

degenerating nerve and they failed to acquire the enlarged and vacuolated

morphology, typical of the activated phenotype [59]. Similarly, C5 deficient mice

showed delayed macrophage recruitment as well as axonal and myelin degradation

from one to twenty one days post-injury [60].

We previously showed that MAC damages axons in the acute peripheral nerve crush

model [61]. Deficiency of the natural regulator of the MAC, CD59a, in mice was

shown to exacerbate Wallerian degeneration[62], while inhibition of complement with

soluble complement receptor 1 protected the peripheral nerve from early axon loss

after injury [63]. This suggests that complement therapy accelerates nerve

regeneration and functional recovery after mechanical nerve injury [64]. Formation of

the MAC, was shown to cause nerve damage also after traumatic injury of the brain

Chapter 1

24

in human [65;66] and mouse models [67-69]. Involvement of the complement system

in degeneration of axons has been attributed to its role in controlling

neuroinflammation. MAC has recently been shown to activate inflammasome NLRP3

from the surface of complement-opsonized particles to plasma membranes of

macrophages and thereby also activating caspase 1 and release of IL1-b and IL-18.

This process is suggested to play an important role in the activation of the adaptive

immune response including recruiting leukocytes to the site of phagocytosis[70].

Trauma or disease-induced neuroinflammation will have impact on the outcome of

neurological disease. In the peripheral nervous system, neuroinflammation will lead

to prolonged and possibly continuous degeneration associated with functional

impairment such as muscle atrophy, loss of sensibility or pain. In the central nervous

system, the effects can have great impact on disease progression and recovery. The

effects of Wallerian degeneration of a nerve tract and its associated

neuroinflammation can easily spread from one functional system to another. As

described earlier Wallerian degeneration is not only triggered by a traumatic insult,

but also occurs in several neurodegenerative diseases (amyotrophic lateral sclerosis,

Alzheimer’s disease, and Parkinson’s disease). In these diseases, the affected axons

share pathological signs with what is normally observed in axons undergoing

traumatic injury-induced Wallerian degeneration [71]. Complement activation is also

thought to be involved in the pathogenesis of chronic neurological diseases including

Alzheimer’s disease, Parkinson’s disease and multiple sclerosis (reviewed in [72]).

Activation of the complement system is a major aspect of many chronic inflammatory

diseases [73;74].

Initially, complement activation was thought to be involved in only a few CNS

disorders. Nowadays complement has been associated with many more disorders. In

EAE, a mouse model of neuroinflammation and demyelination, as seen in multiple

sclerosis, MAC damages nerves whereas inhibition of MAC reduces neurological

symptoms [75]. Recently the complement system and microglia were shown to be

involved in synapse remodeling during development are inappropriately activated

and mediate synapse loss in Alzheimer’s disease. Inhibition of C1q, C3, or the

microglial complement receptor CR3 showed a reduction in the number of

phagocytic microglia, as well as the extent of early synapse loss [76]. This suggests

that the function of complement extends beyond the lysis of bacteria and clearing

damaged cells. Activation aggravates neuroaxonal loss after nerve trauma and in

neurodegenerative diseases. This change in view is accompanied by an increased

interest for complement therapeutics for treatment of neurological diseases.

In this thesis I present studies on the role of the complement system in two disorders,

leprosy and ALS. I have analyzed the involvement of the complement system in

tissue pathology and studied the effect of complement inhibition in these two

diseases.

1

Introduction

25

in human [65;66] and mouse models [67-69]. Involvement of the complement system

in degeneration of axons has been attributed to its role in controlling

neuroinflammation. MAC has recently been shown to activate inflammasome NLRP3

from the surface of complement-opsonized particles to plasma membranes of

macrophages and thereby also activating caspase 1 and release of IL1-b and IL-18.

This process is suggested to play an important role in the activation of the adaptive

immune response including recruiting leukocytes to the site of phagocytosis[70].

Trauma or disease-induced neuroinflammation will have impact on the outcome of

neurological disease. In the peripheral nervous system, neuroinflammation will lead

to prolonged and possibly continuous degeneration associated with functional

impairment such as muscle atrophy, loss of sensibility or pain. In the central nervous

system, the effects can have great impact on disease progression and recovery. The

effects of Wallerian degeneration of a nerve tract and its associated

neuroinflammation can easily spread from one functional system to another. As

described earlier Wallerian degeneration is not only triggered by a traumatic insult,

but also occurs in several neurodegenerative diseases (amyotrophic lateral sclerosis,

Alzheimer’s disease, and Parkinson’s disease). In these diseases, the affected axons

share pathological signs with what is normally observed in axons undergoing

traumatic injury-induced Wallerian degeneration [71]. Complement activation is also

thought to be involved in the pathogenesis of chronic neurological diseases including

Alzheimer’s disease, Parkinson’s disease and multiple sclerosis (reviewed in [72]).

Activation of the complement system is a major aspect of many chronic inflammatory

diseases [73;74].

Initially, complement activation was thought to be involved in only a few CNS

disorders. Nowadays complement has been associated with many more disorders. In

EAE, a mouse model of neuroinflammation and demyelination, as seen in multiple

sclerosis, MAC damages nerves whereas inhibition of MAC reduces neurological

symptoms [75]. Recently the complement system and microglia were shown to be

involved in synapse remodeling during development are inappropriately activated

and mediate synapse loss in Alzheimer’s disease. Inhibition of C1q, C3, or the

microglial complement receptor CR3 showed a reduction in the number of

phagocytic microglia, as well as the extent of early synapse loss [76]. This suggests

that the function of complement extends beyond the lysis of bacteria and clearing

damaged cells. Activation aggravates neuroaxonal loss after nerve trauma and in

neurodegenerative diseases. This change in view is accompanied by an increased

interest for complement therapeutics for treatment of neurological diseases.

In this thesis I present studies on the role of the complement system in two disorders,

leprosy and ALS. I have analyzed the involvement of the complement system in

tissue pathology and studied the effect of complement inhibition in these two

diseases.

Chapter 1

26

7. Infectious neuropathy leprosy and the immune system

Leprosy is a chronic mycobacterial disease caused by Mycobacterium leprae,

affecting about 214,000 new individuals globally every year (WHO, 2014). M.leprae,

is an obligate intracellular parasite with tropism for macrophages and Schwann cells.

Leprosy is characterized by nerve damage, which can lead to patient deformities

[77;78]. The host immunological response to M.leprae and its antigens determines

the clinical/immunological spectrum of leprosy. The spectrum of leprosy ranges from

Lepromatous leprosy (LL) at one pole, with a high bacterial load in the tissues, an

absence of cellular immune response (CMI) to M.leprae and presence of M.leprae

specifc antibodies, to Tuberculoid leprosy (TT) at the other pole, characterised by

the low levels of bacilli accompanied by the presence of robust M.leprae-specific CMI

[79]. Between these polar forms is the spectrum of borderline leprosy, including the

border line lepromatous (BL), true border line (BB) and border line tuberculoid (BT)

forms, with the varying presence of bacilli and M.leprae-specific CMI.

It is as yet unclear why such diverse responses are generated against a single

pathogen in different patients. The use of WHO recommended Multidrug therapy

(MDT) has resulted an a considerable decline in the prevalence of leprosy world-wide

(WHO, 2016). This has led to a major shift in focus on “elimination of leprosy” in

terms of prevalence of the disease to targets that emphasize a decrease in the

number of new cases to promote early detection and reduction of transmission

(WHO, 2016). A major complication in leprosy is the development of the so-called

leprosy “reactions”.

Particularly the borderline groups can develop two types of reactions due to changes

in their pathogen-specific immune status; type 1 or reversal reaction (RR) and type 2

or erythema nodosum leprosum (ENL). The RR is due to the increased pathogen-

specific cell-mediated immunity encountered among BT and BL patients, whereas

ENL is seen in BL and LL patients and is thought to be immune complex-mediated

[80]. Treatment of reactions is usually by the use of corticosteroids.

There are multiple proposed routes of M. leprae infection, the seriously considered

portals of entry are the skin and the upper respiratory tract. With regard to the

respiratory route evidence suggests M. leprae is able to bind to nasal epithelial cells

by binding to a soluble protein, fibronectin, that binds to fibronectin receptors on the

surface of the epithelial cell [81]. It is suggested that M. leprae enters the nasal

epithelial cells, then enters the blood stream, and migrates to places with the best

environment, the non-myelinating Schwann cells in the extremities [82]. It was shown

that M. leprae invade the nonmyelinating Schwann cells and multiply, as well as

attach to myelinating Schwann cells. M. leprae colonizes the Schwann cells of the

peripheral nervous system. The bacteria can live and grow within macrophages as a

mechanism to evade the host immune system. Once the immune system recognizes

and targets the infected cells, bacterial heterologous and host autologous antigens

are released [77;78;83]. The release of bacterial antigens to the surrounding tissue

has been suggested to cause tissue damage. The M. leprae cells release PGL

proteins that can disturb the DRP2-dystroglycan complex in the Schwann cell and

lead to a decline in myelination [82]. DRP2 is important for myelination and is

normally produced by myelinating Schwann cells. The DRP2-dystroglycan complex

are suggested to help communication between Schwann cells by transferring the

signals from the inside of the cell to the outside [84]. It is known that dead M. leprae

cells or antigens of the bacilli alone can still cause demyelination in vitro and in vivo

[82]. This suggests that even after the bacteria is killed by treatment antigens still can

1

Introduction

27

7. Infectious neuropathy leprosy and the immune system

Leprosy is a chronic mycobacterial disease caused by Mycobacterium leprae,

affecting about 214,000 new individuals globally every year (WHO, 2014). M.leprae,

is an obligate intracellular parasite with tropism for macrophages and Schwann cells.

Leprosy is characterized by nerve damage, which can lead to patient deformities

[77;78]. The host immunological response to M.leprae and its antigens determines

the clinical/immunological spectrum of leprosy. The spectrum of leprosy ranges from

Lepromatous leprosy (LL) at one pole, with a high bacterial load in the tissues, an

absence of cellular immune response (CMI) to M.leprae and presence of M.leprae

specifc antibodies, to Tuberculoid leprosy (TT) at the other pole, characterised by

the low levels of bacilli accompanied by the presence of robust M.leprae-specific CMI

[79]. Between these polar forms is the spectrum of borderline leprosy, including the

border line lepromatous (BL), true border line (BB) and border line tuberculoid (BT)

forms, with the varying presence of bacilli and M.leprae-specific CMI.

It is as yet unclear why such diverse responses are generated against a single

pathogen in different patients. The use of WHO recommended Multidrug therapy

(MDT) has resulted an a considerable decline in the prevalence of leprosy world-wide

(WHO, 2016). This has led to a major shift in focus on “elimination of leprosy” in

terms of prevalence of the disease to targets that emphasize a decrease in the

number of new cases to promote early detection and reduction of transmission

(WHO, 2016). A major complication in leprosy is the development of the so-called

leprosy “reactions”.

Particularly the borderline groups can develop two types of reactions due to changes

in their pathogen-specific immune status; type 1 or reversal reaction (RR) and type 2

or erythema nodosum leprosum (ENL). The RR is due to the increased pathogen-


ENL is seen in BL and LL patients and is thought to be immune complex-mediated

[80]. Treatment of reactions is usually by the use of corticosteroids.

There are multiple proposed routes of M. leprae infection, the seriously considered

portals of entry are the skin and the upper respiratory tract. With regard to the

respiratory route evidence suggests M. leprae is able to bind to nasal epithelial cells

by binding to a soluble protein, fibronectin, that binds to fibronectin receptors on the

surface of the epithelial cell [81]. It is suggested that M. leprae enters the nasal

epithelial cells, then enters the blood stream, and migrates to places with the best

environment, the non-myelinating Schwann cells in the extremities [82]. It was shown

that M. leprae invade the nonmyelinating Schwann cells and multiply, as well as

attach to myelinating Schwann cells. M. leprae colonizes the Schwann cells of the

peripheral nervous system. The bacteria can live and grow within macrophages as a

mechanism to evade the host immune system. Once the immune system recognizes

and targets the infected cells, bacterial heterologous and host autologous antigens

are released [77;78;83]. The release of bacterial antigens to the surrounding tissue

has been suggested to cause tissue damage. The M. leprae cells release PGL

proteins that can disturb the DRP2-dystroglycan complex in the Schwann cell and

lead to a decline in myelination [82]. DRP2 is important for myelination and is

normally produced by myelinating Schwann cells. The DRP2-dystroglycan complex

are suggested to help communication between Schwann cells by transferring the

signals from the inside of the cell to the outside [84]. It is known that dead M. leprae

cells or antigens of the bacilli alone can still cause demyelination in vitro and in vivo

[82]. This suggests that even after the bacteria is killed by treatment antigens still can

Chapter 1

28

trigger demyelination. Therefore, treatment of the patients infected with M. leprae

should be treated on time to avoid more nerve damage. This is why it is important

that the infection is treated right away; before too much damage to the nervous

system is done. Since leprosy patients experience nerve damage even after

treatment understanding the mechanisms of nerve damage by M. lepae and

determining what the modifiers are of the disease is important for a better treatment.

Both host genetic factors [85], and the immune system, including the complement

system are associated with susceptibility to leprosy [86-88]. Recent published data

shows that complement Factor H polymorphisms are associated with susceptibility

to leprosy [89;90].Previous serological studies showed reduced complement

hemolytic activity and reduced levels of C4 in LL patients suggesting consumption of

complement in the circulation via activation of the classical or lectin pathway [88;91].

Also an increased C1q binding activity was measured in LL patients with ENL

reactions suggesting involvement of the classical pathway in these patients, and

increased C3d levels in 70% of patients with ENL and 18% of patients with

uncomplicated LL. In addition, deposits of the membrane attack complex (MAC) have

been found on the damaged nerves of LL but not TT leprosy patients [92]. This

suggests a possible role for complement as a disease modifier in leprosy. We

suggest an important role for complement in nerve damage in leprosy and suggest

that complement activation is associated with the release of bacterial antigens in

tissue.

8. Amyotrophic lateral sclerosis and the immune system

Amyotrophic lateral sclerosis (ALS) is a severe adult-onset motor neuron disease

that is associated with dementia [93], sensory abnormalities [94] and autonomic

dysfunction [95]. It is characterized by progressive loss of motor neurons and

degeneration of the neuromuscular junction/ motor end-plate, leading to muscle

atrophy and eventually death from respiratory paralysis [96] . With rare exceptions,

the cause of disease and the mechanism of motor neuron injury are unknown.

Pathogenesis in ALS includes internal factors in the motor neuron such as

accumulation of different dysfunctional proteins such as TDP43 [97;98], glutamate

toxicity [99] and altered mitochondrial dysfunction [100]. Also external factors have

been associated with damage to the motor neurons, this is known as non-cell

autonomous damage [101;102]. An example of this are astrocytes, which have been

suggested to cause damage to the motor neurons [103].

Genetic and environmental factors have also been associated with ALS. Most ALS

cases (90%) are sporadic ALS while 10% are familial ALS. Several genes have been

identified for familial ALS. C9orf72, SOD1, FUS, TARDBP are the most frequently

affected genes implicated in familial ALS [104]. The most studied gene is SOD-1

(copper/zinc superoxide dismutase 1), that accounts for 10–20% of familial ALS

[105]. Transgenic mice expressing mutated SOD1 (SOD1G93A) develop a

pathological and clinical phenotype resembling human ALS [106;107]. The reason for

toxicity of SOD1 is not fully understood, but it is known that expression of SOD1 in

microglia and astrocytes contributes to disease progression in ALS [102].

Inflammation and immune abnormalities have been found in the ALS mouse models

with mutations in the SOD1 gene and in tissue, blood and CSF of ALS patients. The

1

Introduction

29

trigger demyelination. Therefore, treatment of the patients infected with M. leprae

should be treated on time to avoid more nerve damage. This is why it is important

that the infection is treated right away; before too much damage to the nervous

system is done. Since leprosy patients experience nerve damage even after

treatment understanding the mechanisms of nerve damage by M. lepae and

determining what the modifiers are of the disease is important for a better treatment.

Both host genetic factors [85], and the immune system, including the complement

system are associated with susceptibility to leprosy [86-88]. Recent published data

shows that complement Factor H polymorphisms are associated with susceptibility

to leprosy [89;90].Previous serological studies showed reduced complement


complement in the circulation via activation of the classical or lectin pathway [88;91].

Also an increased C1q binding activity was measured in LL patients with ENL

reactions suggesting involvement of the classical pathway in these patients, and

increased C3d levels in 70% of patients with ENL and 18% of patients with

uncomplicated LL. In addition, deposits of the membrane attack complex (MAC) have

been found on the damaged nerves of LL but not TT leprosy patients [92]. This

suggests a possible role for complement as a disease modifier in leprosy. We

suggest an important role for complement in nerve damage in leprosy and suggest

that complement activation is associated with the release of bacterial antigens in

tissue.

8. Amyotrophic lateral sclerosis and the immune system

Amyotrophic lateral sclerosis (ALS) is a severe adult-onset motor neuron disease

that is associated with dementia [93], sensory abnormalities [94] and autonomic

dysfunction [95]. It is characterized by progressive loss of motor neurons and

degeneration of the neuromuscular junction/ motor end-plate, leading to muscle

atrophy and eventually death from respiratory paralysis [96] . With rare exceptions,

the cause of disease and the mechanism of motor neuron injury are unknown.

Pathogenesis in ALS includes internal factors in the motor neuron such as

accumulation of different dysfunctional proteins such as TDP43 [97;98], glutamate

toxicity [99] and altered mitochondrial dysfunction [100]. Also external factors have

been associated with damage to the motor neurons, this is known as non-cell

autonomous damage [101;102]. An example of this are astrocytes, which have been

suggested to cause damage to the motor neurons [103].

Genetic and environmental factors have also been associated with ALS. Most ALS

cases (90%) are sporadic ALS while 10% are familial ALS. Several genes have been

identified for familial ALS. C9orf72, SOD1, FUS, TARDBP are the most frequently

affected genes implicated in familial ALS [104]. The most studied gene is SOD-1

(copper/zinc superoxide dismutase 1), that accounts for 10–20% of familial ALS

[105]. Transgenic mice expressing mutated SOD1 (SOD1G93A) develop a

pathological and clinical phenotype resembling human ALS [106;107]. The reason for

toxicity of SOD1 is not fully understood, but it is known that expression of SOD1 in

microglia and astrocytes contributes to disease progression in ALS [102].

Inflammation and immune abnormalities have been found in the ALS mouse models

with mutations in the SOD1 gene and in tissue, blood and CSF of ALS patients. The

Chapter 1

30

abnormalities might contribute to the pathogenesis of disease. Previous reviews on

inflammation in ALS suggest the possibility of treating ALS patients by immune

modulation. Inflammation at the site of disease could be a response to damage

through activation of the innate immune system [108], by cells ‘’sensing’’ molecules

released from damaged tissue [109]. An example of this is the release of

mitochondrial DAMPs that cause an inflammatory response after injury [110]. The

inflammatory response includes activation of the innate immune response, which

involves microglial activation [111-113], upregulation of TLR4 signalling genes in ALS

patients and a consistent activation of monocytes and macrophages [114]. In the

areas of motor neurons destruction in the CNS of human ALS, inflammation results in

infiltrating immune cells including macrophages, mast cells [115] and T cells

[111;116;117]. In addition, immunoglobulins have been detected in the spinal cord

and motor cortex of ALS patients[118]. A more recent study shows an increase in

IgG levels in ALS patients compared to controls [119].

The complement system is also suggested to play a role in the pathology of ALS.

Complement deposits have been detected in the spinal cord and motor cortex of ALS

patients [120]. An increased number of CD4+ T helper cells was measured in blood

of sporadic ALS patients compared to controls [121]. There are increased levels of

circulating chemokines and cytokines in ALS. T cells producing IL-13 have been

found in blood of ALS patients and correlate with the disease progression [122]. Also,

increased levels of the cytokine IL-17 are found in serum of ALS patients [123].

Higher levels of chemokine MCP-1 are found in ALS patients with a more severe and

rapidly progressive disease course [124].

A role for complement in the pathogenesis of ALS in humans is suggested by

elevated concentrations of complement activation products in serum and

cerebrospinal fluid [125]. We previously showed that mRNA and protein levels of

complement proteins (C1q, C4, C3 and MAC) are elevated in spinal cord and motor

cortex of patients with sporadic ALS [125]. In murine ALS models, C1q and C4 are

upregulated in motor neurons [126;127], whereas C3 is upregulated in the anterior

horn areas containing motor neuron degeneration [128].

Other studies have also shown upregulation of the major proinflammatory C5a

receptor, during disease progression in mouse motor neurons [129]. SOD1G93A rats

treated with C5aR antagonist displayed a significant extension of survival time and a

reduction in end-stage motor scores, suggesting an important role for complement in

the disease progression [128]. Increased expression of complement components

C1qB, C4, factors B, C3, C5 and a decrease in the expression of the regulators

CD55 (regulator of C3) and CD59a (regulator of MAC) was detected in the lumbar

spinal cord of SOD1G93A mice [130]. Pathological evidence from human ALS and

animal models suggests that neurodegeneration begins at the muscle endplates

proceeding in a ‘‘dying back’’ pattern towards spinal neurons [131].

1

Introduction

31

abnormalities might contribute to the pathogenesis of disease. Previous reviews on

inflammation in ALS suggest the possibility of treating ALS patients by immune

modulation. Inflammation at the site of disease could be a response to damage

through activation of the innate immune system [108], by cells ‘’sensing’’ molecules

released from damaged tissue [109]. An example of this is the release of

mitochondrial DAMPs that cause an inflammatory response after injury [110]. The

inflammatory response includes activation of the innate immune response, which

involves microglial activation [111-113], upregulation of TLR4 signalling genes in ALS

patients and a consistent activation of monocytes and macrophages [114]. In the

areas of motor neurons destruction in the CNS of human ALS, inflammation results in

infiltrating immune cells including macrophages, mast cells [115] and T cells

[111;116;117]. In addition, immunoglobulins have been detected in the spinal cord

and motor cortex of ALS patients[118]. A more recent study shows an increase in

IgG levels in ALS patients compared to controls [119].

The complement system is also suggested to play a role in the pathology of ALS.

Complement deposits have been detected in the spinal cord and motor cortex of ALS

patients [120]. An increased number of CD4+ T helper cells was measured in blood

of sporadic ALS patients compared to controls [121]. There are increased levels of

circulating chemokines and cytokines in ALS. T cells producing IL-13 have been

found in blood of ALS patients and correlate with the disease progression [122]. Also,

increased levels of the cytokine IL-17 are found in serum of ALS patients [123].

Higher levels of chemokine MCP-1 are found in ALS patients with a more severe and

rapidly progressive disease course [124].

A role for complement in the pathogenesis of ALS in humans is suggested by

elevated concentrations of complement activation products in serum and

cerebrospinal fluid [125]. We previously showed that mRNA and protein levels of

complement proteins (C1q, C4, C3 and MAC) are elevated in spinal cord and motor

cortex of patients with sporadic ALS [125]. In murine ALS models, C1q and C4 are

upregulated in motor neurons [126;127], whereas C3 is upregulated in the anterior

horn areas containing motor neuron degeneration [128].


receptor, during disease progression in mouse motor neurons [129]. SOD1G93A rats






spinal cord of SOD1G93A mice [130]. Pathological evidence from human ALS and

animal models suggests that neurodegeneration begins at the muscle endplates

proceeding in a ‘‘dying back’’ pattern towards spinal neurons [131].

Chapter 1

32

Aim outline thesis

An informative way to study the role of the complement system in neurodegeneration

is testing the effect of complement inhibition in different disease models. Insight in

the proces of Wallerian degeneration helps understanding the mechanisms of

neurodegeneration in diseases [132]. We have demonstrated that both genetic and

pharmacological inhibition of the complement system on the level of MAC formation

protect the peripheral nerve from early axon loss after injury [61-64] and stimulate

post-traumatic axonal regeneration and functional recovery [64]. To show this, we

used a drug which inhibits C6 to block MAC formation. C6 is one of the proteins

necessary to form the MAC. This protein is mainly produced in the liver. The C6

inhibiting drug is a modified oligonucleotide that uses antisense principles to target

the mRNA of C6. Inhibition of C6 is not expected to cause side effects because prior

studies have shown that the C6 protein (and presumably MAC formation) is not

essential in humans. Our in house-developed C6 inhibitor is an effective and

selective inhibitor of the terminal complement pathway and is expected to be more

safe in humans than other complement inhibitors on the market.

We showed that C6 RNA antagonist substantially lowered expression of C6 mRNA in

the liver and C6 protein in circulation and reduced MAC activity in treated mice. The

knockdown effect lasts for several weeks after treatment. Importantly, the RNA

antagonist is stable with no overt toxicity in mice.

The hypothesis of this project is that complement activation contributes to

neurodegeneration in leprosy and Amyotrophic lateral sclerosis.

The aim of this thesis is to understand the role of the complement system, especially

the terminal complement pathway, in the pheripheral nerve degenerion in Leprosy

and motor end-plate pathology in Amyotrophic lateral sclerosis.

More specifically, the aim of the leprosy project is (1) to determine whether

complement is deposited on nerves in a mouse model of M. leprae induced nerve

damage, (2) to determine whether complement inhibition in this model is

neuroprotective (3) and to determine whether and where complement is activated in

serum and deposited in skin and nerve biopsies of leprosy patients along the disease

spectrum.

The aim of the ALS project is (1) to determine whether complement is deposited at

the neuromuscular junction of the SOD1G93A mouse model at the pre symptomatic,

the symptomatic and the end-stage of the disease (2) to determine whether

complement inhibition affects the disease progression in a mouse model of ALS (3)

and to determine whether complement activation products and regulators are

deposited on the neuromuscular junctions in human ALS post-mortem tissue.

Chapter 2 of this thesis shows the effect of complement inhibition in an mouse model

for M. leprae- induced nerve damage. In Chapter 3 the levels of complement

activation products and regulators in serum samples of leprosy patients with and

without reactions are presented. Chapter 4 presents the role of complement and

inflammatory cells in skin lesions of leprosy patients. In Chapter 5 presents

complement deposition on motor end-plates of SOD1G93A mice at the

presymptomatic, symptomactic and end stage of the disease. In Chapter 6

complement activation products and regulators are shown deposited on motor end-

plates in post-mortem intercostal muscle of ALS patients. Chapter 7 describes the

effect of complement inhibition in SOD1G93A mice on the survival, body weight and

1

Introduction

33

Aim outline thesis

An informative way to study the role of the complement system in neurodegeneration

is testing the effect of complement inhibition in different disease models. Insight in

the proces of Wallerian degeneration helps understanding the mechanisms of

neurodegeneration in diseases [132]. We have demonstrated that both genetic and

pharmacological inhibition of the complement system on the level of MAC formation

protect the peripheral nerve from early axon loss after injury [61-64] and stimulate

post-traumatic axonal regeneration and functional recovery [64]. To show this, we

used a drug which inhibits C6 to block MAC formation. C6 is one of the proteins

necessary to form the MAC. This protein is mainly produced in the liver. The C6

inhibiting drug is a modified oligonucleotide that uses antisense principles to target

the mRNA of C6. Inhibition of C6 is not expected to cause side effects because prior

studies have shown that the C6 protein (and presumably MAC formation) is not

essential in humans. Our in house-developed C6 inhibitor is an effective and

selective inhibitor of the terminal complement pathway and is expected to be more

safe in humans than other complement inhibitors on the market.

We showed that C6 RNA antagonist substantially lowered expression of C6 mRNA in

the liver and C6 protein in circulation and reduced MAC activity in treated mice. The

knockdown effect lasts for several weeks after treatment. Importantly, the RNA

antagonist is stable with no overt toxicity in mice.

The hypothesis of this project is that complement activation contributes to

neurodegeneration in leprosy and Amyotrophic lateral sclerosis.

The aim of this thesis is to understand the role of the complement system, especially

the terminal complement pathway, in the pheripheral nerve degenerion in Leprosy

and motor end-plate pathology in Amyotrophic lateral sclerosis.

More specifically, the aim of the leprosy project is (1) to determine whether

complement is deposited on nerves in a mouse model of M. leprae induced nerve

damage, (2) to determine whether complement inhibition in this model is

neuroprotective (3) and to determine whether and where complement is activated in

serum and deposited in skin and nerve biopsies of leprosy patients along the disease

spectrum.

The aim of the ALS project is (1) to determine whether complement is deposited at

the neuromuscular junction of the SOD1G93A mouse model at the pre symptomatic,

the symptomatic and the end-stage of the disease (2) to determine whether

complement inhibition affects the disease progression in a mouse model of ALS (3)

and to determine whether complement activation products and regulators are

deposited on the neuromuscular junctions in human ALS post-mortem tissue.

Chapter 2 of this thesis shows the effect of complement inhibition in an mouse model

for M. leprae- induced nerve damage. In Chapter 3 the levels of complement

activation products and regulators in serum samples of leprosy patients with and

without reactions are presented. Chapter 4 presents the role of complement and

inflammatory cells in skin lesions of leprosy patients. In Chapter 5 presents

complement deposition on motor end-plates of SOD1G93A mice at the

presymptomatic, symptomactic and end stage of the disease. In Chapter 6

complement activation products and regulators are shown deposited on motor end-

plates in post-mortem intercostal muscle of ALS patients. Chapter 7 describes the

effect of complement inhibition in SOD1G93A mice on the survival, body weight and

Chapter 1

34

neurological score. In Chapter 8 all the findings from each study reported in this

thesis are summarized and discussed.

References

[1] King RH, Tournev I, Colomer J, Merlini L, Kalaydjieva L, Thomas PK: Ultrastructural changes in peripheral nerve in hereditary motor and sensory neuropathy-Lom. Neuropathol Appl Neurobiol 1999;25:306-312.

[2] Stoll G, Jander S, Myers RR: Degeneration and regeneration of the peripheral nervous system: from Augustus Waller's observations to neuroinflammation. J Peripher Nerv Syst 2002;7:13-27.

[3] LeBlanc AC, Poduslo JF: Axonal modulation of myelin gene expression in the peripheral nerve. J Neurosci Res 1990;26:317-326.

[4] Kiefer R, Kieseier BC, Stoll G, Hartung HP: The role of macrophages in immune-mediated damage to the peripheral nervous system. Prog Neurobiol 2001;64:109-127.

[5] Makwana M, Raivich G: Molecular mechanisms in successful peripheral regeneration. FEBS J 2005;272:2628-2638.

[6] Chen ZL, Yu WM, Strickland S: Peripheral regeneration. Annu Rev Neurosci 2007;30:209-233.

[7] Barrette B, Hebert MA, Filali M, Lafortune K, Vallieres N, Gowing G, Julien JP, Lacroix S: Requirement of myeloid cells for axon regeneration. J Neurosci 17-9-2008;28:9363-9376.

[8] Narciso MS, Mietto BS, Marques SA, Soares CP, Mermelstein CS, El-Cheikh MC, Martinez AM: Sciatic nerve regeneration is accelerated in galectin-3 knockout mice. Exp Neurol 2009;217:7-15.

[9] Mietto BS, Jurgensen S, Alves L, Pecli C, Narciso MS, Assuncao-Miranda I, Villa-Verde DM, de Souza Lima FR, de Menezes JR, Benjamim CF, Bozza MT, Martinez AM: Lack of galectin-3 speeds Wallerian degeneration by altering TLR and pro-inflammatory cytokine expressions in injured sciatic nerve. Eur J Neurosci 2013;37:1682-1690.

[10] Tessier-Lavigne M, Goodman CS: The molecular biology of axon guidance. Science 15-11-1996;274:1123-1133.

[11] Yu TW, Bargmann CI: Dynamic regulation of axon guidance. Nat Neurosci 2001;4 Suppl:1169-1176.

[12] Nguyen QT, Sanes JR, Lichtman JW: Pre-existing pathways promote precise projection patterns. Nat Neurosci 2002;5:861-867.

[13] Baker RS, Stava MW, Nelson KR, May PJ, Huffman MD, Porter JD: Aberrant reinnervation of facial musculature in a subhuman primate: a correlative analysis of eyelid kinematics, muscle synkinesis, and motoneuron localization. Neurology 1994;44:2165-2173.

[14] Lundborg G, Rosen B: Hand function after nerve repair. Acta Physiol (Oxf) 2007;189:207-217.

[15] Gaudet AD, Popovich PG, Ramer MS: Wallerian degeneration: gaining perspective on inflammatory events after peripheral nerve injury. J Neuroinflammation 2011;8:110.

[16] Rotshenker S: Wallerian degeneration: the innate-immune response to traumatic nerve injury. J Neuroinflammation 2011;8:109.

[17] Bastien D, Lacroix S: Cytokine pathways regulating glial and leukocyte function after spinal cord and peripheral nerve injury. Exp Neurol 2014;258:62-77.

[18] DeFrancesco-Lisowitz A, Lindborg JA, Niemi JP, Zigmond RE: The neuroimmunology of degeneration and regeneration in the peripheral nervous system. Neuroscience 27-8-2015;302:174-203.

[19] Kim D, Lee S, Lee SJ: Toll-like receptors in peripheral nerve injury and neuropathic pain. Curr Top Microbiol Immunol 2009;336:169-186.

[20] Pineau I, Lacroix S: Endogenous signals initiating inflammation in the injured nervous system. Glia 2009;57:351-361.

[21] Mueller M, Wacker K, Ringelstein EB, Hickey WF, Imai Y, Kiefer R: Rapid response of identified resident endoneurial macrophages to nerve injury. Am J Pathol 2001;159:2187-2197.

[22] Mueller M, Leonhard C, Wacker K, Ringelstein EB, Okabe M, Hickey WF, Kiefer R: Macrophage response to peripheral nerve injury: the quantitative contribution of resident and hematogenous macrophages. Lab Invest 2003;83:175-185.

[23] Leonhard C, Muller M, Hickey WF, Ringelstein EB, Kiefer R: Lesion response of long-term and recently immigrated resident endoneurial macrophages in peripheral nerve explant cultures from bone marrow chimeric mice. Eur J Neurosci 2002;16:1654-1660.

[24] Zedler S, Faist E: The impact of endogenous triggers on trauma-associated inflammation. Curr Opin Crit Care 2006;12:595-601.

[25] Lee H, Jo EK, Choi SY, Oh SB, Park K, Kim JS, Lee SJ: Necrotic neuronal cells induce inflammatory Schwann cell activation via TLR2 and TLR3: implication in Wallerian degeneration. Biochem Biophys Res Commun 24-11-2006;350:742-747.

[26] Wekerle H, Schwab M, Linington C, Meyermann R: Antigen presentation in the peripheral nervous system: Schwann cells present endogenous myelin autoantigens to lymphocytes. Eur J Immunol 1986;16:1551-1557.

[27] Baetas-da-Cruz W, Alves L, Guimaraes EV, Santos-Silva A, Pessolani MC, Barbosa HS, Corte-Real S, Cavalcante LA: Efficient uptake of mannosylated proteins by a human Schwann cell line. Histol Histopathol 2009;24:1029-1034.

[28] Boivin A, Pineau I, Barrette B, Filali M, Vallieres N, Rivest S, Lacroix S: Toll-like receptor signaling is critical for Wallerian degeneration and functional recovery after peripheral nerve injury. J Neurosci 14-11-2007;27:12565-12576.

[29] Malbouisson AM, Ghabriel MN, Allt G: Axonal degeneration in large and small nerve fibres. An electron-microscopic and morphometric study. J Neurol Sci 1985;67:307-318.

[30] Martinez AM, Canavarro S: Early myelin breakdown following sural nerve crush: a freeze-fracture study. Braz J Med Biol Res 2000;33:1477-1482.

[31] Raff MC, Whitmore AV, Finn JT: Axonal self-destruction and neurodegeneration. Science 3-5-2002;296:868-871.

1

Introduction

35

neurological score. In Chapter 8 all the findings from each study reported in this

thesis are summarized and discussed.

References

[1] King RH, Tournev I, Colomer J, Merlini L, Kalaydjieva L, Thomas PK: Ultrastructural changes in peripheral nerve in hereditary motor and sensory neuropathy-Lom. Neuropathol Appl Neurobiol 1999;25:306-312.

[2] Stoll G, Jander S, Myers RR: Degeneration and regeneration of the peripheral nervous system: from Augustus Waller's observations to neuroinflammation. J Peripher Nerv Syst 2002;7:13-27.

[3] LeBlanc AC, Poduslo JF: Axonal modulation of myelin gene expression in the peripheral nerve. J Neurosci Res 1990;26:317-326.

[4] Kiefer R, Kieseier BC, Stoll G, Hartung HP: The role of macrophages in immune-mediated damage to the peripheral nervous system. Prog Neurobiol 2001;64:109-127.

[5] Makwana M, Raivich G: Molecular mechanisms in successful peripheral regeneration. FEBS J 2005;272:2628-2638.

[6] Chen ZL, Yu WM, Strickland S: Peripheral regeneration. Annu Rev Neurosci 2007;30:209-233.

[7] Barrette B, Hebert MA, Filali M, Lafortune K, Vallieres N, Gowing G, Julien JP, Lacroix S: Requirement of myeloid cells for axon regeneration. J Neurosci 17-9-2008;28:9363-9376.

[8] Narciso MS, Mietto BS, Marques SA, Soares CP, Mermelstein CS, El-Cheikh MC, Martinez AM: Sciatic nerve regeneration is accelerated in galectin-3 knockout mice. Exp Neurol 2009;217:7-15.

[9] Mietto BS, Jurgensen S, Alves L, Pecli C, Narciso MS, Assuncao-Miranda I, Villa-Verde DM, de Souza Lima FR, de Menezes JR, Benjamim CF, Bozza MT, Martinez AM: Lack of galectin-3 speeds Wallerian degeneration by altering TLR and pro-inflammatory cytokine expressions in injured sciatic nerve. Eur J Neurosci 2013;37:1682-1690.

[10] Tessier-Lavigne M, Goodman CS: The molecular biology of axon guidance. Science 15-11-1996;274:1123-1133.

[11] Yu TW, Bargmann CI: Dynamic regulation of axon guidance. Nat Neurosci 2001;4 Suppl:1169-1176.

[12] Nguyen QT, Sanes JR, Lichtman JW: Pre-existing pathways promote precise projection patterns. Nat Neurosci 2002;5:861-867.

[13] Baker RS, Stava MW, Nelson KR, May PJ, Huffman MD, Porter JD: Aberrant reinnervation of facial musculature in a subhuman primate: a correlative analysis of eyelid kinematics, muscle synkinesis, and motoneuron localization. Neurology 1994;44:2165-2173.

[14] Lundborg G, Rosen B: Hand function after nerve repair. Acta Physiol (Oxf) 2007;189:207-217.

[15] Gaudet AD, Popovich PG, Ramer MS: Wallerian degeneration: gaining perspective on inflammatory events after peripheral nerve injury. J Neuroinflammation 2011;8:110.

[16] Rotshenker S: Wallerian degeneration: the innate-immune response to traumatic nerve injury. J Neuroinflammation 2011;8:109.

[17] Bastien D, Lacroix S: Cytokine pathways regulating glial and leukocyte function after spinal cord and peripheral nerve injury. Exp Neurol 2014;258:62-77.

[18] DeFrancesco-Lisowitz A, Lindborg JA, Niemi JP, Zigmond RE: The neuroimmunology of degeneration and regeneration in the peripheral nervous system. Neuroscience 27-8-2015;302:174-203.

[19] Kim D, Lee S, Lee SJ: Toll-like receptors in peripheral nerve injury and neuropathic pain. Curr Top Microbiol Immunol 2009;336:169-186.

[20] Pineau I, Lacroix S: Endogenous signals initiating inflammation in the injured nervous system. Glia 2009;57:351-361.

[21] Mueller M, Wacker K, Ringelstein EB, Hickey WF, Imai Y, Kiefer R: Rapid response of identified resident endoneurial macrophages to nerve injury. Am J Pathol 2001;159:2187-2197.

[22] Mueller M, Leonhard C, Wacker K, Ringelstein EB, Okabe M, Hickey WF, Kiefer R: Macrophage response to peripheral nerve injury: the quantitative contribution of resident and hematogenous macrophages. Lab Invest 2003;83:175-185.

[23] Leonhard C, Muller M, Hickey WF, Ringelstein EB, Kiefer R: Lesion response of long-term and recently immigrated resident endoneurial macrophages in peripheral nerve explant cultures from bone marrow chimeric mice. Eur J Neurosci 2002;16:1654-1660.

[24] Zedler S, Faist E: The impact of endogenous triggers on trauma-associated inflammation. Curr Opin Crit Care 2006;12:595-601.

[25] Lee H, Jo EK, Choi SY, Oh SB, Park K, Kim JS, Lee SJ: Necrotic neuronal cells induce inflammatory Schwann cell activation via TLR2 and TLR3: implication in Wallerian degeneration. Biochem Biophys Res Commun 24-11-2006;350:742-747.

[26] Wekerle H, Schwab M, Linington C, Meyermann R: Antigen presentation in the peripheral nervous system: Schwann cells present endogenous myelin autoantigens to lymphocytes. Eur J Immunol 1986;16:1551-1557.

[27] Baetas-da-Cruz W, Alves L, Guimaraes EV, Santos-Silva A, Pessolani MC, Barbosa HS, Corte-Real S, Cavalcante LA: Efficient uptake of mannosylated proteins by a human Schwann cell line. Histol Histopathol 2009;24:1029-1034.

[28] Boivin A, Pineau I, Barrette B, Filali M, Vallieres N, Rivest S, Lacroix S: Toll-like receptor signaling is critical for Wallerian degeneration and functional recovery after peripheral nerve injury. J Neurosci 14-11-2007;27:12565-12576.

[29] Malbouisson AM, Ghabriel MN, Allt G: Axonal degeneration in large and small nerve fibres. An electron-microscopic and morphometric study. J Neurol Sci 1985;67:307-318.

[30] Martinez AM, Canavarro S: Early myelin breakdown following sural nerve crush: a freeze-fracture study. Braz J Med Biol Res 2000;33:1477-1482.

[31] Raff MC, Whitmore AV, Finn JT: Axonal self-destruction and neurodegeneration. Science 3-5-2002;296:868-871.

Chapter 1

36

[32] Wang JT, Medress ZA, Barres BA: Axon degeneration: molecular mechanisms of a self-destruction pathway. J Cell Biol 9-1-2012;196:7-18.

[33] Vargas ME, Watanabe J, Singh SJ, Robinson WH, Barres BA: Endogenous antibodies promote rapid myelin clearance and effective axon regeneration after nerve injury. Proc Natl Acad Sci U S A 29-6-2010;107:11993-11998.

[34] Fernandez-Valle C, Bunge RP, Bunge MB: Schwann cells degrade myelin and proliferate in the absence of macrophages: evidence from in vitro studies of Wallerian degeneration. J Neurocytol 1995;24:667-679.

[35] Perry VH, Tsao JW, Fearn S, Brown MC: Radiation-induced reductions in macrophage recruitment have only slight effects on myelin degeneration in sectioned peripheral nerves of mice. Eur J Neurosci 1-2-1995;7:271-280.

[36] David S, Kroner A: Repertoire of microglial and macrophage responses after spinal cord injury. Nat Rev Neurosci 2011;12:388-399.

[37] Shamash S, Reichert F, Rotshenker S: The cytokine network of Wallerian degeneration: tumor necrosis factor-alpha, interleukin-1alpha, and interleukin-1beta. J Neurosci 15-4-2002;22:3052-3060.

[38] Be'eri H, Reichert F, Saada A, Rotshenker S: The cytokine network of wallerian degeneration: IL-10 and GM-CSF. Eur J Neurosci 1998;10:2707-2713.

[39] Perrin FE, Lacroix S, Aviles-Trigueros M, David S: Involvement of monocyte chemoattractant protein-1, macrophage inflammatory protein-1alpha and interleukin-1beta in Wallerian degeneration. Brain 2005;128:854-866.

[40] Murakami M, Nakatani Y, Atsumi G, Inoue K, Kudo I: Regulatory functions of phospholipase A2. Crit Rev Immunol 1997;17:225-283.

[41] De S, Trigueros MA, Kalyvas A, David S: Phospholipase A2 plays an important role in myelin breakdown and phagocytosis during Wallerian degeneration. Mol Cell Neurosci 2003;24:753-765.

[42] Martini R, Fischer S, Lopez-Vales R, David S: Interactions between Schwann cells and macrophages in injury and inherited demyelinating disease. Glia 1-11-2008;56:1566-1577.

[43] Gilley J, Coleman MP: Endogenous Nmnat2 is an essential survival factor for maintenance of healthy axons. PLoS Biol 2010;8:e1000300.

[44] Ricklin D, Hajishengallis G, Yang K, Lambris JD: Complement: a key system for immune surveillance and homeostasis. Nat Immunol 2010;11:785-797.

[45] Stevens B, Allen NJ, Vazquez LE, Howell GR, Christopherson KS, Nouri N, Micheva KD, Mehalow AK, Huberman AD, Stafford B, Sher A, Litke AM, Lambris JD, Smith SJ, John SW, Barres BA: The classical complement cascade mediates CNS synapse elimination. Cell 14-12-2007;131:1164-1178.

[46] Muller-Eberhard HJ, Gotze O: C3 proactivator convertase and its mode of action. J Exp Med 1-4-1972;135:1003-1008.

[47] Atkinson JP, Frank MM: Bypassing complement: evolutionary lessons and future implications. J Clin Invest 2006;116:1215-1218.

[48] Atkinson JP, Oglesby TJ, White D, Adams EA, Liszewski MK: Separation of self from non-self in the complement system: a role for membrane cofactor protein and decay accelerating factor. Clin Exp Immunol 1991;86 Suppl 1:27-30.

[49] Kim DD, Song WC: Membrane complement regulatory proteins. Clin Immunol 2006;118:127-136.

[50] Kirkitadze MD, Barlow PN: Structure and flexibility of the multiple domain proteins that regulate complement activation. Immunol Rev 2001;180:146-161.

[51] Liszewski MK, Farries TC, Lublin DM, Rooney IA, Atkinson JP: Control of the complement system. Adv Immunol 1996;61:201-283.

[52] Harris CL, Rushmere NK, Morgan BP: Molecular and functional analysis of mouse decay accelerating factor (CD55). Biochem J 1-8-1999;341 ( Pt 3):821-829.

[53] Wiesmann C, Katschke KJ, Yin J, Helmy KY, Steffek M, Fairbrother WJ, McCallum SA, Embuscado L, DeForge L, Hass PE, van Lookeren CM: Structure of C3b in complex with CRIg gives insights into regulation of complement activation. Nature 9-11-2006;444:217-220.

[54] Koski CL, Vanguri P, Shin ML: Activation of the alternative pathway of complement by human peripheral nerve myelin. J Immunol 1985;134:1810-1814.

[55] Vanguri P, Koski CL, Silverman B, Shin ML: Complement activation by isolated myelin: activation of the classical pathway in the absence of myelin-specific antibodies. Proc Natl Acad Sci U S A 1982;79:3290-3294.

[56] de Jonge RR, van Schaik IN, Vreijling JP, Troost D, Baas F: Expression of complement components in the peripheral nervous system. Hum Mol Genet 1-2-2004;13:295-302.

[57] Reichert F, Rotshenker S: Complement-receptor-3 and scavenger-receptor-AI/II mediated myelin phagocytosis in microglia and macrophages. Neurobiol Dis 2003;12:65-72.

[58] Makranz C, Cohen G, Reichert F, Kodama T, Rotshenker S: cAMP cascade (PKA, Epac, adenylyl cyclase, Gi, and phosphodiesterases) regulates myelin phagocytosis mediated by complement receptor-3 and scavenger receptor-AI/II in microglia and macrophages. Glia 2006;53:441-448.

[59] Dailey AT, Avellino AM, Benthem L, Silver J, Kliot M: Complement depletion reduces macrophage infiltration and activation during Wallerian degeneration and axonal regeneration. J Neurosci 1-9-1998;18:6713-6722.

[60] Liu L, Lioudyno M, Tao R, Eriksson P, Svensson M, Aldskogius H: Hereditary absence of complement C5 in adult mice influences Wallerian degeneration, but not retrograde responses, following injury to peripheral nerve. J Peripher Nerv Syst 1999;4:123-133.

[61] Ramaglia V, King RH, Nourallah M, Wolterman R, de JR, Ramkema M, Vigar MA, van der Wetering S, Morgan BP, Troost D, Baas F: The membrane attack complex of the complement system is essential for rapid Wallerian degeneration. J Neurosci 18-7-2007;27:7663-7672.

[62] Ramaglia V, King RH, Morgan BP, Baas F: Deficiency of the complement regulator CD59a exacerbates Wallerian degeneration. Mol Immunol 2009;46:1892-1896.

[63] Ramaglia V, Wolterman R, de KM, Vigar MA, Wagenaar-Bos I, King RH, Morgan BP, Baas F: Soluble complement receptor 1 protects the peripheral nerve from early axon loss after injury. Am J Pathol 2008;172:1043-1052.

[64] Ramaglia V, Tannemaat MR, de KM, Wolterman R, Vigar MA, King RH, Morgan BP, Baas F: Complement inhibition accelerates regeneration in a model of peripheral nerve injury. Mol Immunol 2009;47:302-309.

[65] Stahel PF, Morganti-Kossmann MC, Perez D, Redaelli C, Gloor B, Trentz O, Kossmann T: Intrathecal levels of complement-derived soluble membrane attack complex (sC5b-9) correlate

1

Introduction

37

[32] Wang JT, Medress ZA, Barres BA: Axon degeneration: molecular mechanisms of a self-destruction pathway. J Cell Biol 9-1-2012;196:7-18.

[33] Vargas ME, Watanabe J, Singh SJ, Robinson WH, Barres BA: Endogenous antibodies promote rapid myelin clearance and effective axon regeneration after nerve injury. Proc Natl Acad Sci U S A 29-6-2010;107:11993-11998.

[34] Fernandez-Valle C, Bunge RP, Bunge MB: Schwann cells degrade myelin and proliferate in the absence of macrophages: evidence from in vitro studies of Wallerian degeneration. J Neurocytol 1995;24:667-679.

[35] Perry VH, Tsao JW, Fearn S, Brown MC: Radiation-induced reductions in macrophage recruitment have only slight effects on myelin degeneration in sectioned peripheral nerves of mice. Eur J Neurosci 1-2-1995;7:271-280.

[36] David S, Kroner A: Repertoire of microglial and macrophage responses after spinal cord injury. Nat Rev Neurosci 2011;12:388-399.

[37] Shamash S, Reichert F, Rotshenker S: The cytokine network of Wallerian degeneration: tumor necrosis factor-alpha, interleukin-1alpha, and interleukin-1beta. J Neurosci 15-4-2002;22:3052-3060.

[38] Be'eri H, Reichert F, Saada A, Rotshenker S: The cytokine network of wallerian degeneration: IL-10 and GM-CSF. Eur J Neurosci 1998;10:2707-2713.

[39] Perrin FE, Lacroix S, Aviles-Trigueros M, David S: Involvement of monocyte chemoattractant protein-1, macrophage inflammatory protein-1alpha and interleukin-1beta in Wallerian degeneration. Brain 2005;128:854-866.

[40] Murakami M, Nakatani Y, Atsumi G, Inoue K, Kudo I: Regulatory functions of phospholipase A2. Crit Rev Immunol 1997;17:225-283.

[41] De S, Trigueros MA, Kalyvas A, David S: Phospholipase A2 plays an important role in myelin breakdown and phagocytosis during Wallerian degeneration. Mol Cell Neurosci 2003;24:753-765.

[42] Martini R, Fischer S, Lopez-Vales R, David S: Interactions between Schwann cells and macrophages in injury and inherited demyelinating disease. Glia 1-11-2008;56:1566-1577.

[43] Gilley J, Coleman MP: Endogenous Nmnat2 is an essential survival factor for maintenance of healthy axons. PLoS Biol 2010;8:e1000300.

[44] Ricklin D, Hajishengallis G, Yang K, Lambris JD: Complement: a key system for immune surveillance and homeostasis. Nat Immunol 2010;11:785-797.

[45] Stevens B, Allen NJ, Vazquez LE, Howell GR, Christopherson KS, Nouri N, Micheva KD, Mehalow AK, Huberman AD, Stafford B, Sher A, Litke AM, Lambris JD, Smith SJ, John SW, Barres BA: The classical complement cascade mediates CNS synapse elimination. Cell 14-12-2007;131:1164-1178.

[46] Muller-Eberhard HJ, Gotze O: C3 proactivator convertase and its mode of action. J Exp Med 1-4-1972;135:1003-1008.

[47] Atkinson JP, Frank MM: Bypassing complement: evolutionary lessons and future implications. J Clin Invest 2006;116:1215-1218.

[48] Atkinson JP, Oglesby TJ, White D, Adams EA, Liszewski MK: Separation of self from non-self in the complement system: a role for membrane cofactor protein and decay accelerating factor. Clin Exp Immunol 1991;86 Suppl 1:27-30.

[49] Kim DD, Song WC: Membrane complement regulatory proteins. Clin Immunol 2006;118:127-136.

[50] Kirkitadze MD, Barlow PN: Structure and flexibility of the multiple domain proteins that regulate complement activation. Immunol Rev 2001;180:146-161.

[51] Liszewski MK, Farries TC, Lublin DM, Rooney IA, Atkinson JP: Control of the complement system. Adv Immunol 1996;61:201-283.

[52] Harris CL, Rushmere NK, Morgan BP: Molecular and functional analysis of mouse decay accelerating factor (CD55). Biochem J 1-8-1999;341 ( Pt 3):821-829.

[53] Wiesmann C, Katschke KJ, Yin J, Helmy KY, Steffek M, Fairbrother WJ, McCallum SA, Embuscado L, DeForge L, Hass PE, van Lookeren CM: Structure of C3b in complex with CRIg gives insights into regulation of complement activation. Nature 9-11-2006;444:217-220.

[54] Koski CL, Vanguri P, Shin ML: Activation of the alternative pathway of complement by human peripheral nerve myelin. J Immunol 1985;134:1810-1814.

[55] Vanguri P, Koski CL, Silverman B, Shin ML: Complement activation by isolated myelin: activation of the classical pathway in the absence of myelin-specific antibodies. Proc Natl Acad Sci U S A 1982;79:3290-3294.

[56] de Jonge RR, van Schaik IN, Vreijling JP, Troost D, Baas F: Expression of complement components in the peripheral nervous system. Hum Mol Genet 1-2-2004;13:295-302.

[57] Reichert F, Rotshenker S: Complement-receptor-3 and scavenger-receptor-AI/II mediated myelin phagocytosis in microglia and macrophages. Neurobiol Dis 2003;12:65-72.

[58] Makranz C, Cohen G, Reichert F, Kodama T, Rotshenker S: cAMP cascade (PKA, Epac, adenylyl cyclase, Gi, and phosphodiesterases) regulates myelin phagocytosis mediated by complement receptor-3 and scavenger receptor-AI/II in microglia and macrophages. Glia 2006;53:441-448.

[59] Dailey AT, Avellino AM, Benthem L, Silver J, Kliot M: Complement depletion reduces macrophage infiltration and activation during Wallerian degeneration and axonal regeneration. J Neurosci 1-9-1998;18:6713-6722.

[60] Liu L, Lioudyno M, Tao R, Eriksson P, Svensson M, Aldskogius H: Hereditary absence of complement C5 in adult mice influences Wallerian degeneration, but not retrograde responses, following injury to peripheral nerve. J Peripher Nerv Syst 1999;4:123-133.

[61] Ramaglia V, King RH, Nourallah M, Wolterman R, de JR, Ramkema M, Vigar MA, van der Wetering S, Morgan BP, Troost D, Baas F: The membrane attack complex of the complement system is essential for rapid Wallerian degeneration. J Neurosci 18-7-2007;27:7663-7672.

[62] Ramaglia V, King RH, Morgan BP, Baas F: Deficiency of the complement regulator CD59a exacerbates Wallerian degeneration. Mol Immunol 2009;46:1892-1896.

[63] Ramaglia V, Wolterman R, de KM, Vigar MA, Wagenaar-Bos I, King RH, Morgan BP, Baas F: Soluble complement receptor 1 protects the peripheral nerve from early axon loss after injury. Am J Pathol 2008;172:1043-1052.

[64] Ramaglia V, Tannemaat MR, de KM, Wolterman R, Vigar MA, King RH, Morgan BP, Baas F: Complement inhibition accelerates regeneration in a model of peripheral nerve injury. Mol Immunol 2009;47:302-309.

[65] Stahel PF, Morganti-Kossmann MC, Perez D, Redaelli C, Gloor B, Trentz O, Kossmann T: Intrathecal levels of complement-derived soluble membrane attack complex (sC5b-9) correlate

Chapter 1

38

with blood-brain barrier dysfunction in patients with traumatic brain injury. J Neurotrauma 2001;18:773-781.

[66] Kossmann T, Stahel PF, Morganti-Kossmann MC, Jones JL, Barnum SR: Elevated levels of the complement components C3 and factor B in ventricular cerebrospinal fluid of patients with traumatic brain injury. J Neuroimmunol 1997;73:63-69.

[67] Leinhase I, Holers VM, Thurman JM, Harhausen D, Schmidt OI, Pietzcker M, Taha ME, Rittirsch D, Huber-Lang M, Smith WR, Ward PA, Stahel PF: Reduced neuronal cell death after experimental brain injury in mice lacking a functional alternative pathway of complement activation. BMC Neurosci 2006;7:55.

[68] Rancan M, Morganti-Kossmann MC, Barnum SR, Saft S, Schmidt OI, Ertel W, Stahel PF: Central nervous system-targeted complement inhibition mediates neuroprotection after closed head injury in transgenic mice. J Cereb Blood Flow Metab 2003;23:1070-1074.

[69] Anderson AJ, Robert S, Huang W, Young W, Cotman CW: Activation of complement pathways after contusion-induced spinal cord injury. J Neurotrauma 2004;21:1831-1846.

[70] Suresh R, Chandrasekaran P, Sutterwala FS, Mosser DM: Complement-mediated 'bystander' damage initiates host NLRP3 inflammasome activation. J Cell Sci 1-5-2016;129:1928-1939.

[71] Coleman MP, Perry VH: Axon pathology in neurological disease: a neglected therapeutic target. Trends Neurosci 2002;25:532-537.

[72] Bonifati DM, Kishore U: Role of complement in neurodegeneration and neuroinflammation. Mol Immunol 2007;44:999-1010.

[73] Walport MJ: Complement. First of two parts. N Engl J Med 5-4-2001;344:1058-1066.

[74] Walport MJ: Complement. Second of two parts. N Engl J Med 12-4-2001;344:1140-1144.

[75] Mead RJ, Singhrao SK, Neal JW, Lassmann H, Morgan BP: The membrane attack complex of complement causes severe demyelination associated with acute axonal injury. J Immunol 1-1-2002;168:458-465.

[76] Hong S, Beja-Glasser VF, Nfonoyim BM, Frouin A, Li S, Ramakrishnan S, Merry KM, Shi Q, Rosenthal A, Barres BA, Lemere CA, Selkoe DJ, Stevens B: Complement and microglia mediate early synapse loss in Alzheimer mouse models. Science 6-5-2016;352:712-716.

[77] Sansarricq H: The WHO leprosy programme. Ann Microbiol (Paris) 1982;133:5-12.

[78] Bleharski JR, Li H, Meinken C, Graeber TG, Ochoa MT, Yamamura M, Burdick A, Sarno EN, Wagner M, Rollinghoff M, Rea TH, Colonna M, Stenger S, Bloom BR, Eisenberg D, Modlin RL: Use of genetic profiling in leprosy to discriminate clinical forms of the disease. Science 12-9-2003;301:1527-1530.

[79] Ridley DS, Jopling WH: Classification of leprosy according to immunity. A five-group system. Int J Lepr Other Mycobact Dis 1966;34:255-273.

[80] Laal S, Bhutani LK, Nath I: Natural emergence of antigen-reactive T cells in lepromatous leprosy patients during erythema nodosum leprosum. Infect Immun 1985;50:887-892.

[81] Byrd SR, Gelber R, Bermudez LE: Roles of soluble fibronectin and beta 1 integrin receptors in the binding of Mycobacterium leprae to nasal epithelial cells. Clin Immunol Immunopathol 1993;69:266-271.

[82] Brophy PJ: Microbiology. Subversion of Schwann cells and the leper's bell. Science 3-5-2002;296:862-863.

[83] Kaplan G: Recent advances in cytokine therapy in leprosy. J Infect Dis 1993;167 Suppl 1:S18-S22.

[84] Ooi WW, Srinivasan J: Leprosy and the peripheral nervous system: basic and clinical aspects. Muscle Nerve 2004;30:393-409.

[85] Britton WJ, Lockwood DN: Leprosy. Lancet 10-4-2004;363:1209-1219.

[86] Saitz EW, Dierks RE, Shepard CC: Complement and the second component of complement in leprosy. Int J Lepr Other Mycobact Dis 1968;36:400-404.

[87] Petchclai B, Chutanondh R, Prasongsom S, Hiranras S, Ramasoota T: Complement profile in leprosy. Am J Trop Med Hyg 1973;22:761-764.

[88] Gomes GI, Nahn EP, Jr., Santos RK, Da Silva WD, Kipnis TL: The functional state of the complement system in leprosy. Am J Trop Med Hyg 2008;78:605-610.

[89] Zhang DF, Huang XQ, Wang D, Li YY, Yao YG: Genetic variants of complement genes ficolin-2, mannose-binding lectin and complement factor H are associated with leprosy in Han Chinese from Southwest China. Hum Genet 2013;132:629-640.

[90] Zhang DF, Wang D, Li YY, Yao YG: Mapping genetic variants in the CFH gene for association with leprosy in Han Chinese. Genes Immun 2014;15:506-510.

[91] Tyagi P, Ramanathan VD, Girdhar BK, Katoch K, Bhatia AS, Sengupta U: Activation of complement by circulating immune complexes isolated from leprosy patients. Int J Lepr Other Mycobact Dis 1990;58:31-38.

[92] Parkash O, Kumar V, Mukherjee A, Sengupta U, Malaviya GN, Girdhar BK: Membrane attack complex in thickened cutaneous sensory nerves of leprosy patients. Acta Leprol 1995;9:195-199.

[93] Geser F, Martinez-Lage M, Kwong LK, Lee VM, Trojanowski JQ: Amyotrophic lateral sclerosis, frontotemporal dementia and beyond: the TDP-43 diseases. J Neurol 2009;256:1205-1214.

[94] Heads T, Pollock M, Robertson A, Sutherland WH, Allpress S: Sensory nerve pathology in amyotrophic lateral sclerosis. Acta Neuropathol 1991;82:316-320.

[95] Chida K, Sakamaki S, Takasu T: Alteration in autonomic function and cardiovascular regulation in amyotrophic lateral sclerosis. J Neurol 1989;236:127-130.

[96] Mitchell JD, Borasio GD: Amyotrophic lateral sclerosis. Lancet 16-6-2007;369:2031-2041.

[97] Liscic RM, Grinberg LT, Zidar J, Gitcho MA, Cairns NJ: ALS and FTLD: two faces of TDP-43 proteinopathy. Eur J Neurol 2008;15:772-780.

[98] Buratti E, Baralle FE: The molecular links between TDP-43 dysfunction and neurodegeneration. Adv Genet 2009;66:1-34.

[99] Rothstein JD: Current hypotheses for the underlying biology of amyotrophic lateral sclerosis. Ann Neurol 2009;65 Suppl 1:S3-S9.

[100] Shi P, Gal J, Kwinter DM, Liu X, Zhu H: Mitochondrial dysfunction in amyotrophic lateral sclerosis. Biochim Biophys Acta 2010;1802:45-51.

[101] Boillee S, Vande VC, Cleveland DW: ALS: a disease of motor neurons and their nonneuronal neighbors. Neuron 5-10-2006;52:39-59.

1

Introduction

39

with blood-brain barrier dysfunction in patients with traumatic brain injury. J Neurotrauma 2001;18:773-781.

[66] Kossmann T, Stahel PF, Morganti-Kossmann MC, Jones JL, Barnum SR: Elevated levels of the complement components C3 and factor B in ventricular cerebrospinal fluid of patients with traumatic brain injury. J Neuroimmunol 1997;73:63-69.

[67] Leinhase I, Holers VM, Thurman JM, Harhausen D, Schmidt OI, Pietzcker M, Taha ME, Rittirsch D, Huber-Lang M, Smith WR, Ward PA, Stahel PF: Reduced neuronal cell death after experimental brain injury in mice lacking a functional alternative pathway of complement activation. BMC Neurosci 2006;7:55.

[68] Rancan M, Morganti-Kossmann MC, Barnum SR, Saft S, Schmidt OI, Ertel W, Stahel PF: Central nervous system-targeted complement inhibition mediates neuroprotection after closed head injury in transgenic mice. J Cereb Blood Flow Metab 2003;23:1070-1074.

[69] Anderson AJ, Robert S, Huang W, Young W, Cotman CW: Activation of complement pathways after contusion-induced spinal cord injury. J Neurotrauma 2004;21:1831-1846.

[70] Suresh R, Chandrasekaran P, Sutterwala FS, Mosser DM: Complement-mediated 'bystander' damage initiates host NLRP3 inflammasome activation. J Cell Sci 1-5-2016;129:1928-1939.

[71] Coleman MP, Perry VH: Axon pathology in neurological disease: a neglected therapeutic target. Trends Neurosci 2002;25:532-537.

[72] Bonifati DM, Kishore U: Role of complement in neurodegeneration and neuroinflammation. Mol Immunol 2007;44:999-1010.

[73] Walport MJ: Complement. First of two parts. N Engl J Med 5-4-2001;344:1058-1066.

[74] Walport MJ: Complement. Second of two parts. N Engl J Med 12-4-2001;344:1140-1144.

[75] Mead RJ, Singhrao SK, Neal JW, Lassmann H, Morgan BP: The membrane attack complex of complement causes severe demyelination associated with acute axonal injury. J Immunol 1-1-2002;168:458-465.

[76] Hong S, Beja-Glasser VF, Nfonoyim BM, Frouin A, Li S, Ramakrishnan S, Merry KM, Shi Q, Rosenthal A, Barres BA, Lemere CA, Selkoe DJ, Stevens B: Complement and microglia mediate early synapse loss in Alzheimer mouse models. Science 6-5-2016;352:712-716.

[77] Sansarricq H: The WHO leprosy programme. Ann Microbiol (Paris) 1982;133:5-12.

[78] Bleharski JR, Li H, Meinken C, Graeber TG, Ochoa MT, Yamamura M, Burdick A, Sarno EN, Wagner M, Rollinghoff M, Rea TH, Colonna M, Stenger S, Bloom BR, Eisenberg D, Modlin RL: Use of genetic profiling in leprosy to discriminate clinical forms of the disease. Science 12-9-2003;301:1527-1530.

[79] Ridley DS, Jopling WH: Classification of leprosy according to immunity. A five-group system. Int J Lepr Other Mycobact Dis 1966;34:255-273.

[80] Laal S, Bhutani LK, Nath I: Natural emergence of antigen-reactive T cells in lepromatous leprosy patients during erythema nodosum leprosum. Infect Immun 1985;50:887-892.

[81] Byrd SR, Gelber R, Bermudez LE: Roles of soluble fibronectin and beta 1 integrin receptors in the binding of Mycobacterium leprae to nasal epithelial cells. Clin Immunol Immunopathol 1993;69:266-271.

[82] Brophy PJ: Microbiology. Subversion of Schwann cells and the leper's bell. Science 3-5-2002;296:862-863.

[83] Kaplan G: Recent advances in cytokine therapy in leprosy. J Infect Dis 1993;167 Suppl 1:S18-S22.

[84] Ooi WW, Srinivasan J: Leprosy and the peripheral nervous system: basic and clinical aspects. Muscle Nerve 2004;30:393-409.

[85] Britton WJ, Lockwood DN: Leprosy. Lancet 10-4-2004;363:1209-1219.

[86] Saitz EW, Dierks RE, Shepard CC: Complement and the second component of complement in leprosy. Int J Lepr Other Mycobact Dis 1968;36:400-404.

[87] Petchclai B, Chutanondh R, Prasongsom S, Hiranras S, Ramasoota T: Complement profile in leprosy. Am J Trop Med Hyg 1973;22:761-764.

[88] Gomes GI, Nahn EP, Jr., Santos RK, Da Silva WD, Kipnis TL: The functional state of the complement system in leprosy. Am J Trop Med Hyg 2008;78:605-610.

[89] Zhang DF, Huang XQ, Wang D, Li YY, Yao YG: Genetic variants of complement genes ficolin-2, mannose-binding lectin and complement factor H are associated with leprosy in Han Chinese from Southwest China. Hum Genet 2013;132:629-640.

[90] Zhang DF, Wang D, Li YY, Yao YG: Mapping genetic variants in the CFH gene for association with leprosy in Han Chinese. Genes Immun 2014;15:506-510.

[91] Tyagi P, Ramanathan VD, Girdhar BK, Katoch K, Bhatia AS, Sengupta U: Activation of complement by circulating immune complexes isolated from leprosy patients. Int J Lepr Other Mycobact Dis 1990;58:31-38.

[92] Parkash O, Kumar V, Mukherjee A, Sengupta U, Malaviya GN, Girdhar BK: Membrane attack complex in thickened cutaneous sensory nerves of leprosy patients. Acta Leprol 1995;9:195-199.

[93] Geser F, Martinez-Lage M, Kwong LK, Lee VM, Trojanowski JQ: Amyotrophic lateral sclerosis, frontotemporal dementia and beyond: the TDP-43 diseases. J Neurol 2009;256:1205-1214.

[94] Heads T, Pollock M, Robertson A, Sutherland WH, Allpress S: Sensory nerve pathology in amyotrophic lateral sclerosis. Acta Neuropathol 1991;82:316-320.

[95] Chida K, Sakamaki S, Takasu T: Alteration in autonomic function and cardiovascular regulation in amyotrophic lateral sclerosis. J Neurol 1989;236:127-130.

[96] Mitchell JD, Borasio GD: Amyotrophic lateral sclerosis. Lancet 16-6-2007;369:2031-2041.

[97] Liscic RM, Grinberg LT, Zidar J, Gitcho MA, Cairns NJ: ALS and FTLD: two faces of TDP-43 proteinopathy. Eur J Neurol 2008;15:772-780.

[98] Buratti E, Baralle FE: The molecular links between TDP-43 dysfunction and neurodegeneration. Adv Genet 2009;66:1-34.

[99] Rothstein JD: Current hypotheses for the underlying biology of amyotrophic lateral sclerosis. Ann Neurol 2009;65 Suppl 1:S3-S9.

[100] Shi P, Gal J, Kwinter DM, Liu X, Zhu H: Mitochondrial dysfunction in amyotrophic lateral sclerosis. Biochim Biophys Acta 2010;1802:45-51.

[101] Boillee S, Vande VC, Cleveland DW: ALS: a disease of motor neurons and their nonneuronal neighbors. Neuron 5-10-2006;52:39-59.

Chapter 1

40

[102] Ilieva H, Polymenidou M, Cleveland DW: Non-cell autonomous toxicity in neurodegenerative disorders: ALS and beyond. J Cell Biol 14-12-2009;187:761-772.

[103] Aebischer J, Cassina P, Otsmane B, Moumen A, Seilhean D, Meininger V, Barbeito L, Pettmann B, Raoul C: IFNgamma triggers a LIGHT-dependent selective death of motoneurons contributing to the non-cell-autonomous effects of mutant SOD1. Cell Death Differ 2011;18:754-768.

[104] Pasinelli P, Brown RH: Molecular biology of amyotrophic lateral sclerosis: insights from genetics. Nat Rev Neurosci 2006;7:710-723.

[105] Rosen DR, Siddique T, Patterson D, Figlewicz DA, Sapp P, Hentati A, Donaldson D, Goto J, O'Regan JP, Deng HX, .: Mutations in Cu/Zn superoxide dismutase gene are associated with familial amyotrophic lateral sclerosis. Nature 4-3-1993;362:59-62.

[106] Gurney ME, Pu H, Chiu AY, Dal Canto MC, Polchow CY, Alexander DD, Caliendo J, Hentati A, Kwon YW, Deng HX, .: Motor neuron degeneration in mice that express a human Cu,Zn superoxide dismutase mutation. Science 17-6-1994;264:1772-1775.

[107] Gurney ME: Transgenic-mouse model of amyotrophic lateral sclerosis. N Engl J Med 22-12-1994;331:1721-1722.

[108] Papadimitriou D, Le V, V, Jacquier A, Ikiz B, Przedborski S, Re DB: Inflammation in ALS and SMA: sorting out the good from the evil. Neurobiol Dis 2010;37:493-502.

[109] Matzinger P: Tolerance, danger, and the extended family. Annu Rev Immunol 1994;12:991-1045.

[110] Zhang Q, Raoof M, Chen Y, Sumi Y, Sursal T, Junger W, Brohi K, Itagaki K, Hauser CJ: Circulating mitochondrial DAMPs cause inflammatory responses to injury. Nature 4-3-2010;464:104-107.

[111] McGeer PL, McGeer EG, Kawamata T, Yamada T, Akiyama H: Reactions of the immune system in chronic degenerative neurological diseases. Can J Neurol Sci 1991;18:376-379.

[112] Engelhardt JI, Tajti J, Appel SH: Lymphocytic infiltrates in the spinal cord in amyotrophic lateral sclerosis. Arch Neurol 1993;50:30-36.

[113] McGeer PL, McGeer EG: Inflammatory processes in amyotrophic lateral sclerosis. Muscle Nerve 2002;26:459-470.

[114] Zhang R, Hadlock KG, Do H, Yu S, Honrada R, Champion S, Forshew D, Madison C, Katz J, Miller RG, McGrath MS: Gene expression profiling in peripheral blood mononuclear cells from patients with sporadic amyotrophic lateral sclerosis (sALS). J Neuroimmunol 2011;230:114-123.

[115] Graves MC, Fiala M, Dinglasan LA, Liu NQ, Sayre J, Chiappelli F, van KC, Vinters HV: Inflammation in amyotrophic lateral sclerosis spinal cord and brain is mediated by activated macrophages, mast cells and T cells. Amyotroph Lateral Scler Other Motor Neuron Disord 2004;5:213-219.

[116] Lawson JM, Tremble J, Dayan C, Beyan H, Leslie RD, Peakman M, Tree TI: Increased resistance to CD4+CD25hi regulatory T cell-mediated suppression in patients with type 1 diabetes. Clin Exp Immunol 2008;154:353-359.

[117] Holmoy T, Roos PM, Kvale EO: ALS: cytokine profile in cerebrospinal fluid T-cell clones. Amyotroph Lateral Scler 2006;7:183-186.

[118] Engelhardt JI, Appel SH: IgG reactivity in the spinal cord and motor cortex in amyotrophic lateral sclerosis. Arch Neurol 1990;47:1210-1216.

[119] Saleh IA, Zesiewicz T, Xie Y, Sullivan KL, Miller AM, Kuzmin-Nichols N, Sanberg PR, Garbuzova-Davis S: Evaluation of humoral immune response in adaptive immunity in ALS patients during disease progression. J Neuroimmunol 30-10-2009;215:96-101.

[120] Donnenfeld H, Kascsak RJ, Bartfeld H: Deposits of IgG and C3 in the spinal cord and motor cortex of ALS patients. J Neuroimmunol 1984;6:51-57.

[121] Zhang R, Gascon R, Miller RG, Gelinas DF, Mass J, Hadlock K, Jin X, Reis J, Narvaez A, McGrath MS: Evidence for systemic immune system alterations in sporadic amyotrophic lateral sclerosis (sALS). J Neuroimmunol 2005;159:215-224.

[122] Shi N, Kawano Y, Tateishi T, Kikuchi H, Osoegawa M, Ohyagi Y, Kira J: Increased IL-13-producing T cells in ALS: positive correlations with disease severity and progression rate. J Neuroimmunol 2007;182:232-235.

[123] Fiala M, Chattopadhay M, La CA, Tse E, Liu G, Lourenco E, Eskin A, Liu PT, Magpantay L, Tse S, Mahanian M, Weitzman R, Tong J, Nguyen C, Cho T, Koo P, Sayre J, Martinez-Maza O, Rosenthal MJ, Wiedau-Pazos M: IL-17A is increased in the serum and in spinal cord CD8 and mast cells of ALS patients. J Neuroinflammation 2010;7:76.

[124] Kuhle J, Lindberg RL, Regeniter A, Mehling M, Steck AJ, Kappos L, Czaplinski A: Increased levels of inflammatory chemokines in amyotrophic lateral sclerosis. Eur J Neurol 2009;16:771-774.

[125] Sta M, Sylva-Steenland RM, Casula M, de Jong JM, Troost D, Aronica E, Baas F: Innate and adaptive immunity in amyotrophic lateral sclerosis: evidence of complement activation. Neurobiol Dis 2011;42:211-220.

[126] Lobsiger CS, Boillee S, Cleveland DW: Toxicity from different SOD1 mutants dysregulates the complement system and the neuronal regenerative response in ALS motor neurons. Proc Natl Acad Sci U S A 1-5-2007;104:7319-7326.

[127] Ferraiuolo L, Heath PR, Holden H, Kasher P, Kirby J, Shaw PJ: Microarray analysis of the cellular pathways involved in the adaptation to and progression of motor neuron injury in the SOD1 G93A mouse model of familial ALS. J Neurosci 22-8-2007;27:9201-9219.

[128] Woodruff TM, Costantini KJ, Taylor SM, Noakes PG: Role of complement in motor neuron disease: animal models and therapeutic potential of complement inhibitors. Adv Exp Med Biol 2008;632:143-158.

[129] Humayun S, Gohar M, Volkening K, Moisse K, Leystra-Lantz C, Mepham J, McLean J, Strong MJ: The complement factor C5a receptor is upregulated in NFL-/- mouse motor neurons. J Neuroimmunol 29-5-2009;210:52-62.

[130] Lee JD, Kamaruzaman NA, Fung JN, Taylor SM, Turner BJ, Atkin JD, Woodruff TM, Noakes PG: Dysregulation of the complement cascade in the hSOD1G93A transgenic mouse model of amyotrophic lateral sclerosis. J Neuroinflammation 2013;10:119.

[131] Fischer LR, Culver DG, Tennant P, Davis AA, Wang M, Castellano-Sanchez A, Khan J, Polak MA, Glass JD: Amyotrophic lateral sclerosis is a distal axonopathy: evidence in mice and man. Exp Neurol 2004;185:232-240.

[132] Glass JD: Wallerian degeneration as a window to peripheral neuropathy. J Neurol Sci 15-5-2004;220:123-124.

1

Introduction

41

[102] Ilieva H, Polymenidou M, Cleveland DW: Non-cell autonomous toxicity in neurodegenerative disorders: ALS and beyond. J Cell Biol 14-12-2009;187:761-772.

[103] Aebischer J, Cassina P, Otsmane B, Moumen A, Seilhean D, Meininger V, Barbeito L, Pettmann B, Raoul C: IFNgamma triggers a LIGHT-dependent selective death of motoneurons contributing to the non-cell-autonomous effects of mutant SOD1. Cell Death Differ 2011;18:754-768.

[104] Pasinelli P, Brown RH: Molecular biology of amyotrophic lateral sclerosis: insights from genetics. Nat Rev Neurosci 2006;7:710-723.

[105] Rosen DR, Siddique T, Patterson D, Figlewicz DA, Sapp P, Hentati A, Donaldson D, Goto J, O'Regan JP, Deng HX, .: Mutations in Cu/Zn superoxide dismutase gene are associated with familial amyotrophic lateral sclerosis. Nature 4-3-1993;362:59-62.

[106] Gurney ME, Pu H, Chiu AY, Dal Canto MC, Polchow CY, Alexander DD, Caliendo J, Hentati A, Kwon YW, Deng HX, .: Motor neuron degeneration in mice that express a human Cu,Zn superoxide dismutase mutation. Science 17-6-1994;264:1772-1775.

[107] Gurney ME: Transgenic-mouse model of amyotrophic lateral sclerosis. N Engl J Med 22-12-1994;331:1721-1722.

[108] Papadimitriou D, Le V, V, Jacquier A, Ikiz B, Przedborski S, Re DB: Inflammation in ALS and SMA: sorting out the good from the evil. Neurobiol Dis 2010;37:493-502.

[109] Matzinger P: Tolerance, danger, and the extended family. Annu Rev Immunol 1994;12:991-1045.

[110] Zhang Q, Raoof M, Chen Y, Sumi Y, Sursal T, Junger W, Brohi K, Itagaki K, Hauser CJ: Circulating mitochondrial DAMPs cause inflammatory responses to injury. Nature 4-3-2010;464:104-107.

[111] McGeer PL, McGeer EG, Kawamata T, Yamada T, Akiyama H: Reactions of the immune system in chronic degenerative neurological diseases. Can J Neurol Sci 1991;18:376-379.

[112] Engelhardt JI, Tajti J, Appel SH: Lymphocytic infiltrates in the spinal cord in amyotrophic lateral sclerosis. Arch Neurol 1993;50:30-36.

[113] McGeer PL, McGeer EG: Inflammatory processes in amyotrophic lateral sclerosis. Muscle Nerve 2002;26:459-470.

[114] Zhang R, Hadlock KG, Do H, Yu S, Honrada R, Champion S, Forshew D, Madison C, Katz J, Miller RG, McGrath MS: Gene expression profiling in peripheral blood mononuclear cells from patients with sporadic amyotrophic lateral sclerosis (sALS). J Neuroimmunol 2011;230:114-123.

[115] Graves MC, Fiala M, Dinglasan LA, Liu NQ, Sayre J, Chiappelli F, van KC, Vinters HV: Inflammation in amyotrophic lateral sclerosis spinal cord and brain is mediated by activated macrophages, mast cells and T cells. Amyotroph Lateral Scler Other Motor Neuron Disord 2004;5:213-219.

[116] Lawson JM, Tremble J, Dayan C, Beyan H, Leslie RD, Peakman M, Tree TI: Increased resistance to CD4+CD25hi regulatory T cell-mediated suppression in patients with type 1 diabetes. Clin Exp Immunol 2008;154:353-359.

[117] Holmoy T, Roos PM, Kvale EO: ALS: cytokine profile in cerebrospinal fluid T-cell clones. Amyotroph Lateral Scler 2006;7:183-186.

[118] Engelhardt JI, Appel SH: IgG reactivity in the spinal cord and motor cortex in amyotrophic lateral sclerosis. Arch Neurol 1990;47:1210-1216.

[119] Saleh IA, Zesiewicz T, Xie Y, Sullivan KL, Miller AM, Kuzmin-Nichols N, Sanberg PR, Garbuzova-Davis S: Evaluation of humoral immune response in adaptive immunity in ALS patients during disease progression. J Neuroimmunol 30-10-2009;215:96-101.

[120] Donnenfeld H, Kascsak RJ, Bartfeld H: Deposits of IgG and C3 in the spinal cord and motor cortex of ALS patients. J Neuroimmunol 1984;6:51-57.

[121] Zhang R, Gascon R, Miller RG, Gelinas DF, Mass J, Hadlock K, Jin X, Reis J, Narvaez A, McGrath MS: Evidence for systemic immune system alterations in sporadic amyotrophic lateral sclerosis (sALS). J Neuroimmunol 2005;159:215-224.

[122] Shi N, Kawano Y, Tateishi T, Kikuchi H, Osoegawa M, Ohyagi Y, Kira J: Increased IL-13-producing T cells in ALS: positive correlations with disease severity and progression rate. J Neuroimmunol 2007;182:232-235.

[123] Fiala M, Chattopadhay M, La CA, Tse E, Liu G, Lourenco E, Eskin A, Liu PT, Magpantay L, Tse S, Mahanian M, Weitzman R, Tong J, Nguyen C, Cho T, Koo P, Sayre J, Martinez-Maza O, Rosenthal MJ, Wiedau-Pazos M: IL-17A is increased in the serum and in spinal cord CD8 and mast cells of ALS patients. J Neuroinflammation 2010;7:76.

[124] Kuhle J, Lindberg RL, Regeniter A, Mehling M, Steck AJ, Kappos L, Czaplinski A: Increased levels of inflammatory chemokines in amyotrophic lateral sclerosis. Eur J Neurol 2009;16:771-774.

[125] Sta M, Sylva-Steenland RM, Casula M, de Jong JM, Troost D, Aronica E, Baas F: Innate and adaptive immunity in amyotrophic lateral sclerosis: evidence of complement activation. Neurobiol Dis 2011;42:211-220.

[126] Lobsiger CS, Boillee S, Cleveland DW: Toxicity from different SOD1 mutants dysregulates the complement system and the neuronal regenerative response in ALS motor neurons. Proc Natl Acad Sci U S A 1-5-2007;104:7319-7326.

[127] Ferraiuolo L, Heath PR, Holden H, Kasher P, Kirby J, Shaw PJ: Microarray analysis of the cellular pathways involved in the adaptation to and progression of motor neuron injury in the SOD1 G93A mouse model of familial ALS. J Neurosci 22-8-2007;27:9201-9219.

[128] Woodruff TM, Costantini KJ, Taylor SM, Noakes PG: Role of complement in motor neuron disease: animal models and therapeutic potential of complement inhibitors. Adv Exp Med Biol 2008;632:143-158.

[129] Humayun S, Gohar M, Volkening K, Moisse K, Leystra-Lantz C, Mepham J, McLean J, Strong MJ: The complement factor C5a receptor is upregulated in NFL-/- mouse motor neurons. J Neuroimmunol 29-5-2009;210:52-62.

[130] Lee JD, Kamaruzaman NA, Fung JN, Taylor SM, Turner BJ, Atkin JD, Woodruff TM, Noakes PG: Dysregulation of the complement cascade in the hSOD1G93A transgenic mouse model of amyotrophic lateral sclerosis. J Neuroinflammation 2013;10:119.

[131] Fischer LR, Culver DG, Tennant P, Davis AA, Wang M, Castellano-Sanchez A, Khan J, Polak MA, Glass JD: Amyotrophic lateral sclerosis is a distal axonopathy: evidence in mice and man. Exp Neurol 2004;185:232-240.

[132] Glass JD: Wallerian degeneration as a window to peripheral neuropathy. J Neurol Sci 15-5-2004;220:123-124.

Maria (87) woont al veertig jaar vlakbij het ziekenhuis. Sinds de introductie van de

multi-drug therapie (een cocktail van antibiotica) in de jaren tachtig kan lepra

genezen worden. Helaas kwam voor Maria de medicatie te laat. ‘Mijn handen werden

steeds slechter. Mijn been raakte ontstoken en moest geamputeerd worden. Het is

zo moeilijk als ik bedenk hoe gezond ik vroeger was.’

Leprastichting / Netherlands Leprosy Relief (NLR) Fondsenwerving & Voorlichting

M. leprae components induce nerve damage by complement


complement activator

Nawal Bahia El Idrissi 1, Pranab K. Das 2,3,4, Kees Fluiter 1, Patricia S. Rosa4, Jeroen

Vreijling1, Dirk Troost 2, B. Paul Morgan 5, Frank Baas 1 and Valeria Ramaglia 1

Acta Neuropathologica, 2015 May.

1 Department of Genome Analysis and 2 Department of Neuropathology, Academic Medical

Center, Amsterdam, The Netherlands; 3 Department of Clinical Immunology, Colleges of

Medical and Dental Sciences, University of Birmingham, Birmingham,United Kingdom; 4

Instituto Lauro de Souza Lima, Bauru, Sao Paulo, Brazil; 5 Institute of Infection and Immunity,

School of Medicine, Cardiff University, Cardiff, United Kingdom.

Maria (87) woont al veertig jaar vlakbij het ziekenhuis. Sinds de introductie van de

multi-drug therapie (een cocktail van antibiotica) in de jaren tachtig kan lepra

genezen worden. Helaas kwam voor Maria de medicatie te laat. ‘Mijn handen werden

steeds slechter. Mijn been raakte ontstoken en moest geamputeerd worden. Het is

zo moeilijk als ik bedenk hoe gezond ik vroeger was.’


M. leprae components induce nerve damage by complement


complement activator

Nawal Bahia El Idrissi 1, Pranab K. Das 2,3,4, Kees Fluiter 1, Patricia S. Rosa4, Jeroen

Vreijling1, Dirk Troost 2, B. Paul Morgan 5, Frank Baas 1 and Valeria Ramaglia 1

Acta Neuropathologica, 2015 May.


Center, Amsterdam, The Netherlands; 3 Department of Clinical Immunology, Colleges of

Medical and Dental Sciences, University of Birmingham, Birmingham,United Kingdom; 4

Instituto Lauro de Souza Lima, Bauru, Sao Paulo, Brazil; 5 Institute of Infection and Immunity,

School of Medicine, Cardiff University, Cardiff, United Kingdom. 2

Chapter 2

44

Abstract

Peripheral nerve damage is the hallmark of leprosy pathology but its etiology is

unclear. We previously identified the membrane attack complex (MAC) of the

complement system as a key determinant of post-traumatic nerve damage and

demonstrated that its inhibition is neuroprotective. Here, we determined the

contribution of the MAC to nerve damage caused by M. leprae and its components in

mouse. Furthermore, we studied the association between MAC and the key M.

leprae component lipoarabinomannan (LAM) in nerve biopsies of leprosy patients.

Intraneural injections of M. leprae sonicate induced MAC deposition and pathological

changes in the mouse nerve whereas MAC inhibition preserved myelin and axons.

Complement activation occurred mainly via the lectin pathway and the principal

activator was LAM. In leprosy nerves, the extent of LAM and MAC immunoreactivity

was robust and significantly higher in multibacillary compared to paucibacillary

donors (p=0.01 and p=0.001, respectively), with a highly significant association

between LAM and MAC in the diseased samples (r=0.9601, p=0.0001). Further,

MAC co-localized with LAM on axons, pointing to a role for this M. leprae antigen in

complement activation and nerve damage in leprosy. Our findings demonstrate that

MAC contributes to nerve damage in a model of M. leprae-induced nerve injury and

its inhibition is neuroprotective. In addition, our data identified LAM as the key

pathogen associated molecule that activates complement and causes nerve damage.

Taken together our data imply an important role of complement in nerve damage in

leprosy and may inform the development of novel therapeutics for patients.

Keywords. Leprosy, complement, neuropathy, therapy

Introduction

Leprosy is one of the earliest recorded human infectious diseases. To date, infection

with Mycobacterium leprae (M. leprae) remains the leading cause of infectious

neuropathy and disabilities. Despite effective multidrug therapy (MDT), leprosy is still

endemic in several parts of the world, especially in Brazil and India. The majority of

the infected population remains healthy whereas a subset of infected individuals

develop clinical symptoms, which are associated with host immunity to the bacilli.

The manifestation of the disease displays a broad clinical, histopathological and

immunological spectrum, with tuberculoid (TT) and lepromatous (LL) forms at the two

poles, and with several intermediate forms including borderline tuberculoid (BT),

borderline borderline (BB) and borderline lepromatous (BL) [14]. The BT and TT are

paucibacillary (PB) whereas LL, BL and BB are multibacillary (MB). PB patients show

a strong T-cell-mediated immunity to M. leprae, whereas MB patients show a M.

leprae-specific cell-mediated response anergy but mount an antibody response,

which results in extensive diffuse bacilli-laden skin lesions. In addition to the above

described spectrum of the disease, a percentage of patients, particularly those in the

borderline groups during treatment, develop two types of reactions due to changes in

their pathogen-specific immune status; type 1 or reversal reaction (RR) and type 2 or

erythema nodusum leprosum (ENL). The RR is due to the increased pathogen-


ENL is seen in BL and LL patients and are thought to be immune complex-mediated

[5].

Histologically, skin lesions of paucibacillary patients show T-cell infiltrates and

epitheloid giant cells, whereas those of multibacillary patients show a paucity of T-

2

C6 inhibition in nerve damage in leprosy

45

Abstract

Peripheral nerve damage is the hallmark of leprosy pathology but its etiology is

unclear. We previously identified the membrane attack complex (MAC) of the

complement system as a key determinant of post-traumatic nerve damage and

demonstrated that its inhibition is neuroprotective. Here, we determined the

contribution of the MAC to nerve damage caused by M. leprae and its components in

mouse. Furthermore, we studied the association between MAC and the key M.

leprae component lipoarabinomannan (LAM) in nerve biopsies of leprosy patients.

Intraneural injections of M. leprae sonicate induced MAC deposition and pathological

changes in the mouse nerve whereas MAC inhibition preserved myelin and axons.

Complement activation occurred mainly via the lectin pathway and the principal

activator was LAM. In leprosy nerves, the extent of LAM and MAC immunoreactivity

was robust and significantly higher in multibacillary compared to paucibacillary

donors (p=0.01 and p=0.001, respectively), with a highly significant association

between LAM and MAC in the diseased samples (r=0.9601, p=0.0001). Further,

MAC co-localized with LAM on axons, pointing to a role for this M. leprae antigen in

complement activation and nerve damage in leprosy. Our findings demonstrate that

MAC contributes to nerve damage in a model of M. leprae-induced nerve injury and

its inhibition is neuroprotective. In addition, our data identified LAM as the key

pathogen associated molecule that activates complement and causes nerve damage.

Taken together our data imply an important role of complement in nerve damage in

leprosy and may inform the development of novel therapeutics for patients.

Keywords. Leprosy, complement, neuropathy, therapy

Introduction

Leprosy is one of the earliest recorded human infectious diseases. To date, infection

with Mycobacterium leprae (M. leprae) remains the leading cause of infectious

neuropathy and disabilities. Despite effective multidrug therapy (MDT), leprosy is still

endemic in several parts of the world, especially in Brazil and India. The majority of

the infected population remains healthy whereas a subset of infected individuals

develop clinical symptoms, which are associated with host immunity to the bacilli.

The manifestation of the disease displays a broad clinical, histopathological and

immunological spectrum, with tuberculoid (TT) and lepromatous (LL) forms at the two

poles, and with several intermediate forms including borderline tuberculoid (BT),

borderline borderline (BB) and borderline lepromatous (BL) [14]. The BT and TT are

paucibacillary (PB) whereas LL, BL and BB are multibacillary (MB). PB patients show

a strong T-cell-mediated immunity to M. leprae, whereas MB patients show a M.

leprae-specific cell-mediated response anergy but mount an antibody response,

which results in extensive diffuse bacilli-laden skin lesions. In addition to the above

described spectrum of the disease, a percentage of patients, particularly those in the

borderline groups during treatment, develop two types of reactions due to changes in

their pathogen-specific immune status; type 1 or reversal reaction (RR) and type 2 or

erythema nodusum leprosum (ENL). The RR is due to the increased pathogen-


ENL is seen in BL and LL patients and are thought to be immune complex-mediated

[5].

Histologically, skin lesions of paucibacillary patients show T-cell infiltrates and

epitheloid giant cells, whereas those of multibacillary patients show a paucity of T-

Chapter 2

46

cells and the accumulation of bacilli laden macrophages. The major pathological

hallmark of M. leprae infection across the entire disease spectrum is nerve damage.

Nerve damage in leprosy is almost exclusively studied in late disease stages; no

published study describes nerve changes at the early stages of the disease.

However, epidemiological surveys in endemic areas reported that nerve damage

occurs even among the non-diseased leprosy contacts [19], suggesting that nerve

damage might commence long before the disease manifests as skin lesions. Indeed,

the natural affinity of M. leprae for nerve, particularly for Schwann cells, makes it

likely that nerve damage starts at a very early stage of infection. However, the

mechanisms underlying nerve damage in early disease remain to be elucidated.

Understanding the molecular and immunological mechanisms of M. leprae-induced

nerve damage is a necessary step in the management of leprosy to prevent

progression of the infection into an extensive neuropathic condition.

Previous studies in animal models induced by direct interaction of M. leprae with

nerves have shown that myelin loss and axonal damage can occur in M. leprae

infection, even in the absence of a functional adaptive immune system[13, 17].

Although the adaptive immune response plays a critical role in the clinical

manifestation of the disease, the identification of an adaptive immunity-independent

myelin loss suggests the existence of additional mechanisms. We have previously

identified an important role of the complement system in myelin loss and axonal

injury of the peripheral nerve after acute trauma [9]. The complement system is a key

component of the host defense against pathogens but uncontrolled or excessive

activation can cause damage to the host. Complement activation can occur via the

recognition of antigen-antibody complexes (classical pathway), foreign surfaces

(alternative pathway) or bacterial sugars (lectin pathway). Regardless of the trigger,

activation results in the cleavage of C3, followed by cleavage of C5 and formation of

the membrane attack complex (MAC), which forms pores in the cell membrane

resulting in lysis of the target cell. Because activated complement components are

soluble and can drift from their site of activation to adjacent areas, MAC can damage

adjacent healthy tissue and enhance inflammation [22, 23]. We have shown that

formation of the MAC contributes to early clearance of myelin proteins and to axonal

damage after traumatic injury of the peripheral nerve [9, 11], while inhibition of MAC

formation reduces nerve damage [10] and improves regeneration and functional

recovery [12].

Our hypothesis is that complement, specifically the MAC, may play an important role

in nerve damage in leprosy. This hypothesis is substantiated by pathological studies

which reported MAC deposits on damaged nerves of LL but not TT leprosy patients

[8], pointing to the possibility that complement, and specifically the MAC, plays a role

as disease modifier in leprosy. In addition, significant serum complement

consumption by M. leprae was also reported [4].

In this study, we injected M. leprae or its components into the mouse sciatic nerve to

induce nerve injury. This model does not recapitulate M. leprae-induced neuropathy

in man. However, it is a good model to study M. leprae-induced loss of axonal

components and focal loss of myelin, which we define as nerve damage in this study.

Since, we made use of nude mice (NMRI-Foxn1nu), which lack functional T and B

lymphocytes, we can study the direct role of complement in M. leprae-induced nerve

damage in the absence of a cellular adaptive immune response. In a first experiment,

we demonstrated that M. leprae sonicate and its components, particularly

lipoarabinomannan (LAM), induce complement activation, which results in MAC

deposition, myelin loss and axonal damage of the mouse sciatic nerve. In a second

2


47

cells and the accumulation of bacilli laden macrophages. The major pathological

hallmark of M. leprae infection across the entire disease spectrum is nerve damage.

Nerve damage in leprosy is almost exclusively studied in late disease stages; no

published study describes nerve changes at the early stages of the disease.

However, epidemiological surveys in endemic areas reported that nerve damage

occurs even among the non-diseased leprosy contacts [19], suggesting that nerve

damage might commence long before the disease manifests as skin lesions. Indeed,

the natural affinity of M. leprae for nerve, particularly for Schwann cells, makes it

likely that nerve damage starts at a very early stage of infection. However, the

mechanisms underlying nerve damage in early disease remain to be elucidated.

Understanding the molecular and immunological mechanisms of M. leprae-induced

nerve damage is a necessary step in the management of leprosy to prevent

progression of the infection into an extensive neuropathic condition.

Previous studies in animal models induced by direct interaction of M. leprae with

nerves have shown that myelin loss and axonal damage can occur in M. leprae

infection, even in the absence of a functional adaptive immune system[13, 17].

Although the adaptive immune response plays a critical role in the clinical

manifestation of the disease, the identification of an adaptive immunity-independent

myelin loss suggests the existence of additional mechanisms. We have previously

identified an important role of the complement system in myelin loss and axonal

injury of the peripheral nerve after acute trauma [9]. The complement system is a key

component of the host defense against pathogens but uncontrolled or excessive

activation can cause damage to the host. Complement activation can occur via the

recognition of antigen-antibody complexes (classical pathway), foreign surfaces

(alternative pathway) or bacterial sugars (lectin pathway). Regardless of the trigger,

activation results in the cleavage of C3, followed by cleavage of C5 and formation of

the membrane attack complex (MAC), which forms pores in the cell membrane

resulting in lysis of the target cell. Because activated complement components are

soluble and can drift from their site of activation to adjacent areas, MAC can damage

adjacent healthy tissue and enhance inflammation [22, 23]. We have shown that

formation of the MAC contributes to early clearance of myelin proteins and to axonal

damage after traumatic injury of the peripheral nerve [9, 11], while inhibition of MAC

formation reduces nerve damage [10] and improves regeneration and functional

recovery [12].

Our hypothesis is that complement, specifically the MAC, may play an important role

in nerve damage in leprosy. This hypothesis is substantiated by pathological studies

which reported MAC deposits on damaged nerves of LL but not TT leprosy patients

[8], pointing to the possibility that complement, and specifically the MAC, plays a role

as disease modifier in leprosy. In addition, significant serum complement

consumption by M. leprae was also reported [4].

In this study, we injected M. leprae or its components into the mouse sciatic nerve to

induce nerve injury. This model does not recapitulate M. leprae-induced neuropathy

in man. However, it is a good model to study M. leprae-induced loss of axonal

components and focal loss of myelin, which we define as nerve damage in this study.

Since, we made use of nude mice (NMRI-Foxn1nu), which lack functional T and B

lymphocytes, we can study the direct role of complement in M. leprae-induced nerve

damage in the absence of a cellular adaptive immune response. In a first experiment,

we demonstrated that M. leprae sonicate and its components, particularly

lipoarabinomannan (LAM), induce complement activation, which results in MAC

deposition, myelin loss and axonal damage of the mouse sciatic nerve. In a second

Chapter 2

48

experiment we proved that, in this model, inhibition of MAC formation is

neuroprotective. In addition, we explored the extent of complement deposition,

including MAC, in a snap-shot of nerve biopsies from patients with full blown leprosy

at either of the two poles of the disease spectrum, showing an association between

the amount of MAC deposition and LAM immunoreactivity in nerves of leprosy

patients. Altogether, our findings strongly point to an important role of complement in

nerve damage in leprosy.

Materials and methods

Animals. Outbred nude (NMRI-Foxn1nu) mice were purchased from Charles River

(United Kingdom). The mice were housed under standard pathogen-free conditions

and allowed free access to food and water. Female mice, aged between 8 to 12

weeks, were used in all experiments and allowed to acclimatize for at least 1 week

prior to the experimental procedures. All experiments complied with national ethical

guidelines for the care of experimental animals.

Bacterial fractions. The following reagents were obtained through BEI Resources,

NIAID, NIH: Whole M. leprae sonicate and its fractions, including cell wall, cell

membrane, lipoarbinomannan (LAM) and phenolic glycolipid-1 (PGL-1), as well as M.

tuberculosis sonicate (see table S1). M. leprae was propagated in armadillos.

Both M. leprae and M. tuberculosis were made non-viable by gamma-irradiation

before sonication. Gamma-irradiated and sonicated M. leprae is referred to in the text

and figures as M. leprae or sonicated M. leprae. Gamma-irradiated and sonicated M.

tuberculosis is referred to in the text and figures as M. tuberculosis or sonicated M.

tuberculosis.

Intraneural injection of M. leprae sonicate or fractions. Surgical procedures were

performed under deep isoflurane anesthesia (2.5% vol isoflurane, 1 L/minute O2, and

1 L/minute N2O). For analgesia, Buprenorphine (0.1mg/kg, Temgesic®, Schering-

Plough, The Netherlands) was administered subcutaneously 30 minutes prior to the

surgery. The sciatic nerve was exposed via an incision in the thigh and injected

2


49

experiment we proved that, in this model, inhibition of MAC formation is

neuroprotective. In addition, we explored the extent of complement deposition,

including MAC, in a snap-shot of nerve biopsies from patients with full blown leprosy

at either of the two poles of the disease spectrum, showing an association between

the amount of MAC deposition and LAM immunoreactivity in nerves of leprosy

patients. Altogether, our findings strongly point to an important role of complement in

nerve damage in leprosy.


Animals. Outbred nude (NMRI-Foxn1nu) mice were purchased from Charles River

(United Kingdom). The mice were housed under standard pathogen-free conditions

and allowed free access to food and water. Female mice, aged between 8 to 12

weeks, were used in all experiments and allowed to acclimatize for at least 1 week

prior to the experimental procedures. All experiments complied with national ethical

guidelines for the care of experimental animals.

Bacterial fractions. The following reagents were obtained through BEI Resources,

NIAID, NIH: Whole M. leprae sonicate and its fractions, including cell wall, cell

membrane, lipoarbinomannan (LAM) and phenolic glycolipid-1 (PGL-1), as well as M.

tuberculosis sonicate (see table S1). M. leprae was propagated in armadillos.

Both M. leprae and M. tuberculosis were made non-viable by gamma-irradiation

before sonication. Gamma-irradiated and sonicated M. leprae is referred to in the text

and figures as M. leprae or sonicated M. leprae. Gamma-irradiated and sonicated M.

tuberculosis is referred to in the text and figures as M. tuberculosis or sonicated M.

tuberculosis.

Intraneural injection of M. leprae sonicate or fractions. Surgical procedures were

performed under deep isoflurane anesthesia (2.5% vol isoflurane, 1 L/minute O2, and

1 L/minute N2O). For analgesia, Buprenorphine (0.1mg/kg, Temgesic®, Schering-

Plough, The Netherlands) was administered subcutaneously 30 minutes prior to the

surgery. The sciatic nerve was exposed via an incision in the thigh and injected

Chapter 2

50

according to the procedure previously described by Rambukkana et al [13].

Importantly, this pin-prick injection by itself does not induce complement activation,

myelin loss or axonal damage. Specifically, a micro needle was used to inject the

sciatic nerve with a single dose of a solution containing 1 µg of either sonicated M.

leprae (n=10) or cell membrane (n=7) or LAM (n=5) in a volume of 5 µl. Intraneural

injections with equal volume of either phosphate buffer saline (PBS) (n=10) or

sonicated M. tuberculosis (n=4) were used as controls. In all experiments, the

contralateral nerve of each mouse was injected with PBS as internal control.

In addition, sciatic nerves from nude mice that did not receive intraneurial injection

were analyzed as controls for the PBS injections. We found no difference in axonal

density between non-injected and PBS-injected nerves (data not shown).

The injection site was marked by indian ink. The skin was sutured and the mice were

allowed to recover. At 3 days post-intraneural injections, mice were deeply

anaesthetized. Blood and liver biopsies were collected for serum analysis and qPCR

analysis, respectively. All mice were then euthanized by intracardial perfusion with

PBS followed by formalin. The sciatic nerves were collected and post-fixed in

formalin for 1 week at 4 ºC before they were processed in paraffin for histology,

according to standard procedures.

Mouse tissue preparation and immunohistochemistry. Paraffin-embedded nerves

were sectioned at a thickness of 6 µm for the entire length of the nerve, including the

site of injection, and mounted on glass slides. Up to 4000 sections per nerve were

cut. Three adjacent sections of every 10 were selected and stained for hematoxylin

and eosin (H&E) and scored by two independent investigators (NBEI and VR) for

damage and accumulation of immune cells. Immunohistochemistry for PGL-1 and/or

LAM was used to locate the site of injection in the nerves. Seventy to 80 sections per

sciatic nerve were further analyzed by immunohistochemistry to evaluate the axonal,

myelin and Schwann cell damage as well as MAC deposition and the extent of

endoneurial accumulation of macrophages.

For the immunohistochemistry, sections were deparaffinated and rehydrated. The

endogenous peroxidase activity was blocked with 0.3 % H2O2 in methanol for 20

minutes at room temperature. Epitopes were exposed by heat-induced antigen

retrieval, in either 10mM sodium citrate buffer (pH 6.0) or 10mM Tris 1mM EDTA

buffer (pH 9.0) depending on the primary antibody used (see table S2). Aspecific

binding of antibodies was blocked using 10% normal goat serum (DAKO, Heverlee,

Belgium) in PBS for 30 minutes at room temperature. Primary antibodies were diluted

in Normal Antibody Diluent (Immunologic, Duiven, The Netherlands) and incubated

for 1 hour at room temperature. Detection was performed by incubating the sections

in the secondary Poly-HRP-Goat anti Mouse/Rabbit/Rat IgG (Brightvision

Immunologic, Duiven, The Netherlands) antibody diluted 1:1 in PBS for 30 minutes at

room temperature followed by incubation in 3,3- diaminobenzidine tetrahydrochloride

(DAB; Vector Laboratories, Burlingame, CA) as chromogen and counterstaining with

hematoxylin for 5 minutes. Sections stained with secondary antibody alone were

included as negative controls with each test. After dehydration, slides were mounted

in Pertex (Histolab, Gothenburg, Sweden). Images were captured with a light

microscope (BX41TF; Olympus,Center Valley, PA) using the Cell D software

(Olympus).

For immunofluorescence, the primary antibodies raised in rabbit (see table S2) were

detected with FITC (green, 488nm)-conjugated goat anti-rabbit IgG (Sigma-Aldrich,

2


51

according to the procedure previously described by Rambukkana et al [13].

Importantly, this pin-prick injection by itself does not induce complement activation,

myelin loss or axonal damage. Specifically, a micro needle was used to inject the

sciatic nerve with a single dose of a solution containing 1 µg of either sonicated M.

leprae (n=10) or cell membrane (n=7) or LAM (n=5) in a volume of 5 µl. Intraneural

injections with equal volume of either phosphate buffer saline (PBS) (n=10) or

sonicated M. tuberculosis (n=4) were used as controls. In all experiments, the

contralateral nerve of each mouse was injected with PBS as internal control.

In addition, sciatic nerves from nude mice that did not receive intraneurial injection

were analyzed as controls for the PBS injections. We found no difference in axonal

density between non-injected and PBS-injected nerves (data not shown).

The injection site was marked by indian ink. The skin was sutured and the mice were

allowed to recover. At 3 days post-intraneural injections, mice were deeply

anaesthetized. Blood and liver biopsies were collected for serum analysis and qPCR

analysis, respectively. All mice were then euthanized by intracardial perfusion with

PBS followed by formalin. The sciatic nerves were collected and post-fixed in

formalin for 1 week at 4 ºC before they were processed in paraffin for histology,

according to standard procedures.

Mouse tissue preparation and immunohistochemistry. Paraffin-embedded nerves

were sectioned at a thickness of 6 µm for the entire length of the nerve, including the

site of injection, and mounted on glass slides. Up to 4000 sections per nerve were

cut. Three adjacent sections of every 10 were selected and stained for hematoxylin

and eosin (H&E) and scored by two independent investigators (NBEI and VR) for

damage and accumulation of immune cells. Immunohistochemistry for PGL-1 and/or

LAM was used to locate the site of injection in the nerves. Seventy to 80 sections per

sciatic nerve were further analyzed by immunohistochemistry to evaluate the axonal,

myelin and Schwann cell damage as well as MAC deposition and the extent of

endoneurial accumulation of macrophages.

For the immunohistochemistry, sections were deparaffinated and rehydrated. The

endogenous peroxidase activity was blocked with 0.3 % H2O2 in methanol for 20

minutes at room temperature. Epitopes were exposed by heat-induced antigen

retrieval, in either 10mM sodium citrate buffer (pH 6.0) or 10mM Tris 1mM EDTA

buffer (pH 9.0) depending on the primary antibody used (see table S2). Aspecific

binding of antibodies was blocked using 10% normal goat serum (DAKO, Heverlee,

Belgium) in PBS for 30 minutes at room temperature. Primary antibodies were diluted

in Normal Antibody Diluent (Immunologic, Duiven, The Netherlands) and incubated

for 1 hour at room temperature. Detection was performed by incubating the sections

in the secondary Poly-HRP-Goat anti Mouse/Rabbit/Rat IgG (Brightvision

Immunologic, Duiven, The Netherlands) antibody diluted 1:1 in PBS for 30 minutes at

room temperature followed by incubation in 3,3- diaminobenzidine tetrahydrochloride

(DAB; Vector Laboratories, Burlingame, CA) as chromogen and counterstaining with

hematoxylin for 5 minutes. Sections stained with secondary antibody alone were

included as negative controls with each test. After dehydration, slides were mounted

in Pertex (Histolab, Gothenburg, Sweden). Images were captured with a light

microscope (BX41TF; Olympus,Center Valley, PA) using the Cell D software

(Olympus).

For immunofluorescence, the primary antibodies raised in rabbit (see table S2) were

detected with FITC (green, 488nm)-conjugated goat anti-rabbit IgG (Sigma-Aldrich,

Chapter 2

52

Saint Louis, MI) and the primary antibodies raised in mouse were detected with Cy3

(red, 560nm)–conjugated goat anti-mouse IgG (Sigma-Aldrich, Saint Louis, MI).

Sections were counterstained with 4.6-diamidine-2-phenylindole dihydrochloride

(DAPI, Sigma-Aldrich) (blue, 280nm), air dried and mounted in Vectashield (Vector,

Burlingame, CA). Images were captured with a digital camera (DFC500; Leica) on a

fluorescence microscope (DM LB2; Leica, Wetzlar, Germany). .

Measurement of human serum complement consumption by M. leprae. Blood

from healthy volunteers was collected by venepuncture and allowed to clot on ice.

The serum was separated by centrifugation at 5000 x g at 4ºC for 10 minutes and

assayed immediately. 50 µl of serum was incubated with equal volume of either

whole M. leprae sonicate (1x109 cells), referred to in the text and figures as M.

leprae, or PBS as control, for 1 hour at 37 ºC. In the subsequent step, residual

human complement activity was tested in triplicate by hemolytic assay according to

standard procedures [7, 15].

ELISA for fluid-phase terminal complement complex (TCC). Enzyme-linked

immunosorbent assay (ELISA) for TCC, was performed on Microlon high-affinity

binding plates (Greiner bio one, Frickenhausen, Germany) coated with 2.5µg of

either M. leprae, cell wall, cell membrane, LAM or PGL-1 in carbonate buffer (pH 9.6)

overnight at 4ºC. Nonspecific binding was blocked with 10% bovine serum albumin

(BSA) (pH 7.4) for 1 hour at room temperature. After washing with 0.05% Tween in

PBS, the wells were incubated with 10% fresh normal human serum (NHS) in dilution

buffer (4mM barbital, 145mM NaCl, 2mM CaCl2, 1 mM MgCl2, 0.3% BSA, 0.02%

Tween20) for 1 hour at 37ºC. After washing, TCC was detected by incubation with a

mouse anti-human C5b-9neo monoclonal antibody (aE11 clone, DAKO) (1:100 in

dilution buffer). The wells were washed and then incubated with the polyclonal goat

anti-mouse Ig HRPO-conjugate (DAKO) (1:2000 in dilution buffer) for 1 hour at room

temperature. Plates were developed using tetramethylbenzidine (TMB) as substrate

and the reaction was stopped using 1M H2SO4. The absorbance was measured at

450 nm. The signals were corrected for background by subtracting the absorbance of

the controls.

Identification of complement pathways activated by M. leprae. Neutralizing anti-

C1q antibody (anti-C1q-85, Sanquin, Amsterdam, The Netherlands) (50 µg/ml),

which inhibits the classical pathway of complement, or C1 inhibitor (C1inh; Cetor,

Sanquin) (1 µg/µl), which blocks activation of both the classical and lectin pathways,

were pre-incubated with 10% fresh human serum in dilution buffer for 15 minutes at

37ºC. Mannose-binding lectin (MBL) deficient serum (10% in dilution buffer) was

used as control for lectin pathway activation. Fresh serum pre-incubated with either

BSA or EDTA was used as controls. All sera were assayed for M. leprae-mediated

generation of TCC by ELISA as described above. Microlon high-affinity binding plates

(Greiner bio one) were coated with 2.5 µg of M. leprae in carbonate buffer (pH 9.6)

overnight at 4ºC. Coating of the wells with either 1 µg mannan (Sigma, M7504) or

1µg IgG1,2,3,4 (Gammaquin 160 g/l, Sanquin) were included as controls. Blocking of

nonspecific binding sites, detection of the TCC and development of the enzymatic

HRP reaction were performed as described above. The signals were corrected for

background by subtracting the absorbance of the controls.

2


53

Saint Louis, MI) and the primary antibodies raised in mouse were detected with Cy3

(red, 560nm)–conjugated goat anti-mouse IgG (Sigma-Aldrich, Saint Louis, MI).

Sections were counterstained with 4.6-diamidine-2-phenylindole dihydrochloride

(DAPI, Sigma-Aldrich) (blue, 280nm), air dried and mounted in Vectashield (Vector,

Burlingame, CA). Images were captured with a digital camera (DFC500; Leica) on a

fluorescence microscope (DM LB2; Leica, Wetzlar, Germany). .

Measurement of human serum complement consumption by M. leprae. Blood

from healthy volunteers was collected by venepuncture and allowed to clot on ice.

The serum was separated by centrifugation at 5000 x g at 4ºC for 10 minutes and

assayed immediately. 50 µl of serum was incubated with equal volume of either

whole M. leprae sonicate (1x109 cells), referred to in the text and figures as M.

leprae, or PBS as control, for 1 hour at 37 ºC. In the subsequent step, residual

human complement activity was tested in triplicate by hemolytic assay according to

standard procedures [7, 15].

ELISA for fluid-phase terminal complement complex (TCC). Enzyme-linked

immunosorbent assay (ELISA) for TCC, was performed on Microlon high-affinity

binding plates (Greiner bio one, Frickenhausen, Germany) coated with 2.5µg of

either M. leprae, cell wall, cell membrane, LAM or PGL-1 in carbonate buffer (pH 9.6)

overnight at 4ºC. Nonspecific binding was blocked with 10% bovine serum albumin

(BSA) (pH 7.4) for 1 hour at room temperature. After washing with 0.05% Tween in

PBS, the wells were incubated with 10% fresh normal human serum (NHS) in dilution

buffer (4mM barbital, 145mM NaCl, 2mM CaCl2, 1 mM MgCl2, 0.3% BSA, 0.02%

Tween20) for 1 hour at 37ºC. After washing, TCC was detected by incubation with a

mouse anti-human C5b-9neo monoclonal antibody (aE11 clone, DAKO) (1:100 in

dilution buffer). The wells were washed and then incubated with the polyclonal goat

anti-mouse Ig HRPO-conjugate (DAKO) (1:2000 in dilution buffer) for 1 hour at room

temperature. Plates were developed using tetramethylbenzidine (TMB) as substrate

and the reaction was stopped using 1M H2SO4. The absorbance was measured at

450 nm. The signals were corrected for background by subtracting the absorbance of

the controls.

Identification of complement pathways activated by M. leprae. Neutralizing anti-

C1q antibody (anti-C1q-85, Sanquin, Amsterdam, The Netherlands) (50 µg/ml),

which inhibits the classical pathway of complement, or C1 inhibitor (C1inh; Cetor,

Sanquin) (1 µg/µl), which blocks activation of both the classical and lectin pathways,

were pre-incubated with 10% fresh human serum in dilution buffer for 15 minutes at

37ºC. Mannose-binding lectin (MBL) deficient serum (10% in dilution buffer) was

used as control for lectin pathway activation. Fresh serum pre-incubated with either

BSA or EDTA was used as controls. All sera were assayed for M. leprae-mediated

generation of TCC by ELISA as described above. Microlon high-affinity binding plates

(Greiner bio one) were coated with 2.5 µg of M. leprae in carbonate buffer (pH 9.6)

overnight at 4ºC. Coating of the wells with either 1 µg mannan (Sigma, M7504) or

1µg IgG1,2,3,4 (Gammaquin 160 g/l, Sanquin) were included as controls. Blocking of

nonspecific binding sites, detection of the TCC and development of the enzymatic

HRP reaction were performed as described above. The signals were corrected for

background by subtracting the absorbance of the controls.

Chapter 2

54

C6 antisense oligonucleotide synthesis. The C6 Locked Nucleic Acid (LNA)

oligonucleotides were synthesized with phosphorothioate backbones and 5-methyl

cytosine residues (medC) by Ribotask (Odense, Denmark) on a Mermade 12™,

using 2g NittoPhase™ (BioAutomation, Irving, Texas). All oligonucleotides were

HPLC purified. C6 oligonucleotide (C6 LNA): 5’ A A C t t g c t g g g A A T 3’.

Mismatch control oligonucleotide (mismatch LNA): 5’ A T C t t c g c g t g a a T A A 3’.

LNA is shown in capital letters and DNA in lowercase.

Treatment with C6 antisense oligonucleotide. C6 antisense is a LNA-DNA based

gap-mer RNase H recruiting oligonucleotide that specifically targets the mRNA of C6,

resulting in the degradation of the mRNA thereby stopping the production of C6

protein, ultimately preventing MAC formation.

Mice were treated with either 5mg/kg of C6 antisense LNA oligonucleotide (n=5)

(referred to as C6 LNA) or scrambled mismatch antisense LNA oligonucleotide as

control (n=5) (referred to as mismatch LNA) administered by subcutaneous injections

for 4 consecutive days followed by 2 days of suspended treatment prior to intraneural

injection with M. leprae. At 3 days post-intraneural injections, blood, liver and sciatic

nerves were collected as described above.

qPCR for C6. RNA from the liver was isolated using Trizol according to the

instructions of the manufacturer (Invitrogen). cDNA was generated using oligo-dT

primer and SuperScriptII enzyme (Invitrogen). qPCR was performed using Universal

probe primers (Roche) and a Lightcycler 480 (Roche). Primers specific for C6 were

used (C6-forward 5’-CAGAGAAAAATGAACATTCCCATTA; C6-reverse 5’-

TTCTTGTGGGAAGCTTTAATGAC). Amplification of C6 mRNA was quantified using

LightCycler software (Roche Diagnostics). Values were normalized to Hypoxanthine-

guanine phosphoribosyltransferase mRNA (HPRT-forward 5’-

GGTCCATTCCTATGACTGTAGATTTT; HPRT-reverse 5’-

CAATCAAGACGTTCTTTCCAGTT). All reactions were done in quadruplicate and

qPCR conditions were as recommended by the manufacturer (Roche).

Human nerve biopsies. Sural or ulnar nerve biopsies (n=12) of leprosy patients with

multibacillary (MB, including BL and LL; n= 7) or paucibacillary (PB, including TT and

BT; n= 5) leprosy, classified according to the Ridley-Jopling scale [14], as well as 5

control nerve biopsies from Brazilian donors, were obtained at hospitalization at the

Instituto Lauro de Souza Lima, Bauru, Sao Paulo, Brazil according to diagnostic

procedures (Table S3). The nerve biopsies were chosen randomly from routine

pathology from patients with active disease (duration from 6-15 months) and

chronically inflamed tissues. The control biopsies were from non-leprosy individuals

with an unrelated peripheral nerve complaint requiring microsurgery. These

specimens were made available by Dr. Marcos Virmond and were found to be devoid

of any evidence of infection. Informed consent for the use of diagnostic tissue for

research purposes was obtained from the patients.

Briefly, the nerves were fixed in 10% formalin immediately after dissection and were

processed according to standard procedures for embedding in paraffin. Paraffin

section of 6 µm thickness were cut using a microtome and mounted on glass slides

for further pathological analysis. The immunohistochemistry on the human nerve

biopsies was performed essentially as described above for mouse tissue.

2


55

C6 antisense oligonucleotide synthesis. The C6 Locked Nucleic Acid (LNA)

oligonucleotides were synthesized with phosphorothioate backbones and 5-methyl

cytosine residues (medC) by Ribotask (Odense, Denmark) on a Mermade 12™,

using 2g NittoPhase™ (BioAutomation, Irving, Texas). All oligonucleotides were

HPLC purified. C6 oligonucleotide (C6 LNA): 5’ A A C t t g c t g g g A A T 3’.

Mismatch control oligonucleotide (mismatch LNA): 5’ A T C t t c g c g t g a a T A A 3’.

LNA is shown in capital letters and DNA in lowercase.

Treatment with C6 antisense oligonucleotide. C6 antisense is a LNA-DNA based

gap-mer RNase H recruiting oligonucleotide that specifically targets the mRNA of C6,

resulting in the degradation of the mRNA thereby stopping the production of C6

protein, ultimately preventing MAC formation.

Mice were treated with either 5mg/kg of C6 antisense LNA oligonucleotide (n=5)

(referred to as C6 LNA) or scrambled mismatch antisense LNA oligonucleotide as

control (n=5) (referred to as mismatch LNA) administered by subcutaneous injections

for 4 consecutive days followed by 2 days of suspended treatment prior to intraneural

injection with M. leprae. At 3 days post-intraneural injections, blood, liver and sciatic

nerves were collected as described above.

qPCR for C6. RNA from the liver was isolated using Trizol according to the






LightCycler software (Roche Diagnostics). Values were normalized to Hypoxanthine-

guanine phosphoribosyltransferase mRNA (HPRT-forward 5’-

GGTCCATTCCTATGACTGTAGATTTT; HPRT-reverse 5’-


qPCR conditions were as recommended by the manufacturer (Roche).

Human nerve biopsies. Sural or ulnar nerve biopsies (n=12) of leprosy patients with

multibacillary (MB, including BL and LL; n= 7) or paucibacillary (PB, including TT and

BT; n= 5) leprosy, classified according to the Ridley-Jopling scale [14], as well as 5

control nerve biopsies from Brazilian donors, were obtained at hospitalization at the

Instituto Lauro de Souza Lima, Bauru, Sao Paulo, Brazil according to diagnostic

procedures (Table S3). The nerve biopsies were chosen randomly from routine

pathology from patients with active disease (duration from 6-15 months) and

chronically inflamed tissues. The control biopsies were from non-leprosy individuals

with an unrelated peripheral nerve complaint requiring microsurgery. These

specimens were made available by Dr. Marcos Virmond and were found to be devoid

of any evidence of infection. Informed consent for the use of diagnostic tissue for

research purposes was obtained from the patients.

Briefly, the nerves were fixed in 10% formalin immediately after dissection and were

processed according to standard procedures for embedding in paraffin. Paraffin

section of 6 µm thickness were cut using a microtome and mounted on glass slides

for further pathological analysis. The immunohistochemistry on the human nerve

biopsies was performed essentially as described above for mouse tissue.

Chapter 2

56

Quantitative analysis of immunohistochemistry on mouse and human nerves.

All quantitative analyses of immunohistochemistry were performed with the Image

Pro Plus software version 7 (Media Cybernetics Europe, Marlow, UK) by blinded

investigators. Digital images of the immunostainings were captured with a light

microscope (BX41TF, Olympus) using the Cell D software (Olympus). Images of 20x

magnification, covering the complete nerve biopsy were quantified. The surface area

stained is expressed as percentage of total area examined. For the mouse nerves

error bars represent the standard deviation and for the human nerves error bars

indicate standard error of the mean.

Statistical analysis. Student’s t test was performed for statistical analysis comparing

two groups. For comparison of more than two groups One way ANOVA with

Bonferroni multiple comparison post-hoc test was used, changes were considered

statistically significant for p ≤ 0.05. For the correlation analysis we included a

selection of paucibacillary and multibacillary nerves for which serial sections stained

for LAM, MAC and C3d were available. Shapiro-Wilk normality test was performed

before using Pearson’s correlation, to determine whether the data was normally

distributed.

Results

M. leprae sonicate induces complement deposition and nerve damage in vivo

To determine whether M. leprae induces complement deposition and nerve damage

in vivo, sonicates of M. leprae or M. tuberculosis as a control mycobacterial species

were injected into the sciatic nerves of nude (NMRI-Foxn1nu) mice. The use of nude

mice, which lack functional T and B lymphocytes, allowed us to study the direct role

of complement in M. leprae-induced nerve damage in the absence of a cellular

adaptive immune response. Nerves were analyzed at 3 days post-injection.

Intraneural injection of whole M. leprae sonicate induced deposition of C9 (a marker

for MAC) at the site of injection (Fig. 1a) whereas injection of M. tuberculosis

sonicate did not (Fig. 1b), p=0.0008 (Fig, 1c). M. leprae-induced complement

activation was accompanied by axonal damage, as shown by the loss of

neurofilament staining in the M. leprae -injected (Fig.1d) but not in the M.tuberculosis

-injected nerves (Fig. 1e), p=0.01 (Fig. 1f). In the M. leprae-injected nerves, C9

deposition was found to localize on neurofilament–positive axons (Fig. 1g, arrows),

indicating that MAC attacks the axons in the M. leprae-injected nerve but not in the

M. tuberculosis-injected nerve (Fig. 1h), p=0.0003 (Fig. 1i). The C9 and

neurofilament expression in the M.leprae- injected nerves extended beyond the

injection site, some regions around the injection site show reduced neurofilament

staining and show no co-localization with C9 deposition (figure 1g, asterisk),

indicating that macrophages might already have cleared the debris.

The M. leprae injection also resulted in loss of immunoreactivity for myelin basic

protein (MBP) (Fig. 1j, asterisk), and loss of the S100β Schwann cell marker (Fig.

1m); these changes were not observed in M. tuberculosis-injected nerves (Fig. 1k, n),

2


57

Quantitative analysis of immunohistochemistry on mouse and human nerves.

All quantitative analyses of immunohistochemistry were performed with the Image

Pro Plus software version 7 (Media Cybernetics Europe, Marlow, UK) by blinded

investigators. Digital images of the immunostainings were captured with a light

microscope (BX41TF, Olympus) using the Cell D software (Olympus). Images of 20x

magnification, covering the complete nerve biopsy were quantified. The surface area

stained is expressed as percentage of total area examined. For the mouse nerves

error bars represent the standard deviation and for the human nerves error bars

indicate standard error of the mean.

Statistical analysis. Student’s t test was performed for statistical analysis comparing

two groups. For comparison of more than two groups One way ANOVA with

Bonferroni multiple comparison post-hoc test was used, changes were considered

statistically significant for p ≤ 0.05. For the correlation analysis we included a

selection of paucibacillary and multibacillary nerves for which serial sections stained

for LAM, MAC and C3d were available. Shapiro-Wilk normality test was performed

before using Pearson’s correlation, to determine whether the data was normally

distributed.

Results

M. leprae sonicate induces complement deposition and nerve damage in vivo

To determine whether M. leprae induces complement deposition and nerve damage

in vivo, sonicates of M. leprae or M. tuberculosis as a control mycobacterial species

were injected into the sciatic nerves of nude (NMRI-Foxn1nu) mice. The use of nude

mice, which lack functional T and B lymphocytes, allowed us to study the direct role

of complement in M. leprae-induced nerve damage in the absence of a cellular

adaptive immune response. Nerves were analyzed at 3 days post-injection.

Intraneural injection of whole M. leprae sonicate induced deposition of C9 (a marker

for MAC) at the site of injection (Fig. 1a) whereas injection of M. tuberculosis

sonicate did not (Fig. 1b), p=0.0008 (Fig, 1c). M. leprae-induced complement

activation was accompanied by axonal damage, as shown by the loss of

neurofilament staining in the M. leprae -injected (Fig.1d) but not in the M.tuberculosis

-injected nerves (Fig. 1e), p=0.01 (Fig. 1f). In the M. leprae-injected nerves, C9

deposition was found to localize on neurofilament–positive axons (Fig. 1g, arrows),

indicating that MAC attacks the axons in the M. leprae-injected nerve but not in the

M. tuberculosis-injected nerve (Fig. 1h), p=0.0003 (Fig. 1i). The C9 and

neurofilament expression in the M.leprae- injected nerves extended beyond the

injection site, some regions around the injection site show reduced neurofilament

staining and show no co-localization with C9 deposition (figure 1g, asterisk),

indicating that macrophages might already have cleared the debris.

The M. leprae injection also resulted in loss of immunoreactivity for myelin basic

protein (MBP) (Fig. 1j, asterisk), and loss of the S100β Schwann cell marker (Fig.

1m); these changes were not observed in M. tuberculosis-injected nerves (Fig. 1k, n),

Chapter 2

58

p=0.0001 (Fig. 1l, o). Further, accumulation of macrophages (Iba-1) at the site of

injection was observed in M. leprae-injected (Fig. 1p) but not in M. tuberculosis-

injected nerves (Fig. 1q), p=0.008 (Fig. 1r). To additionally control for the possibility

that the injection per se may induce nerve damage, the contra-lateral sciatic nerve of

each mouse was injected with PBS. These nerves showed no signs of axonal loss,

no loss of the myelin protein MBP, no loss of immunoreactivity for the S100β

Schwann cell marker and no deposition of C9 (data not shown). These data show

that the changes observed in the M. leprae-injected nerves are antigen-specific and

are not the result of the injection per se.

2


59

p=0.0001 (Fig. 1l, o). Further, accumulation of macrophages (Iba-1) at the site of

injection was observed in M. leprae-injected (Fig. 1p) but not in M. tuberculosis-

injected nerves (Fig. 1q), p=0.008 (Fig. 1r). To additionally control for the possibility

that the injection per se may induce nerve damage, the contra-lateral sciatic nerve of

each mouse was injected with PBS. These nerves showed no signs of axonal loss,

no loss of the myelin protein MBP, no loss of immunoreactivity for the S100β

Schwann cell marker and no deposition of C9 (data not shown). These data show

that the changes observed in the M. leprae-injected nerves are antigen-specific and

are not the result of the injection per se.

Chapter 2

60

Fig. 1 M. leprae induces complement deposition and nerve damage in vivo. Immunohistochemistry

and quantification for C9 detecting MAC (a-c), neurofilament detecting axons (c-f), co-localization of

MAC and axons (g-i), MBP detecting myelin (j-l), S100β detecting Schwann cells (m-o), or Iba-1

detecting macrophages (p-r) in cross sections of mouse sciatic nerves at 3 days post-injection with

either M. leprae (a, d, g, j, m, p) or M. tuberculosis (b, e, h, k, n, q), showing a significant higher

amount of MAC immunoreactivity (a, asterisk) (c, Student’s t-test: p=0.0008), axonal damage (d) and

loss (d, asterisk) (f, Student’s t-test: p=0.01), MAC deposited on axons (g, arrows) (i, Student’s t-test:

p=0.0003) and axonal debris (g, asterisk), myelin loss (j, asterisk) (l, Student’s t-test: p=0.0001), loss

of S100β expression on Schwann cells (m, asterisk) (o, Student’s t-test: p=0.0001) and accumulation

of macrophages (p, arrows) (r, Student’s t-test: p=0.008) in M. leprae-injected nerves compared to M.

tuberculosis-injected nerves where no MAC deposition and nerve damage was detected (b, e, h, k, n,

q). The arrow in (n) points to the normal moon-shaped appearance of S100β-positive Schwann cells.

The M. leprae component lipoarabinomannan (LAM) is a dominant complement

activator and induces nerve damage in vivo

To determine whether M. leprae sonicate is a direct activator of human complement,

we tested the capacity of M. leprae to induce complement consumption in normal

human serum (NHS). Complement consumption was measured in an antibody-

induced complement-mediated erythrocyte lysis assay [7]. Pre-incubation of NHS

with M. leprae significantly reduced haemolysis in this assay compared to PBS pre-

incubated controls (67% reduction; p=0.0001), suggesting that complement was

consumed by M. leprae (Fig. 2a). Pre-incubation of NHS with M. tuberculosis did not

significantly reduce haemolysis compared to PBS, indicating that M. tuberculosis

sonicate, unlike M. leprae, is not a strong activator of complement (Fig. 2a).

To confirm that reduction of haemolysis was the result of complement consumption

by M. leprae rather than inhibition of complement activation, we performed ELISA to

detect formation of the MAC in its soluble form, the terminal complement complex

(TCC), in human serum added to plates coated with M. leprae. In the same

experiment, we aimed to identify which complement pathway(s) are activated by M.

leprae by pre-incubating NHS with either the anti-C1q neutralizing antibody to block

the classical pathway or the C1 esterase-inhibitor (C1inh; Cetor), to block both the

classical and the lectin pathways. MBL-deficient (MBL-/-) serum was also used to test

for complement activation via the MBL-dependent lectin pathway. Both, the MBL-/-

serum and the C1inh-treated NHS on M. leprae showed a significant reduction in

TCC formation compared to NHS alone (respectively 57% and 65%, p=0.036 and

p=0.047); the anti-C1q antibody had no effect, suggesting that M. leprae activates

complement via the lectin pathway (Fig. 2b). As controls, we measured activation of

the classical and lectin pathways on mannan- or IgG1,2,3,4- coated plates,

2


61

Fig. 1 M. leprae induces complement deposition and nerve damage in vivo. Immunohistochemistry

and quantification for C9 detecting MAC (a-c), neurofilament detecting axons (c-f), co-localization of

MAC and axons (g-i), MBP detecting myelin (j-l), S100β detecting Schwann cells (m-o), or Iba-1

detecting macrophages (p-r) in cross sections of mouse sciatic nerves at 3 days post-injection with

either M. leprae (a, d, g, j, m, p) or M. tuberculosis (b, e, h, k, n, q), showing a significant higher

amount of MAC immunoreactivity (a, asterisk) (c, Student’s t-test: p=0.0008), axonal damage (d) and

loss (d, asterisk) (f, Student’s t-test: p=0.01), MAC deposited on axons (g, arrows) (i, Student’s t-test:

p=0.0003) and axonal debris (g, asterisk), myelin loss (j, asterisk) (l, Student’s t-test: p=0.0001), loss

of S100β expression on Schwann cells (m, asterisk) (o, Student’s t-test: p=0.0001) and accumulation

of macrophages (p, arrows) (r, Student’s t-test: p=0.008) in M. leprae-injected nerves compared to M.

tuberculosis-injected nerves where no MAC deposition and nerve damage was detected (b, e, h, k, n,

q). The arrow in (n) points to the normal moon-shaped appearance of S100β-positive Schwann cells.

The M. leprae component lipoarabinomannan (LAM) is a dominant complement

activator and induces nerve damage in vivo

To determine whether M. leprae sonicate is a direct activator of human complement,

we tested the capacity of M. leprae to induce complement consumption in normal

human serum (NHS). Complement consumption was measured in an antibody-

induced complement-mediated erythrocyte lysis assay [7]. Pre-incubation of NHS

with M. leprae significantly reduced haemolysis in this assay compared to PBS pre-

incubated controls (67% reduction; p=0.0001), suggesting that complement was

consumed by M. leprae (Fig. 2a). Pre-incubation of NHS with M. tuberculosis did not

significantly reduce haemolysis compared to PBS, indicating that M. tuberculosis

sonicate, unlike M. leprae, is not a strong activator of complement (Fig. 2a).

To confirm that reduction of haemolysis was the result of complement consumption

by M. leprae rather than inhibition of complement activation, we performed ELISA to

detect formation of the MAC in its soluble form, the terminal complement complex

(TCC), in human serum added to plates coated with M. leprae. In the same

experiment, we aimed to identify which complement pathway(s) are activated by M.

leprae by pre-incubating NHS with either the anti-C1q neutralizing antibody to block

the classical pathway or the C1 esterase-inhibitor (C1inh; Cetor), to block both the

classical and the lectin pathways. MBL-deficient (MBL-/-) serum was also used to test

for complement activation via the MBL-dependent lectin pathway. Both, the MBL-/-

serum and the C1inh-treated NHS on M. leprae showed a significant reduction in

TCC formation compared to NHS alone (respectively 57% and 65%, p=0.036 and

p=0.047); the anti-C1q antibody had no effect, suggesting that M. leprae activates

complement via the lectin pathway (Fig. 2b). As controls, we measured activation of

the classical and lectin pathways on mannan- or IgG1,2,3,4- coated plates,

Chapter 2

62

respectively. Mannan driven TCC formation was significantly reduced in MBL-/-serum

compared to MBL+/+ serum control (54% compared to the control, p=0.0001) (Fig.

S1a), while pre-incubation of NHS with the anti-C1q antibody showed significant

inhibition of IgG-triggered classical pathway activation and TCC formation (81%

compared to the control, p=0.0038, Fig. S1b).

To identify which components of M. leprae are responsible for activation of

complement, we performed TCC ELISA in NHS on plates coated with either whole M.

leprae sonicate, cell wall, cell membrane, PGL-1 or LAM. M. tuberculosis sonicate or

mannan were used as controls. We found that, except for PGL-1, all M. leprae

components examined induced TCC formation (Fig. 2c). LAM was a strong inducer,

resulting in TCC levels close to mannan control values (p=0.05). In line with the in

vivo data (Fig. 1a,b), also in this assay, M. tuberculosis did not induce TCC formation

(p=0.01, Fig. 2c). These in vitro data confirmed the in vivo observations that M.

leprae specifically activates the complement cascade. In addition, we found that LAM

is a dominant complement activator in vitro.

To determine whether the M. leprae fractions, that induced TCC formation in vitro

also caused MAC deposition and nerve damage in vivo, we injected the cell

membrane and the LAM fraction in the sciatic nerve of the nude mice and analyzed

and quantified the pathological changes at 3 days post-injection (Fig. 2d-w).

Intraneural injection of PBS was used as control. PBS caused no pathological

changes in the nerves (Fig. 2d, h, l, p, t). Intraneural injections of cell membrane or

LAM caused MAC deposition (Fig. 2e, f), axonal damage (Fig. 2i, j), loss of MBP

reactivity (Fig. 2m, n), loss of the Schwann cell marker S100β (Fig. 2q, r) and

accumulation of Iba-1 positive macrophages (Fig. 2u, v). Quantification of staining on

cell membrane- and LAM injected nerves showed a significantly higher amount of

MAC deposition (p=0.0001; p=0.0001, respectively), axonal damage (p=0.0001;

p=0.0001, respectively), myelin loss (p=0.0001; p=0.0001, respectively), loss of

S100β expression (p=0.0001; p=0.0001, respectively) and accumulation of

macrophages (p=0.0001; p=0.0001, respectively) compared to PBS-injected nerves.

These findings prove that the M. leprae cell membrane and purified LAM cause MAC

deposition and nerve damage in vivo.

2


63

respectively. Mannan driven TCC formation was significantly reduced in MBL-/-serum

compared to MBL+/+ serum control (54% compared to the control, p=0.0001) (Fig.

S1a), while pre-incubation of NHS with the anti-C1q antibody showed significant

inhibition of IgG-triggered classical pathway activation and TCC formation (81%

compared to the control, p=0.0038, Fig. S1b).

To identify which components of M. leprae are responsible for activation of

complement, we performed TCC ELISA in NHS on plates coated with either whole M.

leprae sonicate, cell wall, cell membrane, PGL-1 or LAM. M. tuberculosis sonicate or

mannan were used as controls. We found that, except for PGL-1, all M. leprae

components examined induced TCC formation (Fig. 2c). LAM was a strong inducer,

resulting in TCC levels close to mannan control values (p=0.05). In line with the in

vivo data (Fig. 1a,b), also in this assay, M. tuberculosis did not induce TCC formation

(p=0.01, Fig. 2c). These in vitro data confirmed the in vivo observations that M.

leprae specifically activates the complement cascade. In addition, we found that LAM

is a dominant complement activator in vitro.

To determine whether the M. leprae fractions, that induced TCC formation in vitro

also caused MAC deposition and nerve damage in vivo, we injected the cell

membrane and the LAM fraction in the sciatic nerve of the nude mice and analyzed

and quantified the pathological changes at 3 days post-injection (Fig. 2d-w).

Intraneural injection of PBS was used as control. PBS caused no pathological

changes in the nerves (Fig. 2d, h, l, p, t). Intraneural injections of cell membrane or

LAM caused MAC deposition (Fig. 2e, f), axonal damage (Fig. 2i, j), loss of MBP

reactivity (Fig. 2m, n), loss of the Schwann cell marker S100β (Fig. 2q, r) and

accumulation of Iba-1 positive macrophages (Fig. 2u, v). Quantification of staining on

cell membrane- and LAM injected nerves showed a significantly higher amount of

MAC deposition (p=0.0001; p=0.0001, respectively), axonal damage (p=0.0001;

p=0.0001, respectively), myelin loss (p=0.0001; p=0.0001, respectively), loss of

S100β expression (p=0.0001; p=0.0001, respectively) and accumulation of

macrophages (p=0.0001; p=0.0001, respectively) compared to PBS-injected nerves.

These findings prove that the M. leprae cell membrane and purified LAM cause MAC

deposition and nerve damage in vivo.

Chapter 2

64

Fig. 2 The M. leprae component lipoarabinomanan (LAM) is the dominant complement activator and

induces nerve damage in vivo. a Haemolytic assay of normal human serum (NHS) pre-incubated for 1

hour at 37°C with either M. leprae sonicate (5 µg/µl) or M. tuberculosis sonicate (5 µg/µl) or PBS as

controls, showing significantly decreased haemolytic activity in NHS pre-incubated with M. leprae but

not with M. tuberculosis or PBS, demonstrating complement consumption by M. leprae. b ELISA for

MAC generation on M. leprae sonicate (2.5 µg)-coated plates incubated with either mannose binding

lectin deficient (MBL-/-

) serum (to test for the contribution of the lectin pathway) or NHS in the presence

of the neutralizing anti-C1q antibody (to test for the contribution of the classical pathway) or C1

inhibitor (to test for the combined contribution of the lectin and classical pathways) or BSA as control,

showing a significant reduction of MAC formation in the MBL-/-

serum and NHS supplemented with the

C1 inhibitor, but not by the neutralizing anti-C1q antibody, demonstrating complement activation by M.

leprae via the lectin pathway. c ELISA for TCC generation in NHS on plates coated with either M.

leprae sonicate (2.5 µg) or its cellular fractions, including cell membrane (2.5 µg), the inner cell wall

component lipoarabinomannan (LAM) (2.5 µg) or the outer cell wall component phenolic glycolipid 1

(PGL-1) (2.5 µg), showing that all components except PGL-1 result in TCC generation. d-r Intraneural

injections of cell membrane or LAM induce complement deposition and nerve damage in vivo.

Immunohistochemistry and quantification for C9 detecting MAC (d-g), neurofilament detecting axons

(h-k), MBP detecting myelin (l-o), S100β detecting Schwann cells (p-s) or Iba-1 detecting

macrophages (t-w) in cross sections of mouse sciatic nerves at 72h post-injection with either PBS (d,

h, l, p, t), cell membrane (e, i, m, q, u) or LAM (f, j, n, r, v), showing a significant higher amount of

MAC deposition (e, f and asterisks) (g, One way ANOVA test: p=0.0001;p=0.0001), ,axonal damage

(i, j and asterisks) (k, One way ANOVA test: p=0.0001;p=0.0001), loss of myelin proteins (m, n and

asterisks) (o, One way ANOVA test: p=0.0001;p=0.0001), loss of S100β expression on Schwann

cells (q, r and asterisks) (s, One way ANOVA test: p=0.0001;p=0.0001) and accumulation of

macrophages (u, v and arrows) in cell membrane- and LAM- injected nerves compared to PBS-

injected nerves where no signs of MAC deposition (d), undamaged nerve morphology (h, l), preserved

S100β expression (p) and a paucity of endoneurial macrophages (t) were observed.

2


65

Fig. 2 The M. leprae component lipoarabinomanan (LAM) is the dominant complement activator and

induces nerve damage in vivo. a Haemolytic assay of normal human serum (NHS) pre-incubated for 1

hour at 37°C with either M. leprae sonicate (5 µg/µl) or M. tuberculosis sonicate (5 µg/µl) or PBS as

controls, showing significantly decreased haemolytic activity in NHS pre-incubated with M. leprae but

not with M. tuberculosis or PBS, demonstrating complement consumption by M. leprae. b ELISA for

MAC generation on M. leprae sonicate (2.5 µg)-coated plates incubated with either mannose binding

lectin deficient (MBL-/-

) serum (to test for the contribution of the lectin pathway) or NHS in the presence

of the neutralizing anti-C1q antibody (to test for the contribution of the classical pathway) or C1

inhibitor (to test for the combined contribution of the lectin and classical pathways) or BSA as control,

showing a significant reduction of MAC formation in the MBL-/-

serum and NHS supplemented with the

C1 inhibitor, but not by the neutralizing anti-C1q antibody, demonstrating complement activation by M.

leprae via the lectin pathway. c ELISA for TCC generation in NHS on plates coated with either M.

leprae sonicate (2.5 µg) or its cellular fractions, including cell membrane (2.5 µg), the inner cell wall

component lipoarabinomannan (LAM) (2.5 µg) or the outer cell wall component phenolic glycolipid 1

(PGL-1) (2.5 µg), showing that all components except PGL-1 result in TCC generation. d-r Intraneural

injections of cell membrane or LAM induce complement deposition and nerve damage in vivo.

Immunohistochemistry and quantification for C9 detecting MAC (d-g), neurofilament detecting axons

(h-k), MBP detecting myelin (l-o), S100β detecting Schwann cells (p-s) or Iba-1 detecting

macrophages (t-w) in cross sections of mouse sciatic nerves at 72h post-injection with either PBS (d,

h, l, p, t), cell membrane (e, i, m, q, u) or LAM (f, j, n, r, v), showing a significant higher amount of

MAC deposition (e, f and asterisks) (g, One way ANOVA test: p=0.0001;p=0.0001), ,axonal damage

(i, j and asterisks) (k, One way ANOVA test: p=0.0001;p=0.0001), loss of myelin proteins (m, n and

asterisks) (o, One way ANOVA test: p=0.0001;p=0.0001), loss of S100β expression on Schwann

cells (q, r and asterisks) (s, One way ANOVA test: p=0.0001;p=0.0001) and accumulation of

macrophages (u, v and arrows) in cell membrane- and LAM- injected nerves compared to PBS-

injected nerves where no signs of MAC deposition (d), undamaged nerve morphology (h, l), preserved

S100β expression (p) and a paucity of endoneurial macrophages (t) were observed.

Chapter 2

66

MAC inhibition protects against M. leprae-induced nerve damage

To determine the contribution of MAC formation to M. leprae sonicate-induced nerve

damage in vivo, we treated mice with an antisense LNA-DNA oligonucleotide against

C6 for 4 days, starting at 1 week prior to the intraneural injection of M. leprae

sonicate (Fig. 3a). In the absence of C6, MAC cannot be formed. Quantification of C6

mRNA in the liver of C6 LNA-treated mice showed a significant 60% reduction

compared to mismatch LNA-treated controls (p=0.01) (Fig. 3b). Such reduction in the

amount of C6 mRNA liver levels is sufficient to block MAC formation, as shown by

the significant 80% reduction of MAC deposits in the nerves of C6 LNA-treated mice

compared to mismatch LNA-treated controls at 3 days post-injection (p=0.005) (Fig.

3c-e ). In addition, C6 LNA treatment conserved the intact annular nerve morphology

and preserved staining of the myelin protein MBP, compared to the collapsed myelin

structure and significant loss of myelin MBP immunoreactivity seen in the mismatch

LNA-treated animals (p=0.0007) (Fig. 3f-h). Axons were protected from damage in

the C6 LNA-treated mice but not in the mismatch LNA-treated animals, which

showed a significant loss of neurofilament immunoreactivity (p=0.0006) (Fig. 3i-k).

The nerves of C6 LNA-treated mice showed also expression of the Schwann cell

marker S100β which had normal appearance as half-moon-shaped profiles (Fig. 3l,

arrows), whereas in the mismatch LNA-treated nerves this marker was significantly

reduced (p=0.03) (Fig. 3l-n). Lastly, C6 LNA treatment significantly reduced

accumulation of intraneural Iba-1 positive macrophages compared to controls

(p=0.0001) (Fig. 3o-q). These data show that inhibition of C6 synthesis blocks MAC

deposition in the M. leprae-injected nerves and prevents the loss of myelin and

axonal proteins, protects from the loss of a key Schwann cell marker and reduces

accumulation of intraneural macrophages.

Fig. 3 MAC inhibition by C6 antisense therapy protects against M. leprae-induced nerve damage. a

Schedule of treatment and experimental timeline for the C6 antisense therapy. Mice were treated for 4

days with either the C6 LNA (n=5) or the control mismatch LNA (n=5). At day 6, M. leprae sonicate

was injected into the mouse sciatic nerve. At day 9 (3 days post-injection) mice were sacrificed for

determination of C6 mRNA liver levels and pathlogical analysis. b qPCR of liver C6 mRNA, showing

significant lower levels in mice treated with the C6 LNA compared to mismatch LNA-treated controls.

2


67

MAC inhibition protects against M. leprae-induced nerve damage

To determine the contribution of MAC formation to M. leprae sonicate-induced nerve

damage in vivo, we treated mice with an antisense LNA-DNA oligonucleotide against

C6 for 4 days, starting at 1 week prior to the intraneural injection of M. leprae

sonicate (Fig. 3a). In the absence of C6, MAC cannot be formed. Quantification of C6

mRNA in the liver of C6 LNA-treated mice showed a significant 60% reduction

compared to mismatch LNA-treated controls (p=0.01) (Fig. 3b). Such reduction in the

amount of C6 mRNA liver levels is sufficient to block MAC formation, as shown by

the significant 80% reduction of MAC deposits in the nerves of C6 LNA-treated mice

compared to mismatch LNA-treated controls at 3 days post-injection (p=0.005) (Fig.

3c-e ). In addition, C6 LNA treatment conserved the intact annular nerve morphology

and preserved staining of the myelin protein MBP, compared to the collapsed myelin

structure and significant loss of myelin MBP immunoreactivity seen in the mismatch

LNA-treated animals (p=0.0007) (Fig. 3f-h). Axons were protected from damage in

the C6 LNA-treated mice but not in the mismatch LNA-treated animals, which

showed a significant loss of neurofilament immunoreactivity (p=0.0006) (Fig. 3i-k).

The nerves of C6 LNA-treated mice showed also expression of the Schwann cell

marker S100β which had normal appearance as half-moon-shaped profiles (Fig. 3l,

arrows), whereas in the mismatch LNA-treated nerves this marker was significantly

reduced (p=0.03) (Fig. 3l-n). Lastly, C6 LNA treatment significantly reduced

accumulation of intraneural Iba-1 positive macrophages compared to controls

(p=0.0001) (Fig. 3o-q). These data show that inhibition of C6 synthesis blocks MAC

deposition in the M. leprae-injected nerves and prevents the loss of myelin and

axonal proteins, protects from the loss of a key Schwann cell marker and reduces

accumulation of intraneural macrophages.

Fig. 3 MAC inhibition by C6 antisense therapy protects against M. leprae-induced nerve damage. a

Schedule of treatment and experimental timeline for the C6 antisense therapy. Mice were treated for 4

days with either the C6 LNA (n=5) or the control mismatch LNA (n=5). At day 6, M. leprae sonicate

was injected into the mouse sciatic nerve. At day 9 (3 days post-injection) mice were sacrificed for

determination of C6 mRNA liver levels and pathlogical analysis. b qPCR of liver C6 mRNA, showing

significant lower levels in mice treated with the C6 LNA compared to mismatch LNA-treated controls.

Chapter 2

68

Immunohistochemistry and quantification of C9 detecting MAC (c-e), MBP detecting myelin (f-h),

neurofilament detecting axons (i-k), S100β detecting Schwann cells (l-n) or Iba-1 detecting

macrophages (o-q) in cross sections of sciatic nerves from C6 LNA-treated (c, f, i, l, o) or mismatch

LNA-treated (d, g, j, m, p) mice at 72h post-injection with M. leprae sonicate, showing a significant

and robust reduction in MAC deposition (Student’s t-test: p=0.005) (e), intact myelin (Student’s t-test:

p=0.0007) (h) and axonal morphology (k), S100β expression by Schwann cells (l and arrows) and

reduced accumulation of macrophages (Student’s t-test: p=0.0001) (k) in C6 LNA-treated mice

compared to mismatch-treated controls (asterisks in g, j and m indicate damaged areas of the

mismatch-treated nerves, Arrows in p indicate iba-1 positive macrophages in the mismatch-treated

nerves).

Leprosy nerves are LAM positive and show MAC deposition

To determine the extent of M. leprae antigen deposition and to test whether MAC is

deposited in the nerve biopsies of leprosy patients, we performed

immunohistochemistry for LAM and MAC on nerve biopsies from paucibacillary and

multibacillary patients (Fig. 4a-f). These nerves, showed substantial myelin and

axonal loss, as demonstrated by quantification of the immunostaining for MBP and

SMI31 (Fig. S2). Immunostaining for LAM and MAC were always negative in control

nerves (Fig. 4a and 4b, respectively). Nerves of paucibacillary and multibacillary

patients were both positive for LAM (Fig. 4c, e) with the percentage of LAM staining

per surface area being significantly higher in multibacillary nerves compared to

paucibacillary (p=0.01) (Fig. 4g). Nerves of multibacillary patients also showed

substantial MAC deposition (up to 15% of total area assessed, mean 8%) (Fig. 4f, h)

whereas nerve biopsies from paucibacillary patients were negative for MAC

(p=0.007) (Fig. 4d). In line with the robust deposition of MAC, we also found

substantial C3d deposition in nerves of multibacillary patients, with the percentage of

C3d staining per surface area being significantly higher (>4-fold) than paucibacillary

patients (p=0.006) (Fig. S3).

2


69

Immunohistochemistry and quantification of C9 detecting MAC (c-e), MBP detecting myelin (f-h),

neurofilament detecting axons (i-k), S100β detecting Schwann cells (l-n) or Iba-1 detecting

macrophages (o-q) in cross sections of sciatic nerves from C6 LNA-treated (c, f, i, l, o) or mismatch

LNA-treated (d, g, j, m, p) mice at 72h post-injection with M. leprae sonicate, showing a significant

and robust reduction in MAC deposition (Student’s t-test: p=0.005) (e), intact myelin (Student’s t-test:

p=0.0007) (h) and axonal morphology (k), S100β expression by Schwann cells (l and arrows) and

reduced accumulation of macrophages (Student’s t-test: p=0.0001) (k) in C6 LNA-treated mice

compared to mismatch-treated controls (asterisks in g, j and m indicate damaged areas of the

mismatch-treated nerves, Arrows in p indicate iba-1 positive macrophages in the mismatch-treated

nerves).

Leprosy nerves are LAM positive and show MAC deposition

To determine the extent of M. leprae antigen deposition and to test whether MAC is

deposited in the nerve biopsies of leprosy patients, we performed

immunohistochemistry for LAM and MAC on nerve biopsies from paucibacillary and

multibacillary patients (Fig. 4a-f). These nerves, showed substantial myelin and

axonal loss, as demonstrated by quantification of the immunostaining for MBP and

SMI31 (Fig. S2). Immunostaining for LAM and MAC were always negative in control

nerves (Fig. 4a and 4b, respectively). Nerves of paucibacillary and multibacillary

patients were both positive for LAM (Fig. 4c, e) with the percentage of LAM staining

per surface area being significantly higher in multibacillary nerves compared to

paucibacillary (p=0.01) (Fig. 4g). Nerves of multibacillary patients also showed

substantial MAC deposition (up to 15% of total area assessed, mean 8%) (Fig. 4f, h)

whereas nerve biopsies from paucibacillary patients were negative for MAC

(p=0.007) (Fig. 4d). In line with the robust deposition of MAC, we also found

substantial C3d deposition in nerves of multibacillary patients, with the percentage of

C3d staining per surface area being significantly higher (>4-fold) than paucibacillary

patients (p=0.006) (Fig. S3).

Chapter 2

70

Fig. 4 LAM and MAC deposition in nerves of leprosy patients. Immunostaining for the M. leprae

antigen LAM and C9, detecting MAC, in nerve biopsies of control (a, b) compared to paucibacillary (c,

d) and multibacillary (e, f) leprosy patients. The control nerves were negative for LAM (a) and MAC

(b), as expected. paucibacillary nerves show little immunoreactivity for LAM (c) and virtually no MAC

deposition (d) whereas multibacillary patients show robust staining for LAM (e and arrows) and MAC

(f). Quantification of the immunostainings showed that the amount of immunoreactivity for LAM (g)

and MAC (h) is significantly higher in multibacillary compared to paucibacillary nerves (Student’s t-test

paucibacillary versus multibacillary: LAM, p=0.01; C9, p=0.007). Error bars indicate standard error of

the mean.

Complement deposition is associated with M. leprae antigen LAM in leprosy

lesions.

To determine the location of the deposition of activated complement components in

the nerves of multibacillary leprosy patients, we performed immunofluorescent

double staining for MAC and C3d with the M. leprae antigen LAM or markers of

axons (SMI31 or pan-neurofilament). We found colocalization of LAM with MAC (Fig.

5a) and C3d (Fig. S4a), indicating that complement targets M. leprae in the nerve, as

expected. Notably, MAC and C3d immunoreactivity extended also to LAM-negative

nerve areas, which we identified to be axons as shown by the double immunolabeling

of C9 and C3d with the axonal marker SMI31 (Fig. 5b and Fig. S4b). In addition, co-

localization of LAM with neurofilament (see table S2), showed that LAM is present in

close proximity to axons which show signs of damage, including swelling and

degradation (Fig. 5c). Together these data suggest a functional link between

complement, the M. leprae antigen LAM and axonal changes in leprosy.

To determine whether there is a link between the amount of LAM and the amount of

complement activation in the nerves of paucibacillary and multibacillary leprosy

patients, we tested whether there is a correlation between the extent of C9 staining

and the extent of LAM staining in corresponding nerve areas. We found a highly

significant positive correlation between the amount of LAM and MAC (r=0.9601,

p<0.0001) in leprosy nerves (Fig. 5d). Also the percentage of C3d positive staining

correlated with the amount of LAM positive staining in the nerves (r=0.9692,

p<0.0001) (Fig. S4c). In line with these findings, we also found a significant

correlation between the percentage of complement-immunoreactivity for C3d

(r=0.9692, p=0.0003) or C9 (r=0.9682, p=0.0015) and the bacterial index in nerve

biopsies of paucibacillary and multibacillary leprosy patients (Fig. S5a, b). Overall

these data show a strong link between the presence of M. leprae antigen LAM in the

nerves and complement activation.

2


71

Fig. 4 LAM and MAC deposition in nerves of leprosy patients. Immunostaining for the M. leprae

antigen LAM and C9, detecting MAC, in nerve biopsies of control (a, b) compared to paucibacillary (c,

d) and multibacillary (e, f) leprosy patients. The control nerves were negative for LAM (a) and MAC

(b), as expected. paucibacillary nerves show little immunoreactivity for LAM (c) and virtually no MAC

deposition (d) whereas multibacillary patients show robust staining for LAM (e and arrows) and MAC

(f). Quantification of the immunostainings showed that the amount of immunoreactivity for LAM (g)

and MAC (h) is significantly higher in multibacillary compared to paucibacillary nerves (Student’s t-test

paucibacillary versus multibacillary: LAM, p=0.01; C9, p=0.007). Error bars indicate standard error of

the mean.

Complement deposition is associated with M. leprae antigen LAM in leprosy

lesions.

To determine the location of the deposition of activated complement components in

the nerves of multibacillary leprosy patients, we performed immunofluorescent

double staining for MAC and C3d with the M. leprae antigen LAM or markers of

axons (SMI31 or pan-neurofilament). We found colocalization of LAM with MAC (Fig.

5a) and C3d (Fig. S4a), indicating that complement targets M. leprae in the nerve, as

expected. Notably, MAC and C3d immunoreactivity extended also to LAM-negative

nerve areas, which we identified to be axons as shown by the double immunolabeling

of C9 and C3d with the axonal marker SMI31 (Fig. 5b and Fig. S4b). In addition, co-

localization of LAM with neurofilament (see table S2), showed that LAM is present in

close proximity to axons which show signs of damage, including swelling and

degradation (Fig. 5c). Together these data suggest a functional link between

complement, the M. leprae antigen LAM and axonal changes in leprosy.

To determine whether there is a link between the amount of LAM and the amount of

complement activation in the nerves of paucibacillary and multibacillary leprosy

patients, we tested whether there is a correlation between the extent of C9 staining

and the extent of LAM staining in corresponding nerve areas. We found a highly

significant positive correlation between the amount of LAM and MAC (r=0.9601,

p<0.0001) in leprosy nerves (Fig. 5d). Also the percentage of C3d positive staining

correlated with the amount of LAM positive staining in the nerves (r=0.9692,

p<0.0001) (Fig. S4c). In line with these findings, we also found a significant

correlation between the percentage of complement-immunoreactivity for C3d

(r=0.9692, p=0.0003) or C9 (r=0.9682, p=0.0015) and the bacterial index in nerve

biopsies of paucibacillary and multibacillary leprosy patients (Fig. S5a, b). Overall

these data show a strong link between the presence of M. leprae antigen LAM in the

nerves and complement activation.

Chapter 2

72

Fig. 5 LAM is associated with MAC deposition in nerves of leprosy patients. Immunofluorescent

doublestaining for complement component C9, detecting MAC, and the M. leprae antigen LAM,

showing colocalization in the nerves of multibacillary patients (a). C9 and LAM also colocalized with

the SMI31 (b) and the neurofilament (NF) (c) markers of axons, respectively. The amount of C9

immunoreactivity significantly correlated with the amount of LAM immunoreactivity found in

paucibacillary and multibacillary leprosy nerves (Pearson’s correlation, r=0.9601, p<0.0001) (d),

indicating an association between the extent of M.leprae antigen LAM and MAC deposition in leprosy

nerves.

Discussion

The occurrence of polyneuropathy due to various infectious agents is well recognized

in the literature [18]. Among them, nerve damage in leprosy leading to permanent

disability still represents an important global health problem. The nerve damage in

leprosy is widely regarded as the consequence of adaptive immunity via M. leprae-

specific T cell activity, persisting long after the patients have completed treatment

[16]. However, the nerve damage should be regarded as an early sign of leprosy,

because the loss of sensation in patients with suspected leprosy is considered the

hall mark of early disease [1]. Despite advances in our knowledge of the

pathogenesis of leprosy spectrum, the understanding of the mechanisms of nerve

damage and regeneration in leprosy-associated neuropathy remains poor. Progress

has been limited by the lack of established experimental models for studying leprosy-

induced neuropathy.

Assuming that nerve dysfunction occurs at the onset of effective infection, it can be

hypothesized that before the initiation of host adaptive immunity, a direct interaction

between the nerve and the infectious agent, could be the initiator of nerve damage

which is then compounded by the inflammatory sequel. In support of this hypothesis,

literature reports imply that loss of myelin proteins can be induced by M. leprae in the

absence of lymphocytes in Rag knock out mice [13]. These data suggest the

existence of host innate factors that interact with a pathogen-associated molecule

(PAM) causing the initial damage. Understanding the molecular mechanisms, which

initiate nerve damage in leprosy, is critical for the development of effective therapies

aimed at preventing the severe disability in patients.

2


73

Fig. 5 LAM is associated with MAC deposition in nerves of leprosy patients. Immunofluorescent

doublestaining for complement component C9, detecting MAC, and the M. leprae antigen LAM,

showing colocalization in the nerves of multibacillary patients (a). C9 and LAM also colocalized with

the SMI31 (b) and the neurofilament (NF) (c) markers of axons, respectively. The amount of C9

immunoreactivity significantly correlated with the amount of LAM immunoreactivity found in

paucibacillary and multibacillary leprosy nerves (Pearson’s correlation, r=0.9601, p<0.0001) (d),

indicating an association between the extent of M.leprae antigen LAM and MAC deposition in leprosy

nerves.

Discussion

The occurrence of polyneuropathy due to various infectious agents is well recognized

in the literature [18]. Among them, nerve damage in leprosy leading to permanent

disability still represents an important global health problem. The nerve damage in

leprosy is widely regarded as the consequence of adaptive immunity via M. leprae-

specific T cell activity, persisting long after the patients have completed treatment

[16]. However, the nerve damage should be regarded as an early sign of leprosy,

because the loss of sensation in patients with suspected leprosy is considered the

hall mark of early disease [1]. Despite advances in our knowledge of the

pathogenesis of leprosy spectrum, the understanding of the mechanisms of nerve

damage and regeneration in leprosy-associated neuropathy remains poor. Progress

has been limited by the lack of established experimental models for studying leprosy-

induced neuropathy.

Assuming that nerve dysfunction occurs at the onset of effective infection, it can be

hypothesized that before the initiation of host adaptive immunity, a direct interaction

between the nerve and the infectious agent, could be the initiator of nerve damage

which is then compounded by the inflammatory sequel. In support of this hypothesis,

literature reports imply that loss of myelin proteins can be induced by M. leprae in the

absence of lymphocytes in Rag knock out mice [13]. These data suggest the


(PAM) causing the initial damage. Understanding the molecular mechanisms, which

initiate nerve damage in leprosy, is critical for the development of effective therapies

aimed at preventing the severe disability in patients.

Chapter 2

74

Response against pathogens, which result in the activation of host’s innate and

adaptive factors, is essential for containing the infection, but excessive activation can

damage self-tissues. We have previously shown that activation of the complement

system, a key component of the host’s immune response, is an important player in

the process of nerve damage and regeneration. Specifically, we proved that

formation of the membrane attack complex (MAC: comprised of C5b C6 C7 C8 and

C9) is essential for rapid Wallerian degeneration of axons in peripheral nerves and

inhibition of MAC formation promotes axonal regeneration and recovery of the

damaged nerve [9, 11, 12]

In view of these key findings, we undertook the present study in two subsequent

steps Firstly, we made use of a mouse model of M. leprae-induced nerve injury to

elucidated the molecular pathways of the interaction between the nerve and M.

leprae components. Secondly, we analyzed nerve biopsies of leprosy patients to

establish the relevance of our experimental findings in the understanding of the

pathology of leprosy neuropathy. The combined data collected from the mouse

experiments and from the immunohistopathological analysis of nerve biopsies of

leprosy patients, led to our conclusion that lipoarabinomannan (LAM) of M. leprae is

the dominant PAM, which interacts with the nerve and initiates complement activation

resulting in the in situ formation of the MAC, causing nerve damage. We also show

that inhibition of MAC formation by antisense oligonucleotide-based therapy protects

the nerve from M. leprae-induced damage. Therefore we propose that MAC inhibition

could form the basis of future development of novel therapeutics for leprosy.

Complement activation in leprosy has been previously associated with immune

complexes, pointing to the involvement of the classical pathway of complement in the

disease [2]. Our data show that LAM-mediated complement activation is initiated via

the lectin pathway, potentially occurring via the binding of MBL or ficolins from the

circulation. However, we do not exclude a contribution of other pathways in the

pathogenesis of leprosy. We further demonstrated the co-localization of axonal

markers with LAM and MAC, which strongly points to the possibility that LAM

interacts with an axonal component and activates the complement cascade.

Complement activation induced by LAM may trigger a number of events, including

activation of neuronal cells, in situ generation of chemokines and chemoattractants,

recruitment of inflammatory cells including macrophages, ultimately leading to nerve

fragmentation in a similar manner to that seen in Wallerian degeneration [3, 6, 20].

The involvement of LAM in the pathogenesis of leprosy-induced neuropathy is also

supported by early studies showing that clearance of LAM from granulomas in skin

lesions is inefficient. Even after completion of treatment, LAM could still be detected

in skin and nerve biopsies from leprosy patients, with clearance of LAM from

granulomas in multibacillary lesions being slower than other antigens e.g. PGL-1

[21]. Interestingly, in this work the in situ expression of LAM appeared to be

associated with the occurrence of a reactional state. LAM is abundantly present in

infiltrating macrophages in lesions of multibacillary patients but not in paucibacillary

patients. In the latter case, hardly any macrophage infiltration is seen, instead

epitheloid cells are usually present.

LAM, a major pathogen-associated molecule of M. leprae, could be the trigger for

complement activation and subsequent demyelination. This generates myelin debris,

which by itself also activates complement and will attract macrophages [9]. In this

way, a vicious cycle occurs. Since LAM can be detected in nerves of leprosy patients

accompanied by myelinated axonal loss after multidrug therapy, the signals for

myelinated axonal loss might persist even after treatment.

2


75

Response against pathogens, which result in the activation of host’s innate and

adaptive factors, is essential for containing the infection, but excessive activation can

damage self-tissues. We have previously shown that activation of the complement

system, a key component of the host’s immune response, is an important player in

the process of nerve damage and regeneration. Specifically, we proved that

formation of the membrane attack complex (MAC: comprised of C5b C6 C7 C8 and

C9) is essential for rapid Wallerian degeneration of axons in peripheral nerves and

inhibition of MAC formation promotes axonal regeneration and recovery of the

damaged nerve [9, 11, 12]

In view of these key findings, we undertook the present study in two subsequent

steps Firstly, we made use of a mouse model of M. leprae-induced nerve injury to

elucidated the molecular pathways of the interaction between the nerve and M.

leprae components. Secondly, we analyzed nerve biopsies of leprosy patients to

establish the relevance of our experimental findings in the understanding of the

pathology of leprosy neuropathy. The combined data collected from the mouse

experiments and from the immunohistopathological analysis of nerve biopsies of

leprosy patients, led to our conclusion that lipoarabinomannan (LAM) of M. leprae is

the dominant PAM, which interacts with the nerve and initiates complement activation

resulting in the in situ formation of the MAC, causing nerve damage. We also show

that inhibition of MAC formation by antisense oligonucleotide-based therapy protects

the nerve from M. leprae-induced damage. Therefore we propose that MAC inhibition

could form the basis of future development of novel therapeutics for leprosy.

Complement activation in leprosy has been previously associated with immune

complexes, pointing to the involvement of the classical pathway of complement in the

disease [2]. Our data show that LAM-mediated complement activation is initiated via

the lectin pathway, potentially occurring via the binding of MBL or ficolins from the

circulation. However, we do not exclude a contribution of other pathways in the

pathogenesis of leprosy. We further demonstrated the co-localization of axonal

markers with LAM and MAC, which strongly points to the possibility that LAM

interacts with an axonal component and activates the complement cascade.

Complement activation induced by LAM may trigger a number of events, including

activation of neuronal cells, in situ generation of chemokines and chemoattractants,

recruitment of inflammatory cells including macrophages, ultimately leading to nerve

fragmentation in a similar manner to that seen in Wallerian degeneration [3, 6, 20].

The involvement of LAM in the pathogenesis of leprosy-induced neuropathy is also

supported by early studies showing that clearance of LAM from granulomas in skin

lesions is inefficient. Even after completion of treatment, LAM could still be detected

in skin and nerve biopsies from leprosy patients, with clearance of LAM from

granulomas in multibacillary lesions being slower than other antigens e.g. PGL-1

[21]. Interestingly, in this work the in situ expression of LAM appeared to be

associated with the occurrence of a reactional state. LAM is abundantly present in

infiltrating macrophages in lesions of multibacillary patients but not in paucibacillary

patients. In the latter case, hardly any macrophage infiltration is seen, instead

epitheloid cells are usually present.

LAM, a major pathogen-associated molecule of M. leprae, could be the trigger for

complement activation and subsequent demyelination. This generates myelin debris,

which by itself also activates complement and will attract macrophages [9]. In this

way, a vicious cycle occurs. Since LAM can be detected in nerves of leprosy patients

accompanied by myelinated axonal loss after multidrug therapy, the signals for

myelinated axonal loss might persist even after treatment.

Chapter 2

76

We and others [8] also found that C3d and MAC are abundantly deposited in nerves

of multibacillary patients, even in biopsies from patients that have completed

treatment.

However, we should emphasize that the analysis of the nerve biopsies of leprosy

patients represents a snap shot of the disease pathology at the time when the patient

comes into the clinic. Therefore, a temporal course of pathological processes cannot

be concluded from the sole analysis of these biopsies. In view of this consideration,

the lack of MAC immunoreactivity in the nerves of paucibacillary patients, should be

interpreted carefully. Based on the in vitro and in vivo findings reported in this study,

we propose that the lack of MAC immunoreactivity in the paucibacillary biopsies is

likely due to the fact that in these patients the nerves are severely damaged and

MAC-activating debris and LAM are almost completely cleared, resulting in no

obvious MAC deposition at the time of biopsy. In line with this interpretation, we also

found a strong association between the presence of LAM and MAC deposition in the

nerves, which suggests a functional link between these two factors.

Here we investigated the acute effects of the cognate interaction of the nerve with M.

leprae components which trigger complement activation causing nerve damage. This

initial event cannot be studied in humans, because leprosy is a slowly developing

chronic inflammatory disease with adaptive immunity in operation, resulting in

M.leprae disruption, release and subsequent clearance of its components. In such a

situation the host may be intermittently exposed to some M.leprae components (e.g.

LAM) due to inefficient clearance or access of drug into nerves leading to changes in

component concentrations, altering the drive to complement activation that may be

relevant to the ongoing disease process.

Our model, comprising M.leprae intraneurial injections in nude mouse sciatic nerves

does not accurately represent human leprosy but rather tests the capacity of

M.leprae inactivated by gamma-irradiation or fractions thereof to activate

complement; infection with intact M.leprae in the immunocompetent host would not

allow such an analysis. Our analysis of human nerve biopsies from leprosy patients

allowed us to extrapolate results from the mouse model to man, showing relevance

of complement activation to the human disease. Complement was activated in

leprosy nerve biopsies, including formation of MAC, capable of damaging myelin and

causing lysis of the target cell. Nerve biopsies were available only from established

disease so these results only provide a snapshot demonstration of MAC deposition in

diseased nerves and do not allow us to conclude that the nerve damage, which

occurs early, is mediated by complement activation. A longitudinal study would be

important to test the role of MAC in nerve damage early in disease and such a study

is currently in progress.

In conclusion, we have shown that LAM is a dominant complement activating M.

leprae antigen. We also showed, in a model optimized to study the early cognate

interaction of M. leprae components with the nerve axon, that this interaction leads to

complement activation, myelin loss and axonal damage. Importantly, we proved that

inhibition of MAC formation prevented myelin and axonal loss in this model, providing

the proof of principle that blocking MAC formation may potentially reduce nerve

damage in M. leprae-induced neuropathy.

2


77

We and others [8] also found that C3d and MAC are abundantly deposited in nerves

of multibacillary patients, even in biopsies from patients that have completed

treatment.

However, we should emphasize that the analysis of the nerve biopsies of leprosy

patients represents a snap shot of the disease pathology at the time when the patient

comes into the clinic. Therefore, a temporal course of pathological processes cannot

be concluded from the sole analysis of these biopsies. In view of this consideration,

the lack of MAC immunoreactivity in the nerves of paucibacillary patients, should be

interpreted carefully. Based on the in vitro and in vivo findings reported in this study,

we propose that the lack of MAC immunoreactivity in the paucibacillary biopsies is

likely due to the fact that in these patients the nerves are severely damaged and

MAC-activating debris and LAM are almost completely cleared, resulting in no

obvious MAC deposition at the time of biopsy. In line with this interpretation, we also

found a strong association between the presence of LAM and MAC deposition in the

nerves, which suggests a functional link between these two factors.

Here we investigated the acute effects of the cognate interaction of the nerve with M.

leprae components which trigger complement activation causing nerve damage. This

initial event cannot be studied in humans, because leprosy is a slowly developing

chronic inflammatory disease with adaptive immunity in operation, resulting in

M.leprae disruption, release and subsequent clearance of its components. In such a

situation the host may be intermittently exposed to some M.leprae components (e.g.

LAM) due to inefficient clearance or access of drug into nerves leading to changes in

component concentrations, altering the drive to complement activation that may be

relevant to the ongoing disease process.

Our model, comprising M.leprae intraneurial injections in nude mouse sciatic nerves

does not accurately represent human leprosy but rather tests the capacity of

M.leprae inactivated by gamma-irradiation or fractions thereof to activate

complement; infection with intact M.leprae in the immunocompetent host would not

allow such an analysis. Our analysis of human nerve biopsies from leprosy patients

allowed us to extrapolate results from the mouse model to man, showing relevance

of complement activation to the human disease. Complement was activated in

leprosy nerve biopsies, including formation of MAC, capable of damaging myelin and

causing lysis of the target cell. Nerve biopsies were available only from established

disease so these results only provide a snapshot demonstration of MAC deposition in

diseased nerves and do not allow us to conclude that the nerve damage, which

occurs early, is mediated by complement activation. A longitudinal study would be

important to test the role of MAC in nerve damage early in disease and such a study

is currently in progress.

In conclusion, we have shown that LAM is a dominant complement activating M.

leprae antigen. We also showed, in a model optimized to study the early cognate

interaction of M. leprae components with the nerve axon, that this interaction leads to

complement activation, myelin loss and axonal damage. Importantly, we proved that

inhibition of MAC formation prevented myelin and axonal loss in this model, providing

the proof of principle that blocking MAC formation may potentially reduce nerve

damage in M. leprae-induced neuropathy.

Chapter 2

78

Acknowledgements. This work was supported by the Leprosy Foundation of the Netherlands [grant

number 701.03.08]. NBEI performed the experiments and the data analysis; KF and PR performed the

intraneural injection of M. leprae in the pilot experiment (data not shown); JV performed the qPCR

experiment; PKD, FB and VR formulated the project and supervised the progress of the project; DT

and BPM advised on the project; FB coordinated the project; NBEI wrote the manuscript.

Conflicts of interest. FB. KF and VR are co-inventors of patents that describe the use of inhibitors of

the terminal complement pathway for therapeutic purposes and are founders of Regenesance BV,

which is developing inhibitors of the terminal complement pathway for clinical applications.

References

1. WHO Expert Committee on Leprosy (1998) World Health Organ Tech Rep Ser 874:1-43.

2. Bjorvatn B, Barnetson RS, Kronvall G, Zubler RH, Lambert PH (1976) Immune complexes and

complement hypercatabolism in patients with leprosy. Clin Exp Immunol 26:388-396.

3. Camara-Lemarroy CR, Guzman-De La Garza FJ, Fernandez-Garza NE (2010) Molecular

inflammatory mediators in peripheral nerve damage and regeneration. Neuroimmunomodulation

17:314-324.

4. Gomes GI, Nahn EP, Jr., Santos RK, Da Silva WD, Kipnis TL (2008) The functional state of the

complement system in leprosy. Am J Trop Med Hyg 78:605-610.

5. Laal S, Bhutani LK, Nath I (1985) Natural emergence of antigen-reactive T cells in lepromatous

leprosy patients during erythema nodosum leprosum. Infect Immun 50:887-892.

6. Leonhard C, Muller M, Hickey WF, Ringelstein EB, Kiefer R (2002) Lesion response of long-

term and recently immigrated resident endoneurial macrophages in peripheral nerve explant

cultures from bone marrow chimeric mice. Eur J Neurosci 16:1654-1660.

7. Morgan BP (2000) Measurement of complement hemolytic activity, generation of complement-

depleted sera, and production of hemolytic intermediates. Methods Mol Biol 150:61-71.

8. Parkash O, Kumar V, Mukherjee A, Sengupta U, et al. (1995) Membrane attack complex in

thickened cutaneous sensory nerves of leprosy patients. Acta Leprol 9:195-199.

9. Ramaglia V, King RH, Nourallah M, Wolterman R, et al. (2007) The membrane attack complex

of the complement system is essential for rapid Wallerian degeneration. J Neurosci 27:7663-

7672.

10. Ramaglia V, Wolterman R, de Kok M, Vigar MA, et al. (2008) Soluble complement receptor 1

protects the peripheral nerve from early axon loss after injury. Am J Pathol 172:1043-1052.

11. Ramaglia V, King RH, Morgan BP, Baas F (2009) Deficiency of the complement regulator

CD59a exacerbates Wallerian degeneration. Mol Immunol 46:1892-1896.

12. Ramaglia V, Tannemaat MR, de KM, Wolterman R, et al. (2009) Complement inhibition

accelerates regeneration in a model of peripheral nerve injury. Mol Immunol 47:302-309.

13. Rambukkana A, Zanazzi G, Tapinos N, Salzer JL (2002) Contact-dependent demyelination by

Mycobacterium leprae in the absence of immune cells. Science 296:927-931.

14. Ridley DS, Jopling WH (1966) Classification of leprosy according to immunity. A five-group

system. Int J Lepr Other Mycobact Dis 34:255-273.

15. Ruseva MM, Hughes TR, Donev RM, Sivasankar B, et al. (2009) Crry deficiency in complement

sufficient mice: C3 consumption occurs without associated renal injury. Mol Immunol 46:803-

811.

16. Scollard DM, Adams LB, Gillis TP, Krahenbuhl JL, et al. (2006) The continuing challenges of

leprosy. Clin Microbiol Rev 19:338-381.

2


79

Acknowledgements. This work was supported by the Leprosy Foundation of the Netherlands [grant

number 701.03.08]. NBEI performed the experiments and the data analysis; KF and PR performed the

intraneural injection of M. leprae in the pilot experiment (data not shown); JV performed the qPCR

experiment; PKD, FB and VR formulated the project and supervised the progress of the project; DT

and BPM advised on the project; FB coordinated the project; NBEI wrote the manuscript.

Conflicts of interest. FB. KF and VR are co-inventors of patents that describe the use of inhibitors of

the terminal complement pathway for therapeutic purposes and are founders of Regenesance BV,

which is developing inhibitors of the terminal complement pathway for clinical applications.

References

1. WHO Expert Committee on Leprosy (1998) World Health Organ Tech Rep Ser 874:1-43.

2. Bjorvatn B, Barnetson RS, Kronvall G, Zubler RH, Lambert PH (1976) Immune complexes and

complement hypercatabolism in patients with leprosy. Clin Exp Immunol 26:388-396.

3. Camara-Lemarroy CR, Guzman-De La Garza FJ, Fernandez-Garza NE (2010) Molecular

inflammatory mediators in peripheral nerve damage and regeneration. Neuroimmunomodulation

17:314-324.

4. Gomes GI, Nahn EP, Jr., Santos RK, Da Silva WD, Kipnis TL (2008) The functional state of the

complement system in leprosy. Am J Trop Med Hyg 78:605-610.

5. Laal S, Bhutani LK, Nath I (1985) Natural emergence of antigen-reactive T cells in lepromatous

leprosy patients during erythema nodosum leprosum. Infect Immun 50:887-892.

6. Leonhard C, Muller M, Hickey WF, Ringelstein EB, Kiefer R (2002) Lesion response of long-

term and recently immigrated resident endoneurial macrophages in peripheral nerve explant

cultures from bone marrow chimeric mice. Eur J Neurosci 16:1654-1660.

7. Morgan BP (2000) Measurement of complement hemolytic activity, generation of complement-

depleted sera, and production of hemolytic intermediates. Methods Mol Biol 150:61-71.

8. Parkash O, Kumar V, Mukherjee A, Sengupta U, et al. (1995) Membrane attack complex in

thickened cutaneous sensory nerves of leprosy patients. Acta Leprol 9:195-199.

9. Ramaglia V, King RH, Nourallah M, Wolterman R, et al. (2007) The membrane attack complex

of the complement system is essential for rapid Wallerian degeneration. J Neurosci 27:7663-

7672.

10. Ramaglia V, Wolterman R, de Kok M, Vigar MA, et al. (2008) Soluble complement receptor 1

protects the peripheral nerve from early axon loss after injury. Am J Pathol 172:1043-1052.

11. Ramaglia V, King RH, Morgan BP, Baas F (2009) Deficiency of the complement regulator

CD59a exacerbates Wallerian degeneration. Mol Immunol 46:1892-1896.

12. Ramaglia V, Tannemaat MR, de KM, Wolterman R, et al. (2009) Complement inhibition

accelerates regeneration in a model of peripheral nerve injury. Mol Immunol 47:302-309.

13. Rambukkana A, Zanazzi G, Tapinos N, Salzer JL (2002) Contact-dependent demyelination by

Mycobacterium leprae in the absence of immune cells. Science 296:927-931.

14. Ridley DS, Jopling WH (1966) Classification of leprosy according to immunity. A five-group

system. Int J Lepr Other Mycobact Dis 34:255-273.

15. Ruseva MM, Hughes TR, Donev RM, Sivasankar B, et al. (2009) Crry deficiency in complement

sufficient mice: C3 consumption occurs without associated renal injury. Mol Immunol 46:803-

811.

16. Scollard DM, Adams LB, Gillis TP, Krahenbuhl JL, et al. (2006) The continuing challenges of

leprosy. Clin Microbiol Rev 19:338-381.

Chapter 2

80

17. Shetty VP, Mistry NF, Birdi TJ, Antia NH (1995) Effect of T-cell depletion on bacterial

multiplication and pattern of nerve damage in M. leprae-infected mice. Indian J Lepr 67:363-374.

18. Sindic CJ (2013) Infectious neuropathies. Curr Opin Neurol 26:510-515.

19. Sohi AS, Kandhari KC, Singh N (1971) Motor nerve conduction studies in leprosy. Int J Dermatol

10:151-155.

20. Stoll G, Jander S, Myers RR (2002) Degeneration and regeneration of the peripheral nervous

system: from Augustus Waller's observations to neuroinflammation. J Peripher Nerv Syst 7:13-

27.

21. Verhagen C, Faber W, Klatser P, Buffing A, et al. (1999) Immunohistological analysis of in situ

expression of mycobacterial antigens in skin lesions of leprosy patients across the

histopathological spectrum. Association of Mycobacterial lipoarabinomannan (LAM) and

Mycobacterium leprae phenolic glycolipid-I (PGL-I) with leprosy reactions. Am J Pathol

154:1793-1804.

22. Walport MJ (2001) Complement. First of two parts. N Engl J Med 344:1058-1066.

23. Walport MJ (2001) Complement. Second of two parts. N Engl J Med 344:1140-1144.

SUPPLEMENTARY FIGURES & TABLES

Fig S1. a ELISA for MAC generation on mannan (1 µg)-coated plates incubated with either normal

human serum (NHS) or MBL-deficient (MBL-/-) serum for 15 minutes at 37°C, showing significant

reduction of MAC formation in MBL-/- serum, demonstrating that MBL-/- serum blocks lectin pathway

activation initiated by mannan. b ELISA for MAC generation on IgG1, 2, 3, 4 (IgG, 1 µg)-coated plates

incubated with NHS with either the neutralizing anti-C1q antibody or BSA as control, showing a

significant reduction of MAC formation by the anti-C1q antibody, demonstrating the anti-C1q antibody

blocks classical complement activation initiated by IgG. Normal human serum with BSA produced

abundant MAC generation (positive control) whereas normal human serum with EDTA (negative

control) blocked MAC formation as expected.

2


81

17. Shetty VP, Mistry NF, Birdi TJ, Antia NH (1995) Effect of T-cell depletion on bacterial

multiplication and pattern of nerve damage in M. leprae-infected mice. Indian J Lepr 67:363-374.

18. Sindic CJ (2013) Infectious neuropathies. Curr Opin Neurol 26:510-515.

19. Sohi AS, Kandhari KC, Singh N (1971) Motor nerve conduction studies in leprosy. Int J Dermatol

10:151-155.

20. Stoll G, Jander S, Myers RR (2002) Degeneration and regeneration of the peripheral nervous

system: from Augustus Waller's observations to neuroinflammation. J Peripher Nerv Syst 7:13-

27.

21. Verhagen C, Faber W, Klatser P, Buffing A, et al. (1999) Immunohistological analysis of in situ

expression of mycobacterial antigens in skin lesions of leprosy patients across the

histopathological spectrum. Association of Mycobacterial lipoarabinomannan (LAM) and

Mycobacterium leprae phenolic glycolipid-I (PGL-I) with leprosy reactions. Am J Pathol

154:1793-1804.

22. Walport MJ (2001) Complement. First of two parts. N Engl J Med 344:1058-1066.

23. Walport MJ (2001) Complement. Second of two parts. N Engl J Med 344:1140-1144.

SUPPLEMENTARY FIGURES & TABLES

Fig S1. a ELISA for MAC generation on mannan (1 µg)-coated plates incubated with either normal

human serum (NHS) or MBL-deficient (MBL-/-) serum for 15 minutes at 37°C, showing significant

reduction of MAC formation in MBL-/- serum, demonstrating that MBL-/- serum blocks lectin pathway

activation initiated by mannan. b ELISA for MAC generation on IgG1, 2, 3, 4 (IgG, 1 µg)-coated plates

incubated with NHS with either the neutralizing anti-C1q antibody or BSA as control, showing a

significant reduction of MAC formation by the anti-C1q antibody, demonstrating the anti-C1q antibody

blocks classical complement activation initiated by IgG. Normal human serum with BSA produced

abundant MAC generation (positive control) whereas normal human serum with EDTA (negative

control) blocked MAC formation as expected.

Chapter 2

82

Fig S2. Myelin loss and axonal damage in nerves of leprosy patients. Immunohistochemistry for MBP

and the phosphorylated-neurofilament marker of axons, SMI31, showing intact myelin and axons in

control nerves (zoom a, b) whereas myelin loss and axonal damage are detected in nerves of

paucibacillary (c, d) and mutibacillary (e, f) leprosy patients. Quantification of the immunostainings

shows reduced immunoreactivity for MBP (g) and SMI31 (h) in both paucibacillary and multibacillary

nerves, indicating myelin loss and axonal damage in both groups. Notably, the amount of axonal

antigens are significantly more abundant in the multibacillary nerves compare to the paucibacillary (h)

(Student’s t-test paucibacillary versus multibacillary: p=0.02). Error bars indicate standard error of the

mean.

2


83

Fig S2. Myelin loss and axonal damage in nerves of leprosy patients. Immunohistochemistry for MBP

and the phosphorylated-neurofilament marker of axons, SMI31, showing intact myelin and axons in

control nerves (zoom a, b) whereas myelin loss and axonal damage are detected in nerves of

paucibacillary (c, d) and mutibacillary (e, f) leprosy patients. Quantification of the immunostainings

shows reduced immunoreactivity for MBP (g) and SMI31 (h) in both paucibacillary and multibacillary

nerves, indicating myelin loss and axonal damage in both groups. Notably, the amount of axonal

antigens are significantly more abundant in the multibacillary nerves compare to the paucibacillary (h)

(Student’s t-test paucibacillary versus multibacillary: p=0.02). Error bars indicate standard error of the

mean.

Chapter 2

84

Fig. S3. C3d deposition in nerves of leprosy patients. Immunohistochemistry for C3d on nerve

biopsies of controls (a) compared to paucibacillary (b) and multibacillary (c) leprosy patients. The

control nerves are negative for C3d (a) whereas the nerves of paucibacillary and multibacillary

patients show immunoreactivity for C3d (b, c and arrows). Quantification of the staining (d), shows a

significant higher amounts of C3d deposits in the nerves of multibacillary compared to paucibacillary

patients (Student’s t-test paucibacillary versus multibacillary: p=0.006). Error bars indicate standard

error of the mean.

Fig. S4. Bacterial Index (BI) is associated with C3d and MAC deposition in nerves of leprosy patients.

The amount of C3d (a) and C9 (b) immunoreactivity significantly correlated with the BI of

paucibacillary and multibacillary leprosy nerves (Pearson’s correlation, r=0.9692, p=0.0003 and

r=0.9682, p=0.0015 respectively), indicating an association between the M.leprae BI and complement

activation in leprosy nerves.

Table S1. Bacterial fractions (BEI Resources)

Catalogue number Product Description

NR-19329 Whole Cell Sonicate of gamma-irradiated -- Mycobacterium leprae

NR-19348 Lipoarabinomannan (LAM) -- Mycobacterium leprae

NR-19342 Phenolic Glycolipid-1 (PGL-1) -- Mycobacterium leprae

NR-19333 Cell Wall Fraction (MLCwA) -- Mycobacterium leprae

NR-19331 Cell Membrane Fraction (MLMA) -- Mycobacterium leprae

NR-14821 HN878 Gamma-irradiated Whole Cells – Mycobacterium tuberculosis

2


85

Fig. S3. C3d deposition in nerves of leprosy patients. Immunohistochemistry for C3d on nerve

biopsies of controls (a) compared to paucibacillary (b) and multibacillary (c) leprosy patients. The

control nerves are negative for C3d (a) whereas the nerves of paucibacillary and multibacillary

patients show immunoreactivity for C3d (b, c and arrows). Quantification of the staining (d), shows a

significant higher amounts of C3d deposits in the nerves of multibacillary compared to paucibacillary

patients (Student’s t-test paucibacillary versus multibacillary: p=0.006). Error bars indicate standard

error of the mean.

Fig. S4. Bacterial Index (BI) is associated with C3d and MAC deposition in nerves of leprosy patients.

The amount of C3d (a) and C9 (b) immunoreactivity significantly correlated with the BI of

paucibacillary and multibacillary leprosy nerves (Pearson’s correlation, r=0.9692, p=0.0003 and

r=0.9682, p=0.0015 respectively), indicating an association between the M.leprae BI and complement

activation in leprosy nerves.

Table S1. Bacterial fractions (BEI Resources)

Catalogue number Product Description

NR-19329 Whole Cell Sonicate of gamma-irradiated -- Mycobacterium leprae

NR-19348 Lipoarabinomannan (LAM) -- Mycobacterium leprae

NR-19342 Phenolic Glycolipid-1 (PGL-1) -- Mycobacterium leprae

NR-19333 Cell Wall Fraction (MLCwA) -- Mycobacterium leprae

NR-19331 Cell Membrane Fraction (MLMA) -- Mycobacterium leprae

NR-14821 HN878 Gamma-irradiated Whole Cells – Mycobacterium tuberculosis

Chapter 2

86

Table S2. Antibody, source, dilution

Antibody Detects Source Dilution

Polyclonal rabbit anti-rat C9

(cross-reacts with human C9)

MAC Made in house

(B.P. Morgan)

1:200’

Polyclonal rabbit anti-human MBP Myelin Dako (A0623) 1:100*

Polyclonal rabbit anti-mouse

Neurofilament

Axons Abcam (ab8135) 1:1000*

Polyclonal rabbit anti-mouse S100β Schwann cells Dako (Z0311) 1:400*

Polyclonal rabbit anti-mouse Iba-1 Macrophages Wako (019-19741) 1:200*

Monoclonal mouse anti-M. leprae PGL-1 Phenolic glycolipid-1 Made in house

(P.K. Das)

1:200’

Polyclonal rabbit anti-human C3d C3dg Dako (A0063) 1:200*

Monoclonal mouse anti-LAM LAM Made in house

(P.K. Das)

1:200’

Monoclonal mouse anti-human

phosphorylated neurofilament (clone

SMI31)

Axons Sternberger

Monoclonals Inc.

1:1000’

Antigen retrieval was performed with either 10mM Tris 1mM EDTA pH 9’ or 10mM Sodium Citrate pH 6*

Table S3. Characterization of nerve biopsies and clinical data of leprosy patients and controls

Case Nerve biopsy Leprosy type Gender Age

diagnosis

(in years)

Treatment

1 ulnar - F Unknown -

2 sural - F 50 -

3 sural - M 54 -

4 sural - M 45 -

5 sural - F 60 -

6 sural Paucibacillary M 65 MDT

7 sural Paucibacillary M Unknown Unknown

8 ulnar Paucibacillary M 59 MDT

9 ulnar Paucibacillary M 52 ROM

10 sural Paucibacillary F 43 MDT

11 sural Multibacillary F 28 DDS

12 sural Multibacillary F 43 MDT

13 fibular Multibacillary M Unknown Unknown

14 ulnar Multibacillary M 36 MDT

15 ulnar Multibacillary M 27 Unknown

16 sural Multibacillary M 43 DDS, MDT

17 ulnar Multibacillary M 49 MDT, Thalimidoglutarimide

Prednisolone

F, female; M, male; MDT, multidrug therapy; DDS, diamino diphenyl sulphone; ROM, rifampicin,

ofloxacin and minocycline.

2


87

Table S2. Antibody, source, dilution

Antibody Detects Source Dilution



MAC Made in house

(B.P. Morgan)

1:200’

Polyclonal rabbit anti-human MBP Myelin Dako (A0623) 1:100*

Polyclonal rabbit anti-mouse

Neurofilament

Axons Abcam (ab8135) 1:1000*

Polyclonal rabbit anti-mouse S100β Schwann cells Dako (Z0311) 1:400*

Polyclonal rabbit anti-mouse Iba-1 Macrophages Wako (019-19741) 1:200*

Monoclonal mouse anti-M. leprae PGL-1 Phenolic glycolipid-1 Made in house

(P.K. Das)

1:200’

Polyclonal rabbit anti-human C3d C3dg Dako (A0063) 1:200*


(P.K. Das)

1:200’



SMI31)

Axons Sternberger

Monoclonals Inc.

1:1000’


Table S3. Characterization of nerve biopsies and clinical data of leprosy patients and controls

Case Nerve biopsy Leprosy type Gender Age

diagnosis

(in years)

Treatment

1 ulnar - F Unknown -

2 sural - F 50 -

3 sural - M 54 -

4 sural - M 45 -

5 sural - F 60 -

6 sural Paucibacillary M 65 MDT

7 sural Paucibacillary M Unknown Unknown

8 ulnar Paucibacillary M 59 MDT

9 ulnar Paucibacillary M 52 ROM

10 sural Paucibacillary F 43 MDT

11 sural Multibacillary F 28 DDS

12 sural Multibacillary F 43 MDT

13 fibular Multibacillary M Unknown Unknown

14 ulnar Multibacillary M 36 MDT

15 ulnar Multibacillary M 27 Unknown

16 sural Multibacillary M 43 DDS, MDT

17 ulnar Multibacillary M 49 MDT, Thalimidoglutarimide

Prednisolone

F, female; M, male; MDT, multidrug therapy; DDS, diamino diphenyl sulphone; ROM, rifampicin,

ofloxacin and minocycline.

Maria Rita (70, hier met kleinzoon) is genezen van lepra. Door de ziekte heeft ze

geen gevoel meer in haar handen, maar wat lepra precies is, vindt ze moeilijk te

omschrijven. Haar vrienden heeft ze niets verteld.


Complement Activation In Leprosy: A Retrospective Study

Shows Elevated Circulating Terminal Complement Complex In

Reactional Leprosy

Nawal Bahia El Idrissi1, Svetlana Hakobyan2, Valeria Ramaglia1, Annemieke Geluk3,

B. Paul Morgan2, Pranab Kumar Das1,4 and Frank Baas1 Clinical Experimental

Immunology, 2016 January.

1 Department of Genome Analysis, Academic Medical Center, Amsterdam, 1105 AZ, The

Netherlands; 2 Institute of Infection and Immunity, School of Medicine, Cardiff University,

Cardiff, CF14 4YU, United Kingdom; 3 Department of Infectious Diseases, Leiden University

Medical Centre, Leiden, 2333 ZA, The Netherlands.; 4 Department of Clinical Immunology,

Colleges of Medical and Dental Sciences, University of Birmingham, Birmingham, UK

Maria Rita (70, hier met kleinzoon) is genezen van lepra. Door de ziekte heeft ze

geen gevoel meer in haar handen, maar wat lepra precies is, vindt ze moeilijk te

omschrijven. Haar vrienden heeft ze niets verteld.


Complement Activation In Leprosy: A Retrospective Study

Shows Elevated Circulating Terminal Complement Complex In

Reactional Leprosy

Nawal Bahia El Idrissi1, Svetlana Hakobyan2, Valeria Ramaglia1, Annemieke Geluk3,

B. Paul Morgan2, Pranab Kumar Das1,4 and Frank Baas1 Clinical Experimental

Immunology, 2016 January.

1 Department of Genome Analysis, Academic Medical Center, Amsterdam, 1105 AZ, The

Netherlands; 2 Institute of Infection and Immunity, School of Medicine, Cardiff University,

Cardiff, CF14 4YU, United Kingdom; 3 Department of Infectious Diseases, Leiden University

Medical Centre, Leiden, 2333 ZA, The Netherlands.; 4 Department of Clinical Immunology,

Colleges of Medical and Dental Sciences, University of Birmingham, Birmingham, UK

3

Chapter 3

90

Summary

Mycobacterium leprae (M. leprae) infection gives rise to the immunologically and

histopathologically classified spectrum of leprosy. At present several tools for the

stratification of patients are based on acquired immunity markers. However, the role

of innate immunity, particularly the complement system, is largely unexplored. The

present retrospective study was undertaken to explore whether the systemic levels of

complement activation components and regulators can stratify leprosy patients,

particularly in reference to the reactional state of the disease.

Serum samples from two cohorts were analyzed. The cohort from Bangladesh

included multibacillary (MB) patients with (n=12) or without (n=46) reaction (R) at

intake and endemic controls (n=20). The cohort from Ethiopia included paucibacillary

(PB; n= 7) and MB (n= 23) patients without reaction and MB (n=15) patients with

reaction.

The results showed that the activation products terminal complement complex (TCC)

(p ≤0.01), C4d (p ≤0.05) and iC3b (p ≤0.05) were specifically elevated in Bangladeshi

patients with reaction at intake compared to endemic controls. In addition, levels of

the regulator Clusterin (p ≤0.001 without R; p<0.05 with R) were also elevated in MB

patients irrespective of a reaction. Similar analysis of the Ethiopian cohort confirmed

that irrespective of a reaction, serum TCC levels were significantly increased in

patients with reactions compared to patients without reactions (p ≤0.05).

Our findings suggests that serum TCC levels may prove to be a valuable tool in

diagnosing patients at risk of developing reactions.

Keywords. Complement, Leprosy, Reactions

Introduction

Leprosy is a chronic debilitating disease caused by Mycobacterium leprae (M.

leprae), an obligate intracellular parasite with tropism for macrophages and Schwann

cells. Effective treatment with multi drug therapy (MDT) has reduced the prevalence

around the world, although new case detection has remained stable at around

200,000 per annum. Nevertheless, the disease is still endemic in several parts of the

world, including parts of Bangladesh, Ethiopia, Brazil and Nepal

(http://www.who.int/mediacentre/factsheets/).

Although the infection is asymptomatic for a prolonged period, the disease eventually

presents with nerve damage, which is the major cause of patients’ disability and

deformities. On the basis of clinical, histopathological and immunological criteria

leprosy is recognized as a spectral disease [1]. The inter-individual variablity of

acquired immune response to M. leprae and its antigens dictates the clinical,

histopathological and immunological spectrum of leprosy [2]. As a result, it is now

well established that the leprosy spectrum fluctuates between two poles: tuberculoid

leprosy (TT) with a strong M. leprae specific T-helper 1 (Th1) cell-mediated immunity

associated with negligible bacillary load, and lepromatous leprosy (LL) with a strong

antibody response to M. leprae, phenolic glycolipid- 1 (PGL-I) accompanied by

complete absence of M. leprae specific Th1 response. The polar LL patients show

high bacillary load in relation to T-cell anergy to M. leprae not only in the lesions, but

also in other tissues in a disseminated manner. Between the two polar forms, the

majority of patients belong to immunologically unstable borderline categories that

are classified as borderline tuberculoid (BT), mid-borderline (BB) and borderline

lepromatous (BL) with variable degree of bacillary load with an increasing trend from

3

Complement in serum of leprosy patients

91

Summary

Mycobacterium leprae (M. leprae) infection gives rise to the immunologically and

histopathologically classified spectrum of leprosy. At present several tools for the

stratification of patients are based on acquired immunity markers. However, the role

of innate immunity, particularly the complement system, is largely unexplored. The

present retrospective study was undertaken to explore whether the systemic levels of

complement activation components and regulators can stratify leprosy patients,

particularly in reference to the reactional state of the disease.

Serum samples from two cohorts were analyzed. The cohort from Bangladesh

included multibacillary (MB) patients with (n=12) or without (n=46) reaction (R) at

intake and endemic controls (n=20). The cohort from Ethiopia included paucibacillary

(PB; n= 7) and MB (n= 23) patients without reaction and MB (n=15) patients with

reaction.

The results showed that the activation products terminal complement complex (TCC)

(p ≤0.01), C4d (p ≤0.05) and iC3b (p ≤0.05) were specifically elevated in Bangladeshi

patients with reaction at intake compared to endemic controls. In addition, levels of

the regulator Clusterin (p ≤0.001 without R; p<0.05 with R) were also elevated in MB

patients irrespective of a reaction. Similar analysis of the Ethiopian cohort confirmed

that irrespective of a reaction, serum TCC levels were significantly increased in

patients with reactions compared to patients without reactions (p ≤0.05).

Our findings suggests that serum TCC levels may prove to be a valuable tool in

diagnosing patients at risk of developing reactions.

Keywords. Complement, Leprosy, Reactions

Introduction

Leprosy is a chronic debilitating disease caused by Mycobacterium leprae (M.

leprae), an obligate intracellular parasite with tropism for macrophages and Schwann

cells. Effective treatment with multi drug therapy (MDT) has reduced the prevalence

around the world, although new case detection has remained stable at around

200,000 per annum. Nevertheless, the disease is still endemic in several parts of the

world, including parts of Bangladesh, Ethiopia, Brazil and Nepal

(http://www.who.int/mediacentre/factsheets/).

Although the infection is asymptomatic for a prolonged period, the disease eventually

presents with nerve damage, which is the major cause of patients’ disability and

deformities. On the basis of clinical, histopathological and immunological criteria

leprosy is recognized as a spectral disease [1]. The inter-individual variablity of

acquired immune response to M. leprae and its antigens dictates the clinical,

histopathological and immunological spectrum of leprosy [2]. As a result, it is now

well established that the leprosy spectrum fluctuates between two poles: tuberculoid

leprosy (TT) with a strong M. leprae specific T-helper 1 (Th1) cell-mediated immunity

associated with negligible bacillary load, and lepromatous leprosy (LL) with a strong

antibody response to M. leprae, phenolic glycolipid- 1 (PGL-I) accompanied by

complete absence of M. leprae specific Th1 response. The polar LL patients show

high bacillary load in relation to T-cell anergy to M. leprae not only in the lesions, but

also in other tissues in a disseminated manner. Between the two polar forms, the

majority of patients belong to immunologically unstable borderline categories that

are classified as borderline tuberculoid (BT), mid-borderline (BB) and borderline

lepromatous (BL) with variable degree of bacillary load with an increasing trend from

Chapter 3

92

BT towards BL/LL. On the basis of bacillary indices of the lesions, LL together with

BB and BL are collectively grouped as multibacillary (MB), whereas the BT and TT

forms are grouped as paucibacillary (PB) [1].

MDT is effective in curing leprosy to a large extent as, in the majority of MB patients,

the dead bacilli are cleared steadily. However, a considerable number of patients

show a changing clinical and immunohistopathological status in the course of the

disease as well as during and post-treatment either as a result of treatment or as a

natural evolution of the disease. Such episodic disease status is widely recognized

as reactional state, resulting in clinical and pathological alterations accompanied by

exacerbation of tissue (particularly) nerve damage [3,4].

The change in immunological response results in one of two types of reactions: i)

reversal reaction (RR, also called type 1 reaction) primarily encountered with patients

with BT and BL category or ii) erythema nodosum leprosum (ENL, also called type 2

reaction), especially in the borderline and lepromatous region of the spectrum. Both

these episodic reactions appear to be due to the persistence of antigens like

lipoarabinomannan (LAM) or PGL-I [5]. Interestingly, the localization of persisting M.

leprae antigens in leprosy patients with nerve damage was also demonstrated by

Shetty VP et al [6].

In general, RR or type 1 reactions are due to the polarization of M. leprae specific T-

cell activity with the cytokine characteristic of Th1 profile [7,8], and usually occur

early in the course of treatment and result in an increased cellular immune response

to mycobacterial antigens.

On the other hand, ENL or type 2 reactions are due to the increased T-cell

dependent antibody production (specifically to M. leprae antigens or to treatment

drugs) resulting in immune complex formation and complement activation [9-13].

Accordingly, efforts to establish sets of biomarkers for laboratory diagnosis and

prognosis of leprosy spectrum and leprosy reactions has concentrated on acquired

immunity-based cytokine and antibody profiling of the patients [14-17]. In contrast,

biomarkers of innate immunity in leprosy pathomechanism have received little

attention. Indeed, studies linking biomarkers of innate immunity in regards to the role

of complement in leprosy disease state, particularly to the reactional state, are rare

in literature.

The complement system is an integral part of innate immunity, comprising more than

30 serum and cell-associated proteins and plays an important role in host immunity

and inflammation[18]. Its activation and regulation occurs via multiple pathways.

Complement activation can be triggered by antigen-antibody complexes (classical

pathway), foreign surfaces (alternative pathway) or bacterial sugars (lectin pathway).

Regardless of the trigger, activation results in the cleavage of C3, generating the

anaphylatoxin C3a and the opsonin C3b, the latter of which binds pathogens thereby

mediating clearance by phagocytes. C3b is also required for the formation of the C5

convertase, to cleave C5 into C5a and C5b. C5b initiates activation of the terminal

pathway, which results in the formation of the membrane attack complex (MAC)

comprising a heteropolymer of C5b, C6, C7, C8 and multiple C9 molecules that

forms transmembrane channels in the target cell, resulting in lysis.

Deposits of MAC or the soluble terminal complement complex (TCC) were

demonstrated in association with damaged nerve in leprosy patients[19]. In this

3


93

BT towards BL/LL. On the basis of bacillary indices of the lesions, LL together with

BB and BL are collectively grouped as multibacillary (MB), whereas the BT and TT

forms are grouped as paucibacillary (PB) [1].

MDT is effective in curing leprosy to a large extent as, in the majority of MB patients,

the dead bacilli are cleared steadily. However, a considerable number of patients

show a changing clinical and immunohistopathological status in the course of the

disease as well as during and post-treatment either as a result of treatment or as a

natural evolution of the disease. Such episodic disease status is widely recognized

as reactional state, resulting in clinical and pathological alterations accompanied by

exacerbation of tissue (particularly) nerve damage [3,4].

The change in immunological response results in one of two types of reactions: i)

reversal reaction (RR, also called type 1 reaction) primarily encountered with patients

with BT and BL category or ii) erythema nodosum leprosum (ENL, also called type 2

reaction), especially in the borderline and lepromatous region of the spectrum. Both

these episodic reactions appear to be due to the persistence of antigens like

lipoarabinomannan (LAM) or PGL-I [5]. Interestingly, the localization of persisting M.

leprae antigens in leprosy patients with nerve damage was also demonstrated by

Shetty VP et al [6].

In general, RR or type 1 reactions are due to the polarization of M. leprae specific T-

cell activity with the cytokine characteristic of Th1 profile [7,8], and usually occur

early in the course of treatment and result in an increased cellular immune response

to mycobacterial antigens.

On the other hand, ENL or type 2 reactions are due to the increased T-cell

dependent antibody production (specifically to M. leprae antigens or to treatment

drugs) resulting in immune complex formation and complement activation [9-13].

Accordingly, efforts to establish sets of biomarkers for laboratory diagnosis and

prognosis of leprosy spectrum and leprosy reactions has concentrated on acquired

immunity-based cytokine and antibody profiling of the patients [14-17]. In contrast,

biomarkers of innate immunity in leprosy pathomechanism have received little

attention. Indeed, studies linking biomarkers of innate immunity in regards to the role

of complement in leprosy disease state, particularly to the reactional state, are rare

in literature.

The complement system is an integral part of innate immunity, comprising more than

30 serum and cell-associated proteins and plays an important role in host immunity

and inflammation[18]. Its activation and regulation occurs via multiple pathways.

Complement activation can be triggered by antigen-antibody complexes (classical

pathway), foreign surfaces (alternative pathway) or bacterial sugars (lectin pathway).

Regardless of the trigger, activation results in the cleavage of C3, generating the

anaphylatoxin C3a and the opsonin C3b, the latter of which binds pathogens thereby

mediating clearance by phagocytes. C3b is also required for the formation of the C5

convertase, to cleave C5 into C5a and C5b. C5b initiates activation of the terminal

pathway, which results in the formation of the membrane attack complex (MAC)

comprising a heteropolymer of C5b, C6, C7, C8 and multiple C9 molecules that

forms transmembrane channels in the target cell, resulting in lysis.

Deposits of MAC or the soluble terminal complement complex (TCC) were

demonstrated in association with damaged nerve in leprosy patients[19]. In this

Chapter 3

94

context, we recently showed the association between persistence of the M. leprae

antigen LAM and complement activation in the damaged nerve. This finding strongly

suggests that complement activation plays a causal role in nerve damage in leprosy.

Since nerve damage is prominent in reactional episodes it is rational to speculate

that complement activation and formation of TCC or MAC can be valuable in

diagnosing leprosy patients without reaction from those with reactions. There are

only a few studies on serology of complement activation in leprosy reported in the

literature [20-23]. PPrevious serological studies showed 1) reduced complement


complement in the circulation via activation of the classical or lectin pathway [23,24];

2) an increased C1q binding activity (the initiator of classical pathway activation) in

LL patients with ENL reactions suggesting involvement of the classical pathway in

these patients, and increased C3d levels in 70% of patients with ENL and 18% of

patients with uncomplicated LL. Such findings suggested that C3d could be a marker

of complement activation which may be of some practical interest in the early

diagnosis of reactional state [12]. Thus, taking the literature findings with our own, we

decided to reinvestigate the use of serological markers of complement activation in

leprosy reaction, which is the major cause of leprosy-associated nerve damage.

In this retrospective study we used a state-of-the-art multiplex assay set (Meso

Scale) for the quantification of complement activation products and regulators in

serum of patients and controls to test whether the quantification of complement

products might be valuable in diagnosing leprosy patients without reaction from those

with reactions.


Serum samples

Serum samples were obtained from stored serum bank collected for a prospective

cohort study in two leprosy endemic regions, Bangladesh and Ethiopia [25]. Ethical

approval of the study-protocol was obtained through appropriate ethics committees

and written informed consent was obtained from the patients before the samples

were collected.

These samples were transported to the LUMC, Leiden, Netherlands for storage. It

should be stated with clarity that the serum samples were collected and stored under

conditions found suitable for another study [25]; complement assay require special

addition of EDTA which was not included in the collection of these sera. We have

refrained from dealing with the types of reactions , as the patients’ samples are

obtained from archive of stored specimens and not with the aim of longitudinal study.

Serum samples were stored at -20◦C or below and shipped frozen on dry ice.

Briefly, in this study we used biobanked serum samples of untreated leprosy patients

without clinical reactions ( and before MDT) and newly diagnosed patients who

visited clinics with reactions and sera were collected in a similar fashion and before

starting treatment. In addition, we had the opportunity to follow up four of these

patients with reaction and also collected samples after the completion of treatment.

Serum samples from the Bangladesh cohort consisted of MB patients with (n=12) or

without (n=46) reactions at intake and endemic controls lacking clinical signs and

symptoms of leprosy or TB (n=20); a replication cohort comprised serum samples of

PB (TT and BT) (n=7), multibacillary (BL and LL) without (n=23) and with reaction

3


95

context, we recently showed the association between persistence of the M. leprae

antigen LAM and complement activation in the damaged nerve. This finding strongly

suggests that complement activation plays a causal role in nerve damage in leprosy.

Since nerve damage is prominent in reactional episodes it is rational to speculate

that complement activation and formation of TCC or MAC can be valuable in

diagnosing leprosy patients without reaction from those with reactions. There are

only a few studies on serology of complement activation in leprosy reported in the

literature [20-23]. PPrevious serological studies showed 1) reduced complement


complement in the circulation via activation of the classical or lectin pathway [23,24];

2) an increased C1q binding activity (the initiator of classical pathway activation) in

LL patients with ENL reactions suggesting involvement of the classical pathway in

these patients, and increased C3d levels in 70% of patients with ENL and 18% of

patients with uncomplicated LL. Such findings suggested that C3d could be a marker

of complement activation which may be of some practical interest in the early

diagnosis of reactional state [12]. Thus, taking the literature findings with our own, we

decided to reinvestigate the use of serological markers of complement activation in

leprosy reaction, which is the major cause of leprosy-associated nerve damage.

In this retrospective study we used a state-of-the-art multiplex assay set (Meso

Scale) for the quantification of complement activation products and regulators in

serum of patients and controls to test whether the quantification of complement

products might be valuable in diagnosing leprosy patients without reaction from those

with reactions.


Serum samples

Serum samples were obtained from stored serum bank collected for a prospective

cohort study in two leprosy endemic regions, Bangladesh and Ethiopia [25]. Ethical

approval of the study-protocol was obtained through appropriate ethics committees

and written informed consent was obtained from the patients before the samples

were collected.

These samples were transported to the LUMC, Leiden, Netherlands for storage. It

should be stated with clarity that the serum samples were collected and stored under

conditions found suitable for another study [25]; complement assay require special

addition of EDTA which was not included in the collection of these sera. We have

refrained from dealing with the types of reactions , as the patients’ samples are

obtained from archive of stored specimens and not with the aim of longitudinal study.

Serum samples were stored at -20◦C or below and shipped frozen on dry ice.

Briefly, in this study we used biobanked serum samples of untreated leprosy patients

without clinical reactions ( and before MDT) and newly diagnosed patients who

visited clinics with reactions and sera were collected in a similar fashion and before

starting treatment. In addition, we had the opportunity to follow up four of these

patients with reaction and also collected samples after the completion of treatment.

Serum samples from the Bangladesh cohort consisted of MB patients with (n=12) or

without (n=46) reactions at intake and endemic controls lacking clinical signs and

symptoms of leprosy or TB (n=20); a replication cohort comprised serum samples of

PB (TT and BT) (n=7), multibacillary (BL and LL) without (n=23) and with reaction

Chapter 3

96

(n=15) from Ethiopia (Table 1). No endemic control samples were tested for the

Ethiopian cohort.

Table 1. Demographic and clinical data of cases and controls for serological studies

Number of cases Female/male ratio Age Ethnicity Leprosy Type

20 7: 13 22-45 Bangladesh Endemic controls

46 12:22 20-41 Bangladesh MB, No reaction

47 5:14 18-44 Bangladesh MB, Reaction

7 3:4 24-46 Ethiopia PB (TT/BT), No reaction

23 10:13 16- 41 Ethiopia MB (BL/LL), No reaction

15 3:13 18- 44 Ethiopia MB, Reaction

Meso Scale Discovery (MSD) platform

All the complement assays were performed on a novel multiplex developed using the

MesoScale Discovery Platform (MSD; Gaithersburg, MD; www.mesoscale.com). The

multiplex set comprised C1s, the activation markers C4d, Bb, iC3b and TCC, and the

regulators FH (using FH Y402, FH H402 monoclonal antibodies which quantifies the

concentration of total factor H as described previously [26]) and clusterin (Table 2).

All the in-house antibodies were initially established as ELISA assays for evaluating

the level of compliment activation products on the MSD platform. The assays were

extensively validated, and the results were described in details previously [26,27].

Antibody-coated plates were blocked with BSA/EDTA/PBS, serum samples and

standards diluted in BSA/EDTA/PBS added to wells and incubated for 1 hour at RT

on a shaker. Plates were washed, the detecting antibody cocktail added to the plate

(Table 2) and incubated for 1 hour at RT on a shaker. After washing, the reading

buffer (R92TC-2; MesoScale Diagnostics) was added and plates were read on a

MSD Sector Imager 6000 instrument. The data were analyzed using SoftMax Pro 4.6

Enterprise Edition (Molecular Devices LLC, Sunnyvale, CA, USA).

3


97

(n=15) from Ethiopia (Table 1). No endemic control samples were tested for the

Ethiopian cohort.

Table 1. Demographic and clinical data of cases and controls for serological studies

Number of cases Female/male ratio Age Ethnicity Leprosy Type

20 7: 13 22-45 Bangladesh Endemic controls

46 12:22 20-41 Bangladesh MB, No reaction

47 5:14 18-44 Bangladesh MB, Reaction

7 3:4 24-46 Ethiopia PB (TT/BT), No reaction

23 10:13 16- 41 Ethiopia MB (BL/LL), No reaction

15 3:13 18- 44 Ethiopia MB, Reaction

Meso Scale Discovery (MSD) platform

All the complement assays were performed on a novel multiplex developed using the

MesoScale Discovery Platform (MSD; Gaithersburg, MD; www.mesoscale.com). The

multiplex set comprised C1s, the activation markers C4d, Bb, iC3b and TCC, and the

regulators FH (using FH Y402, FH H402 monoclonal antibodies which quantifies the

concentration of total factor H as described previously [26]) and clusterin (Table 2).

All the in-house antibodies were initially established as ELISA assays for evaluating

the level of compliment activation products on the MSD platform. The assays were

extensively validated, and the results were described in details previously [26,27].

Antibody-coated plates were blocked with BSA/EDTA/PBS, serum samples and

standards diluted in BSA/EDTA/PBS added to wells and incubated for 1 hour at RT

on a shaker. Plates were washed, the detecting antibody cocktail added to the plate

(Table 2) and incubated for 1 hour at RT on a shaker. After washing, the reading

buffer (R92TC-2; MesoScale Diagnostics) was added and plates were read on a

MSD Sector Imager 6000 instrument. The data were analyzed using SoftMax Pro 4.6

Enterprise Edition (Molecular Devices LLC, Sunnyvale, CA, USA).

Chapter 3

98

Table 2. Antibodies for the MSD assays

Statistical analysis

Data analysis was performed using GraphPad Prism version 5.0 (GraphPad

Software Inc, San Diego, CA, USA) statistical package. Student’s t test was

performed for statistical analyses comparing two groups. For comparison of more

than two groups, one-way ANOVA with Bonferroni multiple comparison post-hoc test

was used when the data was normally distributed. For non-normally distributed data

the Kruskal-Wallis test was used. Differences were considered statistically significant

when p ≤ 0.05. The data is presented and expressed as standard error (SE) of the

mean.

Assay Coating Antibody (source) Detection Antibody (source)

C1s M81 (Hycult) F33 (in-house, BPM)

C4d Neo C4d (A251, Quidel) C4d (A213, Quidel)

Bb Neo Bb (A252, Quidel) JC1 (in-house, BPM)

iC3b Neo iC3b (Hycult) C3-30 (in-house, BPM)

TCC aE11 (Hycult) E2 (in-house, BPM)

FH Y402 MBI-6 (in-house, BPM) Ox-24

FH H402 MBI-7 (in-house, BPM) Ox-24

Clusterin Polyclonal-Anti-Apolipoprotein

J (AB825, Milipore)

MBI-40 (in-house, BPM)

Results

Complement activation and regulation in multibacillary leprosy patients with or

without reaction from Bangladesh

Selected complement components, activation products and regulators were

measured in serum samples of leprosy patients with or without a reaction from

Bangladesh and endemic controls collected under similar conditions and all samples

were collected before start of MDT. Analytes were selected in part to interrogate

different parts of the complement activation cascade in order to assess the

contributions of different activation pathways. Complement components, regulators

and activation products were measured on a novel multiplex built on the MSD

platform. The Bangladesh leprosy population showed no significant difference in

serum C1s values compared to controls (p= 0.442) (data is shown in table 3). Levels

of the classical/lectin pathway activation fragment C4d (p <0.001 without R; p <0.001

R) and the alternative pathway fragment Bb (p <0.01 without R; p <0.001 R) were

significantly increased in MB leprosy patients with or without reaction compared to

endemic controls (Figure 1A and B). C4d levels were also significantly increased in

patients with reaction compared to patients without a reaction (p <0.05) (Figure 1A).

The increased serum levels of C4d in the leprosy reaction patients suggest the

involvement of the classical and/or lectin pathway in the reaction process.

The levels of the activation pathway fragment iC3b and the terminal pathway

activation marker TCC were significantly raised in leprosy patients with a reaction

compared to endemic controls (p <0.05 and p <0.01, respectively), showing further

evidence for increased complement activation in reactions (Figure 1C and D). Four

patients from Bangladesh that were followed up after treatment showed that the TCC

3


99

Table 2. Antibodies for the MSD assays








when p ≤ 0.05. The data is presented and expressed as standard error (SE) of the

mean.

Assay Coating Antibody (source) Detection Antibody (source)

C1s M81 (Hycult) F33 (in-house, BPM)

C4d Neo C4d (A251, Quidel) C4d (A213, Quidel)

Bb Neo Bb (A252, Quidel) JC1 (in-house, BPM)

iC3b Neo iC3b (Hycult) C3-30 (in-house, BPM)

TCC aE11 (Hycult) E2 (in-house, BPM)

FH Y402 MBI-6 (in-house, BPM) Ox-24

FH H402 MBI-7 (in-house, BPM) Ox-24

Clusterin Polyclonal-Anti-Apolipoprotein

J (AB825, Milipore)

MBI-40 (in-house, BPM)

Results

Complement activation and regulation in multibacillary leprosy patients with or

without reaction from Bangladesh

Selected complement components, activation products and regulators were

measured in serum samples of leprosy patients with or without a reaction from

Bangladesh and endemic controls collected under similar conditions and all samples

were collected before start of MDT. Analytes were selected in part to interrogate

different parts of the complement activation cascade in order to assess the

contributions of different activation pathways. Complement components, regulators

and activation products were measured on a novel multiplex built on the MSD

platform. The Bangladesh leprosy population showed no significant difference in

serum C1s values compared to controls (p= 0.442) (data is shown in table 3). Levels

of the classical/lectin pathway activation fragment C4d (p <0.001 without R; p <0.001

R) and the alternative pathway fragment Bb (p <0.01 without R; p <0.001 R) were

significantly increased in MB leprosy patients with or without reaction compared to

endemic controls (Figure 1A and B). C4d levels were also significantly increased in

patients with reaction compared to patients without a reaction (p <0.05) (Figure 1A).

The increased serum levels of C4d in the leprosy reaction patients suggest the

involvement of the classical and/or lectin pathway in the reaction process.

The levels of the activation pathway fragment iC3b and the terminal pathway

activation marker TCC were significantly raised in leprosy patients with a reaction

compared to endemic controls (p <0.05 and p <0.01, respectively), showing further

evidence for increased complement activation in reactions (Figure 1C and D). Four

patients from Bangladesh that were followed up after treatment showed that the TCC

Chapter 3

100

levels stay high even after treatment (supplement figure 1). This suggests that

treatment with either multidrug therapy or steroids does not lower complement serum

levels in reaction patients.

Serum levels of Factor H (FH), the principle plasma regulator of the alternative

pathway, and clusterin, a plasma regulator of the TCC, were also analyzed in serum

samples of MB patients with or without reaction from Bangladesh. Total FH levels did

not show a significant difference between leprosy patients with or without a reaction

compared to controls (p=0.149) (data is shown in table 3).

Clusterin levels in leprosy patients with or without reaction were significantly higher

than endemic controls (p <0.05 without R; p <0.001 with R) (Figure 1E), but not

different between the patient groups.

Fig. 1. Complement activation and regulation in multibacillary leprosy patients with and without

reactions from Bangladesh. MSD platform for measuring complement activation products C4d (A), Bb

(B), iC3b (C), TCC (D) and clusterin (E) in serum from endemic controls (n= 20) and multibacillary

leprosy patients with (n=12) or without (n= 46) reaction at intake, showing a significant increase in

multibacillary leprosy patients with and without reaction compared controls for all measured

components (p=<0.05). C4d levels are specifically and significantly increased in patients with reaction

compared to those without reaction (B) [mean C4d no reaction 8.83 mg/l (SE 0,77) versus mean C4d

3


101

levels stay high even after treatment (supplement figure 1). This suggests that

treatment with either multidrug therapy or steroids does not lower complement serum

levels in reaction patients.

Serum levels of Factor H (FH), the principle plasma regulator of the alternative

pathway, and clusterin, a plasma regulator of the TCC, were also analyzed in serum

samples of MB patients with or without reaction from Bangladesh. Total FH levels did

not show a significant difference between leprosy patients with or without a reaction

compared to controls (p=0.149) (data is shown in table 3).

Clusterin levels in leprosy patients with or without reaction were significantly higher

than endemic controls (p <0.05 without R; p <0.001 with R) (Figure 1E), but not

different between the patient groups.

Fig. 1. Complement activation and regulation in multibacillary leprosy patients with and without

reactions from Bangladesh. MSD platform for measuring complement activation products C4d (A), Bb

(B), iC3b (C), TCC (D) and clusterin (E) in serum from endemic controls (n= 20) and multibacillary

leprosy patients with (n=12) or without (n= 46) reaction at intake, showing a significant increase in

multibacillary leprosy patients with and without reaction compared controls for all measured

components (p=<0.05). C4d levels are specifically and significantly increased in patients with reaction

compared to those without reaction (B) [mean C4d no reaction 8.83 mg/l (SE 0,77) versus mean C4d

Chapter 3

102

Reaction 13.41 mg/l (SE 1,60); P < 0.05]. In addition, Clusterin levels were significantly increased in

serum of multibacillary leprosy patients compared to endemic controls, but no difference between

patients with or without reactions (E) [mean clusterin no reaction 398,0 mg/l (SE 10,15 ); P = <0.001

versus mean clusterin Reaction 378,9 mg/l (SE 15,87); P =<0.05]. The error bars represent the

standard error of the mean.

Table 3. Complement levels in the Bangladeshi cohort

Endemic controls MB patients without

reaction

MB patients with

reaction

Bagladeshi

cohort

Mean (mg/l) SE (mg/l) Mean (mg/l) SE (mg/l) Mean (mg/l) SE (mg/l)

C1s 94,69 2,77 99,41 3,07 90,66 4,84

C4d 3,46 0,39 8,83 0,77 13,41 1,60

Bb 16,53 1,92 24,26 0,98 28,12 1,96

iC3b 5,42 0,63 8,63 0,81 12,05 2,71

TCC 1,87 0,15 2,27 0,09 2,56 0,10

Factor H 253,7 15,82 277,3 11,28 231,6 21,97

Clusterin 297,3 19,74 398,0 10,15 378,9 15,87

TCC levels are increased in serum of multibacillary leprosy patients with

reaction compared to patients without reaction from Ethiopia

In the preceding section results using the leprosy serum samples from Bangladesh

data indicate that levels of complement activation products were higher in patients

with reaction compared to those without – significantly so for C4d and trending for

iC3b and TCC. We therefore surmised that these markers could be used as an

indicator for identifying patients with reactions. In order to substantiate this finding we

measured the levels of these complement activation products in serum samples of an

Ethiopian leprosy cohort. These samples were also collected before start of MDT and

classified as PB (TT and BT) or MB (BL and LL) leprosy patients without reaction and

MB patients with reaction. In these samples, like those of Bangladesh, no significant

difference was found in the level of C1s in serum of MB compared to PB patients

without reaction (p= 0.384) (data is shown in table 4). Serum levels of the

complement activation products in MB patients compared to PB patients without a

reaction were significantly increased for C4d (p= 0.04), Bb (p= 0.03) iC3b (p= 0.02 )

and TCC (p= 0.003) (Supplement figure 2). No significant difference was found in

the levels of C4d and Bb in the MB leprosy patients without reaction compared to the

patients with a reaction (p= 0.392 and p=0.143 respectively) (data is shown in table

4). Levels of the common complement pathway marker iC3b were not significantly

different between MB leprosy patients without reaction compared to those with a

reaction (Figure 2A). However, levels of TCC in Ethiopian cohort MB patients with a

reaction were significantly raised in comparison to PB (p=<0.01) patients and to MB

patients without reaction (p=<0.05) (Figure 2B). This latter result independently

confirms that raised plasma levels of TCC represent a potential tool for identifying

leprosy patients with reactions.

3


103

Reaction 13.41 mg/l (SE 1,60); P < 0.05]. In addition, Clusterin levels were significantly increased in

serum of multibacillary leprosy patients compared to endemic controls, but no difference between

patients with or without reactions (E) [mean clusterin no reaction 398,0 mg/l (SE 10,15 ); P = <0.001

versus mean clusterin Reaction 378,9 mg/l (SE 15,87); P =<0.05]. The error bars represent the

standard error of the mean.

Table 3. Complement levels in the Bangladeshi cohort

Endemic controls MB patients without

reaction

MB patients with

reaction

Bagladeshi

cohort


C1s 94,69 2,77 99,41 3,07 90,66 4,84

C4d 3,46 0,39 8,83 0,77 13,41 1,60

Bb 16,53 1,92 24,26 0,98 28,12 1,96

iC3b 5,42 0,63 8,63 0,81 12,05 2,71

TCC 1,87 0,15 2,27 0,09 2,56 0,10

Factor H 253,7 15,82 277,3 11,28 231,6 21,97

Clusterin 297,3 19,74 398,0 10,15 378,9 15,87

TCC levels are increased in serum of multibacillary leprosy patients with

reaction compared to patients without reaction from Ethiopia

In the preceding section results using the leprosy serum samples from Bangladesh

data indicate that levels of complement activation products were higher in patients

with reaction compared to those without – significantly so for C4d and trending for

iC3b and TCC. We therefore surmised that these markers could be used as an

indicator for identifying patients with reactions. In order to substantiate this finding we

measured the levels of these complement activation products in serum samples of an

Ethiopian leprosy cohort. These samples were also collected before start of MDT and

classified as PB (TT and BT) or MB (BL and LL) leprosy patients without reaction and

MB patients with reaction. In these samples, like those of Bangladesh, no significant

difference was found in the level of C1s in serum of MB compared to PB patients

without reaction (p= 0.384) (data is shown in table 4). Serum levels of the

complement activation products in MB patients compared to PB patients without a

reaction were significantly increased for C4d (p= 0.04), Bb (p= 0.03) iC3b (p= 0.02 )

and TCC (p= 0.003) (Supplement figure 2). No significant difference was found in

the levels of C4d and Bb in the MB leprosy patients without reaction compared to the

patients with a reaction (p= 0.392 and p=0.143 respectively) (data is shown in table

4). Levels of the common complement pathway marker iC3b were not significantly

different between MB leprosy patients without reaction compared to those with a

reaction (Figure 2A). However, levels of TCC in Ethiopian cohort MB patients with a

reaction were significantly raised in comparison to PB (p=<0.01) patients and to MB

patients without reaction (p=<0.05) (Figure 2B). This latter result independently

confirms that raised plasma levels of TCC represent a potential tool for identifying

leprosy patients with reactions.

Chapter 3

104

Fig. 2. TCC levels are increased in serum of multibacillary leprosy patients with reaction compared to

patients without reaction from Ethiopia. MSD assay for measuring the common complement pathway

activation fragment iC3b (A) and the terminal pathway activation marker TCC (B), in serum samples of

paucibacillary (n=7) and multibacillary patients without a reaction (n=23) or with a reaction (n=15).

Although no significant difference was found in the levels of iC3b in serum of paucibacillary and

multibacillary patients without and with a reaction, TCC levels were significantly increased in

multibacillary leprosy patients with a reaction comparted to paucibacillary and multibacillary patients

without a reaction [mean TCC no reaction 4,03 mg/l (SE 0,28) versus mean TCC Reaction 7,49 mg/l

(SE 1,48); P =<0.01 and P =<0.05]. The error bars represent the standard error of the mean.

Table 4. Complement levels in the Ethiopian cohort

PB patients without

reaction

MB patients without

reaction

MB patients with

reaction

Ethiopian

cohort


C1s 112,4 9,71 128,2 8,66 134,2 8,59

C4d 17,99 1,99 27,15 4,04 36,73 4,93

Bb 24,91 2,39 28,62 1,99 36,75 2,72

iC3b 13,15 1,94 22,39 1,92 14,80 2,84

TCC 2,02 0,23 4,03 0,28 7,49 1,48

Factor H 385,0 26,85 301,9 14,15 381,1 22,61

Clusterin 457,9 34,08 493,8 21,94 656,1 43,70

3


105

Fig. 2. TCC levels are increased in serum of multibacillary leprosy patients with reaction compared to

patients without reaction from Ethiopia. MSD assay for measuring the common complement pathway

activation fragment iC3b (A) and the terminal pathway activation marker TCC (B), in serum samples of

paucibacillary (n=7) and multibacillary patients without a reaction (n=23) or with a reaction (n=15).

Although no significant difference was found in the levels of iC3b in serum of paucibacillary and

multibacillary patients without and with a reaction, TCC levels were significantly increased in

multibacillary leprosy patients with a reaction comparted to paucibacillary and multibacillary patients

without a reaction [mean TCC no reaction 4,03 mg/l (SE 0,28) versus mean TCC Reaction 7,49 mg/l

(SE 1,48); P =<0.01 and P =<0.05]. The error bars represent the standard error of the mean.

Table 4. Complement levels in the Ethiopian cohort

PB patients without

reaction

MB patients without

reaction

MB patients with

reaction

Ethiopian

cohort


C1s 112,4 9,71 128,2 8,66 134,2 8,59

C4d 17,99 1,99 27,15 4,04 36,73 4,93

Bb 24,91 2,39 28,62 1,99 36,75 2,72

iC3b 13,15 1,94 22,39 1,92 14,80 2,84

TCC 2,02 0,23 4,03 0,28 7,49 1,48

Factor H 385,0 26,85 301,9 14,15 381,1 22,61

Clusterin 457,9 34,08 493,8 21,94 656,1 43,70

Chapter 3

106

Discussion

Nerve damage leading to deformity is a major problem in the course of leprosy and

progression of the disease among susceptible hosts. In the absence of the

peripheral neuropathy, leprosy would be an innocuous inflammatory skin disease

rather than one that, even today in the 21st century, is one of the most stigmatized

diseases often associated with severe social repercussions for the patient [28,29].

The etiology of leprosy reactions and nerve damage has largely been attributed to

the consequence of granulomatous reactions due to the host immune response to M.

leprae. Variability in the hosts’ immune response has a causal relationship to the

spectral pathology of the disease. Timely diagnosis followed by optimum and

evidence based treatment would reduce risks of permanent tissue damage and

assist regeneration of the damaged tissue [30]. Despite continued efforts in the

refinement of diagnostic methods, reactions are often misdiagnosed even by

experienced health workers and clinicians [31]. Unquestionably, a reliable test or

combination of tests for the prompt diagnosis of reactions, particularly RR or type 1,

would contribute positively to the clinical outcome of the patients. Biomarkers for

identification of patients developing reactions have focused on circulating parameters

of adaptive immunity like antibodies, cytokines and chemokines as well as gene

expression profiles [32]. However, a recent report described the importance of innate

immunity in orchestrating leprosy immunopathology and in the initiating phase of host

defense against the pathogen [33]. Innate immune effectors include cellular systems

that are now being studied in relation to mycobacterial pathology, and also humoral

effectors, including the complement system, critical in initiating and orchestrating the

innate immune response to infection [34,35]. These findings imply that the analysis of

the complement system might be of value for the diagnosis and prognosis of leprosy

disease status.

It is now well appreciated that complement activation can be induced by pathogen-

associated molecular patterns (PAMPs) [18,34-36]. Particularly in the context of

leprosy, we recently showed that the membrane attack complex (MAC) of

complement is generated upon cognate interaction of the axon of the peripheral

nerve with the M. leprae specific PAMP lipoarabinomanan (LAM) [19]. In addition, we

showed that MAC formation results in nerve damage and its inhibition is

neuroprotective in a mouse model for M. leprae-induced nerve damage. We also

demonstrated that MAC is deposited in nerve lesions of leprosy patients, paralleling

the observed nerve degeneration. Our findings indicate an important role for

complement in the disease, and therefore we examined whether increased systemic

levels of complement activation could be detected in leprosy patients and whether

complement products and regulators might be useful markers of leprosy disease

state.

The present study reports for the first time the quantification of a panel of

complement activation products and regulators in serum of leprosy patients in

multiplexed assays on the Meso Scale Discovery (MSD) platform. The study was

performed retrospectively using serum samples from PB and MB patients with or

without reaction collected in Ethiopia and Bangladesh for a previous study [25].

Here we show significantly increased levels of complement activation products C4d,

Bb, in serum of Bangladeshi leprosy patients compared to endemic controls. The

increased levels of C4d in the patients supports activation of the lectin and/or

classical pathway of complement, while elevated Bb supports a significant

3


107

Discussion

Nerve damage leading to deformity is a major problem in the course of leprosy and

progression of the disease among susceptible hosts. In the absence of the

peripheral neuropathy, leprosy would be an innocuous inflammatory skin disease

rather than one that, even today in the 21st century, is one of the most stigmatized

diseases often associated with severe social repercussions for the patient [28,29].

The etiology of leprosy reactions and nerve damage has largely been attributed to

the consequence of granulomatous reactions due to the host immune response to M.

leprae. Variability in the hosts’ immune response has a causal relationship to the

spectral pathology of the disease. Timely diagnosis followed by optimum and

evidence based treatment would reduce risks of permanent tissue damage and

assist regeneration of the damaged tissue [30]. Despite continued efforts in the

refinement of diagnostic methods, reactions are often misdiagnosed even by

experienced health workers and clinicians [31]. Unquestionably, a reliable test or

combination of tests for the prompt diagnosis of reactions, particularly RR or type 1,

would contribute positively to the clinical outcome of the patients. Biomarkers for

identification of patients developing reactions have focused on circulating parameters

of adaptive immunity like antibodies, cytokines and chemokines as well as gene

expression profiles [32]. However, a recent report described the importance of innate

immunity in orchestrating leprosy immunopathology and in the initiating phase of host

defense against the pathogen [33]. Innate immune effectors include cellular systems

that are now being studied in relation to mycobacterial pathology, and also humoral

effectors, including the complement system, critical in initiating and orchestrating the

innate immune response to infection [34,35]. These findings imply that the analysis of

the complement system might be of value for the diagnosis and prognosis of leprosy

disease status.

It is now well appreciated that complement activation can be induced by pathogen-

associated molecular patterns (PAMPs) [18,34-36]. Particularly in the context of

leprosy, we recently showed that the membrane attack complex (MAC) of

complement is generated upon cognate interaction of the axon of the peripheral

nerve with the M. leprae specific PAMP lipoarabinomanan (LAM) [19]. In addition, we

showed that MAC formation results in nerve damage and its inhibition is

neuroprotective in a mouse model for M. leprae-induced nerve damage. We also

demonstrated that MAC is deposited in nerve lesions of leprosy patients, paralleling

the observed nerve degeneration. Our findings indicate an important role for

complement in the disease, and therefore we examined whether increased systemic

levels of complement activation could be detected in leprosy patients and whether

complement products and regulators might be useful markers of leprosy disease

state.

The present study reports for the first time the quantification of a panel of

complement activation products and regulators in serum of leprosy patients in

multiplexed assays on the Meso Scale Discovery (MSD) platform. The study was

performed retrospectively using serum samples from PB and MB patients with or

without reaction collected in Ethiopia and Bangladesh for a previous study [25].

Here we show significantly increased levels of complement activation products C4d,

Bb, in serum of Bangladeshi leprosy patients compared to endemic controls. The

increased levels of C4d in the patients supports activation of the lectin and/or

classical pathway of complement, while elevated Bb supports a significant

Chapter 3

108

involvement of the alternative pathway in leprosy patients. Earlier studies had already

suggested a role for the classical pathway of the complement system in leprosy

across the spectrum by meassuring the ability of circulating immune complexes

isolated from sera of leprosy patients to activate complement , but none of these

studies measured pathway-specific activation products [23,24,37].

Bacterial antigens either in the free form or by slow multiplication of bacilli in the

reaction patients could initiate complement activation via the lectin pathway, initiated

by the binding of the pattern recognition molecule mannose-binding lectin (MBL) to

bacterial surfaces [38]. In support of the involvement of the lectin pathway in MB

leprosy patients, one study found that MBL serum levels were significantly increased

in LL form of leprosy compared to other leprosy types [23]. However, it should be

noted that the association of MBL with leprosy pathophysiology is controversial,

because some investigators found increased level of MBL in the patients undergoing

reaction. For this reason, no confirmatory conclusion can be drawn from our present

limited study on the role of MBL pathway in contributing higher level of complement

activation products in leprosy reactions.

iC3b levels in the Bangladeshi population were significantly increased in leprosy

patients with reaction compared to controls. The levels were also higher compared to

patients without a reaction although not significant.

The present study is limited in identifying the major contribution of either the classical

or lectin pathway for complement activation, TCC levels in serum of leprosy patients

from Bangladesh were significantly higher in patients with reaction compared to

endemic controls. No significant difference was found between leprosy patients

without reactions and endemic controls for TCC. This reflects that complement TCC

level may be considered as a promising marker for patients developing a reaction. It

also suggests that treatment with either MDT or steroids does not lower complement

activation in reaction patients, reinforcing the possibility that complement contributes

to the nerve damage in these patients.

Similar to the findings encountered with Bangladeshi cohort, TCC levels in serum

samples of leprosy patients from Ethiopia also showed a significant increase in

reactions compared to patients without reactions. Since complement activation is

under control of several regulatory molecules, we also measured the levels of factor

H, regulator of the alternative pathway of complement, in leprosy patients with or

without reactions; previous studies showed that factor H is associated with a variety

of diseases, including neurodegenerative disease [39-42]. Changes in factor H

levels, might suggest altered regulation of activation of the alternative pathway of

complement during disease. We did not detect any significant change in the total

level of Factor H in serum of leprosy patients with and without a reaction. Clusterin, a

fluid-phase regulator of the MAC, is increased in tissue and plasma in different

diseases including neurodegenerative conditions [43-48]. Hence, we determined the

circulatory levels of Clusterin in leprosy patients in association with disease activities.

Clusterin levels were higher in leprosy patients compared to controls. No difference

was found in Clusterin levels in patients with or without reaction, suggesting no

increase in regulatory status of the terminal pathway of complement by Clusterin in

reaction patients.

Unfortunately, due to the nature of the study, 1) being carried out with the samples

collected in the field situations and 2) the lack of EDTA in the serum samples, any

elaborate interpretation regarding the mechanism of high level of TCC in leprosy

patients with reaction should be avoided at this stage of the study. The lack of

3


109

involvement of the alternative pathway in leprosy patients. Earlier studies had already

suggested a role for the classical pathway of the complement system in leprosy

across the spectrum by meassuring the ability of circulating immune complexes

isolated from sera of leprosy patients to activate complement , but none of these

studies measured pathway-specific activation products [23,24,37].

Bacterial antigens either in the free form or by slow multiplication of bacilli in the

reaction patients could initiate complement activation via the lectin pathway, initiated

by the binding of the pattern recognition molecule mannose-binding lectin (MBL) to

bacterial surfaces [38]. In support of the involvement of the lectin pathway in MB

leprosy patients, one study found that MBL serum levels were significantly increased

in LL form of leprosy compared to other leprosy types [23]. However, it should be

noted that the association of MBL with leprosy pathophysiology is controversial,

because some investigators found increased level of MBL in the patients undergoing

reaction. For this reason, no confirmatory conclusion can be drawn from our present

limited study on the role of MBL pathway in contributing higher level of complement

activation products in leprosy reactions.

iC3b levels in the Bangladeshi population were significantly increased in leprosy

patients with reaction compared to controls. The levels were also higher compared to

patients without a reaction although not significant.

The present study is limited in identifying the major contribution of either the classical

or lectin pathway for complement activation, TCC levels in serum of leprosy patients

from Bangladesh were significantly higher in patients with reaction compared to

endemic controls. No significant difference was found between leprosy patients

without reactions and endemic controls for TCC. This reflects that complement TCC

level may be considered as a promising marker for patients developing a reaction. It

also suggests that treatment with either MDT or steroids does not lower complement

activation in reaction patients, reinforcing the possibility that complement contributes

to the nerve damage in these patients.

Similar to the findings encountered with Bangladeshi cohort, TCC levels in serum

samples of leprosy patients from Ethiopia also showed a significant increase in

reactions compared to patients without reactions. Since complement activation is

under control of several regulatory molecules, we also measured the levels of factor

H, regulator of the alternative pathway of complement, in leprosy patients with or

without reactions; previous studies showed that factor H is associated with a variety

of diseases, including neurodegenerative disease [39-42]. Changes in factor H

levels, might suggest altered regulation of activation of the alternative pathway of

complement during disease. We did not detect any significant change in the total

level of Factor H in serum of leprosy patients with and without a reaction. Clusterin, a

fluid-phase regulator of the MAC, is increased in tissue and plasma in different

diseases including neurodegenerative conditions [43-48]. Hence, we determined the

circulatory levels of Clusterin in leprosy patients in association with disease activities.

Clusterin levels were higher in leprosy patients compared to controls. No difference

was found in Clusterin levels in patients with or without reaction, suggesting no

increase in regulatory status of the terminal pathway of complement by Clusterin in

reaction patients.

Unfortunately, due to the nature of the study, 1) being carried out with the samples

collected in the field situations and 2) the lack of EDTA in the serum samples, any

elaborate interpretation regarding the mechanism of high level of TCC in leprosy

patients with reaction should be avoided at this stage of the study. The lack of

Chapter 3

110

especially EDTA might result in in vitro generation of TCC which continues in serum.

This limitation is considered equally applicable to all the samples studied; therefore,

any comparative values relating the disease state is considered as true reflection.

Despite such limitations, the present datasets have demonstrated convincingly, that

systemic activation of complement occurs in leprosy and likely involves multiple

pathways. The increased serum levels of TCC and other activation markers in

leprosy patients with reaction warrants a prospective and sequential study on

complement activation in leprosy, to confirm conclusively whether circulating

complement activation products such as TCC can be applied as biomarkers for

diagnosis of patients at a risk of developing a reaction.

Funding. This work was supported by the Leprosy Foundation of the Netherlands [grant number

701.03.08]. AG acknowledges the support of QM Gastmann Wichers Foundation for her participation.

Author’s contribution. PKD, VR and FB formulated the project; AG provided access to the stored

serum samples collected for a different prospective study; BPM provided access to the in-house

complement assays and advised on the project; SH performed assays; NBEI analyzed the data and

wrote the manuscript.

Acknowledgements. The authors would like to thank Dr. Sheikh Abdul Hadi (Dhaka), Genet Amare,

Haregewoin Yetesha and Alemayehu Kifle (AHRI/ALERT, Addis Ababa); Dr. Sayera Banu from the

International Center for Diarrhoeal Disease Research Bangladesh, Dhaka (Bangladesh), and Dr.

Kidist Bobosha from the Armauer Hansen Research Institute, Addis Ababa in Ethiopia for sample

collection without which this study could not have been possible.

Competing financial interests. FB and VR are inventors on a patent that describes the use of

inhibitors of the terminal complement pathway for therapeutic purposes. FB and VR are shareholders

of Regenesance BV. The remaining authors declare no competing financial interests.

References

1 Ridley DS, Jopling WH. Classification of leprosy according to immunity. A five-group system. Int.J.Lepr.Other Mycobact.Dis. 1966; 34:255-73.

2 Scollard DM, Adams LB, Gillis TP, Krahenbuhl JL, Truman RW, Williams DL. The continuing challenges of leprosy. Clin.Microbiol.Rev. 2006; 19:338-81.

3 Ridley DS. Reactions in leprosy. Lepr.Rev. 1969; 40:77-81.

4 Godal T, Myrvang B, Samuel DR, Ross WF, Lofgren M. Mechanism of "reactions" in borderline tuberculoid (BT) leprosy. A preliminary report. Acta Pathol.Microbiol.Scand.Suppl 1973; 236:45-53.

5 Verhagen C, Faber W, Klatser P, Buffing A, Naafs B, Das P. Immunohistological analysis of in situ expression of mycobacterial antigens in skin lesions of leprosy patients across the histopathological spectrum. Association of Mycobacterial lipoarabinomannan (LAM) and Mycobacterium leprae phenolic glycolipid-I (PGL-I) with leprosy reactions. Am.J.Pathol. 1999; 154:1793-804.

6 Shetty VP, Uplekar MW, Antia NH. Immunohistological localization of mycobacterial antigens within the peripheral nerves of treated leprosy patients and their significance to nerve damage in leprosy. Acta Neuropathol. 1994; 88:300-6.

7 Verhagen CE, Wierenga EA, Buffing AA, Chand MA, Faber WR, Das PK. Reversal reaction in borderline leprosy is associated with a polarized shift to type 1-like Mycobacterium leprae T cell reactivity in lesional skin: a follow-up study. J.Immunol. 1997; 159:4474-83.

8 Sreenivasan P, Misra RS, Wilfred D, Nath I. Lepromatous leprosy patients show T helper 1-like cytokine profile with differential expression of interleukin-10 during type 1 and 2 reactions. Immunology 1998; 95:529-36.

9 Wemambu SN, Turk JL, Waters MF, Rees RJ. Erythema nodosum leprosum: a clinical manifestation of the arthus phenomenon. Lancet 1969; 2:933-5.

10 Das PK, Klatser PR, Pondman KW et al. Dapsone and anti-dapsone antibody in circulating immune complexes in leprosy patients. Lancet 1980; 1:1309-11.

11 Modlin RL. Th1-Th2 paradigm: insights from leprosy. J.Invest Dermatol. 1994; 102:828-32.

12 Bjorvatn B, Barnetson RS, Kronvall G, Zubler RH, Lambert PH. Immune complexes and complement hypercatabolism in patients with leprosy. Clin.Exp.Immunol. 1976; 26:388-96.

13 Kahawita IP, Lockwood DN. Towards understanding the pathology of erythema nodosum leprosum. Trans.R.Soc.Trop.Med.Hyg. 2008; 102:329-37.

14 Stefani MM, Guerra JG, Sousa AL et al. Potential plasma markers of Type 1 and Type 2 leprosy reactions: a preliminary report. BMC.Infect.Dis. 2009; 9:75.

15 Little D, Khanolkar-Young S, Coulthart A, Suneetha S, Lockwood DN. Immunohistochemical analysis of cellular infiltrate and gamma interferon, interleukin-12, and inducible nitric oxide synthase expression in leprosy type 1 (reversal) reactions before and during prednisolone treatment. Infect.Immun. 2001; 69:3413-7.

16 Partida-Sanchez S, Favila-Castillo L, Pedraza-Sanchez S et al. IgG antibody subclasses, tumor necrosis factor and IFN-gamma levels in patients with type II lepra reaction on thalidomide treatment. Int.Arch.Allergy Immunol. 1998; 116:60-6.

3


111

especially EDTA might result in in vitro generation of TCC which continues in serum.

This limitation is considered equally applicable to all the samples studied; therefore,

any comparative values relating the disease state is considered as true reflection.

Despite such limitations, the present datasets have demonstrated convincingly, that

systemic activation of complement occurs in leprosy and likely involves multiple

pathways. The increased serum levels of TCC and other activation markers in

leprosy patients with reaction warrants a prospective and sequential study on

complement activation in leprosy, to confirm conclusively whether circulating

complement activation products such as TCC can be applied as biomarkers for

diagnosis of patients at a risk of developing a reaction.

Funding. This work was supported by the Leprosy Foundation of the Netherlands [grant number

701.03.08]. AG acknowledges the support of QM Gastmann Wichers Foundation for her participation.

Author’s contribution. PKD, VR and FB formulated the project; AG provided access to the stored

serum samples collected for a different prospective study; BPM provided access to the in-house

complement assays and advised on the project; SH performed assays; NBEI analyzed the data and

wrote the manuscript.

Acknowledgements. The authors would like to thank Dr. Sheikh Abdul Hadi (Dhaka), Genet Amare,

Haregewoin Yetesha and Alemayehu Kifle (AHRI/ALERT, Addis Ababa); Dr. Sayera Banu from the

International Center for Diarrhoeal Disease Research Bangladesh, Dhaka (Bangladesh), and Dr.

Kidist Bobosha from the Armauer Hansen Research Institute, Addis Ababa in Ethiopia for sample

collection without which this study could not have been possible.

Competing financial interests. FB and VR are inventors on a patent that describes the use of

inhibitors of the terminal complement pathway for therapeutic purposes. FB and VR are shareholders

of Regenesance BV. The remaining authors declare no competing financial interests.

References

1 Ridley DS, Jopling WH. Classification of leprosy according to immunity. A five-group system. Int.J.Lepr.Other Mycobact.Dis. 1966; 34:255-73.

2 Scollard DM, Adams LB, Gillis TP, Krahenbuhl JL, Truman RW, Williams DL. The continuing challenges of leprosy. Clin.Microbiol.Rev. 2006; 19:338-81.

3 Ridley DS. Reactions in leprosy. Lepr.Rev. 1969; 40:77-81.

4 Godal T, Myrvang B, Samuel DR, Ross WF, Lofgren M. Mechanism of "reactions" in borderline tuberculoid (BT) leprosy. A preliminary report. Acta Pathol.Microbiol.Scand.Suppl 1973; 236:45-53.

5 Verhagen C, Faber W, Klatser P, Buffing A, Naafs B, Das P. Immunohistological analysis of in situ expression of mycobacterial antigens in skin lesions of leprosy patients across the histopathological spectrum. Association of Mycobacterial lipoarabinomannan (LAM) and Mycobacterium leprae phenolic glycolipid-I (PGL-I) with leprosy reactions. Am.J.Pathol. 1999; 154:1793-804.

6 Shetty VP, Uplekar MW, Antia NH. Immunohistological localization of mycobacterial antigens within the peripheral nerves of treated leprosy patients and their significance to nerve damage in leprosy. Acta Neuropathol. 1994; 88:300-6.

7 Verhagen CE, Wierenga EA, Buffing AA, Chand MA, Faber WR, Das PK. Reversal reaction in borderline leprosy is associated with a polarized shift to type 1-like Mycobacterium leprae T cell reactivity in lesional skin: a follow-up study. J.Immunol. 1997; 159:4474-83.

8 Sreenivasan P, Misra RS, Wilfred D, Nath I. Lepromatous leprosy patients show T helper 1-like cytokine profile with differential expression of interleukin-10 during type 1 and 2 reactions. Immunology 1998; 95:529-36.

9 Wemambu SN, Turk JL, Waters MF, Rees RJ. Erythema nodosum leprosum: a clinical manifestation of the arthus phenomenon. Lancet 1969; 2:933-5.

10 Das PK, Klatser PR, Pondman KW et al. Dapsone and anti-dapsone antibody in circulating immune complexes in leprosy patients. Lancet 1980; 1:1309-11.

11 Modlin RL. Th1-Th2 paradigm: insights from leprosy. J.Invest Dermatol. 1994; 102:828-32.

12 Bjorvatn B, Barnetson RS, Kronvall G, Zubler RH, Lambert PH. Immune complexes and complement hypercatabolism in patients with leprosy. Clin.Exp.Immunol. 1976; 26:388-96.

13 Kahawita IP, Lockwood DN. Towards understanding the pathology of erythema nodosum leprosum. Trans.R.Soc.Trop.Med.Hyg. 2008; 102:329-37.

14 Stefani MM, Guerra JG, Sousa AL et al. Potential plasma markers of Type 1 and Type 2 leprosy reactions: a preliminary report. BMC.Infect.Dis. 2009; 9:75.

15 Little D, Khanolkar-Young S, Coulthart A, Suneetha S, Lockwood DN. Immunohistochemical analysis of cellular infiltrate and gamma interferon, interleukin-12, and inducible nitric oxide synthase expression in leprosy type 1 (reversal) reactions before and during prednisolone treatment. Infect.Immun. 2001; 69:3413-7.

16 Partida-Sanchez S, Favila-Castillo L, Pedraza-Sanchez S et al. IgG antibody subclasses, tumor necrosis factor and IFN-gamma levels in patients with type II lepra reaction on thalidomide treatment. Int.Arch.Allergy Immunol. 1998; 116:60-6.

Chapter 3

112

17 Iyer A, Hatta M, Usman R et al. Serum levels of interferon-gamma, tumour necrosis factor-alpha, soluble interleukin-6R and soluble cell activation markers for monitoring response to treatment of leprosy reactions. Clin.Exp.Immunol. 2007; 150:210-6.

18 Ricklin D, Hajishengallis G, Yang K, Lambris JD. Complement: a key system for immune surveillance and homeostasis. Nat.Immunol. 2010; 11:785-97.

19 Bahia E, I, Das PK, Fluiter K et al. M. leprae components induce nerve damage by complement activation: identification of lipoarabinomannan as the dominant complement activator. Acta Neuropathol. 2015.

20 Saitz EW, Dierks RE, Shepard CC. Complement and the second component of complement in leprosy. Int.J.Lepr.Other Mycobact.Dis. 1968; 36:400-4.

21 Petchclai B, Chutanondh R, Prasongsom S, Hiranras S, Ramasoota T. Complement profile in leprosy. Am.J.Trop.Med.Hyg. 1973; 22:761-4.

22 Gelber RH, Drutz DJ, Epstein WV, Fasal P. Clinical correlates of C1Q-precipitating substances in the sera of patients with leprosy. Am.J.Trop.Med.Hyg. 1974; 23:471-5.

23 Gomes GI, Nahn EP, Jr., Santos RK, Da Silva WD, Kipnis TL. The functional state of the complement system in leprosy. Am.J.Trop.Med.Hyg. 2008; 78:605-10.

24 Tyagi P, Ramanathan VD, Girdhar BK, Katoch K, Bhatia AS, Sengupta U. Activation of complement by circulating immune complexes isolated from leprosy patients. Int.J.Lepr.Other Mycobact.Dis. 1990; 58:31-8.

25 Khadge S, Banu S, Bobosha K et al. Longitudinal immune profiles in type 1 leprosy reactions in Bangladesh, Brazil, Ethiopia and Nepal. BMC.Infect.Dis. 2015; 15:477.

26 Hakobyan S, Harris CL, Tortajada A et al. Measurement of factor H variants in plasma using variant-specific monoclonal antibodies: application to assessing risk of age-related macular degeneration. Invest Ophthalmol.Vis.Sci. 2008; 49:1983-90.

27 Ingram G, Hakobyan S, Hirst CL et al. Systemic complement profiling in multiple sclerosis as a biomarker of disease state. Mult.Scler. 2012; 18:1401-11.

28 Rafferty J. Curing the stigma of leprosy. Lepr.Rev. 2005; 76:119-26.

29 Tsutsumi A, Izutsu T, Islam AM, Maksuda AN, Kato H, Wakai S. The quality of life, mental health, and perceived stigma of leprosy patients in Bangladesh. Soc.Sci.Med. 2007; 64:2443-53.

30 Lockwood DN, Saunderson PR. Nerve damage in leprosy: a continuing challenge to scientists, clinicians and service providers. Int.Health 2012; 4:77-85.

31 Raffe SF, Thapa M, Khadge S, Tamang K, Hagge D, Lockwood DN. Diagnosis and treatment of leprosy reactions in integrated services--the patients' perspective in Nepal. PLoS.Negl.Trop.Dis. 2013; 7:e2089.

32 Geluk A, van Meijgaarden KE, Wilson L et al. Longitudinal immune responses and gene expression profiles in type 1 leprosy reactions. J.Clin.Immunol. 2014; 34:245-55.

33 Montoya D, Modlin RL. Learning from leprosy: insight into the human innate immune response. Adv.Immunol. 2010; 105:1-24.

34 Walport MJ. Complement. First of two parts. N.Engl.J.Med. 2001; 344:1058-66.

35 Walport MJ. Complement. Second of two parts. N.Engl.J.Med. 2001; 344:1140-4.

36 Mogensen TH. Pathogen recognition and inflammatory signaling in innate immune defenses. Clin.Microbiol.Rev. 2009; 22:240-73, Table.

37 Ramanathan VD, Thyagi P, Ramanathan U, Katoch K, Ramu G. A sequential study of circulating immune complexes, complement and immunoglobulins in borderline tuberculoid leprosy patients with and without reactions. Indian J.Lepr. 1998; 70:153-60.

38 Ip WK, Takahashi K, Ezekowitz RA, Stuart LM. Mannose-binding lectin and innate immunity. Immunol.Rev. 2009; 230:9-21.

39 Oksjoki R, Jarva H, Kovanen PT, Laine P, Meri S, Pentikainen MO. Association between complement factor H and proteoglycans in early human coronary atherosclerotic lesions: implications for local regulation of complement activation. Arterioscler.Thromb.Vasc.Biol. 2003; 23:630-6.

40 Edwards AO, Ritter R, III, Abel KJ, Manning A, Panhuysen C, Farrer LA. Complement factor H polymorphism and age-related macular degeneration. Science 2005; 308:421-4.

41 Pickering MC, Cook HT. Translational mini-review series on complement factor H: renal diseases associated with complement factor H: novel insights from humans and animals. Clin.Exp.Immunol. 2008; 151:210-30.

42 Thambisetty M, Hye A, Foy C et al. Proteome-based identification of plasma proteins associated with hippocampal metabolism in early Alzheimer's disease. J.Neurol. 2008; 255:1712-20.

43 Rosenberg ME, Silkensen J. Clusterin and the kidney. Exp.Nephrol. 1995; 3:9-14.

44 Jenne DE, Tschopp J. Molecular structure and functional characterization of a human complement cytolysis inhibitor found in blood and seminal plasma: identity to sulfated glycoprotein 2, a constituent of rat testis fluid. Proc.Natl.Acad.Sci.U.S.A 1989; 86:7123-7.

45 Silkensen JR, Schwochau GB, Rosenberg ME. The role of clusterin in tissue injury. Biochem.Cell Biol. 1994; 72:483-8.

46 Rosenberg ME, Silkensen J. Clusterin: physiologic and pathophysiologic considerations. Int.J.Biochem.Cell Biol. 1995; 27:633-45.

47 Nilselid AM, Davidsson P, Nagga K, Andreasen N, Fredman P, Blennow K. Clusterin in cerebrospinal fluid: analysis of carbohydrates and quantification of native and glycosylated forms. Neurochem.Int. 2006; 48:718-28.

48 Schrijvers EM, Koudstaal PJ, Hofman A, Breteler MM. Plasma clusterin and the risk of Alzheimer disease. JAMA 2011; 305:1322-6.

3


113

17 Iyer A, Hatta M, Usman R et al. Serum levels of interferon-gamma, tumour necrosis factor-alpha, soluble interleukin-6R and soluble cell activation markers for monitoring response to treatment of leprosy reactions. Clin.Exp.Immunol. 2007; 150:210-6.

18 Ricklin D, Hajishengallis G, Yang K, Lambris JD. Complement: a key system for immune surveillance and homeostasis. Nat.Immunol. 2010; 11:785-97.

19 Bahia E, I, Das PK, Fluiter K et al. M. leprae components induce nerve damage by complement activation: identification of lipoarabinomannan as the dominant complement activator. Acta Neuropathol. 2015.

20 Saitz EW, Dierks RE, Shepard CC. Complement and the second component of complement in leprosy. Int.J.Lepr.Other Mycobact.Dis. 1968; 36:400-4.

21 Petchclai B, Chutanondh R, Prasongsom S, Hiranras S, Ramasoota T. Complement profile in leprosy. Am.J.Trop.Med.Hyg. 1973; 22:761-4.

22 Gelber RH, Drutz DJ, Epstein WV, Fasal P. Clinical correlates of C1Q-precipitating substances in the sera of patients with leprosy. Am.J.Trop.Med.Hyg. 1974; 23:471-5.

23 Gomes GI, Nahn EP, Jr., Santos RK, Da Silva WD, Kipnis TL. The functional state of the complement system in leprosy. Am.J.Trop.Med.Hyg. 2008; 78:605-10.

24 Tyagi P, Ramanathan VD, Girdhar BK, Katoch K, Bhatia AS, Sengupta U. Activation of complement by circulating immune complexes isolated from leprosy patients. Int.J.Lepr.Other Mycobact.Dis. 1990; 58:31-8.

25 Khadge S, Banu S, Bobosha K et al. Longitudinal immune profiles in type 1 leprosy reactions in Bangladesh, Brazil, Ethiopia and Nepal. BMC.Infect.Dis. 2015; 15:477.

26 Hakobyan S, Harris CL, Tortajada A et al. Measurement of factor H variants in plasma using variant-specific monoclonal antibodies: application to assessing risk of age-related macular degeneration. Invest Ophthalmol.Vis.Sci. 2008; 49:1983-90.

27 Ingram G, Hakobyan S, Hirst CL et al. Systemic complement profiling in multiple sclerosis as a biomarker of disease state. Mult.Scler. 2012; 18:1401-11.

28 Rafferty J. Curing the stigma of leprosy. Lepr.Rev. 2005; 76:119-26.

29 Tsutsumi A, Izutsu T, Islam AM, Maksuda AN, Kato H, Wakai S. The quality of life, mental health, and perceived stigma of leprosy patients in Bangladesh. Soc.Sci.Med. 2007; 64:2443-53.

30 Lockwood DN, Saunderson PR. Nerve damage in leprosy: a continuing challenge to scientists, clinicians and service providers. Int.Health 2012; 4:77-85.

31 Raffe SF, Thapa M, Khadge S, Tamang K, Hagge D, Lockwood DN. Diagnosis and treatment of leprosy reactions in integrated services--the patients' perspective in Nepal. PLoS.Negl.Trop.Dis. 2013; 7:e2089.

32 Geluk A, van Meijgaarden KE, Wilson L et al. Longitudinal immune responses and gene expression profiles in type 1 leprosy reactions. J.Clin.Immunol. 2014; 34:245-55.

33 Montoya D, Modlin RL. Learning from leprosy: insight into the human innate immune response. Adv.Immunol. 2010; 105:1-24.

34 Walport MJ. Complement. First of two parts. N.Engl.J.Med. 2001; 344:1058-66.

35 Walport MJ. Complement. Second of two parts. N.Engl.J.Med. 2001; 344:1140-4.

36 Mogensen TH. Pathogen recognition and inflammatory signaling in innate immune defenses. Clin.Microbiol.Rev. 2009; 22:240-73, Table.

37 Ramanathan VD, Thyagi P, Ramanathan U, Katoch K, Ramu G. A sequential study of circulating immune complexes, complement and immunoglobulins in borderline tuberculoid leprosy patients with and without reactions. Indian J.Lepr. 1998; 70:153-60.

38 Ip WK, Takahashi K, Ezekowitz RA, Stuart LM. Mannose-binding lectin and innate immunity. Immunol.Rev. 2009; 230:9-21.

39 Oksjoki R, Jarva H, Kovanen PT, Laine P, Meri S, Pentikainen MO. Association between complement factor H and proteoglycans in early human coronary atherosclerotic lesions: implications for local regulation of complement activation. Arterioscler.Thromb.Vasc.Biol. 2003; 23:630-6.

40 Edwards AO, Ritter R, III, Abel KJ, Manning A, Panhuysen C, Farrer LA. Complement factor H polymorphism and age-related macular degeneration. Science 2005; 308:421-4.

41 Pickering MC, Cook HT. Translational mini-review series on complement factor H: renal diseases associated with complement factor H: novel insights from humans and animals. Clin.Exp.Immunol. 2008; 151:210-30.

42 Thambisetty M, Hye A, Foy C et al. Proteome-based identification of plasma proteins associated with hippocampal metabolism in early Alzheimer's disease. J.Neurol. 2008; 255:1712-20.

43 Rosenberg ME, Silkensen J. Clusterin and the kidney. Exp.Nephrol. 1995; 3:9-14.

44 Jenne DE, Tschopp J. Molecular structure and functional characterization of a human complement cytolysis inhibitor found in blood and seminal plasma: identity to sulfated glycoprotein 2, a constituent of rat testis fluid. Proc.Natl.Acad.Sci.U.S.A 1989; 86:7123-7.

45 Silkensen JR, Schwochau GB, Rosenberg ME. The role of clusterin in tissue injury. Biochem.Cell Biol. 1994; 72:483-8.

46 Rosenberg ME, Silkensen J. Clusterin: physiologic and pathophysiologic considerations. Int.J.Biochem.Cell Biol. 1995; 27:633-45.

47 Nilselid AM, Davidsson P, Nagga K, Andreasen N, Fredman P, Blennow K. Clusterin in cerebrospinal fluid: analysis of carbohydrates and quantification of native and glycosylated forms. Neurochem.Int. 2006; 48:718-28.

48 Schrijvers EM, Koudstaal PJ, Hofman A, Breteler MM. Plasma clusterin and the risk of Alzheimer disease. JAMA 2011; 305:1322-6.

Chapter 3

114

SUPPLEMENTARY FIGURES

Sup. Fig. 1. TCC serum levels of leprosy patients followed at reaction and after treatment. TCC

serum levels of leprosy patients at reaction do not change after treatment, indicating that treatment

does not affect complement activity in leprosy.

Sup. Fig. 2. Complement activation in paucibacillary and multibacillary leprosy patients from

Ethiopia. MSD platform for measuring complement activation products C4d (A), Bb (B), iC3b (C) and

TCC (D) in serum from paucibacillary (n= 7) and multibacillary (n=23) leprosy patients, showing a

significant increase in multibacillary compared to paucibacillary leprosy patients for C4d (mean PB

17,99 mg/l SE 1,99 versus mean MB 27,15 mg/l SE 4,04; p=0.04], Bb (mean PB 24,91 mg/l SE 2,39

versus mean MB 28,62 mg/l SE 1,99; p=0.03], iC3b (mean PB 13,15 mg/l SE 1,94 versus mean MB

22,39 mg/l SE 1,92; p=0.02] and TCC (mean PB 2,02 mg/l SE 0.23 versus MB 4,03 mg/l SE 0,28;

p=0.003]. The error bars represent the standard error of the mean.

3


115


Sup. Fig. 1. TCC serum levels of leprosy patients followed at reaction and after treatment. TCC

serum levels of leprosy patients at reaction do not change after treatment, indicating that treatment

does not affect complement activity in leprosy.

Sup. Fig. 2. Complement activation in paucibacillary and multibacillary leprosy patients from

Ethiopia. MSD platform for measuring complement activation products C4d (A), Bb (B), iC3b (C) and

TCC (D) in serum from paucibacillary (n= 7) and multibacillary (n=23) leprosy patients, showing a

significant increase in multibacillary compared to paucibacillary leprosy patients for C4d (mean PB

17,99 mg/l SE 1,99 versus mean MB 27,15 mg/l SE 4,04; p=0.04], Bb (mean PB 24,91 mg/l SE 2,39

versus mean MB 28,62 mg/l SE 1,99; p=0.03], iC3b (mean PB 13,15 mg/l SE 1,94 versus mean MB

22,39 mg/l SE 1,92; p=0.02] and TCC (mean PB 2,02 mg/l SE 0.23 versus MB 4,03 mg/l SE 0,28;

p=0.003]. The error bars represent the standard error of the mean.

Fernanda (19) en haar broer Evaldo (17) werden waarschijnlijk besmet met lepra via

hun buurjongen. Fernanda: ‘Ik kreeg vlekken op mijn handen en armen. Mijn moeder

dacht dat het een huidschimmel was. Maar de zalfjes die ze me gaf, hielpen niet.’

Een buurvrouw nam Fernanda en haar broer uiteindelijk mee naar de dokter. Die zag

direct dat het lepra was. ‘Pas later begrepen we wat het betekende om lepra te

hebben omdat iemand erover kwam vertellen.’


In Situ complement activation and T-cell immunity in leprosy

spectrum: An Immunohistological Study on Leprosy Lesional

skin

Nawal Bahia El Idrissi 1, Anand M Iyer2 , Valeria Ramaglia1, Patricia S. Rosa3,

Cleverson T. Soares3, Frank Baas1* and Pranab K Das4. Submitted to PLOSone.

1Department of Genome Analysis and 2 Department of Neuropathology, Academic Medical

Center, Amsterdam, 1105 AZ, The Netherlands; 3 Instituto Lauro de Souza Lima, Bauru,

17034-971, Brazil;4 Department of Clinical Immunology, Colleges of Medical and Dental

Sciences, University of Birmingham, Birmingham, B15 2TT, UK.

Fernanda (19) en haar broer Evaldo (17) werden waarschijnlijk besmet met lepra via

hun buurjongen. Fernanda: ‘Ik kreeg vlekken op mijn handen en armen. Mijn moeder

dacht dat het een huidschimmel was. Maar de zalfjes die ze me gaf, hielpen niet.’

Een buurvrouw nam Fernanda en haar broer uiteindelijk mee naar de dokter. Die zag

direct dat het lepra was. ‘Pas later begrepen we wat het betekende om lepra te

hebben omdat iemand erover kwam vertellen.’


In Situ complement activation and T-cell immunity in leprosy

spectrum: An Immunohistological Study on Leprosy Lesional

skin

Nawal Bahia El Idrissi 1, Anand M Iyer2 , Valeria Ramaglia1, Patricia S. Rosa3,

Cleverson T. Soares3, Frank Baas1* and Pranab K Das4. Submitted to PLOSone.

1Department of Genome Analysis and 2 Department of Neuropathology, Academic Medical

Center, Amsterdam, 1105 AZ, The Netherlands; 3 Instituto Lauro de Souza Lima, Bauru,

17034-971, Brazil;4 Department of Clinical Immunology, Colleges of Medical and Dental

Sciences, University of Birmingham, Birmingham, B15 2TT, UK.

4

Chapter 4

118

Abstract

Background. Mycobacterium leprae (M. leprae) infection causes nerve damage and

the condition worsens often during and long after treatment. Clearance of bacterial

antigens including lipoarabinomannan (LAM) during and after treatment in leprosy

patients is slow. We previously demonstrated that M. leprae specific component LAM

damages peripheral nerves by in situ generation of the terminal complement

component membrane attack complex (MAC). Investigating the role of complement

activation in skin lesions of leprosy patients might provide insight into the dynamics of

in situ immune reactivity and the destructive pathology of M. leprae. Previously we

showed that LAM and MAC are deposited on axons in nerve biopsies of leprosy

patients. In this study, we analyzed in skin lesions of leprosy patients, whether M.

leprae antigen LAM deposition correlates with the deposition of complement

activation products MAC and C3d on nerves and cells in the surrounding tissue.

Methods. Routine hematoxylin and eosin (H&E) staining was performed on the skin

biopsies of leprosy patients evaluating the histopathology of studied biopsies.

Deposition of LAM and key complement activation products, C3d and membrane

attack complex (MAC) were analyzed in skin biopsies of paucibacillary (n=7),

multibacillary leprosy patients (n=7), and patients with erythema nodosum leprosum

(ENL) (n=6) or reversal reaction (RR) (n=4) and controls (n=4). Double

immunofluorescence stainings were performed to detect which immune cells were

positive for complement products C3d and MAC in skin lesions of leprosy patients. In

addition, nerves were analyzed for MAC deposition in these lesions.

Results. The percentage of C3d, MAC and LAM deposition was significantly higher

in the skin biopsies of multibacillary compared to paucibacillary patients (p=<0.05,

p=<0.001 and p=<0.001 respectively), with a significant association between LAM

and C3d or MAC in the skin biopsies of leprosy patients (r=0.9578, p< 0.0001 and

r=0.8585, p<0.0001 respectively). In skin lesions of multibacillary patients, MAC

deposition was found on axons co-localizing with LAM, suggesting that MAC targets

the axons in skin lesions with LAM as a trigger for complement activation. In addition,

skin lesions of RR showed significantly higher levels of C3d deposition compared to

non-reactional leprosy patients (p=<0.05). MAC immunoreactivity was increased in

both ENL and RR skin lesions compared to non-reactional leprosy patients (p=<0.01

and p=<0.01 respectively). C3d is known to be involved in co-stimulation of T-cells. In

skin lesions of paucibacillary patients, we found C3d positive T-cells in and

surrounding granulomas, but hardly any MAC deposition or nerves detected

compared to multibacillary patients.

Conclusions. The present findings demonstrate that complement is deposited in

skin lesions of leprosy patients, suggesting that inflammation driven by complement

activation might contribute to nerve damage in the lesions of these patients. This

should be regarded as an important factor in M. leprae nerve damage pathology.

Keywords. M. leprae, Lipoarabinomannan, Complement, Membrane attack complex, C3d; T-cells,

Skin lesions.

4

Complement in leprosy skin lesions

119

Abstract

Background. Mycobacterium leprae (M. leprae) infection causes nerve damage and

the condition worsens often during and long after treatment. Clearance of bacterial

antigens including lipoarabinomannan (LAM) during and after treatment in leprosy

patients is slow. We previously demonstrated that M. leprae specific component LAM

damages peripheral nerves by in situ generation of the terminal complement

component membrane attack complex (MAC). Investigating the role of complement

activation in skin lesions of leprosy patients might provide insight into the dynamics of

in situ immune reactivity and the destructive pathology of M. leprae. Previously we

showed that LAM and MAC are deposited on axons in nerve biopsies of leprosy

patients. In this study, we analyzed in skin lesions of leprosy patients, whether M.

leprae antigen LAM deposition correlates with the deposition of complement

activation products MAC and C3d on nerves and cells in the surrounding tissue.

Methods. Routine hematoxylin and eosin (H&E) staining was performed on the skin

biopsies of leprosy patients evaluating the histopathology of studied biopsies.

Deposition of LAM and key complement activation products, C3d and membrane

attack complex (MAC) were analyzed in skin biopsies of paucibacillary (n=7),

multibacillary leprosy patients (n=7), and patients with erythema nodosum leprosum

(ENL) (n=6) or reversal reaction (RR) (n=4) and controls (n=4). Double

immunofluorescence stainings were performed to detect which immune cells were

positive for complement products C3d and MAC in skin lesions of leprosy patients. In

addition, nerves were analyzed for MAC deposition in these lesions.

Results. The percentage of C3d, MAC and LAM deposition was significantly higher

in the skin biopsies of multibacillary compared to paucibacillary patients (p=<0.05,

p=<0.001 and p=<0.001 respectively), with a significant association between LAM

and C3d or MAC in the skin biopsies of leprosy patients (r=0.9578, p< 0.0001 and

r=0.8585, p<0.0001 respectively). In skin lesions of multibacillary patients, MAC

deposition was found on axons co-localizing with LAM, suggesting that MAC targets

the axons in skin lesions with LAM as a trigger for complement activation. In addition,

skin lesions of RR showed significantly higher levels of C3d deposition compared to

non-reactional leprosy patients (p=<0.05). MAC immunoreactivity was increased in

both ENL and RR skin lesions compared to non-reactional leprosy patients (p=<0.01

and p=<0.01 respectively). C3d is known to be involved in co-stimulation of T-cells. In

skin lesions of paucibacillary patients, we found C3d positive T-cells in and

surrounding granulomas, but hardly any MAC deposition or nerves detected

compared to multibacillary patients.

Conclusions. The present findings demonstrate that complement is deposited in

skin lesions of leprosy patients, suggesting that inflammation driven by complement

activation might contribute to nerve damage in the lesions of these patients. This

should be regarded as an important factor in M. leprae nerve damage pathology.

Keywords. M. leprae, Lipoarabinomannan, Complement, Membrane attack complex, C3d; T-cells,

Skin lesions.

Chapter 4

120

1. Introduction

Leprosy is a chronic granulomatous disease caused by the intracellular bacterium

Mycobacterium leprae (M. leprae) which displays a broad spectrum of immunological

and histopathological responses. The leprosy spectrum has as its poles either

tuberculoid (TT) or lepromatous (LL), and intermediate forms known as borderline

lepromatous (BL), borderline borderline (BB) and borderline tuberculoid (BT). The LL,

BL and BB forms are collectively called multibacillary (MB) whereas the BT and TT

are paucibacillary (PB) [1]. Histopathologically, TT skin lesions are characterized by

the presence of epithelioid cells surrounded by a cuff of T-cells with few or no bacilli,

whereas LL lesions show an abundance of bacilli-filled foamy macrophages.

The immunopathological spectrum in leprosy is largely considered to be due to the

variation in immune responses accompanied with changing granulomatous reactions

by the individual host to specific M.leprae antigens. Tuberculoid leprosy is

characterized by a strong T-cell-mediated immunity towards the antigens of M. leprae

whereas lepromatous leprosy is characterized by a selective T-cell unresponsiveness

to M. leprae antigens [2]. In contrast, high levels of M. leprae specific antibodies are

present in LL which does not prevent the spread of the bacteria within the host. The

borderline forms of leprosy (BT, BB and BL) are immunologically unstable. In

addition, about 20-30% of the borderline patients may undergo immune

exacerbations during the course of the disease, which manifest as either reversal

reaction (RR) or erythema nodosum leprosum (ENL). This event can follow initial

treatment and could worsen the nerve damage even after release from treatment.

Most studies have shown that the involvement of the adaptive immunity is

responsible for tissue destruction in leprosy. However, recent evidence suggests that

the innate immunity of the host including complement activation plays an important

role in leprosy pathology and tissue destruction.

The complement system is the first line of defence against pathogens and a key

component of innate immunity, activated early after infections. Activation of the

complement system can occur via the recognition of antigen-antibody complexes

(classical pathway), foreign surfaces (alternative pathway) or bacterial sugars (lectin

pathway). Regardless of the trigger, activation results in the cleavage of C3, and

formation of the membrane attack complex (MAC), which lyses cells by making holes

in their membrane. Activated complement is able to drift from the target site to

adjacent areas and enhance inflammation and damage healthy tissue [3, 4].

The complement system is crucial for the opsonisation and subsequent killing of

bacteria. Previous studies have indicated an important role for complement in

leprosy, showing increased levels of complement components by serological and

pathological studies [5-11]. Another study showed deposits of the MAC in cutaneous

sensory nerves of leprosy patients, suggesting a possible role for MAC in leprosy

pathology [10, 12]. We have shown that formation of the MAC contributes to early

demyelination and axonal damage after traumatic injury of the peripheral nerve [13,

14], and that inhibition of MAC formation reduces nerve damage [15] and improves

regeneration and functional recovery [16].

The pathogenesis of nerve damage in leprosy patients remains largely unsolved. We

have shown that complement contributes to peripheral nerve damage in a model of

M. leprae induced neuropathy [17]. The interesting question is what triggers the

extensive nerve damage. Important elements of an infection with M. leprae are the

recognition of pathogen associated molecular patterns, such as LAM, by pattern

4


121

1. Introduction

Leprosy is a chronic granulomatous disease caused by the intracellular bacterium

Mycobacterium leprae (M. leprae) which displays a broad spectrum of immunological

and histopathological responses. The leprosy spectrum has as its poles either

tuberculoid (TT) or lepromatous (LL), and intermediate forms known as borderline

lepromatous (BL), borderline borderline (BB) and borderline tuberculoid (BT). The LL,

BL and BB forms are collectively called multibacillary (MB) whereas the BT and TT

are paucibacillary (PB) [1]. Histopathologically, TT skin lesions are characterized by

the presence of epithelioid cells surrounded by a cuff of T-cells with few or no bacilli,

whereas LL lesions show an abundance of bacilli-filled foamy macrophages.

The immunopathological spectrum in leprosy is largely considered to be due to the

variation in immune responses accompanied with changing granulomatous reactions

by the individual host to specific M.leprae antigens. Tuberculoid leprosy is

characterized by a strong T-cell-mediated immunity towards the antigens of M. leprae

whereas lepromatous leprosy is characterized by a selective T-cell unresponsiveness

to M. leprae antigens [2]. In contrast, high levels of M. leprae specific antibodies are

present in LL which does not prevent the spread of the bacteria within the host. The

borderline forms of leprosy (BT, BB and BL) are immunologically unstable. In

addition, about 20-30% of the borderline patients may undergo immune

exacerbations during the course of the disease, which manifest as either reversal

reaction (RR) or erythema nodosum leprosum (ENL). This event can follow initial

treatment and could worsen the nerve damage even after release from treatment.

Most studies have shown that the involvement of the adaptive immunity is

responsible for tissue destruction in leprosy. However, recent evidence suggests that

the innate immunity of the host including complement activation plays an important

role in leprosy pathology and tissue destruction.

The complement system is the first line of defence against pathogens and a key

component of innate immunity, activated early after infections. Activation of the

complement system can occur via the recognition of antigen-antibody complexes

(classical pathway), foreign surfaces (alternative pathway) or bacterial sugars (lectin

pathway). Regardless of the trigger, activation results in the cleavage of C3, and

formation of the membrane attack complex (MAC), which lyses cells by making holes

in their membrane. Activated complement is able to drift from the target site to

adjacent areas and enhance inflammation and damage healthy tissue [3, 4].

The complement system is crucial for the opsonisation and subsequent killing of

bacteria. Previous studies have indicated an important role for complement in

leprosy, showing increased levels of complement components by serological and

pathological studies [5-11]. Another study showed deposits of the MAC in cutaneous

sensory nerves of leprosy patients, suggesting a possible role for MAC in leprosy

pathology [10, 12]. We have shown that formation of the MAC contributes to early

demyelination and axonal damage after traumatic injury of the peripheral nerve [13,

14], and that inhibition of MAC formation reduces nerve damage [15] and improves

regeneration and functional recovery [16].

The pathogenesis of nerve damage in leprosy patients remains largely unsolved. We

have shown that complement contributes to peripheral nerve damage in a model of

M. leprae induced neuropathy [17]. The interesting question is what triggers the

extensive nerve damage. Important elements of an infection with M. leprae are the

recognition of pathogen associated molecular patterns, such as LAM, by pattern

Chapter 4

122

recognition receptors that can trigger the activation of the complement system. In

nerve biopsies of leprosy patients we found a correlation between the amount of

MAC and M. leprae antigen LAM deposition, suggestig that LAM is a trigger for

complement activation [17]. An other study showed an increased amount of

antibodies against bacterial antigens such as Lipoarabinomannan (LAM) in serum of

multibacillary patients compared to paucibacillary patients [18, 19], suggesting an

immune response to the bacterial antigens.

Persistence of M. leprae antigens from dead bacilli can provoke immunological

reactions, such as reversal reaction, causing serious nerve damage and subsequent

disabilities. Although multiple drug therapy (MDT) is an affective target to kill M.

leprae, early diagnosis and an effective treatment of the disease related nerve

damage is still a challenge. Treatment with MDT targets M. leprae and this

consequently results in reduction of viable bacilli, and initiates the release of dead

bacilli and M. leprae antigens. This could cause a persistent stimulus with

consequent activation of the complement system and continued inflammatory

response, which contributes to nerve damage. Others and we showed that bacterial

antigens such as LAM and axonal debris could be found in leprosy patients long after

treatment [20]. Persistence of M. leprae antigens might be an important risk factor for

late reactions by continuously triggering pathogen recognition receptors and

activation of complement.

It is important to understand what role the complement system has in leprosy,

because increasing evidence suggests that complement is not only involved in killing

of pathogens but also plays a critical role in modulating the adaptive immune

response and causing nerve damage. Understanding the role of the complement

system in the immunopathology in leprosy skin lesions could be of benefit to develop

therapeutic intervention in modulating the course of the disease.

This study gives an insight into the immunopathology in skin lesions of leprosy

patients throughout the spectrum. It is unknown whether the presence of the M.

leprae antigen LAM is associated with the amount of complement activation in skin

lesions of leprosy patients. Here we explore to what extent complement is present in

skin lesions of paucibacillary, multibacillary patients and patients with a reaction (ENL

and RR) in relation to the presence of M. leprae antigen LAM. We analyzed

borderline lepromatous leprosy patients that developed ENL or RR. In addition, we

were interested in the cellular localization of complement activation products C3d and

MAC and whether MAC targets the axons in skin lesions of leprosy patients.

Our data supports the hypothesis that the persistence of LAM in leprosy lesions

could be the driver of perpetuating disease fluctuation. We propose that complement

plays a significant role in inflammation not only through the deposition of tissue

damaging complement activation product MAC but also via the involvement of the

infiltrating T-cells in situ.

4


123

recognition receptors that can trigger the activation of the complement system. In

nerve biopsies of leprosy patients we found a correlation between the amount of

MAC and M. leprae antigen LAM deposition, suggestig that LAM is a trigger for

complement activation [17]. An other study showed an increased amount of

antibodies against bacterial antigens such as Lipoarabinomannan (LAM) in serum of

multibacillary patients compared to paucibacillary patients [18, 19], suggesting an

immune response to the bacterial antigens.

Persistence of M. leprae antigens from dead bacilli can provoke immunological


disabilities. Although multiple drug therapy (MDT) is an affective target to kill M.

leprae, early diagnosis and an effective treatment of the disease related nerve

damage is still a challenge. Treatment with MDT targets M. leprae and this

consequently results in reduction of viable bacilli, and initiates the release of dead

bacilli and M. leprae antigens. This could cause a persistent stimulus with

consequent activation of the complement system and continued inflammatory

response, which contributes to nerve damage. Others and we showed that bacterial

antigens such as LAM and axonal debris could be found in leprosy patients long after

treatment [20]. Persistence of M. leprae antigens might be an important risk factor for

late reactions by continuously triggering pathogen recognition receptors and

activation of complement.

It is important to understand what role the complement system has in leprosy,

because increasing evidence suggests that complement is not only involved in killing

of pathogens but also plays a critical role in modulating the adaptive immune

response and causing nerve damage. Understanding the role of the complement

system in the immunopathology in leprosy skin lesions could be of benefit to develop

therapeutic intervention in modulating the course of the disease.

This study gives an insight into the immunopathology in skin lesions of leprosy

patients throughout the spectrum. It is unknown whether the presence of the M.

leprae antigen LAM is associated with the amount of complement activation in skin

lesions of leprosy patients. Here we explore to what extent complement is present in

skin lesions of paucibacillary, multibacillary patients and patients with a reaction (ENL

and RR) in relation to the presence of M. leprae antigen LAM. We analyzed

borderline lepromatous leprosy patients that developed ENL or RR. In addition, we

were interested in the cellular localization of complement activation products C3d and

MAC and whether MAC targets the axons in skin lesions of leprosy patients.

Our data supports the hypothesis that the persistence of LAM in leprosy lesions

could be the driver of perpetuating disease fluctuation. We propose that complement

plays a significant role in inflammation not only through the deposition of tissue

damaging complement activation product MAC but also via the involvement of the

infiltrating T-cells in situ.

Chapter 4

124

2. Methods

Skin biopsies. Skin biopsies of paucibacillary (TT and BT) (n=7) and multibacillary

(BL and LL) (n=7) leprosy patients were from Brazilian donors and were obtained at

hospitalization at the Instituto Lauro de Souza Lima, Bauru, Sao Paulo, Brazil as

diagnostic procedure (Table 1). In this study we did not include any borderline

boderline (BB) patient as this group is unstable and rare, which makes pathological

diagnosis difficult. Skin biopsies of leprosy patients after treatment (BL) (n=4) or with

erythema nodusum leprosum (ENL) (n=4) and reversal reaction (RR) (n=4) were

obtained from the archieval material of the Academical medical Center and were

from Dutch donors (Table 2 and 3). The reaction patients were BL patients that

developed ENL or RR. We choose BL leprosy patients because they can develop

ENL as well as RR. All patients were classified according to the Ridley-Jopling scale.

The control biopsies (n=4) were obtained during surgery from patients with no

leprosy. Tissue was obtained and used in accordance with the Declaration of Helsinki

and the Academic Medical Center Research Code provided by the Medical Ethics

Committee. Informed consent was obtained from all the patients.

After dissection, the skin biopsies were fixed in 10% formalin and processed

according to standard procedures for embedding in parrafin. Paraffin section of 6 µm

and/or 14 µm thickness were cut using a microtome and mounted on glass slides for

further pathological analysis. Tissue sections were stained with haematoxylin-eosin

for histopathological analysis and to assess the inflammatory activity in the lesions.

Table 1.Characterization of skin biopsies and clinical data of PB/ MB leprosy patients and controls

Case Material Leprosy type Gender Age diagnosis Treatment

1 Skin - -

2 Skin - -

3 Skin - -

4 Skin - -

1 Skin Paucibacillary (TT) F 12 MDT/PB (2009)

2 Skin Paucibacillary (TT) M unkown MDT/PB (2009)

3 Skin Paucibacillary (BT) F 29 MDT/ (2010)

4 Skin Paucibacillary (BT) F 49 MDT/MB (2010)

5 Skin Paucibacillary (BT) F 53 MDT/PB (2010/11)

6 Skin Paucibacillary (TT) M 23 unknown

7 Skin Paucibacillary (BT) M 29 unknown

8 Skin Multibacillary (LL) M unknown MDT/MB (2010/11)

9 Skin Multibacillary (LL) F 28 MDT/MB (2009/10)

10 Skin Multibacillary (BL) F 49 MDT/MB (2009/10)

11 Skin Multibacillary (LL) M 39 MDT/MB (2010/11)

12 Skin Multibacillary (LL) M 28 MDT/MB (2010)


14 Skin Multibacillary (BL) F 26 MDT/MB (2010)

15 Skin Multibacillary (BL) M 46 MDT/MB (2010)



F, female; M, male; MDT, multidrug therapy.

4


125

2. Methods

Skin biopsies. Skin biopsies of paucibacillary (TT and BT) (n=7) and multibacillary

(BL and LL) (n=7) leprosy patients were from Brazilian donors and were obtained at

hospitalization at the Instituto Lauro de Souza Lima, Bauru, Sao Paulo, Brazil as

diagnostic procedure (Table 1). In this study we did not include any borderline

boderline (BB) patient as this group is unstable and rare, which makes pathological

diagnosis difficult. Skin biopsies of leprosy patients after treatment (BL) (n=4) or with

erythema nodusum leprosum (ENL) (n=4) and reversal reaction (RR) (n=4) were

obtained from the archieval material of the Academical medical Center and were

from Dutch donors (Table 2 and 3). The reaction patients were BL patients that

developed ENL or RR. We choose BL leprosy patients because they can develop

ENL as well as RR. All patients were classified according to the Ridley-Jopling scale.

The control biopsies (n=4) were obtained during surgery from patients with no

leprosy. Tissue was obtained and used in accordance with the Declaration of Helsinki

and the Academic Medical Center Research Code provided by the Medical Ethics


After dissection, the skin biopsies were fixed in 10% formalin and processed

according to standard procedures for embedding in parrafin. Paraffin section of 6 µm

and/or 14 µm thickness were cut using a microtome and mounted on glass slides for

further pathological analysis. Tissue sections were stained with haematoxylin-eosin

for histopathological analysis and to assess the inflammatory activity in the lesions.

Table 1.Characterization of skin biopsies and clinical data of PB/ MB leprosy patients and controls

Case Material Leprosy type Gender Age diagnosis Treatment

1 Skin - -

2 Skin - -

3 Skin - -

4 Skin - -

1 Skin Paucibacillary (TT) F 12 MDT/PB (2009)

2 Skin Paucibacillary (TT) M unkown MDT/PB (2009)

3 Skin Paucibacillary (BT) F 29 MDT/ (2010)

4 Skin Paucibacillary (BT) F 49 MDT/MB (2010)

5 Skin Paucibacillary (BT) F 53 MDT/PB (2010/11)

6 Skin Paucibacillary (TT) M 23 unknown

7 Skin Paucibacillary (BT) M 29 unknown

8 Skin Multibacillary (LL) M unknown MDT/MB (2010/11)

9 Skin Multibacillary (LL) F 28 MDT/MB (2009/10)

10 Skin Multibacillary (BL) F 49 MDT/MB (2009/10)


12 Skin Multibacillary (LL) M 28 MDT/MB (2010)







Chapter 4

126

Table 3. Characterization of skin biopsies and clinical data of ENL leprosy patients

Case Material Leprosy type Gender Age diagnosis

Treatment

1 Skin Multibacillary (ENL) F 28

MDT/MB (2009-10)

2 Skin Multibacillary (ENL) M 39

MDT/MB (2010-11)

3

Skin Multibacillary (ENL) F 18

MDT/MB

+PRED (2003)


MDT/MB (2009-10)

F, female; M, male; MDT, multidrug therapy; PRED, Prednisone.

Table 2. Characterization of skin biopsies and clinical data of RR leprosy patients

Case Material Leprosy type Gender Age

diagnosis

Treatment

1 Skin Multibacillary (RR) M 36 MDT/MB (1998)

2 Skin Multibacillary (RR) F 57 MDT/MB (1995)




Immunohistochemistry. After deparaffination and rehydration, the endogenous

peroxidase activity was blocked with 0.3 % H2O2 in methanol for 20 minutes.

Epitopes were exposed by heat-induced antigen retrieval, in either 10mM sodium

citrate buffer (pH 6.0) or 10mM Tris 1mM EDTA buffer (pH 9.0) depending on the

primary antibody used (see Table 4). Aspecific binding of antibodies was blocked

using 10% Normal Goat Serum (DAKO, Heverlee, Belgium) in phosphate buffer

saline (PBS) for 30 minutes at room temperature. Primary antibodies were diluted in

Normal Antibody Diluent (Immunologic, Duiven, The Netherlands) and incubated for

1 hour at room temperature. Detection was performed by incubating the sections in

the secondary poly-HRP-goat anti Mouse/Rabbit/Rat IgG (Brightvision Immunologic,

Duiven, The Netherlands) antibody cocktail diluted 1:1 in PBS for 30 minutes at room

temperature following by incubation in 3,3- diaminobenzidine tetrahydrochloride

(DAB; Vector Laboratories, Burlingame, CA) as chromogen. Counterstaining to

visualize nuclei was performed by immersion in Hematoxylin for 5 minutes at room

temperature, followed by differentiation in running water for 4 minutes at room

temperature. Sections stained with secondary antibody alone were included as

negative controls with each test. After dehydration, slides were mounted in Pertex

(Histolab, Gothenburg, Sweden).

The quantitative analysis of the immunostainings was performed with the Image Pro

Plus software version 7 (Media Cybernetics Europe, Marlow, UK). Digital images of

20x magnification of the immunostainings were captured with a light microscope

(BX41TF; Olympus,Center Valley, PA) using the Cell D software (Olympus). Images

covering the complete skin biopsy were quantified. The surface area stained is

expressed as percentage of total area examined. The error bars indicate standard

error of the mean.

4


127

Table 3. Characterization of skin biopsies and clinical data of ENL leprosy patients

Case Material Leprosy type Gender Age diagnosis

Treatment

1 Skin Multibacillary (ENL) F 28

MDT/MB (2009-10)


MDT/MB (2010-11)

3

Skin Multibacillary (ENL) F 18

MDT/MB

+PRED (2003)


MDT/MB (2009-10)

F, female; M, male; MDT, multidrug therapy; PRED, Prednisone.

Table 2. Characterization of skin biopsies and clinical data of RR leprosy patients

Case Material Leprosy type Gender Age

diagnosis

Treatment






Immunohistochemistry. After deparaffination and rehydration, the endogenous

peroxidase activity was blocked with 0.3 % H2O2 in methanol for 20 minutes.

Epitopes were exposed by heat-induced antigen retrieval, in either 10mM sodium

citrate buffer (pH 6.0) or 10mM Tris 1mM EDTA buffer (pH 9.0) depending on the

primary antibody used (see Table 4). Aspecific binding of antibodies was blocked

using 10% Normal Goat Serum (DAKO, Heverlee, Belgium) in phosphate buffer

saline (PBS) for 30 minutes at room temperature. Primary antibodies were diluted in

Normal Antibody Diluent (Immunologic, Duiven, The Netherlands) and incubated for

1 hour at room temperature. Detection was performed by incubating the sections in

the secondary poly-HRP-goat anti Mouse/Rabbit/Rat IgG (Brightvision Immunologic,

Duiven, The Netherlands) antibody cocktail diluted 1:1 in PBS for 30 minutes at room

temperature following by incubation in 3,3- diaminobenzidine tetrahydrochloride

(DAB; Vector Laboratories, Burlingame, CA) as chromogen. Counterstaining to

visualize nuclei was performed by immersion in Hematoxylin for 5 minutes at room

temperature, followed by differentiation in running water for 4 minutes at room

temperature. Sections stained with secondary antibody alone were included as

negative controls with each test. After dehydration, slides were mounted in Pertex

(Histolab, Gothenburg, Sweden).

The quantitative analysis of the immunostainings was performed with the Image Pro

Plus software version 7 (Media Cybernetics Europe, Marlow, UK). Digital images of

20x magnification of the immunostainings were captured with a light microscope

(BX41TF; Olympus,Center Valley, PA) using the Cell D software (Olympus). Images

covering the complete skin biopsy were quantified. The surface area stained is

expressed as percentage of total area examined. The error bars indicate standard

error of the mean.

Chapter 4

128

Table 4. Antibody, source, dilution

Antibody Detects Source Concentration/

Dilution



MAC Made in house

(B.P. Morgan)

0.013 µg/µl’

Polyclonal rabbit anti-human C3d C3d Dako (A0063) 0.016 µg/µl *



SMI31)

Axons Sternberger

Monoclonals Inc.

(SMI31R)

1:1000’


(P.K. Das)

1:200’

Mouse anti- CD3 T-cells Life technologies

MHCD0300

1:500*

Mouse anti-CD68 Macrophages PG-M1 Dako 1:200*

Mouse anti-CD20 B-cells DAKO M755 1:400*

Mouse anti-CD21 Receptor for

C3d on B- and

T cells

Abcam Ab9492 1:200*


Immunofluorescence. Immunofluorescence staining was performed to compare the

cellular distribution of two markers in the same tissue section. Deparaffination,

antigen retrieval and blocking of aspecific binding sites were performed essentially as

described above. To determine which cells were C3d or MAC positive in skin lesions

of leprosy patients skin sections of 6 µm were stained with the unconjugated primary

antibodies against CD3+ T-cells, CD20+ B-cells or CD68+ macrophages together

with either C3d or MAC (see table 4). The unbound primary antibodies were

removed by rinsing (3 × 5 min) with PBS followed by incubating with a fluorescently

labeled secondary antibody for 45 min. The primary antibodies raised in rabbit (see

table 4) were detected with FITC (green, 488nm)-conjugated goat anti-rabbit IgG

(Sigma-Aldrich, Saint Louis, MI) and the primary antibodies raised in mouse were

detected with Cy3 (red, 560nm)–conjugated goat anti-mouse IgG (Sigma-Aldrich,

Saint Louis, MI). Sections were air dried and mounted in Vectashield (Vector,

Burlingame, CA). To determine co localization, images were captured digitally with a

fluorescence microscope (DM LB2; Leica, Wetzlar, Germany) connected to a digital

camera (DFC500; Leica).

To analyze the deposition of MAC on nerves, 14 µm skin sections were stained with

unconjugated polyclonal rabbit anti-rat C9 and monoclonal mouse anti-human

phosphorylated neurofilament (see Table 4). The staining was performed in the

same manner as described above. The primary C9 antibody was detected with

Fluorophores FITC (green, 488nm) - conjugated goat anti-rabbit (Sigma-Aldrich,

Saint Louis, MI) and the SMI31 antibody was detected with the secondary antibody

Cy3 (red, 550-570 nm) – conjugated goat anti-mouse (Sigma) using a Leica TCS

SP8 X Confocal Microscope (LEICA Microsystems B.V., Rijswijk, The Netherlands).

Z-stacks of all the positive skin areas were made using the 40x objective /1.30 Oil

4


129

Table 4. Antibody, source, dilution

Antibody Detects Source Concentration/

Dilution



MAC Made in house

(B.P. Morgan)

0.013 µg/µl’

Polyclonal rabbit anti-human C3d C3d Dako (A0063) 0.016 µg/µl *



SMI31)

Axons Sternberger

Monoclonals Inc.

(SMI31R)

1:1000’


(P.K. Das)

1:200’

Mouse anti- CD3 T-cells Life technologies

MHCD0300

1:500*

Mouse anti-CD68 Macrophages PG-M1 Dako 1:200*

Mouse anti-CD20 B-cells DAKO M755 1:400*

Mouse anti-CD21 Receptor for

C3d on B- and

T cells

Abcam Ab9492 1:200*


Immunofluorescence. Immunofluorescence staining was performed to compare the

cellular distribution of two markers in the same tissue section. Deparaffination,

antigen retrieval and blocking of aspecific binding sites were performed essentially as

described above. To determine which cells were C3d or MAC positive in skin lesions

of leprosy patients skin sections of 6 µm were stained with the unconjugated primary

antibodies against CD3+ T-cells, CD20+ B-cells or CD68+ macrophages together

with either C3d or MAC (see table 4). The unbound primary antibodies were

removed by rinsing (3 × 5 min) with PBS followed by incubating with a fluorescently

labeled secondary antibody for 45 min. The primary antibodies raised in rabbit (see

table 4) were detected with FITC (green, 488nm)-conjugated goat anti-rabbit IgG

(Sigma-Aldrich, Saint Louis, MI) and the primary antibodies raised in mouse were

detected with Cy3 (red, 560nm)–conjugated goat anti-mouse IgG (Sigma-Aldrich,

Saint Louis, MI). Sections were air dried and mounted in Vectashield (Vector,

Burlingame, CA). To determine co localization, images were captured digitally with a

fluorescence microscope (DM LB2; Leica, Wetzlar, Germany) connected to a digital

camera (DFC500; Leica).

To analyze the deposition of MAC on nerves, 14 µm skin sections were stained with

unconjugated polyclonal rabbit anti-rat C9 and monoclonal mouse anti-human

phosphorylated neurofilament (see Table 4). The staining was performed in the

same manner as described above. The primary C9 antibody was detected with

Fluorophores FITC (green, 488nm) - conjugated goat anti-rabbit (Sigma-Aldrich,

Saint Louis, MI) and the SMI31 antibody was detected with the secondary antibody

Cy3 (red, 550-570 nm) – conjugated goat anti-mouse (Sigma) using a Leica TCS

SP8 X Confocal Microscope (LEICA Microsystems B.V., Rijswijk, The Netherlands).

Z-stacks of all the positive skin areas were made using the 40x objective /1.30 Oil

Chapter 4

130

analyzing the 14 µm thick skin section. The images were analyzed using Leica LCS

software (Leica).

Statistical analysis. Data analysis was performed using GraphPad Prism version

5.0 (GraphPad Software Inc, San Diego, CA, USA) statistical package. Student’s t

test was performed for statistical analysis comparing two groups. For comparison of

more than two groups One way ANOVA with Bonferroni multiple comparison post-

hoc test was used, changes were considered statistically significant for p ≤ 0.05. For

the correlation analysis Shapiro-Wilk normality test was performed before using

Pearson’s correlation, to determine whether the data was normally distributed.

3. Results

MAC and C3d deposition in skin of paucibacillary and multibacillary leprosy

patients.

The procedure to obtain skin biopsies is less invasive than the nerve biopsies,

therefore it is more commonly used in the diagnosis of leprosy patients. We carried

out immunohistochemical stainings to determine whether complement is deposited in

leprosy skin lesions and whether expression level is different in multibacillary

compared to paucibacillary patients. Immunohistochemistry for C3d, using an anti-

C3d antibody, or MAC, using an antibody against C9, which recognizes bound C9 in

tissue [21], was performed on skin biopsies of controls (Figure 1A, B), paucibacillary

(Figure 1C, D) and multibacillary patients (Figure 1E, F), showing immunoreactivity

for C3d within the dermis of both paucibacillary (Figure 1C, arrow) and multibacillary

(Figure 1E, arrow) skin. In the skin lesions of paucibacillary patients, mainly

macrophages and lymphocytes were found on or in the vicinity of the positive

staining, while in the skin lesions of multibacillary patients macrophages were

predominantly present. In addition, extensive C9 immunoreactivity was found within

the dermis of multibacillary patients’ lesions (Figure 1F), indicating abundant local

deposition of the active terminal complement product MAC in lesions of multibacillary

patients. Quantification of the staining on skin biopsies showed a significantly higher

amount of C3d and MAC deposition in multibacillary compared to paucibacillary

patients (p=<0.05; p=<0.001, respectively) (Figure 1G, H). Control skin biopsies

were negative for C3d and MAC (Figure 1A, B).

4


131

analyzing the 14 µm thick skin section. The images were analyzed using Leica LCS

software (Leica).

Statistical analysis. Data analysis was performed using GraphPad Prism version

5.0 (GraphPad Software Inc, San Diego, CA, USA) statistical package. Student’s t

test was performed for statistical analysis comparing two groups. For comparison of

more than two groups One way ANOVA with Bonferroni multiple comparison post-

hoc test was used, changes were considered statistically significant for p ≤ 0.05. For

the correlation analysis Shapiro-Wilk normality test was performed before using

Pearson’s correlation, to determine whether the data was normally distributed.

3. Results

MAC and C3d deposition in skin of paucibacillary and multibacillary leprosy

patients.

The procedure to obtain skin biopsies is less invasive than the nerve biopsies,

therefore it is more commonly used in the diagnosis of leprosy patients. We carried

out immunohistochemical stainings to determine whether complement is deposited in

leprosy skin lesions and whether expression level is different in multibacillary

compared to paucibacillary patients. Immunohistochemistry for C3d, using an anti-

C3d antibody, or MAC, using an antibody against C9, which recognizes bound C9 in

tissue [21], was performed on skin biopsies of controls (Figure 1A, B), paucibacillary

(Figure 1C, D) and multibacillary patients (Figure 1E, F), showing immunoreactivity

for C3d within the dermis of both paucibacillary (Figure 1C, arrow) and multibacillary

(Figure 1E, arrow) skin. In the skin lesions of paucibacillary patients, mainly

macrophages and lymphocytes were found on or in the vicinity of the positive

staining, while in the skin lesions of multibacillary patients macrophages were

predominantly present. In addition, extensive C9 immunoreactivity was found within

the dermis of multibacillary patients’ lesions (Figure 1F), indicating abundant local

deposition of the active terminal complement product MAC in lesions of multibacillary

patients. Quantification of the staining on skin biopsies showed a significantly higher

amount of C3d and MAC deposition in multibacillary compared to paucibacillary

patients (p=<0.05; p=<0.001, respectively) (Figure 1G, H). Control skin biopsies

were negative for C3d and MAC (Figure 1A, B).

Chapter 4

132

Figure 1. MAC and C3d deposition in skin of paucibacillary and multibacillary leprosy patients.

Representative immunohistochemical stainings of skin sections from control (A and B), paucibacillary

(C and D) and multibacillary (E and F) for C3d, detecting C3d, (C and E) or C9, detecting MAC (D and

F). (magnification; 50 µm) showing immunoreactivity for C3d within the dermis layer of the skin of both

paucibacillary (C) and multibacillary (E) (in brown) (see arrow). In addition, a strong MAC

immunoreactivity was found within the dermis layer of the skin of multibacillary patients (F) (see

arrow), indicating abundant local deposition of the active terminal complement product MAC in lesions

of multibacillary patients. The control biopsies of skin and nerve are negative for C3d and C9 (A, B).

Quantification of the staining (G and H), shows a significant higher amounts of C3d and MAC

deposits in skin lesions of multibacillary compared to paucibacillary patients (p=<0.05 and p=<0.001

respectively). Error bars indicate standard error of the mean.

C3d fragments co localize with T-cells in skin lesions of paucibacillary patients

We found C3d deposited in granulomatous lesions in the skin of paucibacillary

patients (Figure 1C). We tested whether the abundant lymphocytes and

macrophages that we observed in the H&E staining in granulomatous lesions of

paucibacillary patients (Figure 2A and B) were C3d positive by immunofluorescence

staining. We observed that both CD3+ T-cells and CD68+ macrophages co-localized

with the C3d fragment of complement in the skin lesions of paucibacillary patients

(Figure 2C and D). CD68+ cells were occasionally MAC positive in lesions of

paucibacillary patients (data not shown), but CD3+ T-cells were not. B- and T-cells

are known to express the CR2 receptor for C3d. To confirm our findings we analyzed

whether C3d also co-localized with the CR2/CD21 receptor. We observed that also

CD21 co-localized with C3d in skin lesions of paucibacillary patients (Figure 2E).

B cells were also found to co-localize with C3d in the skin lesions of these patients,

but these were not as frequently found as the C3d positive T-cells (Figure 2F).

These findings might suggest a role for C3d in T- and B cell co-stimulation in skin

lesions of paucibacillary patients.

4


133

Figure 1. MAC and C3d deposition in skin of paucibacillary and multibacillary leprosy patients.

Representative immunohistochemical stainings of skin sections from control (A and B), paucibacillary

(C and D) and multibacillary (E and F) for C3d, detecting C3d, (C and E) or C9, detecting MAC (D and

F). (magnification; 50 µm) showing immunoreactivity for C3d within the dermis layer of the skin of both

paucibacillary (C) and multibacillary (E) (in brown) (see arrow). In addition, a strong MAC

immunoreactivity was found within the dermis layer of the skin of multibacillary patients (F) (see

arrow), indicating abundant local deposition of the active terminal complement product MAC in lesions

of multibacillary patients. The control biopsies of skin and nerve are negative for C3d and C9 (A, B).


deposits in skin lesions of multibacillary compared to paucibacillary patients (p=<0.05 and p=<0.001

respectively). Error bars indicate standard error of the mean.

C3d fragments co localize with T-cells in skin lesions of paucibacillary patients

We found C3d deposited in granulomatous lesions in the skin of paucibacillary

patients (Figure 1C). We tested whether the abundant lymphocytes and

macrophages that we observed in the H&E staining in granulomatous lesions of

paucibacillary patients (Figure 2A and B) were C3d positive by immunofluorescence

staining. We observed that both CD3+ T-cells and CD68+ macrophages co-localized

with the C3d fragment of complement in the skin lesions of paucibacillary patients

(Figure 2C and D). CD68+ cells were occasionally MAC positive in lesions of

paucibacillary patients (data not shown), but CD3+ T-cells were not. B- and T-cells

are known to express the CR2 receptor for C3d. To confirm our findings we analyzed

whether C3d also co-localized with the CR2/CD21 receptor. We observed that also

CD21 co-localized with C3d in skin lesions of paucibacillary patients (Figure 2E).

B cells were also found to co-localize with C3d in the skin lesions of these patients,

but these were not as frequently found as the C3d positive T-cells (Figure 2F).

These findings might suggest a role for C3d in T- and B cell co-stimulation in skin

lesions of paucibacillary patients.

Chapter 4

134

Figure 2. Representative stainings of skin sections from paucibacillary patients for H&E (A, B Zoom)

and immunofluorescence for CD3+

T cells and C3d (C) CD68+ macrophages and C3d (D) CD21

detecting the CR2 receptor and C3d (E) or CD20+ B cells and C3d (F). The H&E staining shows

abnormal granulomatous lesions in the skin (A). A zoom in of the H&E staining shows granulomas

with epithelioid cells surrounded by lymphocytes (B) Immunofluorescence on the sections indicated

that the T cells, the CR2 receptor and B-cells all co-localized with C3d in skin lesions of

paucibacullary patients.

MAC deposited on nerves in skin lesions of multibacillary patients.

We have previously shown that MAC can target the axons and cause nerve damage

in a model of M. leprae induced nerve damage [17]. MAC was also found deposited

on axons in nerve biopsies of leprosy patients. Here we showed that MAC is

abundantly present in skin biopsies of multibacillary patients, but not in paucibacillary

patients (Figure 1D and F). We were interested in the cellular localization of MAC in

skin lesions of multibacillary patients and whether MAC targets the nerve endings in

the skin of leprosy patients. H&E staining on skin biopsies of multibacillary patients

demonstrated numerous giant epithelioid cells in the skin lesions (Figure 3A and B).

Both complement markers C3d and MAC co-localized with CD68+ macrophages in

skin lesions of multibacillary patients (Figure 3C and D). In addition, we found that

MAC is deposited on nerves in skin lesion (Figure 3E), indicating that MAC attacks

the nerves. We previously determined in vitro that LAM is a dominant activator of

complement, here we show that also in the skin lesions MAC co-localized with M.

leprae antigen LAM, suggesting that LAM triggers complement activation in these

lesions (Figure 3F).

4


135

Figure 2. Representative stainings of skin sections from paucibacillary patients for H&E (A, B Zoom)

and immunofluorescence for CD3+

T cells and C3d (C) CD68+ macrophages and C3d (D) CD21

detecting the CR2 receptor and C3d (E) or CD20+ B cells and C3d (F). The H&E staining shows

abnormal granulomatous lesions in the skin (A). A zoom in of the H&E staining shows granulomas

with epithelioid cells surrounded by lymphocytes (B) Immunofluorescence on the sections indicated

that the T cells, the CR2 receptor and B-cells all co-localized with C3d in skin lesions of

paucibacullary patients.

MAC deposited on nerves in skin lesions of multibacillary patients.

We have previously shown that MAC can target the axons and cause nerve damage

in a model of M. leprae induced nerve damage [17]. MAC was also found deposited

on axons in nerve biopsies of leprosy patients. Here we showed that MAC is

abundantly present in skin biopsies of multibacillary patients, but not in paucibacillary

patients (Figure 1D and F). We were interested in the cellular localization of MAC in

skin lesions of multibacillary patients and whether MAC targets the nerve endings in

the skin of leprosy patients. H&E staining on skin biopsies of multibacillary patients

demonstrated numerous giant epithelioid cells in the skin lesions (Figure 3A and B).

Both complement markers C3d and MAC co-localized with CD68+ macrophages in

skin lesions of multibacillary patients (Figure 3C and D). In addition, we found that

MAC is deposited on nerves in skin lesion (Figure 3E), indicating that MAC attacks

the nerves. We previously determined in vitro that LAM is a dominant activator of

complement, here we show that also in the skin lesions MAC co-localized with M.

leprae antigen LAM, suggesting that LAM triggers complement activation in these

lesions (Figure 3F).

Chapter 4

136

Figure 3. H&E staining of LL leprosy skin (magnification; 100 µm) (A) and zoom-in (magnification; 25

µm) showing giant epithelioid cells in the skin lesion. Double staining of LL leprosy skin for

macrophage marker CD68 (red) with C3d (green) (C) and MAC (green) (D) showed co-localization of

both complement markers with macrophages (magnification; 25 µm). Staining for MAC with the

marker SMI31 that visualizes the nerves or LAM showed that these markers co-localized indicating

that MAC attacks the axons in the skin and that LAM could be a trigger for the complement activation

in the lesions.

MAC deposition in skin of leprosy patients with reactions.

Reversal reaction (RR) and erythema nodusum leprosum (ENL) can result in

extensive nerve damage and disabilities probably due to the immunological response

to M. leprae antigens. To determine the extent of MAC and C3d deposition in skin

biopsies of reaction leprosy patients we performed immunohistochemistry for C3d

and C9 detecting MAC. Skin biopsies of borderline lepromatous patients without

(Figure 4A, B) or with ENL (Figure 4C, D) or RR (Figure 4E, F) were analyzed. The

skin biopsies of borderline lepromatous patients that developed a RR showed a

significantly higher amount of C3d and MAC deposition compared borderline

lepromatous patients that did not develop a reaction (p=<0.05 and p=<0.01

respectively) (Figure 4E, F). In addition, we found that patients that developed ENL

showed a significantly higher amount of MAC deposition compared to borderline

lepromatous patients that did not develop a reaction (p=<0.01). Quantification of the

stainings indicates that patients who develop ENL or RR have a higher amount of

C3d and MAC deposition in skin lesions compared to patients without reaction

(Figure 4G, H).

4


137

Figure 3. H&E staining of LL leprosy skin (magnification; 100 µm) (A) and zoom-in (magnification; 25

µm) showing giant epithelioid cells in the skin lesion. Double staining of LL leprosy skin for

macrophage marker CD68 (red) with C3d (green) (C) and MAC (green) (D) showed co-localization of

both complement markers with macrophages (magnification; 25 µm). Staining for MAC with the

marker SMI31 that visualizes the nerves or LAM showed that these markers co-localized indicating

that MAC attacks the axons in the skin and that LAM could be a trigger for the complement activation

in the lesions.

MAC deposition in skin of leprosy patients with reactions.

Reversal reaction (RR) and erythema nodusum leprosum (ENL) can result in

extensive nerve damage and disabilities probably due to the immunological response

to M. leprae antigens. To determine the extent of MAC and C3d deposition in skin

biopsies of reaction leprosy patients we performed immunohistochemistry for C3d

and C9 detecting MAC. Skin biopsies of borderline lepromatous patients without

(Figure 4A, B) or with ENL (Figure 4C, D) or RR (Figure 4E, F) were analyzed. The

skin biopsies of borderline lepromatous patients that developed a RR showed a

significantly higher amount of C3d and MAC deposition compared borderline

lepromatous patients that did not develop a reaction (p=<0.05 and p=<0.01

respectively) (Figure 4E, F). In addition, we found that patients that developed ENL

showed a significantly higher amount of MAC deposition compared to borderline

lepromatous patients that did not develop a reaction (p=<0.01). Quantification of the

stainings indicates that patients who develop ENL or RR have a higher amount of

C3d and MAC deposition in skin lesions compared to patients without reaction

(Figure 4G, H).

Chapter 4

138

Figure 4. Representative immunohistochemical stainings of skin sections from BL (A and B), ENL (C

and D) and RR (E and F) for C3d (A, C and E) and MAC (B, D and F) (magnification; 100 µm).


deposits in skin lesions of BL compared to RR patients (p=<0.05 and p=<0.01 respectively). In

addition, patients that developed ENL had a higher amount of MAC deposition in the skin compared to

BL patients without a reaction (p=<0.01). Error bars indicate standard error of the mean.

LAM deposition in skin of paucibacillary and multibacillary leprosy patients.

We previously showed that LAM is the dominant activator of complement and

correlates with the amount of MAC deposition in nerve biopsies of leprosy patients.

Here we determined the amount of LAM deposition in skin biopsies of paucibacillary

and multibacillary patients. We found LAM deposited in both paucibacillary and

multibacillary skin lesions (Figure 5 B, C). Control skin were negative for LAM

deposition (Figure 5A). Quantification of the stainings showed that skin lesions of

multibacillary patients have a significantly higher amount of LAM deposition

compared to paucibacillary patients (p=<0.001) (Figure 5D).

Figure 5. Representative immunohistochemical stainings of skin sections from Control (A),

paucibacillary (B) and multibacillary (C) patients for LAM (magnification; 100 µm). Quantification of the

4


139

Figure 4. Representative immunohistochemical stainings of skin sections from BL (A and B), ENL (C

and D) and RR (E and F) for C3d (A, C and E) and MAC (B, D and F) (magnification; 100 µm).


deposits in skin lesions of BL compared to RR patients (p=<0.05 and p=<0.01 respectively). In

addition, patients that developed ENL had a higher amount of MAC deposition in the skin compared to

BL patients without a reaction (p=<0.01). Error bars indicate standard error of the mean.

LAM deposition in skin of paucibacillary and multibacillary leprosy patients.

We previously showed that LAM is the dominant activator of complement and

correlates with the amount of MAC deposition in nerve biopsies of leprosy patients.

Here we determined the amount of LAM deposition in skin biopsies of paucibacillary

and multibacillary patients. We found LAM deposited in both paucibacillary and

multibacillary skin lesions (Figure 5 B, C). Control skin were negative for LAM

deposition (Figure 5A). Quantification of the stainings showed that skin lesions of

multibacillary patients have a significantly higher amount of LAM deposition

compared to paucibacillary patients (p=<0.001) (Figure 5D).

Figure 5. Representative immunohistochemical stainings of skin sections from Control (A),

paucibacillary (B) and multibacillary (C) patients for LAM (magnification; 100 µm). Quantification of the

Chapter 4

140

staining (D), shows a significant higher amounts of LAM deposits in skin lesions of multibacillary

compared to paucibacillary patients (p=<0.001). Error bars indicate standard error of the mean.

LAM deposition in skin of patients with RR or ENL reaction.

We also analyzed skin biopsies of reactional patients for LAM deposition.

Interestingly, we found a significantly higher amount of LAM deposition in skin

biopsies of borderline lepromatous patients with ENL or RR compared to borderline

lepromatous patients with no reaction (p=<0.05 and p=<0.05, respectively) (Figure

6A, C, D). There was no significant difference between skin biopsies of borderline

lepromatous patients with ENL and borderline lepromatous patients with RR (Figure

6A, B, D).

Figure 6. Representative immunohistochemical stainings of skin sections from BL (A), ENL (B) and

RR(C) patients for LAM (magnification; 100 µm). Quantification of the staining (D), shows a significant

higher amounts of LAM deposits in skin lesions of RR and ENL compared to BL patients without a

reaction (p=<0.05 and p=<0.05, respectively). No statistical difference was found between ENL and

RR patients in the percentage of LAM deposition in skin lesions. Error bars indicate standard error of

the mean.

Complement deposition is associated with the LAM and bacterial index in skin

lesions.

We have previously shown that there is a correlation between bacterial antigen LAM

and complement deposition in nerve biopsies of leprosy patients [17]. We were

interested in whether there is a link between the amount of bacterial antigens/LAM

and the amount of complement activation in the skin biopsies of paucibacillary and

multibacillary leprosy patients. Here, we tested whether there is a correlation

between the extent of C3d staining and the bacterial index (BI) or LAM staining in

corresponding skin areas.

We found a highly significant positive correlation between the amount of C3d and BI

in leprosy skin lesions (r=0.9612, p<0.0001) (Figure 7A). In line with the finding we

also found that the percentage of MAC positive staining correlated with the BI in the

skin lesions (r=0.9909, p<0.0001) (Figure 7B). We also found a significant

association between LAM and C3d or MAC in the skin biopsies of leprosy patients

(r=0.9578, p< 0.0001 and r=0.8585, p<0.0001 respectively) (Figure 7D and E).

Overall, these data show a strong link between the presence of M. leprae antigens or

more specifically LAM and complement activation products in the skin lesions of

leprosy patients.

4


141

staining (D), shows a significant higher amounts of LAM deposits in skin lesions of multibacillary

compared to paucibacillary patients (p=<0.001). Error bars indicate standard error of the mean.

LAM deposition in skin of patients with RR or ENL reaction.

We also analyzed skin biopsies of reactional patients for LAM deposition.

Interestingly, we found a significantly higher amount of LAM deposition in skin

biopsies of borderline lepromatous patients with ENL or RR compared to borderline

lepromatous patients with no reaction (p=<0.05 and p=<0.05, respectively) (Figure

6A, C, D). There was no significant difference between skin biopsies of borderline

lepromatous patients with ENL and borderline lepromatous patients with RR (Figure

6A, B, D).

Figure 6. Representative immunohistochemical stainings of skin sections from BL (A), ENL (B) and

RR(C) patients for LAM (magnification; 100 µm). Quantification of the staining (D), shows a significant

higher amounts of LAM deposits in skin lesions of RR and ENL compared to BL patients without a

reaction (p=<0.05 and p=<0.05, respectively). No statistical difference was found between ENL and

RR patients in the percentage of LAM deposition in skin lesions. Error bars indicate standard error of

the mean.

Complement deposition is associated with the LAM and bacterial index in skin

lesions.

We have previously shown that there is a correlation between bacterial antigen LAM

and complement deposition in nerve biopsies of leprosy patients [17]. We were

interested in whether there is a link between the amount of bacterial antigens/LAM

and the amount of complement activation in the skin biopsies of paucibacillary and

multibacillary leprosy patients. Here, we tested whether there is a correlation

between the extent of C3d staining and the bacterial index (BI) or LAM staining in

corresponding skin areas.

We found a highly significant positive correlation between the amount of C3d and BI

in leprosy skin lesions (r=0.9612, p<0.0001) (Figure 7A). In line with the finding we

also found that the percentage of MAC positive staining correlated with the BI in the

skin lesions (r=0.9909, p<0.0001) (Figure 7B). We also found a significant

association between LAM and C3d or MAC in the skin biopsies of leprosy patients

(r=0.9578, p< 0.0001 and r=0.8585, p<0.0001 respectively) (Figure 7D and E).

Overall, these data show a strong link between the presence of M. leprae antigens or

more specifically LAM and complement activation products in the skin lesions of

leprosy patients.

Chapter 4

142

Figure 7. Bacterial Index (BI) and LAM deposition are associated with C3d and MAC deposition in

skin lesions of leprosy patients. The amount of C3d (a,c) and C9 (b,d) immunoreactivity significantly

correlated with the BI and LAM deposition in skin of paucibacillary and multibacillary (Pearson’s

correlation for BI, r=0.99909, p=<0.0001 and r=0.9612, p=<0.0001 respectively) (Pearson’s correlation

for LAM, r=0.9578, p=<0.0001 and r=0,8585, p=<0.0001 respectively), indicating an association

between the M.leprae BI or LAM and complement activation in leprosy skin.

MAC and LAM deposition in skin lesions of treated BL leprosy patients

We also analyzed skin lesions of leprosy patients after completion of treatment.

Interestingly, skin biopsies of a borderline lepromatous patients after treatment also

showed high levels of MAC deposition (Figure 8A). Along with these findings we

found also high levels of LAM deposition in the skin of these patients (Figure 8B).

This data stregthens the findings that MAC is not cleared by the current treatments.

Figure 8. Representative staining pattern with an antibody against for LAM, detecting M.leprae, or

C9, detecting MAC, in skin biopsies of a treated leprosy patients showing M.leprae antigen LAM (A)

as well as MAC (B) persist in the skin after completion of treatment (magnification; 50 µm).

4


143

Figure 7. Bacterial Index (BI) and LAM deposition are associated with C3d and MAC deposition in

skin lesions of leprosy patients. The amount of C3d (a,c) and C9 (b,d) immunoreactivity significantly

correlated with the BI and LAM deposition in skin of paucibacillary and multibacillary (Pearson’s

correlation for BI, r=0.99909, p=<0.0001 and r=0.9612, p=<0.0001 respectively) (Pearson’s correlation

for LAM, r=0.9578, p=<0.0001 and r=0,8585, p=<0.0001 respectively), indicating an association

between the M.leprae BI or LAM and complement activation in leprosy skin.

MAC and LAM deposition in skin lesions of treated BL leprosy patients

We also analyzed skin lesions of leprosy patients after completion of treatment.

Interestingly, skin biopsies of a borderline lepromatous patients after treatment also

showed high levels of MAC deposition (Figure 8A). Along with these findings we

found also high levels of LAM deposition in the skin of these patients (Figure 8B).

This data stregthens the findings that MAC is not cleared by the current treatments.

Figure 8. Representative staining pattern with an antibody against for LAM, detecting M.leprae, or

C9, detecting MAC, in skin biopsies of a treated leprosy patients showing M.leprae antigen LAM (A)

as well as MAC (B) persist in the skin after completion of treatment (magnification; 50 µm).

Chapter 4

144

4. Discussion

The aim of this study was to explore whether our previous observation in nerve

biopsies can be applied on the skin lesions of leprosy patients to evaluate the

association of complement activation products and persisting M. leprae antigen LAM

in nerve damaging pathology in leprosy. Consequently, we first determined whether

complement activation products are deposited in skin lesions of leprosy patients

throughout the spectrum in relation to the presence of M. leprae antigen LAM. In

addition, we examined the cellular localization of the complement activation products

and whether the deposition of MAC targets the axons in the skin lesions of leprosy

patients. Furthermore, we evaluated whether MAC together with M. leprae antigen

LAM persists in skin lesions of patients after treatment.

We show that C3d is deposited in the center and around granulomas in skin lesions

of paucibacillary patients whereas MAC deposition was rarely found in these lesions.

However, in paucibacillary patients C3d was found to co-localize with macrophages

and T-cells in skin lesions. We suggest that C3d might play an important role in the

inflammation in skin lesions of paucibacillary patients, through co-engagement of the

T-cell receptor and complement receptor 2 (CR2). CR2 is normally found on the

surface of B cells and is a receptor for C3d. Interestingly it has been shown by

different studies that a population of T-cells also has a CR2 receptor [22-24]. C3d

might bind to CR2 expressed on the surface of T-cells and, by ligand–receptor

interaction result in T-cell stimulation and enhancement of the adaptive immune

response. In the skin lesions of paucibacillary leprosy patients nerves were hardly

detected, probably the nerves are already destroyed by the inflammation, caused by

the reactive T-cells.

In skin lesions of multibacillary patients we show that complement component C3d

and MAC deposition was significantly higher compared to lesions of paucibacillary

patients. Also a significantly higher amount of LAM deposition was detected in the

skin lesions of multibacillary patients, compared to paucibacilly patients. These

findings are in line with what we previously observed in nerve biopsies of leprosy

patients, where we found significantly higher amount of LAM deposition in biopsies of

multibacillary compared to paucibacillary patients and LAM co-localizing with MAC on

the axons [17]. In the same study we showed that MAC could be activated by M.

leprae and its antigen LAM and cause nerve damage in mice, while inhibition of MAC

protects the nerve. Interestingly, MAC co-localized with LAM antigen as well as

nerves in the skin lesions, indicating that LAM might be a trigger for complement

activation involving the axonal component. MAC immunoreactivity extended also to

LAM-negative skin areas. This might suggest that the M. leprae antigen LAM

activates complement in the skin and that activated complement may drift from the

target site to adjacent areas attacking axons [3, 4]. It is generally assumed that the

early damage in leprosy patients predominantly occurs in non-myelinated C- fibers

and not in myelinated fibers. In the skin there are myelinated and non-myelinated

nerves, we suggests that the first hallmark of leprosy, loss of sensory nerves in the

skin, may be due to M. leprae antigen LAM which is involved in focal demyelination

and complement activation. We suggest that the nerve and tissue damage is

attributed to the inflammatory response generated in the surrounding tissue by LAM

and MAC.

The terminal complement components are recently associated with host

inflammatory responses generated by phagocytosis of complement-opsonized

particles involving macrophages [25]. In skin lesions of multibacillary patients, LAM is

4


145

4. Discussion

The aim of this study was to explore whether our previous observation in nerve

biopsies can be applied on the skin lesions of leprosy patients to evaluate the

association of complement activation products and persisting M. leprae antigen LAM

in nerve damaging pathology in leprosy. Consequently, we first determined whether

complement activation products are deposited in skin lesions of leprosy patients

throughout the spectrum in relation to the presence of M. leprae antigen LAM. In

addition, we examined the cellular localization of the complement activation products

and whether the deposition of MAC targets the axons in the skin lesions of leprosy

patients. Furthermore, we evaluated whether MAC together with M. leprae antigen

LAM persists in skin lesions of patients after treatment.

We show that C3d is deposited in the center and around granulomas in skin lesions

of paucibacillary patients whereas MAC deposition was rarely found in these lesions.

However, in paucibacillary patients C3d was found to co-localize with macrophages

and T-cells in skin lesions. We suggest that C3d might play an important role in the

inflammation in skin lesions of paucibacillary patients, through co-engagement of the

T-cell receptor and complement receptor 2 (CR2). CR2 is normally found on the

surface of B cells and is a receptor for C3d. Interestingly it has been shown by

different studies that a population of T-cells also has a CR2 receptor [22-24]. C3d

might bind to CR2 expressed on the surface of T-cells and, by ligand–receptor

interaction result in T-cell stimulation and enhancement of the adaptive immune

response. In the skin lesions of paucibacillary leprosy patients nerves were hardly

detected, probably the nerves are already destroyed by the inflammation, caused by

the reactive T-cells.

In skin lesions of multibacillary patients we show that complement component C3d

and MAC deposition was significantly higher compared to lesions of paucibacillary

patients. Also a significantly higher amount of LAM deposition was detected in the

skin lesions of multibacillary patients, compared to paucibacilly patients. These

findings are in line with what we previously observed in nerve biopsies of leprosy

patients, where we found significantly higher amount of LAM deposition in biopsies of

multibacillary compared to paucibacillary patients and LAM co-localizing with MAC on

the axons [17]. In the same study we showed that MAC could be activated by M.

leprae and its antigen LAM and cause nerve damage in mice, while inhibition of MAC

protects the nerve. Interestingly, MAC co-localized with LAM antigen as well as

nerves in the skin lesions, indicating that LAM might be a trigger for complement

activation involving the axonal component. MAC immunoreactivity extended also to

LAM-negative skin areas. This might suggest that the M. leprae antigen LAM

activates complement in the skin and that activated complement may drift from the

target site to adjacent areas attacking axons [3, 4]. It is generally assumed that the

early damage in leprosy patients predominantly occurs in non-myelinated C- fibers

and not in myelinated fibers. In the skin there are myelinated and non-myelinated

nerves, we suggests that the first hallmark of leprosy, loss of sensory nerves in the

skin, may be due to M. leprae antigen LAM which is involved in focal demyelination

and complement activation. We suggest that the nerve and tissue damage is

attributed to the inflammatory response generated in the surrounding tissue by LAM

and MAC.

The terminal complement components are recently associated with host

inflammatory responses generated by phagocytosis of complement-opsonized

particles involving macrophages [25]. In skin lesions of multibacillary patients, LAM is

Chapter 4

146

found abundantly present in macrophages, as seen a previous study [20]. In addition,

C3d and MAC were found also to co-localizing with giant macrophages in these

lesions. It has been suggested that during the process of complement mediated

phagocytosis MAC activates the inflammasome NLRP3 by ‘’jumping’’ from the

surface of complement-opsonized particles to plasma membranes of macrophages

and thereby activating caspase 1 and release of IL1-b and IL-18 [20]. Irrespective of

the mechanism, inflammasome activation plays an important role in the adaptive

immune response including recruiting leukocytes to the site of phagocytosis. This

mechanism might be involved in the skin lesions of multibacillary patients, where

MAC is shown to be on macrophages and might contribute to the nerve damage.

Previous studies have shown that a number of leprosy patients experienced a

reaction, RR or ENL, after the completion of 1 or 2 year of MDT. RR are severe and

of longer duration and are mainly associated with neuritis [26], and occurs mainly in

borderline patients (BT, mid-borderline and BL). Because acute nerve damage

occurs during RR reactions accompanied by and cell-mediated immunity, a role for

the immune system in causing nerve damage during RR has long been suspected

[27].

Here, we show that complement activation products C3d and MAC are deposited in

skin lesions of RR patients. We suggest that both C3d and MAC play an important

role in the nerve damage in the skin. It is likely that C3d co-stimulates auto reactive

T-cells whereas MAC lysis M. leprae infected cells to control the growth of M. leprae

bacilli in the lesions. We suggest that this inflammatory environment amplifies nerve

damage via the release of antigens and continuous activation of complement,

resulting in MAC deposition, which targets the axons.

Leprosy patients with BL and LL forms might experience ENL. During an ENL

reaction, neuritis may occur and cause permanent loss of function of the nerves. The

neuritis may be less aggressive than during a RR, but is still an important problem

during ENL. In ENL patients, it is suggested that inflammatory cytokines are at least

partially responsible for the clinical manifestations [28, 29]. In addition, it is suggested

that antigen antibody complexes are involved in the complement activation occurring

in ENL and thus are involved in complement-mediated inflammation. Interestingly,

skin lesions of ENL patients show an increased amount of MAC deposition compared

to BL patients with no reaction, suggesting a role for complement in reaction patients.

This is in line with a recent study that shows increased immunoreactivity for C1q in

skin lesions of both RR and ENL patients also proving increased activation of

complement in reaction patients [30]. We also found that LAM deposition was also

significantly higher in skin lesions of ENL and RR patients compared to BL patients

with no reaction. We previously showed that there is a correlation between the BI or

LAM and MAC deposition in nerves of leprosy patients [17]. Here, we show that both

the BI and LAM also correlate with C3d and MAC deposition in skin of leprosy

patients indicating a strong link between the presence of M. leprae antigens in skin

and complement activation. Bacterial antigen LAM can be a trigger for complement

activation even after the patients complete treatment. In a previous study, LAM

deposits were detected in lesions of leprosy patients after treatment [20]. We found

an extensive amount of both MAC and LAM deposition in skin lesions of BL patients

after treatment, indicating that treatment does not affect complement activation in the

patients. This data strengthens the findings that LAM is not cleared by the current

treatments. In view of our previous findings that link bacterial antigen LAM with MAC

deposition and that MAC could target the axons, we suggest that complement might

4


147

found abundantly present in macrophages, as seen a previous study [20]. In addition,

C3d and MAC were found also to co-localizing with giant macrophages in these

lesions. It has been suggested that during the process of complement mediated

phagocytosis MAC activates the inflammasome NLRP3 by ‘’jumping’’ from the

surface of complement-opsonized particles to plasma membranes of macrophages

and thereby activating caspase 1 and release of IL1-b and IL-18 [20]. Irrespective of

the mechanism, inflammasome activation plays an important role in the adaptive

immune response including recruiting leukocytes to the site of phagocytosis. This

mechanism might be involved in the skin lesions of multibacillary patients, where

MAC is shown to be on macrophages and might contribute to the nerve damage.

Previous studies have shown that a number of leprosy patients experienced a

reaction, RR or ENL, after the completion of 1 or 2 year of MDT. RR are severe and

of longer duration and are mainly associated with neuritis [26], and occurs mainly in

borderline patients (BT, mid-borderline and BL). Because acute nerve damage

occurs during RR reactions accompanied by and cell-mediated immunity, a role for

the immune system in causing nerve damage during RR has long been suspected

[27].

Here, we show that complement activation products C3d and MAC are deposited in

skin lesions of RR patients. We suggest that both C3d and MAC play an important

role in the nerve damage in the skin. It is likely that C3d co-stimulates auto reactive

T-cells whereas MAC lysis M. leprae infected cells to control the growth of M. leprae

bacilli in the lesions. We suggest that this inflammatory environment amplifies nerve

damage via the release of antigens and continuous activation of complement,

resulting in MAC deposition, which targets the axons.

Leprosy patients with BL and LL forms might experience ENL. During an ENL

reaction, neuritis may occur and cause permanent loss of function of the nerves. The

neuritis may be less aggressive than during a RR, but is still an important problem

during ENL. In ENL patients, it is suggested that inflammatory cytokines are at least

partially responsible for the clinical manifestations [28, 29]. In addition, it is suggested

that antigen antibody complexes are involved in the complement activation occurring

in ENL and thus are involved in complement-mediated inflammation. Interestingly,

skin lesions of ENL patients show an increased amount of MAC deposition compared

to BL patients with no reaction, suggesting a role for complement in reaction patients.

This is in line with a recent study that shows increased immunoreactivity for C1q in

skin lesions of both RR and ENL patients also proving increased activation of

complement in reaction patients [30]. We also found that LAM deposition was also

significantly higher in skin lesions of ENL and RR patients compared to BL patients

with no reaction. We previously showed that there is a correlation between the BI or

LAM and MAC deposition in nerves of leprosy patients [17]. Here, we show that both

the BI and LAM also correlate with C3d and MAC deposition in skin of leprosy

patients indicating a strong link between the presence of M. leprae antigens in skin

and complement activation. Bacterial antigen LAM can be a trigger for complement

activation even after the patients complete treatment. In a previous study, LAM

deposits were detected in lesions of leprosy patients after treatment [20]. We found

an extensive amount of both MAC and LAM deposition in skin lesions of BL patients

after treatment, indicating that treatment does not affect complement activation in the

patients. This data strengthens the findings that LAM is not cleared by the current

treatments. In view of our previous findings that link bacterial antigen LAM with MAC

deposition and that MAC could target the axons, we suggest that complement might

Chapter 4

148

play an important role in M. leprae pathology if the antigens are not completely

cleared from tissue after treatment. We suggest that complement mainly gets

activated in tissue of multibacillary and reaction leprosy patients via the lectin

pathway due to bacterial antigen LAM that triggers this pathway of the complement

system by binding of MBL or ficolins that come from the circulation and results in

MAC deposition on nerves in skin lesions, causing nerve damage.

In summary, complement activation products are found abundantly deposited in skin

lesions of leprosy patients. Skin lesions of multibacillary and reactional leprosy

patients and even after treatment were positive for MAC. We propose the following

model: In multibacillary patients and reactional leprosy patients LAM is the initial

trigger for complement activation and this results in MAC deposition on nerves in skin

lesions, causing nerve damage and inflammation. In paucibacillary patients MAC

deposition is absent to low. However, C3d positive T-cells are found in and around

granulomas in skin lesions, suggesting a possible role for C3d in co-stimulation by

binding CR2 on T-cells resulting in an enhanced immune response.

Our data suggests an important role for complement in M. leprae pathology in the

skin lesions of leprosy patients by either causing nerve damage via MAC deposition

or modulating the adaptive immune response through co-stimulation of T-cells via

C3d. It should be noted that this is a retrospective study; a follow up study, including

the longitudinal analysis of skin biopsies, will be important for a global and definite

conclusion.

Author’s contribution. NBEI performed the experiments, analyzed the data and generated the

figures for the final manuscript; CTS classified the leprosy patients; PR provided the skin biopsies and

validated the data; PKD, FB and VR formulated the project; FB and PKD coordinated the project; AI

advised on the project; NBEI wrote the manuscript.

4


149

play an important role in M. leprae pathology if the antigens are not completely

cleared from tissue after treatment. We suggest that complement mainly gets

activated in tissue of multibacillary and reaction leprosy patients via the lectin

pathway due to bacterial antigen LAM that triggers this pathway of the complement

system by binding of MBL or ficolins that come from the circulation and results in

MAC deposition on nerves in skin lesions, causing nerve damage.

In summary, complement activation products are found abundantly deposited in skin

lesions of leprosy patients. Skin lesions of multibacillary and reactional leprosy

patients and even after treatment were positive for MAC. We propose the following

model: In multibacillary patients and reactional leprosy patients LAM is the initial

trigger for complement activation and this results in MAC deposition on nerves in skin

lesions, causing nerve damage and inflammation. In paucibacillary patients MAC

deposition is absent to low. However, C3d positive T-cells are found in and around

granulomas in skin lesions, suggesting a possible role for C3d in co-stimulation by

binding CR2 on T-cells resulting in an enhanced immune response.

Our data suggests an important role for complement in M. leprae pathology in the

skin lesions of leprosy patients by either causing nerve damage via MAC deposition

or modulating the adaptive immune response through co-stimulation of T-cells via

C3d. It should be noted that this is a retrospective study; a follow up study, including

the longitudinal analysis of skin biopsies, will be important for a global and definite

conclusion.

Author’s contribution. NBEI performed the experiments, analyzed the data and generated the

figures for the final manuscript; CTS classified the leprosy patients; PR provided the skin biopsies and

validated the data; PKD, FB and VR formulated the project; FB and PKD coordinated the project; AI

advised on the project; NBEI wrote the manuscript.

Chapter 4

150

References

1. Ridley DS, Jopling WH. Classification of leprosy according to immunity. A five-group system. Int J Lepr Other Mycobact Dis 1966 Jul;34(3):255-73.

2. Browne SG. Self-healing leprosy: report on 2749 patients. Lepr Rev 1974 Jun;45(2):104-11.

3. Walport MJ. Complement. First of two parts. N Engl J Med 2001 Apr 5;344(14):1058-66.

4. Walport MJ. Complement. Second of two parts. N Engl J Med 2001 Apr 12;344(15):1140-4.

5. Saitz EW, Dierks RE, Shepard CC. Complement and the second component of complement in leprosy. Int J Lepr Other Mycobact Dis 1968 Oct;36(4):400-4.

6. Wemambu SN, Turk JL, Waters MF, Rees RJ. Erythema nodosum leprosum: a clinical manifestation of the arthus phenomenon. Lancet 1969 Nov 1;2(7627):933-5.

7. Malaviya AN, Pasricha A, Pasricha JS, Mehta JS. Significance of serologic abnormalities in lepromatous leprosy. Int J Lepr Other Mycobact Dis 1972 Oct;40(4):361-5.

8. Petchclai B, Chutanondh R, Prasongsom S, Hiranras S, Ramasoota T. Complement profile in leprosy. Am J Trop Med Hyg 1973 Nov;22(6):761-4.

9. Gelber RH, Drutz DJ, Epstein WV, Fasal P. Clinical correlates of C1Q-precipitating substances in the sera of patients with leprosy. Am J Trop Med Hyg 1974 May;23(3):471-5.

10. Gomes GI, Nahn EP, Jr., Santos RK, Da Silva WD, Kipnis TL. The functional state of the complement system in leprosy. Am J Trop Med Hyg 2008 Apr;78(4):605-10.

11. Bahia E, I, Hakobyan S, Ramaglia V, et al. Complement Activation In Leprosy: A Retrospective Study Shows Elevated Circulating Terminal Complement Complex In Reactional Leprosy. Clin Exp Immunol 2016 Jan 8.

12. Parkash O, Kumar V, Mukherjee A, Sengupta U, Malaviya GN, Girdhar BK. Membrane attack complex in thickened cutaneous sensory nerves of leprosy patients. Acta Leprol 1995;9(4):195-9.

13. Ramaglia V, King RH, Nourallah M, et al. The membrane attack complex of the complement system is essential for rapid Wallerian degeneration. J Neurosci 2007 Jul 18;27(29):7663-72.

14. Ramaglia V, King RH, Morgan BP, Baas F. Deficiency of the complement regulator CD59a exacerbates Wallerian degeneration. Mol Immunol 2009 May;46(8-9):1892-6.

15. Ramaglia V, Wolterman R, de KM, et al. Soluble complement receptor 1 protects the peripheral nerve from early axon loss after injury. Am J Pathol 2008 Apr;172(4):1043-52.

16. Ramaglia V, Tannemaat MR, de KM, et al. Complement inhibition accelerates regeneration in a model of peripheral nerve injury. Mol Immunol 2009 Dec;47(2-3):302-9.

17. Bahia E, I, Das PK, Fluiter K, et al. M. leprae components induce nerve damage by complement activation: identification of lipoarabinomannan as the dominant complement activator. Acta Neuropathol 2015 Mar 15.

18. Roche PW, Britton WJ, Failbus SS, Neupane KD, Theuvenet WJ. Serological monitoring of the response to chemotherapy in leprosy patients. Int J Lepr Other Mycobact Dis 1993 Mar;61(1):35-43.

19. Lockwood DN, Colston MJ, Khanolkar-Young SR. The detection of Mycobacterium leprae protein and carbohydrate antigens in skin and nerve from leprosy patients with type 1 (reversal) reactions. Am J Trop Med Hyg 2002 Apr;66(4):409-15.

20. Verhagen C, Faber W, Klatser P, Buffing A, Naafs B, Das P. Immunohistological analysis of in situ expression of mycobacterial antigens in skin lesions of leprosy patients across the histopathological spectrum. Association of Mycobacterial lipoarabinomannan (LAM) and Mycobacterium leprae phenolic glycolipid-I (PGL-I) with leprosy reactions. Am J Pathol 1999 Jun;154(6):1793-804.

21. Fluiter K, Opperhuizen AL, Morgan BP, Baas F, Ramaglia V. Inhibition of the membrane attack complex of the complement system reduces secondary neuroaxonal loss and promotes neurologic recovery after traumatic brain injury in mice. J Immunol 2014 Mar 1;192(5):2339-48.

22. Levy E, Ambrus J, Kahl L, Molina H, Tung K, Holers VM. T lymphocyte expression of complement receptor 2 (CR2/CD21): a role in adhesive cell-cell interactions and dysregulation in a patient with systemic lupus erythematosus (SLE). Clin Exp Immunol 1992 Nov;90(2):235-44.

23. Knopf PM, Rivera DS, Hai SH, McMurry J, Martin W, De Groot AS. Novel function of complement C3d as an autologous helper T-cell target. Immunol Cell Biol 2008 Mar;86(3):221-5.

24. Toapanta FR, Ross TM. Complement-mediated activation of the adaptive immune responses: role of C3d in linking the innate and adaptive immunity. Immunol Res 2006;36(1-3):197-210.

25. Suresh R, Chandrasekaran P, Sutterwala FS, Mosser DM. Complement-mediated 'bystander' damage initiates host NLRP3 inflammasome activation. J Cell Sci 2016 May 1;129(9):1928-39.

26. Balagon MV, Gelber RH, Abalos RM, Cellona RV. Reactions following completion of 1 and 2 year multidrug therapy (MDT). Am J Trop Med Hyg 2010 Sep;83(3):637-44.

27. Modlin RL, Gebhard JF, Taylor CR, Rea TH. In situ characterization of T lymphocyte subsets in the reactional states of leprosy. Clin Exp Immunol 1983 Jul;53(1):17-24.

28. Sarno EN, Grau GE, Vieira LM, Nery JA. Serum levels of tumour necrosis factor-alpha and interleukin-1 beta during leprosy reactional states. Clin Exp Immunol 1991 Apr;84(1):103-8.

29. Khanolkar-Young S, Rayment N, Brickell PM, et al. Tumour necrosis factor-alpha (TNF-alpha) synthesis is associated with the skin and peripheral nerve pathology of leprosy reversal reactions. Clin Exp Immunol 1995 Feb;99(2):196-202.

30. Dupnik KM, Bair TB, Maia AO, et al. Transcriptional Changes That Characterize the Immune Reactions of Leprosy. J Infect Dis 2014 Nov 14.

4


151

References

1. Ridley DS, Jopling WH. Classification of leprosy according to immunity. A five-group system. Int J Lepr Other Mycobact Dis 1966 Jul;34(3):255-73.

2. Browne SG. Self-healing leprosy: report on 2749 patients. Lepr Rev 1974 Jun;45(2):104-11.



5. Saitz EW, Dierks RE, Shepard CC. Complement and the second component of complement in leprosy. Int J Lepr Other Mycobact Dis 1968 Oct;36(4):400-4.

6. Wemambu SN, Turk JL, Waters MF, Rees RJ. Erythema nodosum leprosum: a clinical manifestation of the arthus phenomenon. Lancet 1969 Nov 1;2(7627):933-5.

7. Malaviya AN, Pasricha A, Pasricha JS, Mehta JS. Significance of serologic abnormalities in lepromatous leprosy. Int J Lepr Other Mycobact Dis 1972 Oct;40(4):361-5.

8. Petchclai B, Chutanondh R, Prasongsom S, Hiranras S, Ramasoota T. Complement profile in leprosy. Am J Trop Med Hyg 1973 Nov;22(6):761-4.

9. Gelber RH, Drutz DJ, Epstein WV, Fasal P. Clinical correlates of C1Q-precipitating substances in the sera of patients with leprosy. Am J Trop Med Hyg 1974 May;23(3):471-5.


11. Bahia E, I, Hakobyan S, Ramaglia V, et al. Complement Activation In Leprosy: A Retrospective Study Shows Elevated Circulating Terminal Complement Complex In Reactional Leprosy. Clin Exp Immunol 2016 Jan 8.






17. Bahia E, I, Das PK, Fluiter K, et al. M. leprae components induce nerve damage by complement activation: identification of lipoarabinomannan as the dominant complement activator. Acta Neuropathol 2015 Mar 15.




21. Fluiter K, Opperhuizen AL, Morgan BP, Baas F, Ramaglia V. Inhibition of the membrane attack complex of the complement system reduces secondary neuroaxonal loss and promotes neurologic recovery after traumatic brain injury in mice. J Immunol 2014 Mar 1;192(5):2339-48.





26. Balagon MV, Gelber RH, Abalos RM, Cellona RV. Reactions following completion of 1 and 2 year multidrug therapy (MDT). Am J Trop Med Hyg 2010 Sep;83(3):637-44.

27. Modlin RL, Gebhard JF, Taylor CR, Rea TH. In situ characterization of T lymphocyte subsets in the reactional states of leprosy. Clin Exp Immunol 1983 Jul;53(1):17-24.

28. Sarno EN, Grau GE, Vieira LM, Nery JA. Serum levels of tumour necrosis factor-alpha and interleukin-1 beta during leprosy reactional states. Clin Exp Immunol 1991 Apr;84(1):103-8.

29. Khanolkar-Young S, Rayment N, Brickell PM, et al. Tumour necrosis factor-alpha (TNF-alpha) synthesis is associated with the skin and peripheral nerve pathology of leprosy reversal reactions. Clin Exp Immunol 1995 Feb;99(2):196-202.

30. Dupnik KM, Bair TB, Maia AO, et al. Transcriptional Changes That Characterize the Immune Reactions of Leprosy. J Infect Dis 2014 Nov 14.

Lineke Borstlap. Vrij kort nadat ik met pensioen was gegaan kreeg ik klachten, ik

had veel spierkrampen in mijn hele lichaam en voelde mij behoorlijk moe. Wanneer

je hoort dat je ALS hebt komt er veel op je af en ga je op zoek naar informatie.

Bevestiging gaf gek genoeg ook rust. Het de kinderen vertellen vond ik erg moeilijk.

Aan vrienden vertelde ik dat ik graag films wilde maken voor mijn kleinkinderen, die

nog jong zijn en waarschijnlijk zich later weinig van mij zouden herinneren.

https://www.als.nl/voor-patient/het-verhaal-van/

Complement upregulation and activation on motor neurons

and neuromuscular junction in the SOD1 G93A mouse model of

familial amyotrophic lateral sclerosis

Bianca Heurich1, Nawal Bahia el Idrissi 2, Rossen M Donev1, Susanne Petri 3, Peter

Claus 4, James Neal 5, B. Paul Morgan1, Valeria Ramaglia1,2 Journal of

Neuroimmunology, 2011 March.

1 Department of Infection, Immunity and Biochemistry, School of Medicine, Cardiff, UK; 2

Department of Genome Analysis, Academic Medical Centre, Amsterdam, The Netherlands; 3

Department of Neurology, Hannover Medical School, Germany; 4 Institute of Neuroanatomy,

Hannover Medical School, Germany; 5 Department of Histopathology, School of Medicine,

Cardiff, UK.















Complement upregulation and activation on motor neurons

and neuromuscular junction in the SOD1 G93A mouse model of

familial amyotrophic lateral sclerosis

Bianca Heurich1, Nawal Bahia el Idrissi 2, Rossen M Donev1, Susanne Petri 3, Peter

Claus 4, James Neal 5, B. Paul Morgan1, Valeria Ramaglia1,2 Journal of

Neuroimmunology, 2011 March.

1 Department of Infection, Immunity and Biochemistry, School of Medicine, Cardiff, UK; 2

Department of Genome Analysis, Academic Medical Centre, Amsterdam, The Netherlands; 3

Department of Neurology, Hannover Medical School, Germany; 4 Institute of Neuroanatomy,

Hannover Medical School, Germany; 5 Department of Histopathology, School of Medicine,

Cardiff, UK.

5








Chapter 5

154

Abstract

Complement activation products are elevated in cerebrospinal fluid, spinal cord and

motor cortex of patients with amyotrophic lateral sclerosis (ALS) but are untested in

models. We determined complement expression and activation in the SOD1 G93A

mouse model of familial ALS (fALS). At 126 days, C3 mRNA was upregulated in

spinal cord and C3 protein accumulated in astrocytes and motor neurons. C3

activation products C3b/iC3b were localized exclusively on motor neurons. At the

neuromuscular junction, deposits of C3b/iC3b and C1q were detected at day 47,

before the appearance of clinical symptoms, and remained detectable at

symptomatic stage (126 days). Our findings implicate complement in the denervation

of the muscle endplate by day 47 and destruction of the neuromuscular junction and

spinal neuron loss by day 126 in the SOD1 G93A mouse model of fALS.

Keywords: Amyotrophic lateral sclerosis, Complement, Motor neurons, Neuromuscular junction

1. Introduction

Amyotrophic lateral sclerosis (ALS), the most common adult-onset motor

neuron disease (Pasinelli and Brown, 2006), is characterized by progressive

degeneration of both upperand lower motor neurons, leading to muscle atrophy and

eventually death from respiratory paralysis (Mitchell and Borasio, 2007). With rare

exceptions, the cause of disease is unknown and the mechanism of motor neuron

injury occult. Most ALS cases (90%) are sporadic (sALS) while 10% are familial

(fALS); 15–20% of these are caused by mutations in copper/zinc superoxide

dismutase 1 (SOD1) (Rosen et al., 1993). Transgenic mice expressing the

commonest of these mutations, SOD1 G93A, develop a pathological and

clinical phenotype resembling human ALS (Gurney, 1994a).

Complement (C), a key component of innate immunity, has the capacity to cause

damage to self and is consequently implicated in many diseases (Walport,

2001a and Walport, 2001b). A role for C in the pathogenesis of ALS in humans is

suggested by the presence of C activation products, including C3c, C3d, C4d and

C3dg, in spinal cord and motor cortex, and in elevated concentrations in serum and

CSF (Annunziata and Volpi, 1985, Apostolski et al., 1991, Tsuboi and Yamada,

1994 and Goldknopf et al., 2006). In murine ALS models,upregulation of C1q and C4

in motor neurons (Lobsiger et al., 2007 and Ferraiuolo et al., 2007), and C3

upregulation in the anterior horn areas containing motor neuron degeneration

(Woodruff et al., 2008), are described. Surprisingly, C deposition at

the neuromuscular junction (NMJ) and motor end plate (MEP), principal sites of

degeneration in human and mouse ALS (Fischer et al., 2004), has not been reported.

We examined expression, localization and activation of C3 in spinal cord and MEP,

and C1q deposition at MEP, in the SOD1 G93A mouse model of fALS at

5

Complement in the SOD1G93A mouse

155

Abstract

Complement activation products are elevated in cerebrospinal fluid, spinal cord and

motor cortex of patients with amyotrophic lateral sclerosis (ALS) but are untested in

models. We determined complement expression and activation in the SOD1 G93A

mouse model of familial ALS (fALS). At 126 days, C3 mRNA was upregulated in

spinal cord and C3 protein accumulated in astrocytes and motor neurons. C3

activation products C3b/iC3b were localized exclusively on motor neurons. At the

neuromuscular junction, deposits of C3b/iC3b and C1q were detected at day 47,

before the appearance of clinical symptoms, and remained detectable at

symptomatic stage (126 days). Our findings implicate complement in the denervation

of the muscle endplate by day 47 and destruction of the neuromuscular junction and

spinal neuron loss by day 126 in the SOD1 G93A mouse model of fALS.

Keywords: Amyotrophic lateral sclerosis, Complement, Motor neurons, Neuromuscular junction

1. Introduction

Amyotrophic lateral sclerosis (ALS), the most common adult-onset motor

neuron disease (Pasinelli and Brown, 2006), is characterized by progressive

degeneration of both upperand lower motor neurons, leading to muscle atrophy and

eventually death from respiratory paralysis (Mitchell and Borasio, 2007). With rare

exceptions, the cause of disease is unknown and the mechanism of motor neuron

injury occult. Most ALS cases (90%) are sporadic (sALS) while 10% are familial

(fALS); 15–20% of these are caused by mutations in copper/zinc superoxide

dismutase 1 (SOD1) (Rosen et al., 1993). Transgenic mice expressing the

commonest of these mutations, SOD1 G93A, develop a pathological and

clinical phenotype resembling human ALS (Gurney, 1994a).

Complement (C), a key component of innate immunity, has the capacity to cause

damage to self and is consequently implicated in many diseases (Walport,

2001a and Walport, 2001b). A role for C in the pathogenesis of ALS in humans is

suggested by the presence of C activation products, including C3c, C3d, C4d and

C3dg, in spinal cord and motor cortex, and in elevated concentrations in serum and

CSF (Annunziata and Volpi, 1985, Apostolski et al., 1991, Tsuboi and Yamada,

1994 and Goldknopf et al., 2006). In murine ALS models,upregulation of C1q and C4

in motor neurons (Lobsiger et al., 2007 and Ferraiuolo et al., 2007), and C3

upregulation in the anterior horn areas containing motor neuron degeneration

(Woodruff et al., 2008), are described. Surprisingly, C deposition at

the neuromuscular junction (NMJ) and motor end plate (MEP), principal sites of

degeneration in human and mouse ALS (Fischer et al., 2004), has not been reported.

We examined expression, localization and activation of C3 in spinal cord and MEP,

and C1q deposition at MEP, in the SOD1 G93A mouse model of fALS at

Chapter 5

156

presymptomatic (47 days) and symptomatic (126 days) stages of disease

progression.

2. Materials and methods

2.1. Animals

G93A transgenic familial ALS mice [high copy number; B6SJLTg (SOD1-

G93A)1Gur/J] (Gurney, 1994b) and wildtype (B6SJL) littermates were free of

microbiological infection (FELASA screened). Mice were housed in groups at 20 °C

on 12:12 h light:dark cycle, with free access to food and water. Experimental

protocols complied with national animal care guidelines, licensed by the responsible

authority.

2.2. Tissue processing

SOD1 G93A and wildtype mice were killed at post-natal day 47 (presymptomatic

stage SOD1 G93A n = 5; wildtype n = 5) and post-natal day 126 (symptomatic stage

SOD1 G93A n = 7; wildtype n = 5) by CO2 inhalation. Spinal cord and gastrocnemius

muscle were dissected, post-fixed overnight in 4% paraformaldehyde/PBS at 4 °C,

cryoprotected in 30% sucrose/PBS for 72 h at 4 °C, then embedded in OCT (Sakura,

Zoeterwoude, NL), frozen in liquid nitrogen and stored at − 80 °C until used

for histology. A portion of spinal cord was fresh frozen for RNA analysis.

2.3. Molecular analyses

Total RNA was extracted from spinal cords using GeneElute Mammalian Total RNA

Miniprep kits (Sigma-Aldrich, Dorset, UK). cDNAs were synthesized using

TaqManReverse Transcription reagents (Applied Biosystems, Warrington, UK).

Reactions were run on the Mini Opticon Taqman (Bio-Rad, Hemel Hempstead, UK)

with SYBR GREEN Supermix and primer pairs described in Table 1. C component

copy number was calculated using the comparative Ct (∆∆Ct) method (Donev and

5


157

presymptomatic (47 days) and symptomatic (126 days) stages of disease

progression.

2. Materials and methods

2.1. Animals

G93A transgenic familial ALS mice [high copy number; B6SJLTg (SOD1-

G93A)1Gur/J] (Gurney, 1994b) and wildtype (B6SJL) littermates were free of

microbiological infection (FELASA screened). Mice were housed in groups at 20 °C

on 12:12 h light:dark cycle, with free access to food and water. Experimental

protocols complied with national animal care guidelines, licensed by the responsible

authority.

2.2. Tissue processing

SOD1 G93A and wildtype mice were killed at post-natal day 47 (presymptomatic

stage SOD1 G93A n = 5; wildtype n = 5) and post-natal day 126 (symptomatic stage

SOD1 G93A n = 7; wildtype n = 5) by CO2 inhalation. Spinal cord and gastrocnemius

muscle were dissected, post-fixed overnight in 4% paraformaldehyde/PBS at 4 °C,

cryoprotected in 30% sucrose/PBS for 72 h at 4 °C, then embedded in OCT (Sakura,

Zoeterwoude, NL), frozen in liquid nitrogen and stored at − 80 °C until used

for histology. A portion of spinal cord was fresh frozen for RNA analysis.

2.3. Molecular analyses

Total RNA was extracted from spinal cords using GeneElute Mammalian Total RNA

Miniprep kits (Sigma-Aldrich, Dorset, UK). cDNAs were synthesized using

TaqManReverse Transcription reagents (Applied Biosystems, Warrington, UK).

Reactions were run on the Mini Opticon Taqman (Bio-Rad, Hemel Hempstead, UK)

with SYBR GREEN Supermix and primer pairs described in Table 1. C component

copy number was calculated using the comparative Ct (∆∆Ct) method (Donev and

Chapter 5

158

Morgan, 2006) with results normalized against β-actin. At least two independent

experiments in triplicate were performed for each cDNA analyzed.

Table 1. Mouse Taqman primer sequences

Target gene Accession no. Primer Sequence 5’-3’

C3 NM_009778 Forward

Reverse

5’-AAGCATCAACACACCCAACA-3’

5’-CTTGAGCTCCATTCGTGACA-3’

fH NM_009888 Forward

Reverse

5’-GCACCCAGGCTACCTACAAA-3’

5’-AGATCCAACTGCCAGCCTAA-3’

Crry NM_013499 Forward

Reverse

5’-CCCATCACAGCTTCCTTCTG-3’

5’-CTTCAGCACTCGTCCAGGTT-3’

DAF NM_010016 Forward

Reverse

5’-CTTGCCTTGAGGATTTAGTATGG-3’

5’-CTAGCCTGTACCCTGGGTTG-3’

2.4. Immunohistochemistry

Transverse sections (7 µm) of lumbar spinal cord were fixed (cold acetone,

10 min),endogenous peroxidases were blocked in 0.03% H2O2/PBS (RT, 20 min),

and non-specific binding sites blocked in 10% normal goat serum (NGS)/PBS (RT,

20 min). Slides were incubated with appropriate primary antibodies (Table 2) diluted

in 1% bovine serum albumin(BSA) (90 min, RT), followed by biotinylated

secondary antibody (Table 2) in 1% BSA (30 min, RT), and peroxidase–

polystreptavidin (Sigma-Aldrich; 20 min RT) diluted 1:400 in 1% BSA. Controls

included irrelevant antibody of identical isotype and omission of primary antibody. To

visualize peroxidase activity, slides were incubated in 3,3-diaminobenzidine

tetrahydrochloride (DAB; Peroxidase Substrate Kit, VectorLabs, Peterborough, UK;

3 min) then counterstained with hematoxylin. Slides were dehydrated in ethanol and

mounted in Pertex (Histolab, Gothenburg, Sweden).

For fluorescent immunostaining, sections were pre-incubated with Image-iT FX

Signal Enhancer (Invitrogen, Renfrew, UK; 0.1 ml, 30 min, RT), then with mouse anti-

NeuN in PBS/BSA , followed by rat anti-C3 antibody (each diluted in 1% BSA,

incubated 60 min, RT). Bound antibody was detected using the mouse-on-mouse

Immunodetection Kit (Vector) according to manufacturer's instructions, followed

sequentially by FITC-labeled polystreptavidin (Sigma-Aldrich; 1:400 in PBS/BSA) and

rhodamine (TRITC)-conjugated goat anti-rat immunoglobulin (Table 2). Slides were

counterstained with Dapi (Sigma; 1:1000 in PBS/BSA) and mounted in anti-fade

medium (Fluor Save™, Calbiochem, Nottingham, UK).

For confocal microscopy, 40 µm muscle sections were permeabilized with 1%

TritonX-100 in PBS and blocked with 5% BSA for 1 h at RT, then incubated with

primary and secondary antibodies (Table 2; each overnight at RT). End-plates were

5


159

Morgan, 2006) with results normalized against β-actin. At least two independent

experiments in triplicate were performed for each cDNA analyzed.

Table 1. Mouse Taqman primer sequences

Target gene Accession no. Primer Sequence 5’-3’

C3 NM_009778 Forward

Reverse

5’-AAGCATCAACACACCCAACA-3’

5’-CTTGAGCTCCATTCGTGACA-3’

fH NM_009888 Forward

Reverse

5’-GCACCCAGGCTACCTACAAA-3’

5’-AGATCCAACTGCCAGCCTAA-3’

Crry NM_013499 Forward

Reverse

5’-CCCATCACAGCTTCCTTCTG-3’

5’-CTTCAGCACTCGTCCAGGTT-3’

DAF NM_010016 Forward

Reverse

5’-CTTGCCTTGAGGATTTAGTATGG-3’

5’-CTAGCCTGTACCCTGGGTTG-3’

2.4. Immunohistochemistry

Transverse sections (7 µm) of lumbar spinal cord were fixed (cold acetone,

10 min),endogenous peroxidases were blocked in 0.03% H2O2/PBS (RT, 20 min),

and non-specific binding sites blocked in 10% normal goat serum (NGS)/PBS (RT,

20 min). Slides were incubated with appropriate primary antibodies (Table 2) diluted

in 1% bovine serum albumin(BSA) (90 min, RT), followed by biotinylated

secondary antibody (Table 2) in 1% BSA (30 min, RT), and peroxidase–

polystreptavidin (Sigma-Aldrich; 20 min RT) diluted 1:400 in 1% BSA. Controls

included irrelevant antibody of identical isotype and omission of primary antibody. To

visualize peroxidase activity, slides were incubated in 3,3-diaminobenzidine

tetrahydrochloride (DAB; Peroxidase Substrate Kit, VectorLabs, Peterborough, UK;

3 min) then counterstained with hematoxylin. Slides were dehydrated in ethanol and

mounted in Pertex (Histolab, Gothenburg, Sweden).

For fluorescent immunostaining, sections were pre-incubated with Image-iT FX

Signal Enhancer (Invitrogen, Renfrew, UK; 0.1 ml, 30 min, RT), then with mouse anti-

NeuN in PBS/BSA , followed by rat anti-C3 antibody (each diluted in 1% BSA,

incubated 60 min, RT). Bound antibody was detected using the mouse-on-mouse

Immunodetection Kit (Vector) according to manufacturer's instructions, followed

sequentially by FITC-labeled polystreptavidin (Sigma-Aldrich; 1:400 in PBS/BSA) and

rhodamine (TRITC)-conjugated goat anti-rat immunoglobulin (Table 2). Slides were

counterstained with Dapi (Sigma; 1:1000 in PBS/BSA) and mounted in anti-fade

medium (Fluor Save™, Calbiochem, Nottingham, UK).

For confocal microscopy, 40 µm muscle sections were permeabilized with 1%

TritonX-100 in PBS and blocked with 5% BSA for 1 h at RT, then incubated with

primary and secondary antibodies (Table 2; each overnight at RT). End-plates were

Chapter 5

160

labeled with Alexa Fluor® 647-conjugated anti-α-bungarotoxin (Invitrogen; 5 µg/ml in

PBS/BSA, 1 h, RT). Sections were mounted as above and images captured with a

digital camera attached to a light/fluorescent microscope (DM LB2, Leica

Microsystems, Bucks, UK) or from a confocal imaging system (TCS SP2, Leica).

Table 2. Antibodies for immunohistochemistry

Antibody Clone Source Concentration / dilution

Primary antibodies Monoclonal rat anti-mouse C3

11H9

HyCult biotechnology (NL)

2µg/ml

Monoclonal rat anti-mouse iC3b/C3b/C3c

3/26

HyCult biotechnology

200µg/ml

Monoclonal mouse anti-mouse C1q JL-1 HyCult biotechnology

2µg/ml

Monoclonal mouse anti-mouse NeuN A60 Millipore (UK) 2µg/ml Polyclonal rabbit anti-rat/mouse C9

Made in house 2µg/ml

Rabbit polyclonal antiserum cocktail to neurofilaments

Biotrend (UK)

1:80

Secondary antibodies Biotinylated-polyclonal goat anti-rat

Vector labs (UK)

7.5µg/ml

Alexa-Fluor 488®-conjugated goat anti-rat

Invitrogen (UK)

20µg/ml

Alexa-Fluor 488®-conjugated goat anti-mouse

Invitrogen

20µg/ml

Rhodamine (TRITC)-conjugated donkey anti-rabbit

Jackson Immuno Research (UK)

1µg/ml

2.5. Quantitative analysis of immunohistochemistry

Quantitative analysis of C3 immunostaining was performed using Image Pro Plus

6.00 (Media Cybernatics, Wokingham, UK). Four non-consecutive sections of spinal

cord were scored for each animal in each group. Percentage immunoreactive area

per section was scored and expressed as mean ± SD.

2.6. Statistical analysis

Two tailed t test was performed for the analysis of qPCR and

C3 immunoreactivity data. Statistical significance was accepted when p ≤ 0.05.

5


161

labeled with Alexa Fluor® 647-conjugated anti-α-bungarotoxin (Invitrogen; 5 µg/ml in

PBS/BSA, 1 h, RT). Sections were mounted as above and images captured with a

digital camera attached to a light/fluorescent microscope (DM LB2, Leica

Microsystems, Bucks, UK) or from a confocal imaging system (TCS SP2, Leica).

Table 2. Antibodies for immunohistochemistry

Antibody Clone Source Concentration / dilution

Primary antibodies Monoclonal rat anti-mouse C3

11H9

HyCult biotechnology (NL)

2µg/ml

Monoclonal rat anti-mouse iC3b/C3b/C3c

3/26

HyCult biotechnology

200µg/ml

Monoclonal mouse anti-mouse C1q JL-1 HyCult biotechnology

2µg/ml

Monoclonal mouse anti-mouse NeuN A60 Millipore (UK) 2µg/ml Polyclonal rabbit anti-rat/mouse C9

Made in house 2µg/ml

Rabbit polyclonal antiserum cocktail to neurofilaments

Biotrend (UK)

1:80

Secondary antibodies Biotinylated-polyclonal goat anti-rat

Vector labs (UK)

7.5µg/ml

Alexa-Fluor 488®-conjugated goat anti-rat

Invitrogen (UK)

20µg/ml

Alexa-Fluor 488®-conjugated goat anti-mouse

Invitrogen

20µg/ml

Rhodamine (TRITC)-conjugated donkey anti-rabbit

Jackson Immuno Research (UK)

1µg/ml

2.5. Quantitative analysis of immunohistochemistry

Quantitative analysis of C3 immunostaining was performed using Image Pro Plus

6.00 (Media Cybernatics, Wokingham, UK). Four non-consecutive sections of spinal

cord were scored for each animal in each group. Percentage immunoreactive area

per section was scored and expressed as mean ± SD.

2.6. Statistical analysis

Two tailed t test was performed for the analysis of qPCR and

C3 immunoreactivity data. Statistical significance was accepted when p ≤ 0.05.

Chapter 5

162

3. Results

C component expression is not up-regulated in the spinal cord of

the SOD1 G93A mouse at presymptomatic stage, but is up-regulated in the late

symptomatic stage (Ferraiuolo et al., 2007 and Woodruff et al., 2008). Here we

determined whether C3 up-regulation at symptomatic stage, day 126, was also

paralleled by C3 activation in the spinal cord.

Expression of mRNA encoding C3 and C3 convertase regulators was measured in

spinal cords from 126 days old SOD1 G93A and wildtype mice. C3 mRNA was

elevated 12-fold in SOD1 G93A mice compared to wildtype (p ≤ 0.05), whereas

expression of the C3 convertase regulators CfH, DAF and Crry were not different

(Fig. 1). Abundant C3 proteinimmunoreactivity was detected in SOD1 G93A mice in

neurons and astrocytes in the ventral horn of the spinal cord, while wildtype cord

showed only faint neuronal staining (Fig. 2A-C and I, p < 0.05). Neuronal localization

was confirmed by co-staining with NeuN (Fig. 2D-F). C3 activation product

immunoreactivity, detected with the C3b/iC3b/C3c-specific antibody(clone 3/26), was

observed on ventral horn neurons but not astrocytes in SOD1 G93A spinal cord;

wildtype cord stained only in blood vessels (Fig. 2G and H). Staining for membrane

attack complex (MAC) using a proven anti-mouse C9 antibody, was consistently

negative in all spinal cord sections (not shown).

Figure 1. Complement C3, factor H, DAF and Crry mRNA relative levels in spinal cords of wildtype

(n=5) and SOD1 G93A (n=7) mice at 126 days, showing up-regulation of C3 mRNA in SOD1 G93A

spinal cord compared to wildtypes but no changes in the mRNA levels of fH, DAF and Crry regulators

of the C3 convertase.

5


163

3. Results

C component expression is not up-regulated in the spinal cord of

the SOD1 G93A mouse at presymptomatic stage, but is up-regulated in the late

symptomatic stage (Ferraiuolo et al., 2007 and Woodruff et al., 2008). Here we

determined whether C3 up-regulation at symptomatic stage, day 126, was also

paralleled by C3 activation in the spinal cord.

Expression of mRNA encoding C3 and C3 convertase regulators was measured in

spinal cords from 126 days old SOD1 G93A and wildtype mice. C3 mRNA was

elevated 12-fold in SOD1 G93A mice compared to wildtype (p ≤ 0.05), whereas

expression of the C3 convertase regulators CfH, DAF and Crry were not different

(Fig. 1). Abundant C3 proteinimmunoreactivity was detected in SOD1 G93A mice in

neurons and astrocytes in the ventral horn of the spinal cord, while wildtype cord

showed only faint neuronal staining (Fig. 2A-C and I, p < 0.05). Neuronal localization

was confirmed by co-staining with NeuN (Fig. 2D-F). C3 activation product

immunoreactivity, detected with the C3b/iC3b/C3c-specific antibody(clone 3/26), was

observed on ventral horn neurons but not astrocytes in SOD1 G93A spinal cord;

wildtype cord stained only in blood vessels (Fig. 2G and H). Staining for membrane

attack complex (MAC) using a proven anti-mouse C9 antibody, was consistently

negative in all spinal cord sections (not shown).

Figure 1. Complement C3, factor H, DAF and Crry mRNA relative levels in spinal cords of wildtype

(n=5) and SOD1 G93A (n=7) mice at 126 days, showing up-regulation of C3 mRNA in SOD1 G93A

spinal cord compared to wildtypes but no changes in the mRNA levels of fH, DAF and Crry regulators

of the C3 convertase.

Chapter 5

164

Figure 2. (A-C) Representative C3 immunostaining of ventral horn of the spinal cord in wildtype (A)

(n=5) and SOD1 G93A (B-C) (n=7) at 126 days, showing trace C3 immunoreactivity in wildtypes

contrasting with abundant C3 immunoreactivity in the SOD1 G93A cord localizing with astrocytes (C,

arrows) and neurons (C, arrowheads). (D-F) Double immunofluorescent staining of NeuN and C3,

showing co-localization in the SOD1 G93A cord at 126 days (D-F, arrows and F, in yellow). Note C3-

positive/NeuN-negative astrocytes. (G,H) Representative C3b/iC3b immunostaining of spinal cord

ventral horn showing blood vessel immunoreactivity in the wildtype (G, arrows head), contrasting with

strong neuronal immunoreactivity in SOD1 G93A at 126 days (H, arrow head). (I) Quantification of C3

immunoreactive area, showing higher level in SOD1 G93A spinal cords compared to wildtypes at 126

days. Data represent mean±SD. Statistical significance is for p≤0.05.

C deposition and activation have never been tested at the NMJ of SOD1 G93A mice.

Therefore we examined the NMJ/MEP of SOD1 G93A mice for C deposition and

activation at the presymptomatic (47 days) and symptomatic (126 days) stages.

NMJ/MEP was detected by double immunofluorescent staining with anti-

neurofilament (detects nerve terminals) and α-bungarotoxin (detects MEP). Confocal

microscopy showed abundant C3b/iC3b immunoreactivity in SOD1 G93A muscle, co-

localized with degenerated MEP at post-natal day 47 (Fig. 3A–H) and 126 (Fig. 3Q–

X); C1q immunoreactivity was present at the MEP (Fig. 3O) and nerve terminals

(Fig. 3O, arrows) at 47 days and still detectable at the MEP edge at 126 days

(Fig. 3AE–AF), implicating classical pathway activation, although IgG deposition was

absent from this site. No MAC staining was detected in SOD1 G93A muscle. In

contrast, wildtypes displayed no C3b/iC3b or C1q or MAC immunoreactivity in

muscle.

5


165

Figure 2. (A-C) Representative C3 immunostaining of ventral horn of the spinal cord in wildtype (A)

(n=5) and SOD1 G93A (B-C) (n=7) at 126 days, showing trace C3 immunoreactivity in wildtypes

contrasting with abundant C3 immunoreactivity in the SOD1 G93A cord localizing with astrocytes (C,

arrows) and neurons (C, arrowheads). (D-F) Double immunofluorescent staining of NeuN and C3,

showing co-localization in the SOD1 G93A cord at 126 days (D-F, arrows and F, in yellow). Note C3-

positive/NeuN-negative astrocytes. (G,H) Representative C3b/iC3b immunostaining of spinal cord

ventral horn showing blood vessel immunoreactivity in the wildtype (G, arrows head), contrasting with

strong neuronal immunoreactivity in SOD1 G93A at 126 days (H, arrow head). (I) Quantification of C3

immunoreactive area, showing higher level in SOD1 G93A spinal cords compared to wildtypes at 126

days. Data represent mean±SD. Statistical significance is for p≤0.05.

C deposition and activation have never been tested at the NMJ of SOD1 G93A mice.

Therefore we examined the NMJ/MEP of SOD1 G93A mice for C deposition and

activation at the presymptomatic (47 days) and symptomatic (126 days) stages.

NMJ/MEP was detected by double immunofluorescent staining with anti-

neurofilament (detects nerve terminals) and α-bungarotoxin (detects MEP). Confocal

microscopy showed abundant C3b/iC3b immunoreactivity in SOD1 G93A muscle, co-

localized with degenerated MEP at post-natal day 47 (Fig. 3A–H) and 126 (Fig. 3Q–

X); C1q immunoreactivity was present at the MEP (Fig. 3O) and nerve terminals

(Fig. 3O, arrows) at 47 days and still detectable at the MEP edge at 126 days

(Fig. 3AE–AF), implicating classical pathway activation, although IgG deposition was

absent from this site. No MAC staining was detected in SOD1 G93A muscle. In

contrast, wildtypes displayed no C3b/iC3b or C1q or MAC immunoreactivity in

muscle.

Chapter 5

166

Figure 3. Representative confocal microscopy images of the NMJ from wildtype (n=10) and SOD1

G93A mice (n=12) at 47 (A-P) and 126 days (Q-AF), immunostained for C3b/iC3b (A-H; Q-X) and C1q

(I-P; Y-AF), showing deposition of C3b/iC3b (G and W) and C1q (O and AE arrows) on the muscle

end-plate and nerve terminals (O, arrows) in SOD1 G93A mice. The nerve terminal is labelled with

polyclonal antiserum to neurofilaments (A, E, I, M, Q, U, Y, AC in red). The muscle end-plate is

labelled with α-bungarotoxin (B, F, J, N, R, V, Z, AD in magenta).

5


167

Figure 3. Representative confocal microscopy images of the NMJ from wildtype (n=10) and SOD1

G93A mice (n=12) at 47 (A-P) and 126 days (Q-AF), immunostained for C3b/iC3b (A-H; Q-X) and C1q

(I-P; Y-AF), showing deposition of C3b/iC3b (G and W) and C1q (O and AE arrows) on the muscle

end-plate and nerve terminals (O, arrows) in SOD1 G93A mice. The nerve terminal is labelled with

polyclonal antiserum to neurofilaments (A, E, I, M, Q, U, Y, AC in red). The muscle end-plate is

labelled with α-bungarotoxin (B, F, J, N, R, V, Z, AD in magenta).

Chapter 5

168

4. Discussion

The data show upregulation of C3 mRNA and protein in spinal cord ventral horn

neurons andastrocytes, and C3 activation product deposition restricted to ventral

horn neurons in the 126 days SOD1 G93A fALS model. C3 activation products and

C1q were also deposited on the denervated and degenerated SOD1 G93A MEP at

47 and 126 days.

Motor neuron pathology in the SOD1 G93A mouse begins distally

with denervation of NMJ by day 47, followed by motor axon loss between days 47–

80, and loss of lumbar cord neuronal cell bodies after day 80 (Fischer et al.,

2004). Axons express C components but lack C regulators (de Jonge et al., 2004),

rendering them vulnerable to C attack (Ramaglia et al., 2007). Presynaptic

neurons and perisynaptic Schwann cells are also sensitive to C attack and undergo

C-mediated damage in peripheral neuropathy models (O'Hanlon et al.,

2001 and Halstead et al., 2004). C3 fragment and C1q deposition at the denervated

MEP in SOD1 G93A mice implicate the classical C pathway in degeneration of distal

axons. A novel role for C1q/C3 in selective elimination of synaptic connections during

development was recently described (Stevens et al., 2007). Developmental

elimination of synapses involves tagging by C3 fragments and phagocytosis by

resident macrophages; our data suggest that this process is mimicked at the NMJ in

the SOD1 G93A mouse, leading to synapsedegeneration.

Although C3 biosynthesis was up-regulated in both motor neurons and astrocytes in

SOD1 G93A mice, C3 activation products deposit only on motor neurons, driving

their loss. Neighboring astrocytes resist C3 activation because they abundantly

express C3 convertase regulators (Griffiths et al., 2009), but contribute to neuronal

loss by increasing local synthesis of C components. Both neurons and astrocytes

must express mutant SOD1 for development of ALS pathology (Wang et al.,

2005, Gong et al., 2000 and Pramatarova et al., 2001). If expression of the mutant

SOD1 directly or indirectly drives up-regulation of C component synthesis, then it

may be that local C biosynthesis only breaches the threshold necessary for neuronal

damage when both neurons and astrocytes are involved.

Treatment with C inhibitors protects from early axonal degeneration and facilitates

regeneration and recovery in peripheral nerve injury (Ramaglia et al., 2009). Because

C is deposited and activated at the NMJ before denervation, and axonal loss

precedes motor neuron loss in ALS (Fischer et al., 2004), early intervention with C

inhibitors may protect the NMJ and stop further neuronal degeneration, offering the

prospect of therapy for this currently untreatable disorder.

Acknowledgments. We thank Dr. J. Verhaagen for kindly providing the mouse tissue for this study.

5


169

4. Discussion

The data show upregulation of C3 mRNA and protein in spinal cord ventral horn

neurons andastrocytes, and C3 activation product deposition restricted to ventral

horn neurons in the 126 days SOD1 G93A fALS model. C3 activation products and

C1q were also deposited on the denervated and degenerated SOD1 G93A MEP at

47 and 126 days.

Motor neuron pathology in the SOD1 G93A mouse begins distally

with denervation of NMJ by day 47, followed by motor axon loss between days 47–

80, and loss of lumbar cord neuronal cell bodies after day 80 (Fischer et al.,

2004). Axons express C components but lack C regulators (de Jonge et al., 2004),

rendering them vulnerable to C attack (Ramaglia et al., 2007). Presynaptic

neurons and perisynaptic Schwann cells are also sensitive to C attack and undergo

C-mediated damage in peripheral neuropathy models (O'Hanlon et al.,

2001 and Halstead et al., 2004). C3 fragment and C1q deposition at the denervated

MEP in SOD1 G93A mice implicate the classical C pathway in degeneration of distal

axons. A novel role for C1q/C3 in selective elimination of synaptic connections during

development was recently described (Stevens et al., 2007). Developmental

elimination of synapses involves tagging by C3 fragments and phagocytosis by

resident macrophages; our data suggest that this process is mimicked at the NMJ in

the SOD1 G93A mouse, leading to synapsedegeneration.

Although C3 biosynthesis was up-regulated in both motor neurons and astrocytes in

SOD1 G93A mice, C3 activation products deposit only on motor neurons, driving

their loss. Neighboring astrocytes resist C3 activation because they abundantly

express C3 convertase regulators (Griffiths et al., 2009), but contribute to neuronal

loss by increasing local synthesis of C components. Both neurons and astrocytes

must express mutant SOD1 for development of ALS pathology (Wang et al.,

2005, Gong et al., 2000 and Pramatarova et al., 2001). If expression of the mutant

SOD1 directly or indirectly drives up-regulation of C component synthesis, then it

may be that local C biosynthesis only breaches the threshold necessary for neuronal

damage when both neurons and astrocytes are involved.

Treatment with C inhibitors protects from early axonal degeneration and facilitates

regeneration and recovery in peripheral nerve injury (Ramaglia et al., 2009). Because

C is deposited and activated at the NMJ before denervation, and axonal loss

precedes motor neuron loss in ALS (Fischer et al., 2004), early intervention with C

inhibitors may protect the NMJ and stop further neuronal degeneration, offering the

prospect of therapy for this currently untreatable disorder.

Acknowledgments. We thank Dr. J. Verhaagen for kindly providing the mouse tissue for this study.

Chapter 5

170

References

Annunziata, P., Volpi, N., 1985. High levels of C3c in the cerebrospinal fluid from amyotrophic lateral sclerosis patients. Acta Neurol. Scand. 72, 61-64.

Apostolski, S., Nikolic, J., Bugarski-Prokopljevic, C., Miletic, V., Pavlovic, S., Filipovic, S., 1991. Serum and CSF immunological findings in ALS. Acta Neurol. Scand. 83, 96-98.

de Jonge, R.R., van Schaik, I.N., Vreijling, J.P., Troost, D., Baas, F., 2004. Expression of complement components in the peripheral nervous system. Hum. Mol. Genet. 13, 295-302.

Donev, R.M., Morgan, B.P., 2006. A quantitative method for comparison of expression of alternatively spliced genes using different primer pairs. J. Biochem. Biophys. Methods 66, 23-31.

Ferraiuolo, L., Heath, P.R., Holden, H., Kasher, P., Kirby, J., Shaw, P.J., 2007. Microarray analysis of the cellular pathways involved in the adaptation to and progression of motor neuron injury in the SOD1 G93A mouse model of familial ALS. J. Neurosci. 27, 9201-9219.

Fischer, L.R., Culver, D.G., Tennant, P., Davis, A.A., Wang, M., Castellano-Sanchez, A., Khan, J., Polak, M.A., Glass, J.D., 2004. Amyotrophic lateral sclerosis is a distal axonopathy: evidence in mice and man. Exp. Neurol. 185, 232-240.

Goldknopf, I.L., Sheta, E.A., Bryson, J., Folsom, B., Wilson, C., Duty, J., Yen, A.A., Appel, S.H., 2006. Complement C3c and related protein biomarkers in amyotrophic lateral sclerosis and Parkinson's disease. Biochem. Biophys. Res. Commun. 342, 1034-1039.

Gong, Y.H., Parsadanian, A.S., Andreeva, A., Snider, W.D., Elliott, J.L., 2000. Restricted expression of G86R Cu/Zn superoxide dismutase in astrocytes results in astrocytosis but does not cause motoneuron degeneration. J. Neurosci. 20, 660-665.

Griffiths, M.R., Neal, J.W., Fontaine, M., Das, T., Gasque, P., 2009. Complement factor H, a marker of self protects against experimental autoimmune encephalomyelitis. J. Immunol. 182, 4368-4377.

Gurney, M.E., 1994a. Transgenic-mouse model of amyotrophic lateral sclerosis. N. Engl. J. Med. 331, 1721-1722.

Gurney, M.E., 1994b. Transgenic-mouse model of amyotrophic lateral sclerosis. N. Engl. J. Med. 331, 1721-1722.

Halstead, S.K., O'Hanlon, G.M., Humphreys, P.D., Morrison, D.B., Morgan, B.P., Todd, A.J., Plomp, J.J., Willison, H.J., 2004. Anti-disialoside antibodies kill perisynaptic Schwann cells and damage motor nerve terminals via membrane attack complex in a murine model of neuropathy. Brain 127, 2109-2123.

Lobsiger, C.S., Boillee, S., Cleveland, D.W., 2007. Toxicity from different SOD1 mutants dysregulates the complement system and the neuronal regenerative response in ALS motor neurons. Proc. Natl. Acad. Sci. U. S. A 104, 7319-7326.

Mitchell, J.D., Borasio, G.D., 2007. Amyotrophic lateral sclerosis. Lancet 369, 2031-2041.

O'Hanlon, G.M., Plomp, J.J., Chakrabarti, M., Morrison, I., Wagner, E.R., Goodyear, C.S., Yin, X., Trapp, B.D., Conner, J., Molenaar, P.C., Stewart, S., Rowan, E.G., Willison, H.J., 2001. Anti-GQ1b

ganglioside antibodies mediate complement-dependent destruction of the motor nerve terminal. Brain 124, 893-906.

Pasinelli, P., Brown, R.H., 2006. Molecular biology of amyotrophic lateral sclerosis: insights from genetics. Nat. Rev. Neurosci. 7, 710-723.

Pramatarova, A., Laganiere, J., Roussel, J., Brisebois, K., Rouleau, G.A., 2001. Neuron-specific expression of mutant superoxide dismutase 1 in transgenic mice does not lead to motor impairment. J. Neurosci. 21, 3369-3374.

Ramaglia, V., King, R.H., Nourallah, M., Wolterman, R., de Jonge, R., Ramkema, M., Vigar, M.A., van der, W.S., Morgan, B.P., Troost, D., Baas, F., 2007. The membrane attack complex of the complement system is essential for rapid Wallerian degeneration. J. Neurosci. 27, 7663-7672.

Ramaglia, V., Tannemaat, M.R., de, K.M., Wolterman, R., Vigar, M.A., King, R.H., Morgan, B.P., Baas, F., 2009. Complement inhibition accelerates regeneration in a model of peripheral nerve injury. Mol. Immunol. 47, 302-309.

Rosen, D.R., Siddique, T., Patterson, D., Figlewicz, D.A., Sapp, P., Hentati, A., Donaldson, D., Goto, J., O'Regan, J.P., Deng, H.X., ., 1993. Mutations in Cu/Zn superoxide dismutase gene are associated with familial amyotrophic lateral sclerosis. Nature 362, 59-62.

Stevens, B., Allen, N.J., Vazquez, L.E., Howell, G.R., Christopherson, K.S., Nouri, N., Micheva, K.D., Mehalow, A.K., Huberman, A.D., Stafford, B., Sher, A., Litke, A.M., Lambris, J.D., Smith, S.J., John, S.W., Barres, B.A., 2007. The classical complement cascade mediates CNS synapse elimination. Cell 131, 1164-1178.

Tsuboi, Y., Yamada, T., 1994. Increased concentration of C4d complement protein in CSF in amyotrophic lateral sclerosis. J. Neurol. Neurosurg. Psychiatry 57, 859-861.

Walport, M.J., 2001a. Complement. First of two parts. N. Engl. J. Med. 344, 1058-1066.

Walport, M.J., 2001b. Complement. Second of two parts. N. Engl. J. Med. 344, 1140-1144.

Wang, J., Ma, J.H., Giffard, R.G., 2005. Overexpression of copper/zinc superoxide dismutase decreases ischemia-like astrocyte injury. Free Radic. Biol. Med. 38, 1112-1118.

Woodruff, T.M., Costantini, K.J., Crane, J.W., Atkin, J.D., Monk, P.N., Taylor, S.M., Noakes, P.G., 2008. The complement factor C5a contributes to pathology in a rat model of amyotrophic lateral sclerosis. J. Immunol. 181, 8727-8734.

5


171

References

Annunziata, P., Volpi, N., 1985. High levels of C3c in the cerebrospinal fluid from amyotrophic lateral sclerosis patients. Acta Neurol. Scand. 72, 61-64.

Apostolski, S., Nikolic, J., Bugarski-Prokopljevic, C., Miletic, V., Pavlovic, S., Filipovic, S., 1991. Serum and CSF immunological findings in ALS. Acta Neurol. Scand. 83, 96-98.

de Jonge, R.R., van Schaik, I.N., Vreijling, J.P., Troost, D., Baas, F., 2004. Expression of complement components in the peripheral nervous system. Hum. Mol. Genet. 13, 295-302.

Donev, R.M., Morgan, B.P., 2006. A quantitative method for comparison of expression of alternatively spliced genes using different primer pairs. J. Biochem. Biophys. Methods 66, 23-31.

Ferraiuolo, L., Heath, P.R., Holden, H., Kasher, P., Kirby, J., Shaw, P.J., 2007. Microarray analysis of the cellular pathways involved in the adaptation to and progression of motor neuron injury in the SOD1 G93A mouse model of familial ALS. J. Neurosci. 27, 9201-9219.

Fischer, L.R., Culver, D.G., Tennant, P., Davis, A.A., Wang, M., Castellano-Sanchez, A., Khan, J., Polak, M.A., Glass, J.D., 2004. Amyotrophic lateral sclerosis is a distal axonopathy: evidence in mice and man. Exp. Neurol. 185, 232-240.

Goldknopf, I.L., Sheta, E.A., Bryson, J., Folsom, B., Wilson, C., Duty, J., Yen, A.A., Appel, S.H., 2006. Complement C3c and related protein biomarkers in amyotrophic lateral sclerosis and Parkinson's disease. Biochem. Biophys. Res. Commun. 342, 1034-1039.

Gong, Y.H., Parsadanian, A.S., Andreeva, A., Snider, W.D., Elliott, J.L., 2000. Restricted expression of G86R Cu/Zn superoxide dismutase in astrocytes results in astrocytosis but does not cause motoneuron degeneration. J. Neurosci. 20, 660-665.

Griffiths, M.R., Neal, J.W., Fontaine, M., Das, T., Gasque, P., 2009. Complement factor H, a marker of self protects against experimental autoimmune encephalomyelitis. J. Immunol. 182, 4368-4377.

Gurney, M.E., 1994a. Transgenic-mouse model of amyotrophic lateral sclerosis. N. Engl. J. Med. 331, 1721-1722.

Gurney, M.E., 1994b. Transgenic-mouse model of amyotrophic lateral sclerosis. N. Engl. J. Med. 331, 1721-1722.

Halstead, S.K., O'Hanlon, G.M., Humphreys, P.D., Morrison, D.B., Morgan, B.P., Todd, A.J., Plomp, J.J., Willison, H.J., 2004. Anti-disialoside antibodies kill perisynaptic Schwann cells and damage motor nerve terminals via membrane attack complex in a murine model of neuropathy. Brain 127, 2109-2123.

Lobsiger, C.S., Boillee, S., Cleveland, D.W., 2007. Toxicity from different SOD1 mutants dysregulates the complement system and the neuronal regenerative response in ALS motor neurons. Proc. Natl. Acad. Sci. U. S. A 104, 7319-7326.

Mitchell, J.D., Borasio, G.D., 2007. Amyotrophic lateral sclerosis. Lancet 369, 2031-2041.

O'Hanlon, G.M., Plomp, J.J., Chakrabarti, M., Morrison, I., Wagner, E.R., Goodyear, C.S., Yin, X., Trapp, B.D., Conner, J., Molenaar, P.C., Stewart, S., Rowan, E.G., Willison, H.J., 2001. Anti-GQ1b

ganglioside antibodies mediate complement-dependent destruction of the motor nerve terminal. Brain 124, 893-906.

Pasinelli, P., Brown, R.H., 2006. Molecular biology of amyotrophic lateral sclerosis: insights from genetics. Nat. Rev. Neurosci. 7, 710-723.

Pramatarova, A., Laganiere, J., Roussel, J., Brisebois, K., Rouleau, G.A., 2001. Neuron-specific expression of mutant superoxide dismutase 1 in transgenic mice does not lead to motor impairment. J. Neurosci. 21, 3369-3374.

Ramaglia, V., King, R.H., Nourallah, M., Wolterman, R., de Jonge, R., Ramkema, M., Vigar, M.A., van der, W.S., Morgan, B.P., Troost, D., Baas, F., 2007. The membrane attack complex of the complement system is essential for rapid Wallerian degeneration. J. Neurosci. 27, 7663-7672.

Ramaglia, V., Tannemaat, M.R., de, K.M., Wolterman, R., Vigar, M.A., King, R.H., Morgan, B.P., Baas, F., 2009. Complement inhibition accelerates regeneration in a model of peripheral nerve injury. Mol. Immunol. 47, 302-309.

Rosen, D.R., Siddique, T., Patterson, D., Figlewicz, D.A., Sapp, P., Hentati, A., Donaldson, D., Goto, J., O'Regan, J.P., Deng, H.X., ., 1993. Mutations in Cu/Zn superoxide dismutase gene are associated with familial amyotrophic lateral sclerosis. Nature 362, 59-62.

Stevens, B., Allen, N.J., Vazquez, L.E., Howell, G.R., Christopherson, K.S., Nouri, N., Micheva, K.D., Mehalow, A.K., Huberman, A.D., Stafford, B., Sher, A., Litke, A.M., Lambris, J.D., Smith, S.J., John, S.W., Barres, B.A., 2007. The classical complement cascade mediates CNS synapse elimination. Cell 131, 1164-1178.

Tsuboi, Y., Yamada, T., 1994. Increased concentration of C4d complement protein in CSF in amyotrophic lateral sclerosis. J. Neurol. Neurosurg. Psychiatry 57, 859-861.

Walport, M.J., 2001a. Complement. First of two parts. N. Engl. J. Med. 344, 1058-1066.

Walport, M.J., 2001b. Complement. Second of two parts. N. Engl. J. Med. 344, 1140-1144.

Wang, J., Ma, J.H., Giffard, R.G., 2005. Overexpression of copper/zinc superoxide dismutase decreases ischemia-like astrocyte injury. Free Radic. Biol. Med. 38, 1112-1118.

Woodruff, T.M., Costantini, K.J., Crane, J.W., Atkin, J.D., Monk, P.N., Taylor, S.M., Noakes, P.G., 2008. The complement factor C5a contributes to pathology in a rat model of amyotrophic lateral sclerosis. J. Immunol. 181, 8727-8734.

Robbert Jan Stuit. Het begon bij mij bij mijn linkerhand die niet meer deed wat hij

moest doen. Ik leefde mijn leven in een sneltreinvaart en besteedde in eerste

instantie geen aandacht aan deze klacht. Na een half jaar besloot ik toch naar de

huisarts te gaan. Dan hoor je dat je ALS hebt. ‘Wát gaan we eraan doen?’, vroeg ik.

‘Niets’, wat het antwoord.” Mijn diagnose dwong me tot nadenken over mijn eigen

leven en hoe je dat ingericht hebt. Sinds acht maanden ben ik de vader van Alec.

Mijn vrouw Hiske en ik hebben natuurlijk de afweging gemaakt of je in onze situatie

een gezin wil beginnen. Ook ben ik getest op alle bekende genetische afwijkingen

die verband houden met ALS, want ik zou het niet verantwoord vinden om iets over

te dragen.


Complement activation at the motor end-plates in Amyotrophic

lateral sclerosis

Nawal Bahia El Idrissi1, Sanne Bosch1, Valeria Ramaglia1, Eleonora Aronica2, Frank

Baas1, Dirk Troost2 Journal of Neuroinflammation, 2016 March.


Center, Amsterdam, 1105 AZ, The Netherlands.* equal contribution

Robbert Jan Stuit. Het begon bij mij bij mijn linkerhand die niet meer deed wat hij

moest doen. Ik leefde mijn leven in een sneltreinvaart en besteedde in eerste

instantie geen aandacht aan deze klacht. Na een half jaar besloot ik toch naar de

huisarts te gaan. Dan hoor je dat je ALS hebt. ‘Wát gaan we eraan doen?’, vroeg ik.

‘Niets’, wat het antwoord.” Mijn diagnose dwong me tot nadenken over mijn eigen

leven en hoe je dat ingericht hebt. Sinds acht maanden ben ik de vader van Alec.

Mijn vrouw Hiske en ik hebben natuurlijk de afweging gemaakt of je in onze situatie

een gezin wil beginnen. Ook ben ik getest op alle bekende genetische afwijkingen

die verband houden met ALS, want ik zou het niet verantwoord vinden om iets over

te dragen.


Complement activation at the motor end-plates in Amyotrophic

lateral sclerosis

Nawal Bahia El Idrissi1, Sanne Bosch1, Valeria Ramaglia1, Eleonora Aronica2, Frank

Baas1, Dirk Troost2 Journal of Neuroinflammation, 2016 March.


Center, Amsterdam, 1105 AZ, The Netherlands.* equal contribution

6

Chapter 6

174

Abstract

Background: Amyotrophic lateral sclerosis (ALS) is a fatal progressive

neurodegenerative disease with no available therapy. Components of the innate

immune system are activated in spinal cord and central nervous system of ALS

patients. Studies in the SOD1G93A mouse show deposition of C1q and C3/C3b at the

motor end-plate of before neurological symptoms are apparent, suggesting that

complement activation precedes neurodegeneration in this model. To obtain a better

understanding of the role of complement at the motor end-plates in human ALS

pathology, we analysed post-mortem tissue of ALS donors for complement activation

and its regulators.

Methods: Post-mortem intercostal muscle biopsies were collected at autopsy from

ALS (n=11) and control (n=6) donors. The samples were analysed for C1q,

membrane attack complex (MAC), CD55 and CD59 on the motor end-plates, using

immunofluorescence or immunohistochemistry.

Results: Here, we show that complement activation products and regulators are

deposited on the motor end-plates of ALS patients. C1q co-localized with

neurofilament in the intercostal muscle of ALS donors and was absent in controls

(P=0.001). In addition, C1q was found deposited on the motor end-plates in the

intercostal muscle. MAC was also found deposited on motor end-plates that were

innervated by nerves in intercostal muscle of ALS donors, but not in controls

(P=0.001).

High levels of the regulators CD55 and CD59 were detected at the motor end-plates

of ALS donors, but not in controls, suggesting to an attempt to counteract

complement activation and prevent MAC deposition on the end-plates before they

are lost.

Conclusions: This study provides evidence that complement activation products are

deposited on innervated motor end-plates in the intercostal muscle of ALS donors,

indicating that complement activation may precede end-plate denervation in human

ALS. This study adds to the understanding of ALS pathology in man and identifies

complement as potential modifier of the disease process.

Keywords: Amyotrophic lateral sclerosis, motor end-plates, complement, C1q, MAC, CD55, CD59

6

Complement on motor end-plates in ALS

175

Abstract

Background: Amyotrophic lateral sclerosis (ALS) is a fatal progressive

neurodegenerative disease with no available therapy. Components of the innate

immune system are activated in spinal cord and central nervous system of ALS

patients. Studies in the SOD1G93A mouse show deposition of C1q and C3/C3b at the

motor end-plate of before neurological symptoms are apparent, suggesting that

complement activation precedes neurodegeneration in this model. To obtain a better

understanding of the role of complement at the motor end-plates in human ALS

pathology, we analysed post-mortem tissue of ALS donors for complement activation

and its regulators.

Methods: Post-mortem intercostal muscle biopsies were collected at autopsy from

ALS (n=11) and control (n=6) donors. The samples were analysed for C1q,

membrane attack complex (MAC), CD55 and CD59 on the motor end-plates, using

immunofluorescence or immunohistochemistry.

Results: Here, we show that complement activation products and regulators are

deposited on the motor end-plates of ALS patients. C1q co-localized with

neurofilament in the intercostal muscle of ALS donors and was absent in controls

(P=0.001). In addition, C1q was found deposited on the motor end-plates in the

intercostal muscle. MAC was also found deposited on motor end-plates that were

innervated by nerves in intercostal muscle of ALS donors, but not in controls

(P=0.001).

High levels of the regulators CD55 and CD59 were detected at the motor end-plates

of ALS donors, but not in controls, suggesting to an attempt to counteract

complement activation and prevent MAC deposition on the end-plates before they

are lost.

Conclusions: This study provides evidence that complement activation products are

deposited on innervated motor end-plates in the intercostal muscle of ALS donors,

indicating that complement activation may precede end-plate denervation in human

ALS. This study adds to the understanding of ALS pathology in man and identifies

complement as potential modifier of the disease process.

Keywords: Amyotrophic lateral sclerosis, motor end-plates, complement, C1q, MAC, CD55, CD59

Chapter 6

176

Background

Amyotrophic lateral sclerosis (ALS) is the most common adult-onset motor neuron

disease [1]. It is characterized by progressive loss of both upper and lower motor

neurons, leading to muscle atrophy and eventually death [2]. Most ALS cases (90%)

are sporadic, while 10% are familial. Many genes have been identified for familial

ALS. C9orf72, FUS, TARDBP are the most frequently affected genes. Mutation in the

gene encoding for the copper-zinc superoxide dismutase-1 (SOD-1) is found in about

10 % of familial cases of the disease. The transgenic SOD1G93A rodent model

recapitulates onset and progression of ALS.

The mechanisms leading to ALS are still unclear, both cell autonomous and non-cell

autonomous mechanisms are involved [3-5]. A role of neuroinflammation [6-8] and

early involvement of the neuromuscular junction in the SOD1G93A rodent model has

been suggested [9, 10]. The complement system has been also associated with

neuroinflammation in the ALS rodent model [8, 11]. Complement is a key component

of the innate immunity, but it can cause harm to tissue. Regulators of the

complement system permit elimination of pathogens or dead cells without injuring the

host. When this balance is disrupted, complement activation causes injury to the host

and contributes to pathology in various diseases [12-14].

A role for complement in the pathogenesis of ALS in man is suggested by different

researchers. Elevated concentrations of complement activation products in serum

and cerebrospinal fluid were detected in ALS patients. In spinal cord and motor

cortex of patients with sporadic ALS, mRNA for C1q and C4 and protein levels of

complement proteins C1q, C3 and MAC were elevated [15]. In addition, C1q and C4

were upregulated in motor neurons in murine ALS models, [16, 17], whereas C3 was

upregulated in the anterior horn areas containing motor neuron degeneration [11].


receptor, during disease progression in mouse motor neurons [18]. SOD1G93A rat






spinal cord of SOD1G93A mice [19].

We have previously shown that complement activation products C3/C3b and C1q

were present at the motor end-plates of SOD1G93A mice before the appearance of

symptoms and remained detectable at the symptomatic stage, suggesting that

complement activation precedes neurodegeneration and plays an early role in this

model [20]. Early damage at the end-plates is in line with the "dying-back"

mechanism. Retrograde degeneration is detected in ALS patients [21, 22] and in

transgenic SOD1G93A mice retraction of motor axons from their muscle synapse has

been shown to occur before any symptoms of the disease appear in the muscle [23],

suggesting the disease starts at the motor end-plates.

Here, we analyzed whether key complement components and regulators are also

deposited at the motor end-plates in post-mortem intercostal muscle of human ALS

cases. We tested for the presence of complement components C1q, MAC, regulators

CD55 and CD59 in this tissue.

6


177

Background

Amyotrophic lateral sclerosis (ALS) is the most common adult-onset motor neuron

disease [1]. It is characterized by progressive loss of both upper and lower motor

neurons, leading to muscle atrophy and eventually death [2]. Most ALS cases (90%)

are sporadic, while 10% are familial. Many genes have been identified for familial

ALS. C9orf72, FUS, TARDBP are the most frequently affected genes. Mutation in the

gene encoding for the copper-zinc superoxide dismutase-1 (SOD-1) is found in about

10 % of familial cases of the disease. The transgenic SOD1G93A rodent model

recapitulates onset and progression of ALS.

The mechanisms leading to ALS are still unclear, both cell autonomous and non-cell

autonomous mechanisms are involved [3-5]. A role of neuroinflammation [6-8] and

early involvement of the neuromuscular junction in the SOD1G93A rodent model has

been suggested [9, 10]. The complement system has been also associated with

neuroinflammation in the ALS rodent model [8, 11]. Complement is a key component

of the innate immunity, but it can cause harm to tissue. Regulators of the

complement system permit elimination of pathogens or dead cells without injuring the

host. When this balance is disrupted, complement activation causes injury to the host

and contributes to pathology in various diseases [12-14].

A role for complement in the pathogenesis of ALS in man is suggested by different

researchers. Elevated concentrations of complement activation products in serum

and cerebrospinal fluid were detected in ALS patients. In spinal cord and motor

cortex of patients with sporadic ALS, mRNA for C1q and C4 and protein levels of

complement proteins C1q, C3 and MAC were elevated [15]. In addition, C1q and C4

were upregulated in motor neurons in murine ALS models, [16, 17], whereas C3 was

upregulated in the anterior horn areas containing motor neuron degeneration [11].


receptor, during disease progression in mouse motor neurons [18]. SOD1G93A rat






spinal cord of SOD1G93A mice [19].

We have previously shown that complement activation products C3/C3b and C1q

were present at the motor end-plates of SOD1G93A mice before the appearance of

symptoms and remained detectable at the symptomatic stage, suggesting that

complement activation precedes neurodegeneration and plays an early role in this

model [20]. Early damage at the end-plates is in line with the "dying-back"

mechanism. Retrograde degeneration is detected in ALS patients [21, 22] and in

transgenic SOD1G93A mice retraction of motor axons from their muscle synapse has

been shown to occur before any symptoms of the disease appear in the muscle [23],

suggesting the disease starts at the motor end-plates.

Here, we analyzed whether key complement components and regulators are also

deposited at the motor end-plates in post-mortem intercostal muscle of human ALS

cases. We tested for the presence of complement components C1q, MAC, regulators

CD55 and CD59 in this tissue.

Chapter 6

178

Methods

Ethics Statements

Tissue was obtained and used in accordance with the Declaration of Helsinki and the

Academic Medical Center Research Code provided by the Medical Ethics


Tissue processing human intercostal muscle

Post-mortem intercostal muscle biopsies were collected at autopsy from sex-

matched ALS (n=11) and control (n=6) donors at the Department of neuropathology

of the Academic Medical Center (University of Amsterdam). All cases were reviewed

by a neuropathologist and diagnosed according to the standard histopathological

criteria. None of our patients were on respiratory support. Muscle samples were snap

frozen in liquid nitrogen and stored at -80ºC until processed. Detailed information

about sex, age, and clinical features of ALS and control donors are given in Table 1

and 2. In this study we included material from ALS donors with familial and sporadic

ALS. We used age-matched controls, which did not suffer from neuromuscular or

neurological disease. The tissue was subsequently embedded in Tissue-Tek,

Optimal Cutting Temperature compound (OCT) (Sakura, Zoeterwoude, NL) and cut

using cryostat (Reichert Jung; Leica, Nussloch, Germany); cryosections of 6 µm and

40 µm were cut and stored at -80ºC until immune- and fluorescence stainings were

performed.

Table 1 Demographic and clinical data of ALS donors

Patient nr Gender Age of onset PMD (hrs) Disease duration (yrs) ALS type

1 F 66 6 4,5 Sporadic ALS

2 F 61 unknown 1 Sporadic ALS

3 M 56 10 3,5 Sporadic ALS


5 M 68 unknown 3,5 Familial ALS ♦

6 F 57 9.5 3,5 Sporadic ALS

7 M 62 unknown 4 Sporadic ALS

8 M 72 unknown X Sporadic ALS

9 M 68 unknown 3,5 Sporadic ALS

10 M 54 unknown 1.5 Familial ALS

11 F 58 10 - 11 2 Sporadic ALS

PMD= post-mortem delay. All the cases analysed show classical pathology with motor cell loss and degeneration of the

corticospinal tracts, including P62 and phosphorylated TDP43 inclusions in motor cells,♦ C9ORF repeat

Table 2 Demographic and clinical data control donors

Patient nr Gender Age PMD (hrs)

1 M 69 5 - 6

2 F 65 Unknown

3 F 55 3,5 – 4

4 M 73 11

5 M 62 4 -8

6 F 68 10

6


179

Methods

Ethics Statements

Tissue was obtained and used in accordance with the Declaration of Helsinki and the

Academic Medical Center Research Code provided by the Medical Ethics


Tissue processing human intercostal muscle

Post-mortem intercostal muscle biopsies were collected at autopsy from sex-

matched ALS (n=11) and control (n=6) donors at the Department of neuropathology

of the Academic Medical Center (University of Amsterdam). All cases were reviewed

by a neuropathologist and diagnosed according to the standard histopathological

criteria. None of our patients were on respiratory support. Muscle samples were snap

frozen in liquid nitrogen and stored at -80ºC until processed. Detailed information

about sex, age, and clinical features of ALS and control donors are given in Table 1

and 2. In this study we included material from ALS donors with familial and sporadic

ALS. We used age-matched controls, which did not suffer from neuromuscular or

neurological disease. The tissue was subsequently embedded in Tissue-Tek,

Optimal Cutting Temperature compound (OCT) (Sakura, Zoeterwoude, NL) and cut

using cryostat (Reichert Jung; Leica, Nussloch, Germany); cryosections of 6 µm and

40 µm were cut and stored at -80ºC until immune- and fluorescence stainings were

performed.

Table 1 Demographic and clinical data of ALS donors

Patient nr Gender Age of onset PMD (hrs) Disease duration (yrs) ALS type

1 F 66 6 4,5 Sporadic ALS


3 M 56 10 3,5 Sporadic ALS


5 M 68 unknown 3,5 Familial ALS ♦

6 F 57 9.5 3,5 Sporadic ALS

7 M 62 unknown 4 Sporadic ALS

8 M 72 unknown X Sporadic ALS

9 M 68 unknown 3,5 Sporadic ALS

10 M 54 unknown 1.5 Familial ALS

11 F 58 10 - 11 2 Sporadic ALS

PMD= post-mortem delay. All the cases analysed show classical pathology with motor cell loss and degeneration of the

corticospinal tracts, including P62 and phosphorylated TDP43 inclusions in motor cells,♦ C9ORF repeat

Table 2 Demographic and clinical data control donors

Patient nr Gender Age PMD (hrs)

1 M 69 5 - 6

2 F 65 Unknown

3 F 55 3,5 – 4

4 M 73 11

5 M 62 4 -8

6 F 68 10

Chapter 6

180

Nonspecific esterase reaction followed by immunostaining

Fresh frozen sections of 6 µm were tested for the nonspecific esterase (NE) reaction

according to the technique of Lehrer & Ornstein (1959) [24]. After the NE staining,

the sections were fixed for 10 minutes in 4% paraformaldehyde (PFA) and after

washed in PBS. The sections were permeabalized in PBS/0,2% TritonX and blocked

for 1 hour at room temperature (RT) using PBS/ 5% Fetal Calf Serum (FCS) /0,2%

TritonX (blockmix). The primary antibodies anti-C5b-9 for MAC recognizes a neo-

epitope in C9 (aE11 clone, DAKO, Carpinteria, CA), anti-C1q (Dako, F 0254,

Denmark) or anti-DAF (Decay-accelerating factor) (Abcam, Ab20145, Cambridge,

MA, USA) were diluted in Blockmix according to Table 3 and incubated for 1 hour at

room temperature. The sections were washed with PBS 3 times and incubated with

the secondary antibody Powervision poly-AP anti-mouse IgG or poly-AP anti- rabbit

IgG (immunologic, DPVM55A, Netherlands) for 45 minutes. After washing, the

sections were developed with VECTOR Blue Alkaline Phosphatase (AP) Substrate

Kit (SK-5300). The sections were air-dried and mounted using VectaMount (Vector

laboratories, H-5000-60, USA).

Table 3 Primary antibodies and their dilutions

Antigen Species Specificity Type Dilution Art.#/Company

Neurofilament heavy

chain (NF-H)

Rabbit

polyclonal

Anti-

Neurofilament

Anti-

human

1:1000 ab8135/Abcam

MAC (ae11 clone) Mouse

monoclonal

Anti-C5b-9

complex

Anti-

human

1:200 M0777/Dako

FITC-Conjugated C1q

Complement

Polyclonal

Rabbit

Anti-C1q Anti-

human

1:50 F0254/Dako

FITC- Conjugated DAF Mouse-

monoclonal

Anti-CD55 Anti-

human

1:40 555693/BD

pharmigen

CD59 Mouse-

monoclonal

Anti-CD59 Anti-

human

1:50 HM2120/Hycult

C1q Polyclonal

rabbit

Anti-C1q Anti-

human

1:50 F 0254/Dako

FITC- conjugated C3c

Complement

Polyclonal

rabbit

Anti- C3 Anti-

human

1:50 ab4212/Abcam

DAF Mouse-

monoclonal

Anti-CD55 Anti-

human

1:150 Ab20145/Abcam

Synaptophysin Rabbit-

monoclonal

Anti-

Synaptophysin

Anti-

human

1:50 RM-9111-

S/Thermo

scientific

Synaptophysin Mouse-

monoclonal

Anti-

Synaptophysin

Anti-

human

1:200 M0776/Dako

S100b Rabbit

polyclonal

Anti-S100b Anti-

human

1:100 Z0311/Dako

S100b Mouse-

monoclonal

Anti-S100b Anti-

human

1:500 S2532/Sigma

6


181

Nonspecific esterase reaction followed by immunostaining

Fresh frozen sections of 6 µm were tested for the nonspecific esterase (NE) reaction

according to the technique of Lehrer & Ornstein (1959) [24]. After the NE staining,

the sections were fixed for 10 minutes in 4% paraformaldehyde (PFA) and after

washed in PBS. The sections were permeabalized in PBS/0,2% TritonX and blocked

for 1 hour at room temperature (RT) using PBS/ 5% Fetal Calf Serum (FCS) /0,2%

TritonX (blockmix). The primary antibodies anti-C5b-9 for MAC recognizes a neo-

epitope in C9 (aE11 clone, DAKO, Carpinteria, CA), anti-C1q (Dako, F 0254,

Denmark) or anti-DAF (Decay-accelerating factor) (Abcam, Ab20145, Cambridge,

MA, USA) were diluted in Blockmix according to Table 3 and incubated for 1 hour at

room temperature. The sections were washed with PBS 3 times and incubated with

the secondary antibody Powervision poly-AP anti-mouse IgG or poly-AP anti- rabbit

IgG (immunologic, DPVM55A, Netherlands) for 45 minutes. After washing, the

sections were developed with VECTOR Blue Alkaline Phosphatase (AP) Substrate

Kit (SK-5300). The sections were air-dried and mounted using VectaMount (Vector

laboratories, H-5000-60, USA).

Table 3 Primary antibodies and their dilutions

Antigen Species Specificity Type Dilution Art.#/Company

Neurofilament heavy

chain (NF-H)

Rabbit

polyclonal

Anti-

Neurofilament

Anti-

human

1:1000 ab8135/Abcam

MAC (ae11 clone) Mouse

monoclonal

Anti-C5b-9

complex

Anti-

human

1:200 M0777/Dako

FITC-Conjugated C1q

Complement

Polyclonal

Rabbit

Anti-C1q Anti-

human

1:50 F0254/Dako

FITC- Conjugated DAF Mouse-

monoclonal

Anti-CD55 Anti-

human

1:40 555693/BD

pharmigen

CD59 Mouse-

monoclonal

Anti-CD59 Anti-

human

1:50 HM2120/Hycult

C1q Polyclonal

rabbit

Anti-C1q Anti-

human

1:50 F 0254/Dako

FITC- conjugated C3c

Complement

Polyclonal

rabbit

Anti- C3 Anti-

human

1:50 ab4212/Abcam

DAF Mouse-

monoclonal

Anti-CD55 Anti-

human

1:150 Ab20145/Abcam

Synaptophysin Rabbit-

monoclonal

Anti-

Synaptophysin

Anti-

human

1:50 RM-9111-

S/Thermo

scientific

Synaptophysin Mouse-

monoclonal

Anti-

Synaptophysin

Anti-

human

1:200 M0776/Dako

S100b Rabbit

polyclonal

Anti-S100b Anti-

human

1:100 Z0311/Dako

S100b Mouse-

monoclonal

Anti-S100b Anti-

human

1:500 S2532/Sigma

Chapter 6

182

Animals

SOD1G93A transgenic ALS mice [high copy number; B6SJLTg (SOD1-G93A)1Gur/J]

(Gurney, 1994b) and wildtype (B6SJL) littermates were housed in groups at 20 °C on

12:12 h light:dark cycle, with free access to food and water. Experimental protocols

complied with national animal care guidelines, licensed by the responsible authority.

All animals were free of microbiological infection (FELASA screened).

Tissue processing SODG93A and wildtype mice

SOD1G93A and wildtype mice were sacrificed at post-natal day 47 (presymptomatic

stage SOD1G93A n = 4; wildtype n = 4) by CO2 inhalation. Gastrocnemius muscle was

dissected, post-fixed overnight in 4%paraformaldehyde/PBS at 4 °C, cryoprotected in

30% sucrose/PBS for 72 h at 4 °C, embedded in Tissue-TEK OTC, cryosections of

40µm were cut and stored at − 80 °C until used for histology.

Immunofluorescence staining

For immunofluorescence staining of SOD1G93A gastrocnemius muscle and human

intercostal muscle tissue, sections were air-dried and fixed for 10 minutes in 4% PFA

at -20 ºC. Slides were washed in PBS and permeabalized in PBS/0,2% TritonX.

Subsequently, sections were blocked for 1 hour at room temperature (RT) using

PBS/ 5% Fetal FCS /0,2% TritonX (blockmix). Primary antibodies were diluted in

blockmix according to Table 3 and incubated overnight at 4ºC. The following primary

antibodies were used (see table 3 for specifications); anti-neurofilament heavy-chain

(NF-H, Abcam, Cambridge UK) nerves, anti-Synaptophysin detecting the motor

nerve terminal (RM-911-S/Thermo scientific, USA or M0776/Dako, Carpinteria, CA),

anti-S100b recognizing the terminal Schwann cells (Z0311/Dako, Carpinteria, CA or

S2532 /Sigma, USA), anti-C5b-9 for MAC (aE11 clone, Dako, Carpinteria, CA), anti-

C1q-FITC conjugated (DAKO, Denmark), anti-C3c-FITC conjugated recognizing C3c

part of C3 and C3b, anti-DAF-FITC conjugated detecting the regulator of complement

CD55 (BD Pharmingen), anti-CD59 detecting the regulator of MAC (Hycult Biotech).

The sections were washed in PBS and secondary antibodies was applied, diluted

according to Table 4 in blockmix and incubated for two hours at RT. Used secondary

antibodies are anti-mouse FITC (Jackson Immunoresearch, West Grove, PA), anti-

Rabbit and anti-mouse CY3 (Jackson Immunoresearch, West Grove, PA) and anti-

mouse Cy5 (Invitrogen, Germany). After washing off the secondary antibody, α–

Bungratoxin (α–BTX)-Alexa 488 conjugate (α-BTX; Molecular Probes) (1:500), which

binds to post-synaptic acetylcholine receptors on the muscle fibers, was applied for

20 minutes at room temperature to the sections to visualize the end-plates. The

sections then were washed in PBS and air-dried. Vectashield medium (Vector

Laboratories Inc, Burlingame, USA) was used for mounting.

Table 4 Secondary antibodies, dilutions and exitation/emission rate

Fluorochrome Specificity Dilution Art.#/Company Exitation/

Emission

FITC Anti- mouse 1:150 Jackson ImmunoResearch/ 200-542-037 493-519

Cy3 Anti-mouse 1:150 Jackson ImmunoResearch/ 200-162-037 550/570

Cy3 Anti-Rabbit 1:150 Jackson ImmunoResearch/711-165-152 550/570

Cy5 Anti-mouse 1:450 Invitrogen/A10524 649/665

Alexa488-α-

BTX

Snake 1:500 Anti- nicotinic acetylcholinereceptor 495/519

6


183

Animals

SOD1G93A transgenic ALS mice [high copy number; B6SJLTg (SOD1-G93A)1Gur/J]

(Gurney, 1994b) and wildtype (B6SJL) littermates were housed in groups at 20 °C on

12:12 h light:dark cycle, with free access to food and water. Experimental protocols

complied with national animal care guidelines, licensed by the responsible authority.

All animals were free of microbiological infection (FELASA screened).

Tissue processing SODG93A and wildtype mice

SOD1G93A and wildtype mice were sacrificed at post-natal day 47 (presymptomatic

stage SOD1G93A n = 4; wildtype n = 4) by CO2 inhalation. Gastrocnemius muscle was

dissected, post-fixed overnight in 4%paraformaldehyde/PBS at 4 °C, cryoprotected in

30% sucrose/PBS for 72 h at 4 °C, embedded in Tissue-TEK OTC, cryosections of

40µm were cut and stored at − 80 °C until used for histology.

Immunofluorescence staining

For immunofluorescence staining of SOD1G93A gastrocnemius muscle and human

intercostal muscle tissue, sections were air-dried and fixed for 10 minutes in 4% PFA

at -20 ºC. Slides were washed in PBS and permeabalized in PBS/0,2% TritonX.

Subsequently, sections were blocked for 1 hour at room temperature (RT) using

PBS/ 5% Fetal FCS /0,2% TritonX (blockmix). Primary antibodies were diluted in

blockmix according to Table 3 and incubated overnight at 4ºC. The following primary

antibodies were used (see table 3 for specifications); anti-neurofilament heavy-chain

(NF-H, Abcam, Cambridge UK) nerves, anti-Synaptophysin detecting the motor

nerve terminal (RM-911-S/Thermo scientific, USA or M0776/Dako, Carpinteria, CA),

anti-S100b recognizing the terminal Schwann cells (Z0311/Dako, Carpinteria, CA or

S2532 /Sigma, USA), anti-C5b-9 for MAC (aE11 clone, Dako, Carpinteria, CA), anti-

C1q-FITC conjugated (DAKO, Denmark), anti-C3c-FITC conjugated recognizing C3c

part of C3 and C3b, anti-DAF-FITC conjugated detecting the regulator of complement

CD55 (BD Pharmingen), anti-CD59 detecting the regulator of MAC (Hycult Biotech).

The sections were washed in PBS and secondary antibodies was applied, diluted

according to Table 4 in blockmix and incubated for two hours at RT. Used secondary

antibodies are anti-mouse FITC (Jackson Immunoresearch, West Grove, PA), anti-

Rabbit and anti-mouse CY3 (Jackson Immunoresearch, West Grove, PA) and anti-

mouse Cy5 (Invitrogen, Germany). After washing off the secondary antibody, α–

Bungratoxin (α–BTX)-Alexa 488 conjugate (α-BTX; Molecular Probes) (1:500), which

binds to post-synaptic acetylcholine receptors on the muscle fibers, was applied for

20 minutes at room temperature to the sections to visualize the end-plates. The

sections then were washed in PBS and air-dried. Vectashield medium (Vector

Laboratories Inc, Burlingame, USA) was used for mounting.

Table 4 Secondary antibodies, dilutions and exitation/emission rate

Fluorochrome Specificity Dilution Art.#/Company Exitation/

Emission

FITC Anti- mouse 1:150 Jackson ImmunoResearch/ 200-542-037 493-519

Cy3 Anti-mouse 1:150 Jackson ImmunoResearch/ 200-162-037 550/570

Cy3 Anti-Rabbit 1:150 Jackson ImmunoResearch/711-165-152 550/570

Cy5 Anti-mouse 1:450 Invitrogen/A10524 649/665

Alexa488-α-

BTX

Snake 1:500 Anti- nicotinic acetylcholinereceptor 495/519

Chapter 6

184

Microscopy

The 40 µm muscle sections were analyzed for the positivity for Fluorophores Cy3

(550-570 nm), Cy5 (649/665 nm) and alpha-bungeratoxin- Alexa488 (488-520 nm)

using a Leica TCS SP8 X Confocal Microscope (LEICA Microsystems B.V., Rijswijk,

The Netherlands). For each view, Z-stacks (Objective 40x/1.30 Oil; 290µm x 290µm)

of 40 µm thick muscle tissue were made. The images were analyzed using Leica

LCS software (LEICA).

Quantification

For each view, Z-stacks of 40 µm thick muscle were examined and scored on the

total number of immunoreactivity for Alexa488-α-BTX/MAC, Alexa488- α-BTX /CD59

positive end-plates as well as the total number of NF-H staining co-localizing with

specific complement antibodies C1q and CD55 (Table 3). For each muscle sample of

an individual donor 20 non-overlapping microscopic views of 40 µm thick sections

were examined (total volume 6.73 x107 µm3).

Each motor end-plate identified with Alexa488- α-BTX on the surface of a muscle

fiber was counted and the length of the end-plates were measured in both ALS and

control muscle biopsies. The size of end-plates was measured using Leica

application suite X software (LASX software, Microsystems B.V., Rijswijk, The

Netherlands) 3D visualizer, excluding the end-plates that were not completely in the

3D image. The number of immunoreactive area per section was scored and

expressed as standard deviation of the mean (SD).








when P ≤ 0.05.

6


185

Microscopy

The 40 µm muscle sections were analyzed for the positivity for Fluorophores Cy3

(550-570 nm), Cy5 (649/665 nm) and alpha-bungeratoxin- Alexa488 (488-520 nm)

using a Leica TCS SP8 X Confocal Microscope (LEICA Microsystems B.V., Rijswijk,

The Netherlands). For each view, Z-stacks (Objective 40x/1.30 Oil; 290µm x 290µm)

of 40 µm thick muscle tissue were made. The images were analyzed using Leica

LCS software (LEICA).

Quantification

For each view, Z-stacks of 40 µm thick muscle were examined and scored on the

total number of immunoreactivity for Alexa488-α-BTX/MAC, Alexa488- α-BTX /CD59

positive end-plates as well as the total number of NF-H staining co-localizing with

specific complement antibodies C1q and CD55 (Table 3). For each muscle sample of

an individual donor 20 non-overlapping microscopic views of 40 µm thick sections

were examined (total volume 6.73 x107 µm3).

Each motor end-plate identified with Alexa488- α-BTX on the surface of a muscle

fiber was counted and the length of the end-plates were measured in both ALS and

control muscle biopsies. The size of end-plates was measured using Leica

application suite X software (LASX software, Microsystems B.V., Rijswijk, The

Netherlands) 3D visualizer, excluding the end-plates that were not completely in the

3D image. The number of immunoreactive area per section was scored and

expressed as standard deviation of the mean (SD).








when P ≤ 0.05.

Chapter 6

186

Results

Motor end-plates in ALS intercostal muscle

The size and number of motor end-plates were analyzed in the intercostal muscle of

ALS donors and age and sex matched controls. For analysis of both nerves and

motor end-plates, confocal microscopy was performed on 40 µm thick intercostal

muscle sections of ALS and control donors that were stained for Alexa 448 α-BTX

detecting the motor end-plates and neurofilament heavy chain antibody (NF-H).

Alexa 448 α-BTX positive and negative end-plates were expected in the intercostal

muscle of ALS post-mortem tissue given that the average age of the ALS donors was

64 years and that failure of the respiratory muscle occurs in the end-stage of the

disease in these patients. All control muscles showed co-localization of α-BTX and

NF-H. The BTX-positive end-plates were divided in 2 groups 1) end-plates co-

localizing with NF-H (innervated) (Fig. 1A, B), 2) end-plates that showed no co-

localization with NF-H (denervated) (Fig. 1C).

The average number of α-BTX positive end-plates in the intercostal muscles were 87

in controls and 17 in ALS donors per 20 non-overlapping microscopic views. Thus,

the intercostal muscle of ALS donors showed a significantly lower number of α-BTX

positive motor end-plates (P= 0.0003) (Fig. 1D). The percentage of innervated and

denervated end-plates were 30% and 70% respectively, whereas the control donors

show 100 % innervation. We also analyzed the size of the α-BTX positive end-plates

in the intercostal muscle of two ALS patients and two age-matched controls. The

controls showed a mean of 16,9 µm [SD 4,34) (n=2) and the ALS cases showed a

mean of 11.10 µm [SD 6,44) (P=<0.0001) (n=2) (Fig. 1E). All end-plates in the 20

non-overlapping views were counted.

Fig. 1. Number and size of α-BTX positive end-plates in intercostal muscle of ALS donors. Confocal

microscopic images of motor end-plates from controls (A) and ALS donors (B, C) double-labeled with

α- bungarotoxin (α-BTX, Alexa488) and antibodies against neurofilament (NF-H, CY3). All controls

showed co-localization of NF-H with α-BTX (white arrow). In ALS, both innervated end-plates, (panel

B) and denervated end-plates (panel C) were detected. The number and size of α-BTX positive end-

plates in 20 non-overlapping Z-stacks in 40 µm thick intercostal muscle sections, is shown in panels

(D and E). Both number and size of α-BTX positive end-plates of ALS donors (n=2) is reduced

compared to controls (n=2) (P=0.0003 and P=<0.0001 respectively). Error bar represents standard

deviation of the mean.

6


187

Results

Motor end-plates in ALS intercostal muscle

The size and number of motor end-plates were analyzed in the intercostal muscle of

ALS donors and age and sex matched controls. For analysis of both nerves and

motor end-plates, confocal microscopy was performed on 40 µm thick intercostal

muscle sections of ALS and control donors that were stained for Alexa 448 α-BTX

detecting the motor end-plates and neurofilament heavy chain antibody (NF-H).

Alexa 448 α-BTX positive and negative end-plates were expected in the intercostal

muscle of ALS post-mortem tissue given that the average age of the ALS donors was

64 years and that failure of the respiratory muscle occurs in the end-stage of the

disease in these patients. All control muscles showed co-localization of α-BTX and

NF-H. The BTX-positive end-plates were divided in 2 groups 1) end-plates co-

localizing with NF-H (innervated) (Fig. 1A, B), 2) end-plates that showed no co-

localization with NF-H (denervated) (Fig. 1C).

The average number of α-BTX positive end-plates in the intercostal muscles were 87

in controls and 17 in ALS donors per 20 non-overlapping microscopic views. Thus,

the intercostal muscle of ALS donors showed a significantly lower number of α-BTX

positive motor end-plates (P= 0.0003) (Fig. 1D). The percentage of innervated and

denervated end-plates were 30% and 70% respectively, whereas the control donors

show 100 % innervation. We also analyzed the size of the α-BTX positive end-plates

in the intercostal muscle of two ALS patients and two age-matched controls. The

controls showed a mean of 16,9 µm [SD 4,34) (n=2) and the ALS cases showed a

mean of 11.10 µm [SD 6,44) (P=<0.0001) (n=2) (Fig. 1E). All end-plates in the 20

non-overlapping views were counted.

Fig. 1. Number and size of α-BTX positive end-plates in intercostal muscle of ALS donors. Confocal

microscopic images of motor end-plates from controls (A) and ALS donors (B, C) double-labeled with

α- bungarotoxin (α-BTX, Alexa488) and antibodies against neurofilament (NF-H, CY3). All controls

showed co-localization of NF-H with α-BTX (white arrow). In ALS, both innervated end-plates, (panel

B) and denervated end-plates (panel C) were detected. The number and size of α-BTX positive end-

plates in 20 non-overlapping Z-stacks in 40 µm thick intercostal muscle sections, is shown in panels

(D and E). Both number and size of α-BTX positive end-plates of ALS donors (n=2) is reduced

compared to controls (n=2) (P=0.0003 and P=<0.0001 respectively). Error bar represents standard

deviation of the mean.

Chapter 6

188

C1q deposition on the motor end-plates in the intercostal muscle of ALS

donors

C1q deposits were detected before the appearance of clinical symptoms at the

muscle end-plate of the SOD1G93A mouse model [20]. This suggests that complement

activation is an early event. Here, we tested in an overview experiment whether C1q

deposits are also present in the muscle of ALS donors and if C1q is specifically

deposited on the motor end-plate. Immunofluorescence for NF-H and C1q was

performed on intercostal muscle of control (Fig. 2A, B, C) and ALS (Fig. 2D, E, F)

donors. For each individual, we analyzed 20 non-overlapping Z-stacks in 40 µm thick

sections using confocal microscopy. C1q immunoreactivity was present in the

majority of the intercostal muscle tissue of ALS donors (Fig. 2D, E, F). An average of

14 [control vs ALS P=0.001) of the C1q immunoreactive regions in the intercostal

muscle of ALS donors were co-localizing with NF-H staining (Fig. 2G, black bar). An

additional 20 areas [control versus ALS P=0.001) of the C1q immunoreactivity were

found in the vicinity of NF-H staining (Fig. 2G, grey bar). No C1q immunoreactivity

was detected in the intercostal muscle of age-matched controls (Fig. 2B). The NF-H

immunoreactivity was generally stronger in intercostal muscles of control compared

to ALS donors (data not shown).

To determine whether C1q is deposited on the end-plates we performed a NE

staining on frozen intercostal muscle of control and ALS donors to visualize the end-

plates followed by an immunostaining for C1q. The immunostaining showed an

extensive amount of C1q deposited on and around the end-plates of ALS donors

(Fig. 2I). No C1q deposition was detected in on the end-plates of control donors (Fig.

2H). We also detected C1q on the cellular elements synaptophysin (SYN) and S100b

indicating C1q is also deposited at the motor nerve terminal and terminal schwann

cell in the intercostal muscle of ALS donors (Supplement figure 1B, D- arrows), but

not in controls (Supplement figure 1A, C).

Fig. 2. Confocal microscopic images of intercostal muscle from controls (A, B, C) and ALS donors (D,

E, F) double-labeled with antibodies against neurofilament (NF-H, CY3) and antibodies against

classical pathway component of the complement system C1q (C1q, FITC). C1q deposition was

detected on the nerves as well as near the nerve endings (white asterisks in F) in muscle of ALS

donors but not in controls.(G) Quantification showed C1q positive staining co-localizing with nerves

and in the vicinity of nerve endings (white head arrow pointing to NF-H and asterisk on C1q in F) in

the intercostal muscle of ALS donors, but not in controls (P= 0.001 and P=0.001, respectively). NE

6


189

C1q deposition on the motor end-plates in the intercostal muscle of ALS

donors

C1q deposits were detected before the appearance of clinical symptoms at the

muscle end-plate of the SOD1G93A mouse model [20]. This suggests that complement

activation is an early event. Here, we tested in an overview experiment whether C1q

deposits are also present in the muscle of ALS donors and if C1q is specifically

deposited on the motor end-plate. Immunofluorescence for NF-H and C1q was

performed on intercostal muscle of control (Fig. 2A, B, C) and ALS (Fig. 2D, E, F)

donors. For each individual, we analyzed 20 non-overlapping Z-stacks in 40 µm thick

sections using confocal microscopy. C1q immunoreactivity was present in the

majority of the intercostal muscle tissue of ALS donors (Fig. 2D, E, F). An average of

14 [control vs ALS P=0.001) of the C1q immunoreactive regions in the intercostal

muscle of ALS donors were co-localizing with NF-H staining (Fig. 2G, black bar). An

additional 20 areas [control versus ALS P=0.001) of the C1q immunoreactivity were

found in the vicinity of NF-H staining (Fig. 2G, grey bar). No C1q immunoreactivity

was detected in the intercostal muscle of age-matched controls (Fig. 2B). The NF-H

immunoreactivity was generally stronger in intercostal muscles of control compared

to ALS donors (data not shown).

To determine whether C1q is deposited on the end-plates we performed a NE

staining on frozen intercostal muscle of control and ALS donors to visualize the end-

plates followed by an immunostaining for C1q. The immunostaining showed an

extensive amount of C1q deposited on and around the end-plates of ALS donors

(Fig. 2I). No C1q deposition was detected in on the end-plates of control donors (Fig.

2H). We also detected C1q on the cellular elements synaptophysin (SYN) and S100b

indicating C1q is also deposited at the motor nerve terminal and terminal schwann

cell in the intercostal muscle of ALS donors (Supplement figure 1B, D- arrows), but


Fig. 2. Confocal microscopic images of intercostal muscle from controls (A, B, C) and ALS donors (D,

E, F) double-labeled with antibodies against neurofilament (NF-H, CY3) and antibodies against

classical pathway component of the complement system C1q (C1q, FITC). C1q deposition was

detected on the nerves as well as near the nerve endings (white asterisks in F) in muscle of ALS

donors but not in controls.(G) Quantification showed C1q positive staining co-localizing with nerves

and in the vicinity of nerve endings (white head arrow pointing to NF-H and asterisk on C1q in F) in

the intercostal muscle of ALS donors, but not in controls (P= 0.001 and P=0.001, respectively). NE

Chapter 6

190

staining (dark brown) followed by an immune staining for C1q (blue) showed (I) C1q deposition on the

end-plates of ALS donors (white arrow in I and enlargement of the area as insert) (H) by contrast, no

C1q deposition was found deposited on the motor end-plates in the intercostal muscle of control

donors. Numbers of C1q positive nerve endings in 20 non-overlapping Z-stacks in 40 µm thick

intercostal muscle sections is given on the Y-axis. Error bar represents standard deviation of the

mean. n.d.= not detected.

MAC deposition on the motor end-plates in the intercostal muscle of ALS

donors

To determine whether the terminal pathway of the complement system is also

activated in ALS, we tested for MAC deposition at the motor end-plates. We analyzed

the intercostal muscle of ALS donors. The presence of MAC on innervated or

denervated motor end-plates was measured using immunofluorescence and confocal

microscopy on 40 µm thick sections. We analyzed 20 non-overlapping Z-stacks.

Human intercostal muscle of control (Fig. 3A, B, C, D) and ALS donors (Fig. 3E, F,

G, H) were stained for NF-H, α-BTX detecting end-plates and C9neo epitope, a

component of the terminal complement complex MAC (C5b9). MAC immunoreactivity

was detected on and around nerves and on motor end-plates in ALS patients (Fig.

3E, F, G, H). A strong MAC immunoreactiviy was detected (Fig. 3H- asterisks within

insert) on the end-plates with a weak α-BTX immunoreactivity (Fig. 3H- arrow within

insert). By contrast, a weak MAC immunoreactivity (Fig. 3H- asterisks) was detected

on end-plates with strong α-BTX immunoreactivity (Fig. 3H- arrow) and nerves

innervating the motor end-plate (Fig. 3H- arrow head). We suggest there might be a

highly relevant anti-correlation between MAC and α-BTX immunoreactivity in the

ALS samples. However, the high variability between the biological specimens and

the low number of end-plates detected in these samples make it difficult to draw

a firm conclusions based on the measurement of fluorescence intensities.

No MAC immunoreactivity was detected on or around the end-plates of control

donors (Fig. 3C, D). Quantification showed a mean of 6 innervated [controls vs ALS

donors P=0.01) and 11 denervated [control versus ALS donors P=0.01) MAC positive

motor end-plates in 20 non-overlapping Z-stacks in 40 µm thick intercostal muscle

sections (Fig. 3I).

To determine whether MAC is deposited on the motor end-plates we performed

immunostainings for MAC followed by NE staining on the intercostal muscle of

control (Fig. 3J) and ALS donors (Fig. 3K). We found MAC deposition on the motor

end-plates in the intercostal muscle of ALS donors, but not in controls, suggesting

that the terminal pathway of the complement system is activated on the motor end-

plates. We also detected MAC on the cellular elements synaptophysin (SYN) and

S100b indicating MAC is also deposited at the motor nerve terminal and terminal

schwann cell in the intercostal muscle of ALS donors (Supplement figure 3B, D-

arrows), but not in controls (Supplement figure 3A, C).

6


191

staining (dark brown) followed by an immune staining for C1q (blue) showed (I) C1q deposition on the

end-plates of ALS donors (white arrow in I and enlargement of the area as insert) (H) by contrast, no

C1q deposition was found deposited on the motor end-plates in the intercostal muscle of control

donors. Numbers of C1q positive nerve endings in 20 non-overlapping Z-stacks in 40 µm thick

intercostal muscle sections is given on the Y-axis. Error bar represents standard deviation of the

mean. n.d.= not detected.

MAC deposition on the motor end-plates in the intercostal muscle of ALS

donors

To determine whether the terminal pathway of the complement system is also

activated in ALS, we tested for MAC deposition at the motor end-plates. We analyzed

the intercostal muscle of ALS donors. The presence of MAC on innervated or

denervated motor end-plates was measured using immunofluorescence and confocal

microscopy on 40 µm thick sections. We analyzed 20 non-overlapping Z-stacks.

Human intercostal muscle of control (Fig. 3A, B, C, D) and ALS donors (Fig. 3E, F,

G, H) were stained for NF-H, α-BTX detecting end-plates and C9neo epitope, a

component of the terminal complement complex MAC (C5b9). MAC immunoreactivity

was detected on and around nerves and on motor end-plates in ALS patients (Fig.

3E, F, G, H). A strong MAC immunoreactiviy was detected (Fig. 3H- asterisks within

insert) on the end-plates with a weak α-BTX immunoreactivity (Fig. 3H- arrow within

insert). By contrast, a weak MAC immunoreactivity (Fig. 3H- asterisks) was detected

on end-plates with strong α-BTX immunoreactivity (Fig. 3H- arrow) and nerves

innervating the motor end-plate (Fig. 3H- arrow head). We suggest there might be a

highly relevant anti-correlation between MAC and α-BTX immunoreactivity in the

ALS samples. However, the high variability between the biological specimens and

the low number of end-plates detected in these samples make it difficult to draw

a firm conclusions based on the measurement of fluorescence intensities.

No MAC immunoreactivity was detected on or around the end-plates of control

donors (Fig. 3C, D). Quantification showed a mean of 6 innervated [controls vs ALS

donors P=0.01) and 11 denervated [control versus ALS donors P=0.01) MAC positive

motor end-plates in 20 non-overlapping Z-stacks in 40 µm thick intercostal muscle

sections (Fig. 3I).

To determine whether MAC is deposited on the motor end-plates we performed

immunostainings for MAC followed by NE staining on the intercostal muscle of

control (Fig. 3J) and ALS donors (Fig. 3K). We found MAC deposition on the motor

end-plates in the intercostal muscle of ALS donors, but not in controls, suggesting

that the terminal pathway of the complement system is activated on the motor end-

plates. We also detected MAC on the cellular elements synaptophysin (SYN) and

S100b indicating MAC is also deposited at the motor nerve terminal and terminal



Chapter 6

192

Fig. 3. Representative confocal images of triple-immunofluorescence staining for neurofilament (NF-H,

CY3), motor end-plates with α-BTX (Alexa488) and complement component C5b-9 with MAC (CY5) in

control (A, B, C, D) and ALS intercostal muscle (E, F, G, H), shows presence of MAC (white asterisks

in h and enlarged in the insert) on end-plates (white arrows in h) and around nerves in ALS intercostal

muscle (white arrow head in h), but not in controls (C, D). Quantification showed a significantly higher

percentage of MAC positive innervated end-plates (P=0.001) and denervated end-plates (P=0.001) in

ALS intercostal muscle compared to controls. Numbers of MAC positive end-plates in 20 non-

overlapping Z-stacks in 40 µm thick intercostal muscle sections is given on the Y-axis. Error bar

represents standard deviation of the mean (I). NE staining (dark brown) followed by an immune

staining for MAC (blue) showed (K) MAC deposition deposited on the end-plates of ALS donors (white

arrow in K; enlarged in the insert), (J) but not on end-plates of control donors. n.d.= not detected.

CD55 on the motor end-plates in the intercostal muscle of ALS donors

Regulators such as CD55 and CD59 protect tissues against an attack by the

complement system. The role of these regulators in the pathogenesis in ALS is of

interest. CD55 acts on the membranes of self-cells to circumvent the deposition of

C3b on their surfaces [25]. We found C3/C3b deposition in the intercostal muscle of

ALS donors deposited at the motor nerve terminal and terminal schwann cells

(Supplement figure 2B, D- arrows), but not in controls (Supplement figure 2A, C).

Therefore we analyzed whether CD55 is also deposited in the intercostal muscle ALS

donors. We analyzed 20 non-overlapping Z-stacks in 40 µm thick sections using

confocal microscopy. Human intercostal muscle of control (Fig. 4A, B, C) and ALS

donors (Fig. 4D, E, F) were stained for NF-H and CD55. We identified strong staining

for CD55 on and around nerves in the intercostal muscle of ALS donors (Fig. 4F), but

not in controls (Fig. 4C). Quantification showed a significantly higher percentage of

CD55 positive staining. Not all staining co-localized with NF-H in the intercostal

muscle of ALS donors (Fig. 4G- grey bar).

To determine whether CD55 is deposited on the end-plates, a NE staining on frozen

intercostal muscle of control and ALS donors was performed to visualize the end-

plates followed by immunostaining for CD55. No CD55 deposition was detected on

the end-plates of control donors (Fig. 4C, H), by contrast an extensive amount of

CD55 was found deposited on and around the end-plates of ALS donors (Fig. 4I),

suggesting an increased regulation of the common complement pathway on the end-

plates. We also detected CD55 on the cellular elements synaptophysin (SYN) and

S100b indicating CD55 is also deposited at the motor nerve terminal and terminal



6


193

Fig. 3. Representative confocal images of triple-immunofluorescence staining for neurofilament (NF-H,

CY3), motor end-plates with α-BTX (Alexa488) and complement component C5b-9 with MAC (CY5) in

control (A, B, C, D) and ALS intercostal muscle (E, F, G, H), shows presence of MAC (white asterisks

in h and enlarged in the insert) on end-plates (white arrows in h) and around nerves in ALS intercostal

muscle (white arrow head in h), but not in controls (C, D). Quantification showed a significantly higher

percentage of MAC positive innervated end-plates (P=0.001) and denervated end-plates (P=0.001) in

ALS intercostal muscle compared to controls. Numbers of MAC positive end-plates in 20 non-


represents standard deviation of the mean (I). NE staining (dark brown) followed by an immune

staining for MAC (blue) showed (K) MAC deposition deposited on the end-plates of ALS donors (white

arrow in K; enlarged in the insert), (J) but not on end-plates of control donors. n.d.= not detected.

CD55 on the motor end-plates in the intercostal muscle of ALS donors

Regulators such as CD55 and CD59 protect tissues against an attack by the

complement system. The role of these regulators in the pathogenesis in ALS is of

interest. CD55 acts on the membranes of self-cells to circumvent the deposition of

C3b on their surfaces [25]. We found C3/C3b deposition in the intercostal muscle of

ALS donors deposited at the motor nerve terminal and terminal schwann cells

(Supplement figure 2B, D- arrows), but not in controls (Supplement figure 2A, C).

Therefore we analyzed whether CD55 is also deposited in the intercostal muscle ALS

donors. We analyzed 20 non-overlapping Z-stacks in 40 µm thick sections using

confocal microscopy. Human intercostal muscle of control (Fig. 4A, B, C) and ALS

donors (Fig. 4D, E, F) were stained for NF-H and CD55. We identified strong staining

for CD55 on and around nerves in the intercostal muscle of ALS donors (Fig. 4F), but

not in controls (Fig. 4C). Quantification showed a significantly higher percentage of

CD55 positive staining. Not all staining co-localized with NF-H in the intercostal

muscle of ALS donors (Fig. 4G- grey bar).

To determine whether CD55 is deposited on the end-plates, a NE staining on frozen

intercostal muscle of control and ALS donors was performed to visualize the end-

plates followed by immunostaining for CD55. No CD55 deposition was detected on

the end-plates of control donors (Fig. 4C, H), by contrast an extensive amount of

CD55 was found deposited on and around the end-plates of ALS donors (Fig. 4I),

suggesting an increased regulation of the common complement pathway on the end-

plates. We also detected CD55 on the cellular elements synaptophysin (SYN) and

S100b indicating CD55 is also deposited at the motor nerve terminal and terminal



Chapter 6

194

Fig. 4. Representative confocal double-immunofluorescence for neurofilament (NF-H, CY3) and CD55

detected with anti-DAF (FITC) in control (A, B, C) and ALS (D, E, F) intercostal muscle, shows CD55

deposition in ALS intercostal muscle on and around nerves (white asterisks on CD55 and arrow head

pointing to NF-H in F), but not in control tissue (C). Quantification showed CD55 deposition co-

localizing with nerves or in the vicinity of nerves in the intercostal muscle of ALS donors, but not in

controls (P=0.01 and P=0.0001, respectively) (G). Numbers of CD55 positive end-plates in 20 non-


represents standard deviation of the mean n.d.= not detected. NE staining (dark brown) followed by an

immune staining for CD55 (blue) showing (I) CD55 deposition on the motor end-plates (white arrow in

I) in the intercostal muscle of ALS donors,(H) but no CD55 deposition in controls.

CD59 on the motor end-plates in the intercostal muscle of ALS donor

The glycolipid anchored protein CD59 has a binding site for both C8 and C9 and as

such can prevent formation of MAC [26, 27]. Immunofluorescence staining for NF-H,

α-BTX detecting end-plates and the regulator CD59 was performed on intercostal

muscle of control (Fig. 5A, B, C and D) and ALS (Fig. 5E, F, G and H) donors. We

analyzed 20 non-overlapping Z-stacks in 40 µm thick sections using confocal

microscopy. CD59 was found abundantly present on and around the motor end-

plates in the intercostal muscle of ALS donors (Fig. 5G, H - asterisks), but was

negative in the intercostal muscle of control donors (Fig. 5C, D). Quantification

showed that this difference is significant for both innervated and denervated motor

end-plates of ALS donors (Fig. 5I) [P=0.05, P=0.05 respectively). In addition, we

show that CD59 is also deposited on the motor nerve terminal and terminal schwann

cells in the intercostal muscle of ALS donors (Supplement figure 5B, D- arrows), but


6


195

Fig. 4. Representative confocal double-immunofluorescence for neurofilament (NF-H, CY3) and CD55

detected with anti-DAF (FITC) in control (A, B, C) and ALS (D, E, F) intercostal muscle, shows CD55

deposition in ALS intercostal muscle on and around nerves (white asterisks on CD55 and arrow head

pointing to NF-H in F), but not in control tissue (C). Quantification showed CD55 deposition co-

localizing with nerves or in the vicinity of nerves in the intercostal muscle of ALS donors, but not in

controls (P=0.01 and P=0.0001, respectively) (G). Numbers of CD55 positive end-plates in 20 non-


represents standard deviation of the mean n.d.= not detected. NE staining (dark brown) followed by an

immune staining for CD55 (blue) showing (I) CD55 deposition on the motor end-plates (white arrow in

I) in the intercostal muscle of ALS donors,(H) but no CD55 deposition in controls.

CD59 on the motor end-plates in the intercostal muscle of ALS donor

The glycolipid anchored protein CD59 has a binding site for both C8 and C9 and as

such can prevent formation of MAC [26, 27]. Immunofluorescence staining for NF-H,

α-BTX detecting end-plates and the regulator CD59 was performed on intercostal

muscle of control (Fig. 5A, B, C and D) and ALS (Fig. 5E, F, G and H) donors. We

analyzed 20 non-overlapping Z-stacks in 40 µm thick sections using confocal

microscopy. CD59 was found abundantly present on and around the motor end-

plates in the intercostal muscle of ALS donors (Fig. 5G, H - asterisks), but was

negative in the intercostal muscle of control donors (Fig. 5C, D). Quantification

showed that this difference is significant for both innervated and denervated motor

end-plates of ALS donors (Fig. 5I) [P=0.05, P=0.05 respectively). In addition, we

show that CD59 is also deposited on the motor nerve terminal and terminal schwann

cells in the intercostal muscle of ALS donors (Supplement figure 5B, D- arrows), but


Chapter 6

196

Fig. 5. Representative confocal triple-immunofluorescence for neurofilament (NF-H, CY3), end-plates

detected with α-BTX (Alexa488) and the regulator CD59 (Cy5) in control (A, B, C, D) and ALS (E, F,

G, H) intercostal muscle, showing deposition of CD59 (white asterisks in h, enlarged in insert) in ALS

intercostal muscle tissue on denervated end-plates (white arrow pointing to α-BTX and arrow head

pointing to NF-H in H) , but not in controls. Quantification shows CD59 positive innervated and

denervated motor end-plates in the intercostal muscle of ALS donors, but not in controls (P=0.05 and

P=0.05, respectively). Data represents standard deviation of the mean. n.d. = not detected.

Discussion

Although a role for complement has been found in many neurodegenerative diseases

[28-34], it contribution to disease progression in animal models for ALS is

controversial [35, 36]. We previously provided evidence for an early role of the

complement system in ALS in the SOD1G93A mouse model of familial ALS [20].

Fischer and colleagues suggest that ALS pathology starts at the muscle end-plates

proceeding to the spinal cord and subsequently the brain [23]. In addition, several

physiological and morphological alterations have been reported on the muscle end-

plates from in vivo and ex vivo mouse and rat preparations [37-43].

To obtain a better understanding of the role of complement in human ALS pathology,

we analyzed post-mortem tissue of ALS donors for complement activation and its

regulators. We found a lower number and a decreased size of the α-BTX positive

end-plates in the tissue of ALS donors compared to controls, suggesting that the

end-plates in the intercostal muscle of ALS patients are affected.

In the ALS muscle we found deposition of complement activation products C1q and

C3, but not in controls. C1q and C3 were detected on and around the end-plates, but

also on the nerve terminal and terminal schwann cells. C1q and C3 mRNA and

protein levels were found elevated in spinal cord and motor cortex of patients with

sporadic ALS [15]. In murine ALS models, C1q was also upregulated in motor

neurons [16], whereas C3 is up-regulated in the anterior horn areas containing motor

neuron degeneration. Expression profiling in the mutant SOD1 motor neurons,

showed that C1q genes were upregulated early in the disease. C1q can bind

antibody aggregates and activate the classic complement pathway [11, 17]. This data

suggests a role for C1q and C3 in ALS. However, a study by Lobsiger et al.

6


197

Fig. 5. Representative confocal triple-immunofluorescence for neurofilament (NF-H, CY3), end-plates

detected with α-BTX (Alexa488) and the regulator CD59 (Cy5) in control (A, B, C, D) and ALS (E, F,

G, H) intercostal muscle, showing deposition of CD59 (white asterisks in h, enlarged in insert) in ALS

intercostal muscle tissue on denervated end-plates (white arrow pointing to α-BTX and arrow head

pointing to NF-H in H) , but not in controls. Quantification shows CD59 positive innervated and

denervated motor end-plates in the intercostal muscle of ALS donors, but not in controls (P=0.05 and

P=0.05, respectively). Data represents standard deviation of the mean. n.d. = not detected.

Discussion

Although a role for complement has been found in many neurodegenerative diseases

[28-34], it contribution to disease progression in animal models for ALS is

controversial [35, 36]. We previously provided evidence for an early role of the

complement system in ALS in the SOD1G93A mouse model of familial ALS [20].

Fischer and colleagues suggest that ALS pathology starts at the muscle end-plates

proceeding to the spinal cord and subsequently the brain [23]. In addition, several

physiological and morphological alterations have been reported on the muscle end-

plates from in vivo and ex vivo mouse and rat preparations [37-43].

To obtain a better understanding of the role of complement in human ALS pathology,

we analyzed post-mortem tissue of ALS donors for complement activation and its

regulators. We found a lower number and a decreased size of the α-BTX positive

end-plates in the tissue of ALS donors compared to controls, suggesting that the

end-plates in the intercostal muscle of ALS patients are affected.

In the ALS muscle we found deposition of complement activation products C1q and

C3, but not in controls. C1q and C3 were detected on and around the end-plates, but

also on the nerve terminal and terminal schwann cells. C1q and C3 mRNA and

protein levels were found elevated in spinal cord and motor cortex of patients with

sporadic ALS [15]. In murine ALS models, C1q was also upregulated in motor

neurons [16], whereas C3 is up-regulated in the anterior horn areas containing motor

neuron degeneration. Expression profiling in the mutant SOD1 motor neurons,

showed that C1q genes were upregulated early in the disease. C1q can bind

antibody aggregates and activate the classic complement pathway [11, 17]. This data

suggests a role for C1q and C3 in ALS. However, a study by Lobsiger et al.

Chapter 6

198

demonstrates no significant pathogenic role for C1q and C3 proteins in the SOD1G93A

ALS mice survival, contradicting a possible role for complement in this model [44].

This study however did not analyse downstream pathways, like the extrinsic pathway

of complement which can lead to C5 cleavage and does not need C1q and C3

proteins for activation and MAC formation, which may be the key point at which

complement-mediated neurotoxicity occurs in these ALS models [35, 45].

A role for MAC in the pathology of neurological disorders is suggested, including ALS

[31]. In serum of ALS patients the terminal complement activation products C5a and

MAC are elevated [46]. MAC can damage tissue and target nerves in different

neurodegenerative models [34, 47], suggesting a role for MAC in degeneration.

Furthermore, we show that MAC is deposited on the motor end-plates of SOD1G93A

mouse model on day 47 in the SOD1G93A mouse model, suggesting that MAC

deposition is an early event in this model (Supplement Figure 6). This result is by

contrast to a previous analysis of the SODG93A mice [20]. In that study, no MAC was

detected on the end-plates of the SODG93A mice. We attribute this difference to the

use of another antibody for the detection of C5b9. We used a monoclonal mouse

anti-human C9neo, this antibody gives a specific signal on both frozen human and

mouse sections. It detects C9neo and not C9, therefore it is also more specific to

recognise the C9 within the MAC, whereas the polyclonal mouse anti-rat C9 that was

used previously either gives no staining or a lot of background on frozen sections.

Since we find MAC deposition consistently on end-plates in both human and mouse

muscle, an artefact is excluded.

The present study shows deposition of MAC at the muscle end-plates of ALS donors.

We show strong MAC immunoreactiviy on the end-plates with a weak α-BTX

immunoreactivity in the intercostal muscle of ALS donors. By contrast, a weak MAC

immunoreactivity was detected on end-plates with strong α-BTX immunoreactivity.

This is compatible with a model in which MAC deposition occurs before loss of the

end-plates, in fact MAC could be a contributor to disease progression and end-plate

pathology. In addition, MAC was also found co-localizing with the motor nerve

terminal and terminal Schwann cells.

The propensity of the MAC to “drift” from the site of activation and deposit on other

sites may even result in more damage to the muscle. In general, cells are protected

from complement attack by multiple complement regulators, preventing damage. This

protection can be overwhelmed resulting in damage to tissue and drives inflammation

[48, 49].

CD55 and CD59 restrict complement activation by inhibiting C3/C5 convertase

activities and membrane attack complex formation, respectively. In the actively

immunized experimental autoimmune myasthenia gravis mice deficient in either

CD55 or CD59 a significant increase in complement deposition at the end-plates was

observed and worsened disease outcome associated with increased levels of serum

cytokines was observed [50].

Here we show that also the regulators of the common pathway CD55 and the

terminal pathway CD59, are deposited on the motor end-plates of ALS donors, but

not in controls. In addition, the motor nerve terminal and terminal schwann cells were

also co-localizing with CD55 and CD59. Upregulation of the complement regulators

CD55 and CD59 on the motor end-plates of ALS patients, probably is an attempt to

dampen the high level of complement activation and protect the tissue.

6


199

demonstrates no significant pathogenic role for C1q and C3 proteins in the SOD1G93A

ALS mice survival, contradicting a possible role for complement in this model [44].

This study however did not analyse downstream pathways, like the extrinsic pathway

of complement which can lead to C5 cleavage and does not need C1q and C3

proteins for activation and MAC formation, which may be the key point at which

complement-mediated neurotoxicity occurs in these ALS models [35, 45].

A role for MAC in the pathology of neurological disorders is suggested, including ALS

[31]. In serum of ALS patients the terminal complement activation products C5a and

MAC are elevated [46]. MAC can damage tissue and target nerves in different

neurodegenerative models [34, 47], suggesting a role for MAC in degeneration.

Furthermore, we show that MAC is deposited on the motor end-plates of SOD1G93A

mouse model on day 47 in the SOD1G93A mouse model, suggesting that MAC

deposition is an early event in this model (Supplement Figure 6). This result is by

contrast to a previous analysis of the SODG93A mice [20]. In that study, no MAC was

detected on the end-plates of the SODG93A mice. We attribute this difference to the

use of another antibody for the detection of C5b9. We used a monoclonal mouse

anti-human C9neo, this antibody gives a specific signal on both frozen human and

mouse sections. It detects C9neo and not C9, therefore it is also more specific to

recognise the C9 within the MAC, whereas the polyclonal mouse anti-rat C9 that was

used previously either gives no staining or a lot of background on frozen sections.

Since we find MAC deposition consistently on end-plates in both human and mouse

muscle, an artefact is excluded.

The present study shows deposition of MAC at the muscle end-plates of ALS donors.

We show strong MAC immunoreactiviy on the end-plates with a weak α-BTX

immunoreactivity in the intercostal muscle of ALS donors. By contrast, a weak MAC

immunoreactivity was detected on end-plates with strong α-BTX immunoreactivity.

This is compatible with a model in which MAC deposition occurs before loss of the

end-plates, in fact MAC could be a contributor to disease progression and end-plate

pathology. In addition, MAC was also found co-localizing with the motor nerve

terminal and terminal Schwann cells.

The propensity of the MAC to “drift” from the site of activation and deposit on other

sites may even result in more damage to the muscle. In general, cells are protected

from complement attack by multiple complement regulators, preventing damage. This

protection can be overwhelmed resulting in damage to tissue and drives inflammation

[48, 49].

CD55 and CD59 restrict complement activation by inhibiting C3/C5 convertase

activities and membrane attack complex formation, respectively. In the actively

immunized experimental autoimmune myasthenia gravis mice deficient in either

CD55 or CD59 a significant increase in complement deposition at the end-plates was

observed and worsened disease outcome associated with increased levels of serum

cytokines was observed [50].

Here we show that also the regulators of the common pathway CD55 and the

terminal pathway CD59, are deposited on the motor end-plates of ALS donors, but

not in controls. In addition, the motor nerve terminal and terminal schwann cells were

also co-localizing with CD55 and CD59. Upregulation of the complement regulators

CD55 and CD59 on the motor end-plates of ALS patients, probably is an attempt to

dampen the high level of complement activation and protect the tissue.

Chapter 6

200

Since, we also detected MAC deposition at the motor end-plates of the ALS donors,

the upregulation of CD55 and CD59 is not sufficient to protect the end-plates from

MAC attack.

Conclusions

In summary, we demonstrated that complement activation products C1q and MAC

are deposited on motor end-plates in post-mortem tissue of ALS donors. MAC was

found deposited on motor end-plates that were innervated by nerves, indicating that

complement activation may precede motor-endplate denervation.

Here, we showed that the regulators CD55 and CD59 are also expressed on the

motor end-plates, indicating an attempt to control the activation. This process is

probably not efficient enough because MAC can still be detected on the α-BTX

positive motor end-plates. Since a role for MAC in the pathology of neurological

disorders is suggested [31], detecting complement deposited at the end-plates of

ALS donors, before the end-plates are lost, suggests that complement is an early

event in ALS and might play an important role in the motor end-plate pathology in

ALS. This observation is in line with earlier studies suggesting a "dying-back"

mechanism in ALS, meaning the disease probably starts at the motor end-plates [23].

Although this study was performed using post-mortem intercostal muscle tissue of

ALS patients and there may be some limitations to our conclusions about

complement being involved in motor end-plate degeneration, this study adds to the

understanding of ALS pathology in man.

Authors’ contributions

This work is supported by the NWO Mozaiek grant to NBEI [grant number 017.009.026]. NBEI and SB

performed the experiments; NBEI analyzed the data and generated the figures; EA and DT advised on

the project and provided the material; FB and DT coordinated the project; NBEI, VR and FB

formulated the project; NBEI wrote the manuscript.

Acknowledgements

We thank Prof. Joost Verhaagen for kindly providing us gastrocnemius muscle from wildtype and

SOD1G93A

mice.

6


201

Since, we also detected MAC deposition at the motor end-plates of the ALS donors,

the upregulation of CD55 and CD59 is not sufficient to protect the end-plates from

MAC attack.

Conclusions

In summary, we demonstrated that complement activation products C1q and MAC

are deposited on motor end-plates in post-mortem tissue of ALS donors. MAC was

found deposited on motor end-plates that were innervated by nerves, indicating that

complement activation may precede motor-endplate denervation.

Here, we showed that the regulators CD55 and CD59 are also expressed on the

motor end-plates, indicating an attempt to control the activation. This process is

probably not efficient enough because MAC can still be detected on the α-BTX

positive motor end-plates. Since a role for MAC in the pathology of neurological

disorders is suggested [31], detecting complement deposited at the end-plates of

ALS donors, before the end-plates are lost, suggests that complement is an early

event in ALS and might play an important role in the motor end-plate pathology in

ALS. This observation is in line with earlier studies suggesting a "dying-back"

mechanism in ALS, meaning the disease probably starts at the motor end-plates [23].

Although this study was performed using post-mortem intercostal muscle tissue of

ALS patients and there may be some limitations to our conclusions about



Authors’ contributions

This work is supported by the NWO Mozaiek grant to NBEI [grant number 017.009.026]. NBEI and SB

performed the experiments; NBEI analyzed the data and generated the figures; EA and DT advised on

the project and provided the material; FB and DT coordinated the project; NBEI, VR and FB

formulated the project; NBEI wrote the manuscript.

Acknowledgements

We thank Prof. Joost Verhaagen for kindly providing us gastrocnemius muscle from wildtype and

SOD1G93A

mice.

Chapter 6

202

References

1. Pasinelli P, Brown RH. Molecular biology of amyotrophic lateral sclerosis: insights from genetics. Nat Rev Neurosci 2006;7:710-23.

2. Mitchell JD, Borasio GD. Amyotrophic lateral sclerosis. Lancet 2007;369:2031-41.

3. Raoul C, Estevez AG, Nishimune H, et al. Motoneuron death triggered by a specific pathway downstream of Fas. potentiation by ALS-linked SOD1 mutations. Neuron 2002;35:1067-83.

4. Boillee S, Yamanaka K, Lobsiger CS, et al. Onset and progression in inherited ALS determined by motor neurons and microglia. Science 2006;312:1389-92.

5. Di Giorgio FP, Carrasco MA, Siao MC, Maniatis T, Eggan K. Non-cell autonomous effect of glia on motor neurons in an embryonic stem cell-based ALS model. Nat Neurosci 2007;10:608-14.

6. Bruijn LI, Miller TM, Cleveland DW. Unraveling the mechanisms involved in motor neuron degeneration in ALS. Annu Rev Neurosci 2004;27:723-49.

7. Cozzolino M, Ferri A, Carri MT. Amyotrophic lateral sclerosis: from current developments in the laboratory to clinical implications. Antioxid Redox Signal 2008;10:405-43.

8. Woodruff TM, Costantini KJ, Taylor SM, Noakes PG. Role of complement in motor neuron disease: animal models and therapeutic potential of complement inhibitors. Adv Exp Med Biol 2008;632:143-58.

9. Dupuis L, Gonzalez de Aguilar JL, Echaniz-Laguna A, et al. Muscle mitochondrial uncoupling dismantles neuromuscular junction and triggers distal degeneration of motor neurons. PLoS One 2009;4:e5390.

10. Dupuis L, Loeffler JP. Neuromuscular junction destruction during amyotrophic lateral sclerosis: insights from transgenic models. Curr Opin Pharmacol 2009;9:341-6.

11. Woodruff TM, Costantini KJ, Crane JW, et al. The complement factor C5a contributes to pathology in a rat model of amyotrophic lateral sclerosis. J Immunol 2008;181:8727-34.

12. Ricklin D, Hajishengallis G, Yang K, Lambris JD. Complement: a key system for immune surveillance and homeostasis. Nat Immunol 2010;11:785-97.

13. Leslie M. Immunology. The new view of complement. Science 2012;337:1034-7.

14. de Cordoba SR, Tortajada A, Harris CL, Morgan BP. Complement dysregulation and disease: from genes and proteins to diagnostics and drugs. Immunobiology 2012;217:1034-46.

15. Sta M, Sylva-Steenland RM, Casula M, et al. Innate and adaptive immunity in amyotrophic lateral sclerosis: evidence of complement activation. Neurobiol Dis 2011;42:211-20.

16. Ferraiuolo L, Heath PR, Holden H, Kasher P, Kirby J, Shaw PJ. Microarray analysis of the cellular pathways involved in the adaptation to and progression of motor neuron injury in the SOD1 G93A mouse model of familial ALS. J Neurosci 2007;27:9201-19.

17. Lobsiger CS, Boillee S, Cleveland DW. Toxicity from different SOD1 mutants dysregulates the complement system and the neuronal regenerative response in ALS motor neurons. Proc Natl Acad Sci U S A 2007;104:7319-26.

18. Humayun S, Gohar M, Volkening K, et al. The complement factor C5a receptor is upregulated in NFL-/- mouse motor neurons. J Neuroimmunol 2009;210:52-62.

19. Lee JD, Kamaruzaman NA, Fung JN, et al. Dysregulation of the complement cascade in the hSOD1G93A transgenic mouse model of amyotrophic lateral sclerosis. J Neuroinflammation 2013;10:119.

20. Heurich B, El Idrissi NB, Donev RM, et al. Complement upregulation and activation on motor neurons and neuromuscular junction in the SOD1 G93A mouse model of familial amyotrophic lateral sclerosis. J Neuroimmunol 2011;235:104-9.

21. Eisen A, Weber M. The motor cortex and amyotrophic lateral sclerosis. Muscle Nerve 2001;24:564-73.

22. Karlsborg M, Rosenbaum S, Wiegell M, et al. Corticospinal tract degeneration and possible pathogenesis in ALS evaluated by MR diffusion tensor imaging. Amyotroph Lateral Scler Other Motor Neuron Disord 2004;5:136-40.

23. Fischer LR, Culver DG, Tennant P, et al. Amyotrophic lateral sclerosis is a distal axonopathy: evidence in mice and man. Exp Neurol 2004;185:232-40.

24. LEHRER GM, ORNSTEIN L. A diazo coupling method for the electron microscopic localization of cholinesterase. J Biophys Biochem Cytol 1959;6:399-406.

25. Lin F, Fukuoka Y, Spicer A, et al. Tissue distribution of products of the mouse decay-accelerating factor (DAF) genes. Exploitation of a Daf1 knock-out mouse and site-specific monoclonal antibodies. Immunology 2001;104:215-25.

26. Liszewski MK, Farries TC, Lublin DM, Rooney IA, Atkinson JP. Control of the complement system. Adv Immunol 1996;61:201-83.

27. Stahel PF, Flierl MA, Morgan BP, et al. Absence of the complement regulatory molecule CD59a leads to exacerbated neuropathology after traumatic brain injury in mice. J Neuroinflammation 2009;6:2.

28. Leinhase I, Holers VM, Thurman JM, et al. Reduced neuronal cell death after experimental brain injury in mice lacking a functional alternative pathway of complement activation. BMC Neurosci 2006;7:55.

29. Rancan M, Morganti-Kossmann MC, Barnum SR, et al. Central nervous system-targeted complement inhibition mediates neuroprotection after closed head injury in transgenic mice. J Cereb Blood Flow Metab 2003;23:1070-4.

30. Anderson AJ, Robert S, Huang W, Young W, Cotman CW. Activation of complement pathways after contusion-induced spinal cord injury. J Neurotrauma 2004;21:1831-46.

31. Bonifati DM, Kishore U. Role of complement in neurodegeneration and neuroinflammation. Mol Immunol 2007;44:999-1010.

32. Ramaglia V, Wolterman R, de KM, et al. Soluble complement receptor 1 protects the peripheral nerve from early axon loss after injury. Am J Pathol 2008;172:1043-52.

33. Ramaglia V, Tannemaat MR, de KM, et al. Complement inhibition accelerates regeneration in a model of peripheral nerve injury. Mol Immunol 2009;47:302-9.

34. Fluiter K, Opperhuizen AL, Morgan BP, Baas F, Ramaglia V. Inhibition of the membrane attack complex of the complement system reduces secondary neuroaxonal loss and promotes neurologic recovery after traumatic brain injury in mice. J Immunol 2014;192:2339-48.

35. Woodruff TM, Lee JD, Noakes PG. Role for terminal complement activation in amyotrophic lateral sclerosis disease progression. Proc Natl Acad Sci U S A 2014;111:E3-E4.

6


203

References

1. Pasinelli P, Brown RH. Molecular biology of amyotrophic lateral sclerosis: insights from genetics. Nat Rev Neurosci 2006;7:710-23.

2. Mitchell JD, Borasio GD. Amyotrophic lateral sclerosis. Lancet 2007;369:2031-41.

3. Raoul C, Estevez AG, Nishimune H, et al. Motoneuron death triggered by a specific pathway downstream of Fas. potentiation by ALS-linked SOD1 mutations. Neuron 2002;35:1067-83.

4. Boillee S, Yamanaka K, Lobsiger CS, et al. Onset and progression in inherited ALS determined by motor neurons and microglia. Science 2006;312:1389-92.

5. Di Giorgio FP, Carrasco MA, Siao MC, Maniatis T, Eggan K. Non-cell autonomous effect of glia on motor neurons in an embryonic stem cell-based ALS model. Nat Neurosci 2007;10:608-14.


7. Cozzolino M, Ferri A, Carri MT. Amyotrophic lateral sclerosis: from current developments in the laboratory to clinical implications. Antioxid Redox Signal 2008;10:405-43.

8. Woodruff TM, Costantini KJ, Taylor SM, Noakes PG. Role of complement in motor neuron disease: animal models and therapeutic potential of complement inhibitors. Adv Exp Med Biol 2008;632:143-58.

9. Dupuis L, Gonzalez de Aguilar JL, Echaniz-Laguna A, et al. Muscle mitochondrial uncoupling dismantles neuromuscular junction and triggers distal degeneration of motor neurons. PLoS One 2009;4:e5390.

10. Dupuis L, Loeffler JP. Neuromuscular junction destruction during amyotrophic lateral sclerosis: insights from transgenic models. Curr Opin Pharmacol 2009;9:341-6.

11. Woodruff TM, Costantini KJ, Crane JW, et al. The complement factor C5a contributes to pathology in a rat model of amyotrophic lateral sclerosis. J Immunol 2008;181:8727-34.

12. Ricklin D, Hajishengallis G, Yang K, Lambris JD. Complement: a key system for immune surveillance and homeostasis. Nat Immunol 2010;11:785-97.

13. Leslie M. Immunology. The new view of complement. Science 2012;337:1034-7.

14. de Cordoba SR, Tortajada A, Harris CL, Morgan BP. Complement dysregulation and disease: from genes and proteins to diagnostics and drugs. Immunobiology 2012;217:1034-46.

15. Sta M, Sylva-Steenland RM, Casula M, et al. Innate and adaptive immunity in amyotrophic lateral sclerosis: evidence of complement activation. Neurobiol Dis 2011;42:211-20.

16. Ferraiuolo L, Heath PR, Holden H, Kasher P, Kirby J, Shaw PJ. Microarray analysis of the cellular pathways involved in the adaptation to and progression of motor neuron injury in the SOD1 G93A mouse model of familial ALS. J Neurosci 2007;27:9201-19.

17. Lobsiger CS, Boillee S, Cleveland DW. Toxicity from different SOD1 mutants dysregulates the complement system and the neuronal regenerative response in ALS motor neurons. Proc Natl Acad Sci U S A 2007;104:7319-26.

18. Humayun S, Gohar M, Volkening K, et al. The complement factor C5a receptor is upregulated in NFL-/- mouse motor neurons. J Neuroimmunol 2009;210:52-62.


20. Heurich B, El Idrissi NB, Donev RM, et al. Complement upregulation and activation on motor neurons and neuromuscular junction in the SOD1 G93A mouse model of familial amyotrophic lateral sclerosis. J Neuroimmunol 2011;235:104-9.

21. Eisen A, Weber M. The motor cortex and amyotrophic lateral sclerosis. Muscle Nerve 2001;24:564-73.

22. Karlsborg M, Rosenbaum S, Wiegell M, et al. Corticospinal tract degeneration and possible pathogenesis in ALS evaluated by MR diffusion tensor imaging. Amyotroph Lateral Scler Other Motor Neuron Disord 2004;5:136-40.

23. Fischer LR, Culver DG, Tennant P, et al. Amyotrophic lateral sclerosis is a distal axonopathy: evidence in mice and man. Exp Neurol 2004;185:232-40.

24. LEHRER GM, ORNSTEIN L. A diazo coupling method for the electron microscopic localization of cholinesterase. J Biophys Biochem Cytol 1959;6:399-406.

25. Lin F, Fukuoka Y, Spicer A, et al. Tissue distribution of products of the mouse decay-accelerating factor (DAF) genes. Exploitation of a Daf1 knock-out mouse and site-specific monoclonal antibodies. Immunology 2001;104:215-25.

26. Liszewski MK, Farries TC, Lublin DM, Rooney IA, Atkinson JP. Control of the complement system. Adv Immunol 1996;61:201-83.

27. Stahel PF, Flierl MA, Morgan BP, et al. Absence of the complement regulatory molecule CD59a leads to exacerbated neuropathology after traumatic brain injury in mice. J Neuroinflammation 2009;6:2.


29. Rancan M, Morganti-Kossmann MC, Barnum SR, et al. Central nervous system-targeted complement inhibition mediates neuroprotection after closed head injury in transgenic mice. J Cereb Blood Flow Metab 2003;23:1070-4.

30. Anderson AJ, Robert S, Huang W, Young W, Cotman CW. Activation of complement pathways after contusion-induced spinal cord injury. J Neurotrauma 2004;21:1831-46.

31. Bonifati DM, Kishore U. Role of complement in neurodegeneration and neuroinflammation. Mol Immunol 2007;44:999-1010.

32. Ramaglia V, Wolterman R, de KM, et al. Soluble complement receptor 1 protects the peripheral nerve from early axon loss after injury. Am J Pathol 2008;172:1043-52.

33. Ramaglia V, Tannemaat MR, de KM, et al. Complement inhibition accelerates regeneration in a model of peripheral nerve injury. Mol Immunol 2009;47:302-9.

34. Fluiter K, Opperhuizen AL, Morgan BP, Baas F, Ramaglia V. Inhibition of the membrane attack complex of the complement system reduces secondary neuroaxonal loss and promotes neurologic recovery after traumatic brain injury in mice. J Immunol 2014;192:2339-48.

35. Woodruff TM, Lee JD, Noakes PG. Role for terminal complement activation in amyotrophic lateral sclerosis disease progression. Proc Natl Acad Sci U S A 2014;111:E3-E4.

Chapter 6

204

36. Lobsiger CS, Cleveland DW. Reply to Woodruff et al.: C1q and C3-dependent complement pathway activation does not contribute to disease in SOD1 mutant ALS mice. Proc Natl Acad Sci U S A 2014;111:E5.

37. Pagani MR, Reisin RC, Uchitel OD. Calcium signaling pathways mediating synaptic potentiation triggered by amyotrophic lateral sclerosis IgG in motor nerve terminals. J Neurosci 2006;26:2661-72.

38. Uchitel OD, Appel SH, Crawford F, Sczcupak L. Immunoglobulins from amyotrophic lateral sclerosis patients enhance spontaneous transmitter release from motor-nerve terminals. Proc Natl Acad Sci U S A 1988;85:7371-4.

39. Uchitel OD, Scornik F, Protti DA, Fumberg CG, Alvarez V, Appel SH. Long-term neuromuscular dysfunction produced by passive transfer of amyotrophic lateral sclerosis immunoglobulins. Neurology 1992;42:2175-80.

40. Appel SH, Engelhardt JI, Garcia J, Stefani E. Autoimmunity and ALS: a comparison of animal models of immune-mediated motor neuron destruction and human ALS. Adv Neurol 1991;56:405-12.

41. O'Shaughnessy TJ, Yan H, Kim J, et al. Amyotrophic lateral sclerosis: serum factors enhance spontaneous and evoked transmitter release at the neuromuscular junction. Muscle Nerve 1998;21:81-90.

42. Mohamed HA, Mosier DR, Zou LL, et al. Immunoglobulin Fc gamma receptor promotes immunoglobulin uptake, immunoglobulin-mediated calcium increase, and neurotransmitter release in motor neurons. J Neurosci Res 2002;69:110-6.

43. Muchnik S, Losavio A, De LS. Effect of amyotrophic lateral sclerosis serum on calcium channels related to spontaneous acetylcholine release. Clin Neurophysiol 2002;113:1066-71.

44. Lobsiger CS, Boillee S, Pozniak C, et al. C1q induction and global complement pathway activation do not contribute to ALS toxicity in mutant SOD1 mice. Proc Natl Acad Sci U S A 2013;110:E4385-E4392.

45. Huber-Lang M, Sarma JV, Zetoune FS, et al. Generation of C5a in the absence of C3: a new complement activation pathway. Nat Med 2006;12:682-7.

46. Mantovani S, Gordon R, Macmaw JK, et al. Elevation of the terminal complement activation products C5a and C5b-9 in ALS patient blood. J Neuroimmunol 2014;276:213-8.

47. Bahia E, I, Das PK, Fluiter K, et al. M. leprae components induce nerve damage by complement activation: identification of lipoarabinomannan as the dominant complement activator. Acta Neuropathol 2015;129:653-67.

48. Walport MJ. Complement. First of two parts. N Engl J Med 2001;344:1058-66.

49. Walport MJ. Complement. Second of two parts. N Engl J Med 2001;344:1140-4.

50. Soltys J, Halperin JA, Xuebin Q. DAF/CD55 and Protectin/CD59 modulate adaptive immunity and disease outcome in experimental autoimmune myasthenia gravis. J Neuroimmunol 2012;244:63-9.


Supl. Fig. 1. Representative confocal immunofluorescence for synaptophysin (SYN-CY3) detecting

the motor nerve terminal (A, B) or S100b (CY3) detecting the terminal schwann cells (C, D) double

stained with anti-C1q (FITC) in control (A, C) and ALS (B, D) intercostal muscle, shows C1q co-

localizing with both synaptophysin and S100b (White arrow in B and D respectively), but no C1q

deposition in controls.

6


205

36. Lobsiger CS, Cleveland DW. Reply to Woodruff et al.: C1q and C3-dependent complement pathway activation does not contribute to disease in SOD1 mutant ALS mice. Proc Natl Acad Sci U S A 2014;111:E5.

37. Pagani MR, Reisin RC, Uchitel OD. Calcium signaling pathways mediating synaptic potentiation triggered by amyotrophic lateral sclerosis IgG in motor nerve terminals. J Neurosci 2006;26:2661-72.

38. Uchitel OD, Appel SH, Crawford F, Sczcupak L. Immunoglobulins from amyotrophic lateral sclerosis patients enhance spontaneous transmitter release from motor-nerve terminals. Proc Natl Acad Sci U S A 1988;85:7371-4.

39. Uchitel OD, Scornik F, Protti DA, Fumberg CG, Alvarez V, Appel SH. Long-term neuromuscular dysfunction produced by passive transfer of amyotrophic lateral sclerosis immunoglobulins. Neurology 1992;42:2175-80.

40. Appel SH, Engelhardt JI, Garcia J, Stefani E. Autoimmunity and ALS: a comparison of animal models of immune-mediated motor neuron destruction and human ALS. Adv Neurol 1991;56:405-12.

41. O'Shaughnessy TJ, Yan H, Kim J, et al. Amyotrophic lateral sclerosis: serum factors enhance spontaneous and evoked transmitter release at the neuromuscular junction. Muscle Nerve 1998;21:81-90.

42. Mohamed HA, Mosier DR, Zou LL, et al. Immunoglobulin Fc gamma receptor promotes immunoglobulin uptake, immunoglobulin-mediated calcium increase, and neurotransmitter release in motor neurons. J Neurosci Res 2002;69:110-6.

43. Muchnik S, Losavio A, De LS. Effect of amyotrophic lateral sclerosis serum on calcium channels related to spontaneous acetylcholine release. Clin Neurophysiol 2002;113:1066-71.

44. Lobsiger CS, Boillee S, Pozniak C, et al. C1q induction and global complement pathway activation do not contribute to ALS toxicity in mutant SOD1 mice. Proc Natl Acad Sci U S A 2013;110:E4385-E4392.

45. Huber-Lang M, Sarma JV, Zetoune FS, et al. Generation of C5a in the absence of C3: a new complement activation pathway. Nat Med 2006;12:682-7.

46. Mantovani S, Gordon R, Macmaw JK, et al. Elevation of the terminal complement activation products C5a and C5b-9 in ALS patient blood. J Neuroimmunol 2014;276:213-8.

47. Bahia E, I, Das PK, Fluiter K, et al. M. leprae components induce nerve damage by complement activation: identification of lipoarabinomannan as the dominant complement activator. Acta Neuropathol 2015;129:653-67.

48. Walport MJ. Complement. First of two parts. N Engl J Med 2001;344:1058-66.

49. Walport MJ. Complement. Second of two parts. N Engl J Med 2001;344:1140-4.

50. Soltys J, Halperin JA, Xuebin Q. DAF/CD55 and Protectin/CD59 modulate adaptive immunity and disease outcome in experimental autoimmune myasthenia gravis. J Neuroimmunol 2012;244:63-9.




stained with anti-C1q (FITC) in control (A, C) and ALS (B, D) intercostal muscle, shows C1q co-

localizing with both synaptophysin and S100b (White arrow in B and D respectively), but no C1q


Chapter 6

206



stained with anti-C3c recognizing C3c part of C3 and C3b (FITC) in control (A, C) and ALS (B, D)

intercostal muscle, shows C3c co- localizing with both synaptophysin and S100b (White arrow in B

and D respectively), but no C3c deposition in controls.



stained with an antibody detecting MAC (FITC) in control (A, C) and ALS (B, D) intercostal muscle,

shows MAC deposition on both the motor nerve terminal and the terminal Schwann cells (White arrow

in B and D respectively), but no MAC deposition in controls.



stained with anti-CD55 (FITC) in control (A, C) and ALS (B, D) intercostal muscle, shows CD55 co-

localizing with both synaptophysin and S100b (White arrow in B and D respectively), but no CD55




stained with anti-CD59 (FITC) in control (A, C) and ALS (B, D) intercostal muscle, shows CD59

6


207



stained with anti-C3c recognizing C3c part of C3 and C3b (FITC) in control (A, C) and ALS (B, D)

intercostal muscle, shows C3c co- localizing with both synaptophysin and S100b (White arrow in B

and D respectively), but no C3c deposition in controls.



stained with an antibody detecting MAC (FITC) in control (A, C) and ALS (B, D) intercostal muscle,

shows MAC deposition on both the motor nerve terminal and the terminal Schwann cells (White arrow

in B and D respectively), but no MAC deposition in controls.



stained with anti-CD55 (FITC) in control (A, C) and ALS (B, D) intercostal muscle, shows CD55 co-

localizing with both synaptophysin and S100b (White arrow in B and D respectively), but no CD55




stained with anti-CD59 (FITC) in control (A, C) and ALS (B, D) intercostal muscle, shows CD59

Chapter 6

208

deposition on both the motor nerve terminal and the terminal Schwann cells (White arrow in B and D

respectively), but no CD59 deposition in controls.

Supl. Fig. 6. Representative confocal microscopy images of the motor end-plate from wildtype (n = 4)

(A) and SOD1G93A

mice (n = 4) at 47 (B), immunostained for neurofilament NF-H (white arrow head in

A and B), MAC with C5b9 (white asterisk in B) and the muscle end-plate with α-BTX (Alexa488),

showing deposition of MAC (white asterisk in B) on the innervated motor end-plate (white arrow

pointing to NF-H co-localizing with α-BTX) in SOD1G93A

mice, but not in the wildtype mice. Bar= 20µm

deposition on both the motor nerve terminal and the terminal Schwann cells (White arrow in B and D

respectively), but no CD59 deposition in controls.

Supl. Fig. 6. Representative confocal microscopy images of the motor end-plate from wildtype (n = 4)

(A) and SOD1G93A

mice (n = 4) at 47 (B), immunostained for neurofilament NF-H (white arrow head in

A and B), MAC with C5b9 (white asterisk in B) and the muscle end-plate with α-BTX (Alexa488),

showing deposition of MAC (white asterisk in B) on the innervated motor end-plate (white arrow

pointing to NF-H co-localizing with α-BTX) in SOD1G93A

mice, but not in the wildtype mice. Bar= 20µm

Ineke van Kleef-Peters. Gelukkig is de laatste jaren de bekendheid van ALS bij het

publiek zeer sterk toegenomen. Door de velen acties en campagnes van o.a.

Stichting ALS Nederland, kennen de meeste mensen de ziekte nu wel. Ook heeft

sociale media, o.a. Facebook en diverse Forumsites er aan bijgedragen dat

lotgenoten elkaar gevonden hebben, informatie en tips delen, maar vooral elkaar

steunen door dik en dun. Helaas altijd met het verdrietige moment als er weer een

lotgenoot is overleden of heeft gekozen voor levensbeëindiging omdat de periode

aan het einde van een ALS patiënt vaak ondragelijk is.

Zelf heb ik (nu 51 jaar) 3 jaar de diagnose. Mijn broer (nu 52 jaar) leeft nu 9 jaar met

ALS.

Het Nichtje (nu 66 jaar) leeft nu 7 jaar met ALS. Hoewel ieder persoon met ALS

anders is en het verloop zeer moeilijk te voorspellen is blijven wij kracht vinden in het

motto: “Niet kijken naar wat niet meer lukt maar kijken wat wij nog wel kunnen”. Voor

ons een manier om toch positief te blijven.


Complement component C6 inhibition decreases neurological



Nawal Bahia El Idrissi1, Kees Fluiter1, Fernando G. Vieira2 and Frank Baas1 Annals

of neurodegenerative disorders, 2016 October.

1Department of Genome Analysis, Academic Medical Center, Amsterdam, 1105 AZ, The

Netherlands and 2 ALS Therapy Development Institute, 300 Technology Square, Cambridge,

MA 02139, USA

Ineke van Kleef-Peters. Gelukkig is de laatste jaren de bekendheid van ALS bij het

publiek zeer sterk toegenomen. Door de velen acties en campagnes van o.a.

Stichting ALS Nederland, kennen de meeste mensen de ziekte nu wel. Ook heeft

sociale media, o.a. Facebook en diverse Forumsites er aan bijgedragen dat

lotgenoten elkaar gevonden hebben, informatie en tips delen, maar vooral elkaar

steunen door dik en dun. Helaas altijd met het verdrietige moment als er weer een

lotgenoot is overleden of heeft gekozen voor levensbeëindiging omdat de periode

aan het einde van een ALS patiënt vaak ondragelijk is.

Zelf heb ik (nu 51 jaar) 3 jaar de diagnose. Mijn broer (nu 52 jaar) leeft nu 9 jaar met

ALS.

Het Nichtje (nu 66 jaar) leeft nu 7 jaar met ALS. Hoewel ieder persoon met ALS

anders is en het verloop zeer moeilijk te voorspellen is blijven wij kracht vinden in het

motto: “Niet kijken naar wat niet meer lukt maar kijken wat wij nog wel kunnen”. Voor

ons een manier om toch positief te blijven.


Complement component C6 inhibition decreases neurological



Nawal Bahia El Idrissi1, Kees Fluiter1, Fernando G. Vieira2 and Frank Baas1 Annals

of neurodegenerative disorders, 2016 October.

1Department of Genome Analysis, Academic Medical Center, Amsterdam, 1105 AZ, The

Netherlands and 2 ALS Therapy Development Institute, 300 Technology Square, Cambridge,

MA 02139, USA

7

Chapter 7

212

Abstract

Introduction. Amyotrophic lateral sclerosis (ALS) is a rapidly progressive motor

neuron disease. Activated complement products including the membrane attack

complex (MAC) are found in serum, cerebrospinal fluid, spinal cord, motor cortex and

at the neuromuscular junction of SOD1G93A mice and ALS patients. Inhibiting

membrane attack complex (MAC) formation facilitates axonal regeneration and

recovery. Therefore we tested whether inhibition of MAC formation affects the

disease progression in the SOD1G93A mouse model of familial ALS.

Methods. Female (n=32) and male (n=32) SOD1G93A mice were dosed

subcutaneously with either a complement factor 6 (C6) RNA antagonist (C6-ODN) or

Phosphate Buffered Saline (PBS). Treatment started at day 50 and the experiment

was terminated at day 180. Male SOD1G93A mice have 10-fold higher levels of C6

compared to female SOD1G93A mice. Mice were continuously treated with 1mg/kg/day

of C6 ODN using an osmotic minipump. The weight, onset, survival and neurological

severity scores were assessed.

Results. Female SOD1G93A mice treated with C6 ODN showed a lower neurological

severity score compared to the vehicle controls (p=0.002). The male SOD1G93A

transgenic mice, who had high endogenous expression of C6, the disease onset,

survival and neurological severity in the C6 ODN treated group progressed in the

same manner as the vehicle control (p=0.826, p=0.891 and p=>0.998 respectively).

Combined, the male and female C6 ODN treated SOD1G93A mice together

progressed in a manner that was not significantly different from the vehicle control

animals (p=0.20).

Conclusion. In general this data shows that C6 ODN treatment in female SOD1G93A

mice who already have low endogenous levels of C6 shows reduced neurological

severity and a trend towards delayed onset of disease.

Keywords: Amyotrophic lateral sclerosis, Complement factor C6, antisense oligonucleotide,

SOD1G93A

mouse

7

C6 inhibition in the SOD1G93A mouse

213

Abstract

Introduction. Amyotrophic lateral sclerosis (ALS) is a rapidly progressive motor

neuron disease. Activated complement products including the membrane attack

complex (MAC) are found in serum, cerebrospinal fluid, spinal cord, motor cortex and

at the neuromuscular junction of SOD1G93A mice and ALS patients. Inhibiting

membrane attack complex (MAC) formation facilitates axonal regeneration and

recovery. Therefore we tested whether inhibition of MAC formation affects the

disease progression in the SOD1G93A mouse model of familial ALS.

Methods. Female (n=32) and male (n=32) SOD1G93A mice were dosed

subcutaneously with either a complement factor 6 (C6) RNA antagonist (C6-ODN) or

Phosphate Buffered Saline (PBS). Treatment started at day 50 and the experiment

was terminated at day 180. Male SOD1G93A mice have 10-fold higher levels of C6

compared to female SOD1G93A mice. Mice were continuously treated with 1mg/kg/day

of C6 ODN using an osmotic minipump. The weight, onset, survival and neurological

severity scores were assessed.

Results. Female SOD1G93A mice treated with C6 ODN showed a lower neurological

severity score compared to the vehicle controls (p=0.002). The male SOD1G93A

transgenic mice, who had high endogenous expression of C6, the disease onset,

survival and neurological severity in the C6 ODN treated group progressed in the

same manner as the vehicle control (p=0.826, p=0.891 and p=>0.998 respectively).

Combined, the male and female C6 ODN treated SOD1G93A mice together

progressed in a manner that was not significantly different from the vehicle control

animals (p=0.20).

Conclusion. In general this data shows that C6 ODN treatment in female SOD1G93A

mice who already have low endogenous levels of C6 shows reduced neurological

severity and a trend towards delayed onset of disease.

Keywords: Amyotrophic lateral sclerosis, Complement factor C6, antisense oligonucleotide,

SOD1G93A

mouse

Chapter 7

214

Introduction

Amyotrophic lateral sclerosis (ALS) is a fatal neurodegenerative disorder

characterized by a progressive loss of both upper and lower motor neurons, but the

fundamental processes that lead to the death of neurons are also not fully

understood [1].

Studies have established an earlier role for the adaptive and innate immune systems

in the onset and progression of ALS [2-6].

The complement system, a key component of innate immunity, helps the body to kill

pathogens and remove dead cells after physiological turnover or injury [7, 8].

Complement activation and amplification occurs on the outside of the target cell. The

processes starts by the binding of molecules of the classical, alternative, or lectin

pathways [9]. The classical pathway targets antigen-antibody complexes, viruses,

gram negative bacteria and apoptotic cells [7]. The mannose-binding lectin pathway

binds polysaccharide and destroys pathogens. The alternative pathway gets

activated by spontaneous hydrolysis of Complement component 3 (C3) and plays an

important role in the immune surveillance of tumors. All the three pathways merge

into a final common pathway and results in the formation of the membrane attack

complex (MAC), a pore forming conformation, which consists of C5b, C6, C7, C8,

and a number of C9 molecules [10]. Because of the capacity of complement to cause

harm to self tissue, activation of the pathways is tightly controlled by regulators.

These regulators permit elimination of pathogens or dead cells without injuring the

host. When this balance is disrupted, complement activation causes injury and

contributes to pathology in various diseases.

We have shown that the MAC damages axons in an acute peripheral nerve crush

model, [11] the natural regulator, CD59, of the MAC protects axons from early

degeneration [12]. This neuroprotective effect can also be achieved with inhibitors of

complement activation. It has also been established that administration of

complement inhibitory therapeutics accelerates nerve regeneration and functional

recovery [13]. Activation of complement resulting in the formation of the MAC is a key

determinant of post-traumatic neuroaxonal loss in the CNS, as demonstrated by

studies of traumatic CNS injury in man [14, 15] and animal models [16-18]. In

addition, complement activation has been linked to the pathogenesis of a number of

neurodegenerative diseases including Alzheimer’s disease, Parkinson’s disease and

multiple sclerosis [19].

A role for complement in the pathogenesis of ALS in man is also suggested by the

presence of complement activation products, including C3c, C3d, C4d and C3dg, in

spinal cord and motor cortex, and in elevated concentrations in serum and CSF [20-

23].

mRNA and protein levels of the classical pathway of C (C1q and C4) and

downstream components (C3 and MAC) are elevated in spinal cord and motor cortex

of patients with sporadic ALS [6]. In murine ALS models, C1q and C4 are

upregulated in motor neurons [24, 25], whereas C3 is upregulated in the anterior

horn areas containing motor neuron degeneration [26]. In addition, we showed that

complement is activated at the neuromuscular junction of the SOD1G93A mouse

model of familial ALS at pre-symptomatic stage and before axonal damage is

detected, suggesting that complement activation precedes neurodegeneration of

synapses in this model [27]. In post-mortem intercostal muscle of ALS patients we

7


215

Introduction

Amyotrophic lateral sclerosis (ALS) is a fatal neurodegenerative disorder

characterized by a progressive loss of both upper and lower motor neurons, but the

fundamental processes that lead to the death of neurons are also not fully

understood [1].

Studies have established an earlier role for the adaptive and innate immune systems

in the onset and progression of ALS [2-6].

The complement system, a key component of innate immunity, helps the body to kill

pathogens and remove dead cells after physiological turnover or injury [7, 8].

Complement activation and amplification occurs on the outside of the target cell. The

processes starts by the binding of molecules of the classical, alternative, or lectin

pathways [9]. The classical pathway targets antigen-antibody complexes, viruses,

gram negative bacteria and apoptotic cells [7]. The mannose-binding lectin pathway

binds polysaccharide and destroys pathogens. The alternative pathway gets

activated by spontaneous hydrolysis of Complement component 3 (C3) and plays an

important role in the immune surveillance of tumors. All the three pathways merge

into a final common pathway and results in the formation of the membrane attack

complex (MAC), a pore forming conformation, which consists of C5b, C6, C7, C8,

and a number of C9 molecules [10]. Because of the capacity of complement to cause

harm to self tissue, activation of the pathways is tightly controlled by regulators.

These regulators permit elimination of pathogens or dead cells without injuring the

host. When this balance is disrupted, complement activation causes injury and

contributes to pathology in various diseases.

We have shown that the MAC damages axons in an acute peripheral nerve crush

model, [11] the natural regulator, CD59, of the MAC protects axons from early

degeneration [12]. This neuroprotective effect can also be achieved with inhibitors of

complement activation. It has also been established that administration of

complement inhibitory therapeutics accelerates nerve regeneration and functional

recovery [13]. Activation of complement resulting in the formation of the MAC is a key

determinant of post-traumatic neuroaxonal loss in the CNS, as demonstrated by

studies of traumatic CNS injury in man [14, 15] and animal models [16-18]. In

addition, complement activation has been linked to the pathogenesis of a number of

neurodegenerative diseases including Alzheimer’s disease, Parkinson’s disease and

multiple sclerosis [19].

A role for complement in the pathogenesis of ALS in man is also suggested by the

presence of complement activation products, including C3c, C3d, C4d and C3dg, in

spinal cord and motor cortex, and in elevated concentrations in serum and CSF [20-

23].

mRNA and protein levels of the classical pathway of C (C1q and C4) and

downstream components (C3 and MAC) are elevated in spinal cord and motor cortex

of patients with sporadic ALS [6]. In murine ALS models, C1q and C4 are

upregulated in motor neurons [24, 25], whereas C3 is upregulated in the anterior

horn areas containing motor neuron degeneration [26]. In addition, we showed that

complement is activated at the neuromuscular junction of the SOD1G93A mouse

model of familial ALS at pre-symptomatic stage and before axonal damage is

detected, suggesting that complement activation precedes neurodegeneration of

synapses in this model [27]. In post-mortem intercostal muscle of ALS patients we

Chapter 7

216

also showed complement deposited at the neuromuscular junctions before they were

lost, suggesting an early role for complement in the disease [28].

These data suggest that activation of the complement system occurs early in the

disease process and persists while disease progresses. In this way it is could be a

continuous source of neuroinflammation. Like in other neurological diseases we

propose that MAC is involved in causing secondary damage driving the progressive

loss of motor neuron function. Therefore, we used a Locked Nucleic Acid (LNA)

modified oligonucleotide that uses antisense principles to target the mRNA of C6 (C6

ODN), one of the proteins necessary to form the MAC. Here, we tested whether

targeting complement C6 and thus inhibiting MAC formation results in a delay of

disease progression in a murine model of familial ALS. We expected to find a delay in

the disease progression and a lower neurological severity score in the C6 ODN

treated SOD1G93A mice compared to the controls.

Material and Methods

Mice

All the animal experiments were carried out by ALS Therapy Development Institute

(ALSTDI) after prior approval from ALSTDI Institutional Animal Care and Use

Committee and in accordance with approved institutional protocol.

Female and male SOD1G93A mice (strain name B6SJL-Tg (SOD1-G93A)) were

obtained from The Jackson Laboratory (‘JAX’, Bar Harbor, Maine) and bred by JAX.

This mixed hybrid SOD1G93A colony was kept by breeding a B6/SJLTg (SOD1G93A)

male to B6/SJL F1 female mice. To check for presence of the copynumber of the

transgene in the progeny, tail biopsies were collected by the breeder from 14-day-old

pups, then PCR-genotyped (according to JAX copy number protocol) [29].

Transgenic mice are shipped at age 35–45 days, allowing at least a week to

acclimatize to the facility (a 12-h light/ dark cycle).

C6 antisense oligonucleotide synthesis

The C6 Locked Nucleic Acid (LNA) oligonucleotides were synthesized with

phosphorothioate backbones and 5-methyl cytosine residues (medC) by Ribotask

(Odense, Denmark) on a Mermade 12™, using 2g NittoPhase™ (BioAutomation). All

oligonucleotides were HPLC purified (> 90%). C6 oligonucleotide (C6 ODN): 5’A A C

t t g c t g g g A A T 3’ LNA in capital letters and DNA in lowercase.

7


217

also showed complement deposited at the neuromuscular junctions before they were

lost, suggesting an early role for complement in the disease [28].

These data suggest that activation of the complement system occurs early in the

disease process and persists while disease progresses. In this way it is could be a

continuous source of neuroinflammation. Like in other neurological diseases we

propose that MAC is involved in causing secondary damage driving the progressive

loss of motor neuron function. Therefore, we used a Locked Nucleic Acid (LNA)

modified oligonucleotide that uses antisense principles to target the mRNA of C6 (C6

ODN), one of the proteins necessary to form the MAC. Here, we tested whether

targeting complement C6 and thus inhibiting MAC formation results in a delay of

disease progression in a murine model of familial ALS. We expected to find a delay in

the disease progression and a lower neurological severity score in the C6 ODN

treated SOD1G93A mice compared to the controls.

Material and Methods

Mice

All the animal experiments were carried out by ALS Therapy Development Institute

(ALSTDI) after prior approval from ALSTDI Institutional Animal Care and Use

Committee and in accordance with approved institutional protocol.

Female and male SOD1G93A mice (strain name B6SJL-Tg (SOD1-G93A)) were

obtained from The Jackson Laboratory (‘JAX’, Bar Harbor, Maine) and bred by JAX.

This mixed hybrid SOD1G93A colony was kept by breeding a B6/SJLTg (SOD1G93A)

male to B6/SJL F1 female mice. To check for presence of the copynumber of the

transgene in the progeny, tail biopsies were collected by the breeder from 14-day-old

pups, then PCR-genotyped (according to JAX copy number protocol) [29].

Transgenic mice are shipped at age 35–45 days, allowing at least a week to

acclimatize to the facility (a 12-h light/ dark cycle).

C6 antisense oligonucleotide synthesis

The C6 Locked Nucleic Acid (LNA) oligonucleotides were synthesized with

phosphorothioate backbones and 5-methyl cytosine residues (medC) by Ribotask

(Odense, Denmark) on a Mermade 12™, using 2g NittoPhase™ (BioAutomation). All

oligonucleotides were HPLC purified (> 90%). C6 oligonucleotide (C6 ODN): 5’A A C

t t g c t g g g A A T 3’ LNA in capital letters and DNA in lowercase.

Chapter 7

218

Dose testing and qPCR for C6

Firstly, we tested the affective dose for downregulating C6 mRNA in male and female

SOD1G93A mice. Male and female SOD1G93A mice were dosed subcutaneously using

Alzet osmotic mini pumps (the pump doses 0.11 µl per hour for 28 days) (model

1004; DURECT Corporation, Cupertino, CA 95014) with either 1mg/kg, 2mg/kg,

3mg/kg of C6 ODN or Phosphate Buffered Saline (PBS) for 28 days (each group n=3

per gender/dose of treatment). qPCR for C6 was performed on the liver to determine

the amount of C6 inhibition by the drugs. RNA from the liver of C6 LNA-DNA -

wingmer treated mice or controls was isolated using Trizol according to the






LightCycler software (Roche Diagnostics). Values were normalized to the

housekeeping gene Hypoxanthine-guanine phosphoribosyltransferase (HPRT-

forward 5’ GGTCCATTCCTATGACTGTAGATTTT; HPRT-reverse 5’-


qPCR conditions were as standard recommended by the manufacturer (Roche).

Effect of C6 treatment on blood parameters

In addition to the liver for qPCR (previous paragraph) also blood samples were

collected from each mouse in ethylene diamine tetra-acetic acid (EDTA) tubes. The

concentration of red blood cells (RBC), Hemoglobin (Hb), Hematocrit (HCT) and

Mean Corpus Volume (MCV) and other parameters in the blood were measured

using the Sysmex XE-5000 Automated Hematology System (SYSMEX AMERICA,

INC.) according to manufacturer procedure.

Experimental design

Secondly, we tested in another experiment whether inhibition of C6 in female and

male SODG93A slowed the progression of the disease. The design of the SODG93A

experiment was previously described by Scott et al. 2008 [29]. Briefly, mice are

separated into treatment and vehicle cohorts at age day 45. To ensure minimal

variability between cohorts, each cohort is defined by the following constraints:

balanced for gender, males (n=32) and females (n=32); age-matched; littermate

matched. Littermates are defined as offspring of the same non-transgenic dam and

transgenic sire, born on the same day. Specifically, each male (and female) in the

treatment group has a littermate brother (and sister, respectively) in vehicle group;

bodyweight balanced. The weights of each mouse are recorded at day 50; the

average weight is determined for males and females separately.

This study was performed blinded. Treatment with 1 mg/kg/day of C6 ODN started at

day 50, when the animals did not yet exhibit any sign of motor dysfunction

(presymptomatic stage). However, at is this stage, complement deposition is already

detected at the neuromuscular junctions of the SODG93A mice [27]. Administration of

the drugs was performed subcutaneous by osmotic minipumps. Each mouse was

weighed and neurological score of both hind legs were assessed daily during this

study. The neurological score employed a scale of 0 to 4 that was developed by

observation at ALSTDI [29], with 0 representing normal, 1 representing mild defect, 2

7


219

Dose testing and qPCR for C6

Firstly, we tested the affective dose for downregulating C6 mRNA in male and female

SOD1G93A mice. Male and female SOD1G93A mice were dosed subcutaneously using

Alzet osmotic mini pumps (the pump doses 0.11 µl per hour for 28 days) (model

1004; DURECT Corporation, Cupertino, CA 95014) with either 1mg/kg, 2mg/kg,

3mg/kg of C6 ODN or Phosphate Buffered Saline (PBS) for 28 days (each group n=3

per gender/dose of treatment). qPCR for C6 was performed on the liver to determine

the amount of C6 inhibition by the drugs. RNA from the liver of C6 LNA-DNA -

wingmer treated mice or controls was isolated using Trizol according to the






LightCycler software (Roche Diagnostics). Values were normalized to the

housekeeping gene Hypoxanthine-guanine phosphoribosyltransferase (HPRT-

forward 5’ GGTCCATTCCTATGACTGTAGATTTT; HPRT-reverse 5’-


qPCR conditions were as standard recommended by the manufacturer (Roche).

Effect of C6 treatment on blood parameters

In addition to the liver for qPCR (previous paragraph) also blood samples were

collected from each mouse in ethylene diamine tetra-acetic acid (EDTA) tubes. The

concentration of red blood cells (RBC), Hemoglobin (Hb), Hematocrit (HCT) and

Mean Corpus Volume (MCV) and other parameters in the blood were measured

using the Sysmex XE-5000 Automated Hematology System (SYSMEX AMERICA,

INC.) according to manufacturer procedure.

Experimental design

Secondly, we tested in another experiment whether inhibition of C6 in female and

male SODG93A slowed the progression of the disease. The design of the SODG93A

experiment was previously described by Scott et al. 2008 [29]. Briefly, mice are

separated into treatment and vehicle cohorts at age day 45. To ensure minimal

variability between cohorts, each cohort is defined by the following constraints:

balanced for gender, males (n=32) and females (n=32); age-matched; littermate

matched. Littermates are defined as offspring of the same non-transgenic dam and

transgenic sire, born on the same day. Specifically, each male (and female) in the

treatment group has a littermate brother (and sister, respectively) in vehicle group;

bodyweight balanced. The weights of each mouse are recorded at day 50; the

average weight is determined for males and females separately.

This study was performed blinded. Treatment with 1 mg/kg/day of C6 ODN started at

day 50, when the animals did not yet exhibit any sign of motor dysfunction

(presymptomatic stage). However, at is this stage, complement deposition is already

detected at the neuromuscular junctions of the SODG93A mice [27]. Administration of

the drugs was performed subcutaneous by osmotic minipumps. Each mouse was

weighed and neurological score of both hind legs were assessed daily during this

study. The neurological score employed a scale of 0 to 4 that was developed by

observation at ALSTDI [29], with 0 representing normal, 1 representing mild defect, 2

Chapter 7

220

moderate, 3 strong and 4 paralysis of hind limb. Date and cause of death are

recorded for each mouse. To determine ‘survival’ reliably and humanely, an artificial

endpoint is used, defined by the inability of a mouse to right itself in 30 seconds after

being placed on its side. The moribund mice are scored as ‘Died of ALS’, and are

euthanized.


All data were analyzed using SPSS statistics 23 package (SPSS Inc, Chicago, USA)

for Windows. The data is presented as the standard deviation of the mean. Kaplan-

Meier survival and onset curves were compared using the log rank test. For the

longitudinal analysis of repeated measurements of clinical scores in time the non-

linear mixed model analyses was used. For comparison of more than two groups

One way ANOVA with Bonferroni multiple comparison post hoc test was used.

Significance was determined as p < 0.05.

Results

Dose testing

We first tested the effect of escalating doses of the C6 ODN on blood parameters

and C6 mRNA levels in the SOD1G93A mice. In the SODG93A strain used, the female

mice have 10 times lower C6 levels than males and at the same dose, they are thus

more effectively depleted of C6 as compared to male mice. Eight-10 weeks old male

and female SOD1G93A mice (before disease onset) were dosed subcutaneously using

Alzet osmotic mini pumps (the pump doses 0.11 µl per hour for 28 days) with either 1

mg/kg/day, 2 mg/kg/day or 3 mg/kg/day of C6 ODN and the controls were dosed with

PBS for 28 days. The effect of treatment on C6 mRNA levels in liver was analyzed by

qPCR.

This showed that 1mg/kg/day of C6 ODN treatment results in more than 70%

reduction of C6 in the female SOD1G93A mice (Mean vehicle control 0.099 standard

deviation 0.021 versus mean 1mg/kg/day C6 treatment 0.034 standard deviation

0.012] (Figure 1A) and only 30% reduction in male SOD1G93A mice (Mean vehicle

control 1.159 standard deviation 0.329 versus mean 1mg/kg/day C6 treatment 0.795

standard deviation 0.208] (Figure 1B).

Treatment with 2mg/kg/day of C6 ODN treatment resulted in almost a complete

knock down of C6 in female SOD1G93A mice (Mean vehicle control 0.099 standard

deviation 0.021 versus mean 2 mg/kg/day C6 treatment 0.014 standard deviation

0.007] (Figure 1A) and more than 80% reduction of C6 in male SOD1G93A mice

(Mean vehicle control 1.159 standard deviation 0.329 versus mean 2 mg/kg/day C6

treatment 0.199 standard deviation 0.055] (Figure 1B).

7


221

moderate, 3 strong and 4 paralysis of hind limb. Date and cause of death are

recorded for each mouse. To determine ‘survival’ reliably and humanely, an artificial

endpoint is used, defined by the inability of a mouse to right itself in 30 seconds after

being placed on its side. The moribund mice are scored as ‘Died of ALS’, and are

euthanized.


All data were analyzed using SPSS statistics 23 package (SPSS Inc, Chicago, USA)

for Windows. The data is presented as the standard deviation of the mean. Kaplan-

Meier survival and onset curves were compared using the log rank test. For the

longitudinal analysis of repeated measurements of clinical scores in time the non-

linear mixed model analyses was used. For comparison of more than two groups

One way ANOVA with Bonferroni multiple comparison post hoc test was used.

Significance was determined as p < 0.05.

Results

Dose testing

We first tested the effect of escalating doses of the C6 ODN on blood parameters

and C6 mRNA levels in the SOD1G93A mice. In the SODG93A strain used, the female

mice have 10 times lower C6 levels than males and at the same dose, they are thus

more effectively depleted of C6 as compared to male mice. Eight-10 weeks old male

and female SOD1G93A mice (before disease onset) were dosed subcutaneously using

Alzet osmotic mini pumps (the pump doses 0.11 µl per hour for 28 days) with either 1

mg/kg/day, 2 mg/kg/day or 3 mg/kg/day of C6 ODN and the controls were dosed with

PBS for 28 days. The effect of treatment on C6 mRNA levels in liver was analyzed by

qPCR.

This showed that 1mg/kg/day of C6 ODN treatment results in more than 70%

reduction of C6 in the female SOD1G93A mice (Mean vehicle control 0.099 standard

deviation 0.021 versus mean 1mg/kg/day C6 treatment 0.034 standard deviation

0.012] (Figure 1A) and only 30% reduction in male SOD1G93A mice (Mean vehicle

control 1.159 standard deviation 0.329 versus mean 1mg/kg/day C6 treatment 0.795

standard deviation 0.208] (Figure 1B).

Treatment with 2mg/kg/day of C6 ODN treatment resulted in almost a complete

knock down of C6 in female SOD1G93A mice (Mean vehicle control 0.099 standard

deviation 0.021 versus mean 2 mg/kg/day C6 treatment 0.014 standard deviation

0.007] (Figure 1A) and more than 80% reduction of C6 in male SOD1G93A mice

(Mean vehicle control 1.159 standard deviation 0.329 versus mean 2 mg/kg/day C6

treatment 0.199 standard deviation 0.055] (Figure 1B).

Chapter 7

222

Figure 1. C6 qPCR of SOD1G93A

mice treated with C6 ODN. Female and male SOD1G93A

mice were

subcutaneously treated with either 1mg/kg, 2mg/kg or 3mg/kg of C6 ODN for 28 days to test the

amount of C6 inhibition compared to the controls that were treated with PBS (each group n=3). After

treatment the liver was analyzed for C6 levels by qPCR. C6 mRNA levels in male SOD1G93A

mice were

found to be 10 folds higher than female SOD1G93A

mice (note the x-axis). The results show that (A)

1mg/kg/day of C6 ODN results in more than 70% reduction of C6 in the female SOD1G93A

mice, (B)

while in the male SOD1G93A

mice 2mg/kg of C6 ODN results in a reduction of more than 80%. Error

bar indicates standard deviation of the mean.

We also tested the effect of C6 ODN treatment on blood parameters. A details

analysis of blood parameters showed that concentrations of 3 mg/kg/day of treatment

lowered the count of red blood cells (RBC) (mean PBS 9.27 M/µl standard deviation

0.36 versus mean C6 treated 7.2 M/µl standard deviation 0.5; p<0.0001] (Figure 2A),

hemoglobin (Hb) (mean PBS 12.4 g/dL standard deviation 0.7 versus mean C6

treated 9.4 g/dL standard deviation 0.5; p<0.0001] (Figure 2B), hematocrit (HCT)

(mean PBS 43.1% standard deviation 3.2 versus mean C6 treated 33.8 % standard

deviation 2.6; p=0.0003] (Figure 2C) in the C6 antagonist treated SOD1G93A mice

compared to the PBS treated control group. The red cell distribution width (RDW) and

neutrophils (NEU) counts were also lower in this group compared to the PBS treated

group (p= 0.0003 and p= 0.0039, respectively) (see table 1). Moreover, the levels of

mean corpuscular hemoglobin (MCH) and Mean corpuscular hemoglobin

concentration (MCHC) were slightly lower in the SOD1G93A mice compared to the

PBS treated control group, but the difference was not statistically significant (p=

0.053 and p=0.056, respectively) (see table 1). In contrast, the percentage of

lymphocytes increased significantly in the mice that were treated with 3 mg/kg/day of

the C6 ODN compared to the PBS control group (p=0.027). However, the percentage

of The Mean Corpus Volume (MCV) (Figure 2D) and other clinical chemistry

parameters were unaltered (see table 1).

In view of the effect on RBC we decided to start with 1 mg/kg/day of C6 ODN

treatment.

7


223

Figure 1. C6 qPCR of SOD1G93A

mice treated with C6 ODN. Female and male SOD1G93A

mice were

subcutaneously treated with either 1mg/kg, 2mg/kg or 3mg/kg of C6 ODN for 28 days to test the

amount of C6 inhibition compared to the controls that were treated with PBS (each group n=3). After

treatment the liver was analyzed for C6 levels by qPCR. C6 mRNA levels in male SOD1G93A

mice were

found to be 10 folds higher than female SOD1G93A

mice (note the x-axis). The results show that (A)

1mg/kg/day of C6 ODN results in more than 70% reduction of C6 in the female SOD1G93A

mice, (B)

while in the male SOD1G93A

mice 2mg/kg of C6 ODN results in a reduction of more than 80%. Error

bar indicates standard deviation of the mean.

We also tested the effect of C6 ODN treatment on blood parameters. A details

analysis of blood parameters showed that concentrations of 3 mg/kg/day of treatment

lowered the count of red blood cells (RBC) (mean PBS 9.27 M/µl standard deviation

0.36 versus mean C6 treated 7.2 M/µl standard deviation 0.5; p<0.0001] (Figure 2A),

hemoglobin (Hb) (mean PBS 12.4 g/dL standard deviation 0.7 versus mean C6

treated 9.4 g/dL standard deviation 0.5; p<0.0001] (Figure 2B), hematocrit (HCT)

(mean PBS 43.1% standard deviation 3.2 versus mean C6 treated 33.8 % standard

deviation 2.6; p=0.0003] (Figure 2C) in the C6 antagonist treated SOD1G93A mice

compared to the PBS treated control group. The red cell distribution width (RDW) and

neutrophils (NEU) counts were also lower in this group compared to the PBS treated

group (p= 0.0003 and p= 0.0039, respectively) (see table 1). Moreover, the levels of

mean corpuscular hemoglobin (MCH) and Mean corpuscular hemoglobin

concentration (MCHC) were slightly lower in the SOD1G93A mice compared to the

PBS treated control group, but the difference was not statistically significant (p=

0.053 and p=0.056, respectively) (see table 1). In contrast, the percentage of

lymphocytes increased significantly in the mice that were treated with 3 mg/kg/day of

the C6 ODN compared to the PBS control group (p=0.027). However, the percentage

of The Mean Corpus Volume (MCV) (Figure 2D) and other clinical chemistry

parameters were unaltered (see table 1).

In view of the effect on RBC we decided to start with 1 mg/kg/day of C6 ODN

treatment.

Chapter 7

224

Figure 2. Slightly lowered the concentration of red blood cells during treatment with C6 ODN in

SOD1G93A

mice. Treatment of male and female SOD1G93A

mice with 2 or 3 mg/kg/day of C6 ODN

(each group n=6) shows a slightly decrease in the levels of (A) Red blood cells (RBC), (B) Hemoglobin

(Hb), (C) Hematocrit (HCT) and (D) Mean Corpus Volume (MCV) counts compared to vehicle controls.

This effect is not measured in treatment of SOD1G93A

mice with 1 mg/kg/day of C6 ODN. Error bar

indicates standard deviation of the mean.

Tabel 1. Blood parameters of C6 ODN (3 mg/kg/day) and PBS treated SOD1G93A

mice.

Parameter Treatment N Mean SD SEM P value

Neutrophils (K/uL) PBS 6 1,66 0,30 0,12

Neutrophils (K/uL) C6 antagonist 6 1,06 0,25 0,10 0,0039

Lymfocytes (%) PBS 6 77,99 4,61 1,88

Lymfocytes (%) C6 antagonist 6 83,69 2,85 1,16 0,0277

Neutrophils (%) PBS 6 16,45 5,60 2,29

Neutrophils (%) C6 antagonist 6 10,74 2,79 1,14 0,0493

Red blood cells (M/uL) PBS 6 9,27 0,36 0,15

Red blood cells (M/uL) C6 antagonist 6 7,20 0,50 0,21 <0.0001

Hemoglobin (g/dL) PBS 6 12,4 0,7 0,3

Hemoglobin (g/dL) C6 antagonist 6 9,4 0,5 0,2 <0.0001

Hematocriet (%) PBS 6 43,1 3,2 1,3

Hematocriet (%) C6 antagonist 6 33,8 2,6 1,1 0,0003

Mean corpuscular hemoglobin (pg) PBS 6 14,6 2,0 0,8

mean corpuscular hemoglobin (pg) C6 antagonist 6 12,7 0,7 0,3 0,0532

Mean corpuscular hemoglobin concentration (g/dL) PBS 6 30,2 4,0 1,6

Mean corpuscular hemoglobin concentration (g/dL) C6 antagonist 6 26,6 1,0 0,4 0,0568

Red cell distribution width (%) PBS 6 18,0 0,3 0,1

red cell distribution width (%) C6 antagonist 6 16,7 0,5 0,2 0,0003

White blood cells (K/uL) PBS 6 10,60 2,11 0,86

White blood cells (K/uL) C6 antagonist 6 10,00 1,51 0,62 0,5843

Lymfocytes (K/uL) PBS 6 8,33 2,08 0,85

Lymfocytes (K/uL) C6 antagonist 6 8,37 1,35 0,55 0,9705

Monocytes (K/uL) PBS 6 0,44 0,13 0,05

Monocytes (K/uL) C6 antagonist 6 0,46 0,13 0,05 0,8781

Eosinophils (K/uL) PBS 6 0,13 0,08 0,03

Eosinophils (K/uL) C6 antagonist 6 0,09 0,04 0,02 0,2607

Basophils (K/uL) PBS 6 0,03 0,03 0,01

Basophils (K/uL) C6 antagonist 6 0,02 0,03 0,01 0,6611

Mean Corpus Volume (fL) PBS 6 114,7 166,7 68,1

Mean Corpus Volume (fL) C6 antagonist 6 46,9 1,4 0,6 0,3428

Platelets (K/uL) PBS 6 960 185 76

Platelets (K/uL) C6 antagonist 6 922 255 104 0,7718

Mean platelet volume (fL) PBS 6 5,0 0,3 0,1

Mean platelet volume (fL) C6 antagonist 6 4,8 0,4 0,2 0,3923

7


225

Figure 2. Slightly lowered the concentration of red blood cells during treatment with C6 ODN in

SOD1G93A

mice. Treatment of male and female SOD1G93A

mice with 2 or 3 mg/kg/day of C6 ODN

(each group n=6) shows a slightly decrease in the levels of (A) Red blood cells (RBC), (B) Hemoglobin

(Hb), (C) Hematocrit (HCT) and (D) Mean Corpus Volume (MCV) counts compared to vehicle controls.

This effect is not measured in treatment of SOD1G93A

mice with 1 mg/kg/day of C6 ODN. Error bar

indicates standard deviation of the mean.

Tabel 1. Blood parameters of C6 ODN (3 mg/kg/day) and PBS treated SOD1G93A

mice.

Parameter Treatment N Mean SD SEM P value

Neutrophils (K/uL) PBS 6 1,66 0,30 0,12

Neutrophils (K/uL) C6 antagonist 6 1,06 0,25 0,10 0,0039

Lymfocytes (%) PBS 6 77,99 4,61 1,88

Lymfocytes (%) C6 antagonist 6 83,69 2,85 1,16 0,0277

Neutrophils (%) PBS 6 16,45 5,60 2,29

Neutrophils (%) C6 antagonist 6 10,74 2,79 1,14 0,0493

Red blood cells (M/uL) PBS 6 9,27 0,36 0,15

Red blood cells (M/uL) C6 antagonist 6 7,20 0,50 0,21 <0.0001

Hemoglobin (g/dL) PBS 6 12,4 0,7 0,3

Hemoglobin (g/dL) C6 antagonist 6 9,4 0,5 0,2 <0.0001

Hematocriet (%) PBS 6 43,1 3,2 1,3

Hematocriet (%) C6 antagonist 6 33,8 2,6 1,1 0,0003

Mean corpuscular hemoglobin (pg) PBS 6 14,6 2,0 0,8

mean corpuscular hemoglobin (pg) C6 antagonist 6 12,7 0,7 0,3 0,0532

Mean corpuscular hemoglobin concentration (g/dL) PBS 6 30,2 4,0 1,6

Mean corpuscular hemoglobin concentration (g/dL) C6 antagonist 6 26,6 1,0 0,4 0,0568

Red cell distribution width (%) PBS 6 18,0 0,3 0,1

red cell distribution width (%) C6 antagonist 6 16,7 0,5 0,2 0,0003

White blood cells (K/uL) PBS 6 10,60 2,11 0,86

White blood cells (K/uL) C6 antagonist 6 10,00 1,51 0,62 0,5843

Lymfocytes (K/uL) PBS 6 8,33 2,08 0,85

Lymfocytes (K/uL) C6 antagonist 6 8,37 1,35 0,55 0,9705

Monocytes (K/uL) PBS 6 0,44 0,13 0,05

Monocytes (K/uL) C6 antagonist 6 0,46 0,13 0,05 0,8781

Eosinophils (K/uL) PBS 6 0,13 0,08 0,03

Eosinophils (K/uL) C6 antagonist 6 0,09 0,04 0,02 0,2607

Basophils (K/uL) PBS 6 0,03 0,03 0,01

Basophils (K/uL) C6 antagonist 6 0,02 0,03 0,01 0,6611

Mean Corpus Volume (fL) PBS 6 114,7 166,7 68,1

Mean Corpus Volume (fL) C6 antagonist 6 46,9 1,4 0,6 0,3428

Platelets (K/uL) PBS 6 960 185 76

Platelets (K/uL) C6 antagonist 6 922 255 104 0,7718

Mean platelet volume (fL) PBS 6 5,0 0,3 0,1

Mean platelet volume (fL) C6 antagonist 6 4,8 0,4 0,2 0,3923

Chapter 7

226

The effect of C6 inhibition on onset of the disease and survival in in female

SODG93A mice

The aim of the treatment with the C6 ODN is to knock down mouse C6 mRNA and

protein and reduce functional membrane attack complex (MAC) activity. To test

whether MAC is a potential target for treatment of familial ALS we tested our C6 ODN

in the murine SOD1G93A model. C6 ODN treated female (n=16) and male (n=16)

SODG93A mice were compared to PBS treated female (n=16) and male (n=16)

SODG93A mice. All SOD1G93A mice were sex and litter matched and screened for

SOD-1 copy number before entering the study. C6 ODN was administrated starting at

day 50 after birth and was dosed subcutaneously until death using Alzet osmotic

minipumps at a 1 mg/kg/day dose. We analysed the onset and survival of female and

male SODG93A mice during treatment with C6 ODN and compared this to SODG93A

mice treated with PBS.

We show no statistically significant effects on median onset or survival in either

female or male C6 ODN treated SODG93A mice compared to vehicle controls. Female

SODG93A mice treated with PBS on average have an onset of the disease around day

110 and all the animals die from disease around day 130 (Figure 3A). Although the

onset and survival curve of the C6 ODN treated female SODG93A mice showed a

different disease progression compared to the controls (Figure 3 A and B), there

were no statistical difference in onset and survival (Kaplan-Meier log rank test

p=0.169 and p= 0.354 respectively). Also in the male SODG93A mice treated with

1mg/kg/day of C6 ODN, no significant effect on the onset and survival was observed

compared to the vehicle controls (Kaplan-Meier log rank test p=0.826 and p=0.891

respectively) (Figure 4 A, B).

Figure 3. Later onset and extension of survival time in female SOD1G93A

mice following C6 ODN

treatment. Female SOD1G93A

mice were subcutaneously dosed starting from day 50 with either PBS

(red) or C6 ODN with 1mg/kg/day (blue). (A) Seven out of the 12 C6 ODN treated female SOD1G93A

had a later onset of the disease compared to PBS treated controls. (B) Three out of the 16 C6 ODN-

treated female SOD1G93A

mice died earlier compared the vehicle group and 7 out of the 16 mice

survived longer compared to PBS treated controls. The differences in onset and survival between the

C6 ODN treated females SOD1G93A

mice and vehicle controls were not significantly different by

Kaplan-Meier log rank test (p=0.169 and p=0.354, respectively).

7


227

The effect of C6 inhibition on onset of the disease and survival in in female

SODG93A mice

The aim of the treatment with the C6 ODN is to knock down mouse C6 mRNA and

protein and reduce functional membrane attack complex (MAC) activity. To test

whether MAC is a potential target for treatment of familial ALS we tested our C6 ODN

in the murine SOD1G93A model. C6 ODN treated female (n=16) and male (n=16)

SODG93A mice were compared to PBS treated female (n=16) and male (n=16)

SODG93A mice. All SOD1G93A mice were sex and litter matched and screened for

SOD-1 copy number before entering the study. C6 ODN was administrated starting at

day 50 after birth and was dosed subcutaneously until death using Alzet osmotic

minipumps at a 1 mg/kg/day dose. We analysed the onset and survival of female and

male SODG93A mice during treatment with C6 ODN and compared this to SODG93A

mice treated with PBS.

We show no statistically significant effects on median onset or survival in either

female or male C6 ODN treated SODG93A mice compared to vehicle controls. Female

SODG93A mice treated with PBS on average have an onset of the disease around day

110 and all the animals die from disease around day 130 (Figure 3A). Although the

onset and survival curve of the C6 ODN treated female SODG93A mice showed a

different disease progression compared to the controls (Figure 3 A and B), there

were no statistical difference in onset and survival (Kaplan-Meier log rank test

p=0.169 and p= 0.354 respectively). Also in the male SODG93A mice treated with

1mg/kg/day of C6 ODN, no significant effect on the onset and survival was observed

compared to the vehicle controls (Kaplan-Meier log rank test p=0.826 and p=0.891

respectively) (Figure 4 A, B).

Figure 3. Later onset and extension of survival time in female SOD1G93A


treatment. Female SOD1G93A


(red) or C6 ODN with 1mg/kg/day (blue). (A) Seven out of the 12 C6 ODN treated female SOD1G93A

had a later onset of the disease compared to PBS treated controls. (B) Three out of the 16 C6 ODN-

treated female SOD1G93A

mice died earlier compared the vehicle group and 7 out of the 16 mice

survived longer compared to PBS treated controls. The differences in onset and survival between the

C6 ODN treated females SOD1G93A

mice and vehicle controls were not significantly different by


Chapter 7

228

Figure 4. No effect on the onset and survival time in male SOD1G93A


treatment. Male SOD1G93A


(red) or C6 ODN with 1mg/kg/day (blue). No difference was observed in the proportion at onset (A)

and the fraction of survival (B) of the male C6 ODN-treated animals compared to the controls by


C6 inhibition delays progression of disease in female SODG93A mice as

measured by neurological score

The body weight of the C6 ODN and control treated SOD1G93A mice was measured

every day together with the neurological score. At the end-stage of the disease (day

120) the vehicle control mice dropped in weight (mean= 0.8 gram) while the treated

female SOD1G93A mice that were still alive maintained their body weight (Supplement

Figure 1A). In contrast, male treated SOD1G93A mice showed a decrease in body

weight similar to control (Supplement Figure 1B).

The neurological score of female and male SODG93A mice treated with C6 ODN or

PBS was assessed daily on a scale of 0 to 4, with 0 being normal and 4 being

completely paralyzed of both hind legs. C6 ODN treated female SODG93A mice,

progressed in a manner that was slower than vehicle controls (p=0.002) (Figure 5A).

Together with the maintained body weight this suggests that these mice were

performing better than the vehicle controls. However, C6 ODN-treated male

SODG93A mice did not progress differently from the vehicle controls (p=0.997), as also

observed for the body weight of these mice (Figure 5B).

7


229

Figure 4. No effect on the onset and survival time in male SOD1G93A


treatment. Male SOD1G93A


(red) or C6 ODN with 1mg/kg/day (blue). No difference was observed in the proportion at onset (A)

and the fraction of survival (B) of the male C6 ODN-treated animals compared to the controls by


C6 inhibition delays progression of disease in female SODG93A mice as

measured by neurological score

The body weight of the C6 ODN and control treated SOD1G93A mice was measured

every day together with the neurological score. At the end-stage of the disease (day

120) the vehicle control mice dropped in weight (mean= 0.8 gram) while the treated

female SOD1G93A mice that were still alive maintained their body weight (Supplement

Figure 1A). In contrast, male treated SOD1G93A mice showed a decrease in body

weight similar to control (Supplement Figure 1B).

The neurological score of female and male SODG93A mice treated with C6 ODN or

PBS was assessed daily on a scale of 0 to 4, with 0 being normal and 4 being

completely paralyzed of both hind legs. C6 ODN treated female SODG93A mice,

progressed in a manner that was slower than vehicle controls (p=0.002) (Figure 5A).

Together with the maintained body weight this suggests that these mice were

performing better than the vehicle controls. However, C6 ODN-treated male

SODG93A mice did not progress differently from the vehicle controls (p=0.997), as also

observed for the body weight of these mice (Figure 5B).

Chapter 7

230

Figure 5. Reduction of the neurological disability in female SODG93A


treatment. The neurological score of female (A) and male (B) SODG93A

mice treated with C6 ODN or

PBS was assessed daily from day 50 onwards on a scale of 0 to 4, with 0 being normal and 4 being

completely paralyzed of both hind legs. (A)The neurological disability decreased significantly in female

SODG93A

treated with C6 ODN compared to the PBS treated controls (p=0.002). (B) No effect in the

neurological disability was observed in the male SODG93A

mice treated with C6 ODN compared to the

PBS treated controls (p=0.997).

Discussion

Components of the innate immune system have been implicated in the pathogenesis

of ALS. Especially, complement activation has long been implicated in the

pathogenesis of ALS, with numerous clinical and animal studies demonstrating

strong complement factor up-regulation, including C1q and C3, in regions of motor

neuron death [30]. We recently showed complement components C1q, C3 and MAC

deposited on motor endplates of SOD1G93A mice before appearance of clinical

symptoms, suggesting that complement activation might play an early role in the

disease [27]. In addition, we showed C1q and MAC deposition on the motor

endplates of ALS patients before denervation, suggesting that complement plays an

early role in ALS patients [28]. Recently, the terminal MAC has been shown to

activate inflammasome NLRP3 in macrophages and thereby activate caspase 1 and

promote the release of IL1-b and IL-18. This process is suggested to induce

inflammatory immune responses that may contribute to damage in disease [31].

To analyze the role of the terminal pathway in the disease, we tested whether

inhibition of the terminal pathway using C6 antisense oligonucleotides, which

downregulates C6 and prevents formation of MAC has an effect on the survival and

neurological disabilities in the SOD1G93A mouse model of familial ALS. Our dose

finding study in the SOD1G93A transgenic mice showed a marginal effect of the ODN

on the levels of red blood cells, hemoglobin, hematocrit, red cell distribution width

and neutrophils after treatment with a higher dose than 1 mg/kg/day of C6 mRNA

antagonist. Long term toxicity is an important issue in this types of studies, therefore,

to avoid introduction of confounding factors, we have treated animals with a low dose

of 1mg/kg/day. Animals have to be doses for a long period, starting at day 50. Since

the expression of C6 mRNA is much lower in female than male SOD1G93A mice, we

7


231

Figure 5. Reduction of the neurological disability in female SODG93A


treatment. The neurological score of female (A) and male (B) SODG93A

mice treated with C6 ODN or

PBS was assessed daily from day 50 onwards on a scale of 0 to 4, with 0 being normal and 4 being

completely paralyzed of both hind legs. (A)The neurological disability decreased significantly in female

SODG93A

treated with C6 ODN compared to the PBS treated controls (p=0.002). (B) No effect in the

neurological disability was observed in the male SODG93A

mice treated with C6 ODN compared to the

PBS treated controls (p=0.997).

Discussion

Components of the innate immune system have been implicated in the pathogenesis

of ALS. Especially, complement activation has long been implicated in the

pathogenesis of ALS, with numerous clinical and animal studies demonstrating

strong complement factor up-regulation, including C1q and C3, in regions of motor

neuron death [30]. We recently showed complement components C1q, C3 and MAC

deposited on motor endplates of SOD1G93A mice before appearance of clinical

symptoms, suggesting that complement activation might play an early role in the

disease [27]. In addition, we showed C1q and MAC deposition on the motor

endplates of ALS patients before denervation, suggesting that complement plays an

early role in ALS patients [28]. Recently, the terminal MAC has been shown to

activate inflammasome NLRP3 in macrophages and thereby activate caspase 1 and

promote the release of IL1-b and IL-18. This process is suggested to induce

inflammatory immune responses that may contribute to damage in disease [31].

To analyze the role of the terminal pathway in the disease, we tested whether

inhibition of the terminal pathway using C6 antisense oligonucleotides, which

downregulates C6 and prevents formation of MAC has an effect on the survival and

neurological disabilities in the SOD1G93A mouse model of familial ALS. Our dose

finding study in the SOD1G93A transgenic mice showed a marginal effect of the ODN

on the levels of red blood cells, hemoglobin, hematocrit, red cell distribution width

and neutrophils after treatment with a higher dose than 1 mg/kg/day of C6 mRNA

antagonist. Long term toxicity is an important issue in this types of studies, therefore,

to avoid introduction of confounding factors, we have treated animals with a low dose

of 1mg/kg/day. Animals have to be doses for a long period, starting at day 50. Since

the expression of C6 mRNA is much lower in female than male SOD1G93A mice, we

Chapter 7

232

anticipated on a specific effect in females. Therefore, we compared males and

females at the lowest dose (1 mg/kg/day) expecting so see an effect if any in females

and not in males.

We detected changes in body weight, onset, survival and neurological disability

between the treated female SOD1G93A mice when compared to vehicle controls.

Although only a significant difference was found for the neurological disability, there

seems to be a trend that the female SOD1G93A mice perform better than the vehicle

controls. In the male mice, the C6 ODN treated male SOD1G93A mice behaved similar

to vehicle treated animals. No trend or significant difference was observed in body

weight, onset, survival and neurological disability.

Although a role for complement has been suggested in ALS, its contribution to

disease progression in animal models for ALS is controversial. Previously, Lobsiger

et al. demonstrated that SOD-1 transgenic mice deficient in complement components

C1q and C3 do not have extended survival, concluding that the upstream

complement components do not affect overall disease in familial ALS [32]. Another

study showed that suppressing complement-mediated inflammation in SOD1G93A ALS

rats, either by treating with a selective complement C5a receptor (CD88) antagonist

or by analyzing CD88-deleted SOD1G93A mice extends survival [26]. This data

suggests that if there is a role for complement in ALS, there might be an important

role for the terminal pathway of the complement system. The terminal complement

pathway can get activated in absence of C1q and C3 via the “extrinsic pathway,”

which can bypass the traditional upstream activation pathways that rely on

complement factor C3 [33]. In addition, C3a and C5a has shown to be locally

produced by antigen presenting cells and T cells facilitating T cell activation and

cytokine production, showing that complement can also be locally produced [34].

We show that female C6 ODN -treated mice maintained a body weight when

considering group average body weight over time. At the end-stage of the disease

(day120) the vehicle control mice dropped in weight while the treated mice that were

still alive maintained their body weight, suggesting an effect of the treatment on the

body weight in the female SOD1G93A mice.

Seven out of the 12 C6 ODN treated female SOD1G93A had a later onset of the

disease compared to vehicle controls. Some treated females survived longer than the

vehicle treated animals. However, three female mice died earlier than expected. This

was not observed in males that were treated with 1mg/kg/day of C6 ODN. We have

no explanation for the early death of the 3 females.

Neurological score progression, showed that C6 ODN treated SOD1G93A female

animals progressed slower than their PBS treated controls. Although, this effects

were not observed in male SOD1G93A our data suggests that treatment with 1

mg/kg/day continuously infused subcutaneous C6 ODN, had an effect on female

SOD1G93A mice. The difference in outcome of the disease between male and female

SOD1G93A mice might be explained by the ten-fold difference in C6 levels in the male

SOD1G93A mice compared to females. Therefore, we suggest that a higher

concentration of C6 ODN might have an effect on the outcome of the disease in male

SOD1G93A mice.

7


233

anticipated on a specific effect in females. Therefore, we compared males and

females at the lowest dose (1 mg/kg/day) expecting so see an effect if any in females

and not in males.

We detected changes in body weight, onset, survival and neurological disability

between the treated female SOD1G93A mice when compared to vehicle controls.

Although only a significant difference was found for the neurological disability, there

seems to be a trend that the female SOD1G93A mice perform better than the vehicle

controls. In the male mice, the C6 ODN treated male SOD1G93A mice behaved similar

to vehicle treated animals. No trend or significant difference was observed in body

weight, onset, survival and neurological disability.

Although a role for complement has been suggested in ALS, its contribution to

disease progression in animal models for ALS is controversial. Previously, Lobsiger

et al. demonstrated that SOD-1 transgenic mice deficient in complement components

C1q and C3 do not have extended survival, concluding that the upstream

complement components do not affect overall disease in familial ALS [32]. Another

study showed that suppressing complement-mediated inflammation in SOD1G93A ALS

rats, either by treating with a selective complement C5a receptor (CD88) antagonist

or by analyzing CD88-deleted SOD1G93A mice extends survival [26]. This data

suggests that if there is a role for complement in ALS, there might be an important

role for the terminal pathway of the complement system. The terminal complement

pathway can get activated in absence of C1q and C3 via the “extrinsic pathway,”

which can bypass the traditional upstream activation pathways that rely on

complement factor C3 [33]. In addition, C3a and C5a has shown to be locally

produced by antigen presenting cells and T cells facilitating T cell activation and

cytokine production, showing that complement can also be locally produced [34].

We show that female C6 ODN -treated mice maintained a body weight when

considering group average body weight over time. At the end-stage of the disease

(day120) the vehicle control mice dropped in weight while the treated mice that were

still alive maintained their body weight, suggesting an effect of the treatment on the

body weight in the female SOD1G93A mice.

Seven out of the 12 C6 ODN treated female SOD1G93A had a later onset of the

disease compared to vehicle controls. Some treated females survived longer than the

vehicle treated animals. However, three female mice died earlier than expected. This

was not observed in males that were treated with 1mg/kg/day of C6 ODN. We have

no explanation for the early death of the 3 females.

Neurological score progression, showed that C6 ODN treated SOD1G93A female

animals progressed slower than their PBS treated controls. Although, this effects

were not observed in male SOD1G93A our data suggests that treatment with 1

mg/kg/day continuously infused subcutaneous C6 ODN, had an effect on female

SOD1G93A mice. The difference in outcome of the disease between male and female

SOD1G93A mice might be explained by the ten-fold difference in C6 levels in the male

SOD1G93A mice compared to females. Therefore, we suggest that a higher

concentration of C6 ODN might have an effect on the outcome of the disease in male

SOD1G93A mice.

Chapter 7

234

Conclusions

Overall, we show that the current treatment regimen resulted in differences in female

treated SOD1G93A mice compared to controls but did not significantly improve the

timing of disease onset, the rate of neurological disease progression, or extend

survival in males.

This study suggests that complement inhibition in female SOD G93A mice might

reduce disease severity, based on the results of the female SOD1G93A mice. The lack

of effects in male SOD1G93A mice prevents us to convincingly show that the

hypothesis is correct. Further investigations on the role of C6 in familial ALS disease

progression with a higher dose of the C6 inhibitor are needed.

Acknowledgements

We thank Prof. A.H. Zwinderman from the Clinical Methods & Public Health department of the

Academic Medical Center Amsterdam for the support on the statistical analysis of the data.

Funding acknowledgements

We thank the Netherlands Organization for Scientific Research (NWO) for supporting this work. NWO

Mozaiek grant to NBEI [grant number 017.009.026].

Conflict of Interest

FB and KF are founders of Regenesance BV and are listed as inventors on patents owned by

Regensence BV regarding C6 inhibition for clinical applications.

References

1. Rothstein JD. Current hypotheses for the underlying biology of amyotrophic lateral sclerosis. Ann Neurol 2009 Jan;65 Suppl 1:S3-S9.

2. Engelhardt JI, Tajti J, Appel SH. Lymphocytic infiltrates in the spinal cord in amyotrophic lateral sclerosis. Arch Neurol 1993 Jan;50(1):30-6.

3. McGeer PL, McGeer EG. Inflammatory processes in amyotrophic lateral sclerosis. Muscle Nerve 2002 Oct;26(4):459-70.

4. Chiu IM, Phatnani H, Kuligowski M, et al. Activation of innate and humoral immunity in the peripheral nervous system of ALS transgenic mice. Proc Natl Acad Sci U S A 2009 Dec 8;106(49):20960-5.

5. Dibaj P, Steffens H, Zschuntzsch J, et al. In Vivo imaging reveals distinct inflammatory activity of CNS microglia versus PNS macrophages in a mouse model for ALS. PLoS One 2011;6(3):e17910.

6. Sta M, Sylva-Steenland RM, Casula M, et al. Innate and adaptive immunity in amyotrophic lateral sclerosis: evidence of complement activation. Neurobiol Dis 2011 Jun;42(3):211-20.



9. Kemper C, Atkinson JP. T-cell regulation: with complements from innate immunity. Nat Rev Immunol 2007 Jan;7(1):9-18.

10. Cole DS, Morgan BP. Beyond lysis: how complement influences cell fate. Clin Sci (Lond) 2003 May;104(5):455-66.




14. Stahel PF, Morganti-Kossmann MC, Perez D, et al. Intrathecal levels of complement-derived soluble membrane attack complex (sC5b-9) correlate with blood-brain barrier dysfunction in patients with traumatic brain injury. J Neurotrauma 2001 Aug;18(8):773-81.

15. Kossmann T, Stahel PF, Morganti-Kossmann MC, Jones JL, Barnum SR. Elevated levels of the complement components C3 and factor B in ventricular cerebrospinal fluid of patients with traumatic brain injury. J Neuroimmunol 1997 Mar;73(1-2):63-9.


17. Rancan M, Morganti-Kossmann MC, Barnum SR, et al. Central nervous system-targeted complement inhibition mediates neuroprotection after closed head injury in transgenic mice. J Cereb Blood Flow Metab 2003 Sep;23(9):1070-4.

7


235

Conclusions

Overall, we show that the current treatment regimen resulted in differences in female

treated SOD1G93A mice compared to controls but did not significantly improve the

timing of disease onset, the rate of neurological disease progression, or extend

survival in males.

This study suggests that complement inhibition in female SOD G93A mice might

reduce disease severity, based on the results of the female SOD1G93A mice. The lack

of effects in male SOD1G93A mice prevents us to convincingly show that the

hypothesis is correct. Further investigations on the role of C6 in familial ALS disease

progression with a higher dose of the C6 inhibitor are needed.

Acknowledgements

We thank Prof. A.H. Zwinderman from the Clinical Methods & Public Health department of the

Academic Medical Center Amsterdam for the support on the statistical analysis of the data.

Funding acknowledgements

We thank the Netherlands Organization for Scientific Research (NWO) for supporting this work. NWO

Mozaiek grant to NBEI [grant number 017.009.026].

Conflict of Interest

FB and KF are founders of Regenesance BV and are listed as inventors on patents owned by

Regensence BV regarding C6 inhibition for clinical applications.

References

1. Rothstein JD. Current hypotheses for the underlying biology of amyotrophic lateral sclerosis. Ann Neurol 2009 Jan;65 Suppl 1:S3-S9.

2. Engelhardt JI, Tajti J, Appel SH. Lymphocytic infiltrates in the spinal cord in amyotrophic lateral sclerosis. Arch Neurol 1993 Jan;50(1):30-6.

3. McGeer PL, McGeer EG. Inflammatory processes in amyotrophic lateral sclerosis. Muscle Nerve 2002 Oct;26(4):459-70.

4. Chiu IM, Phatnani H, Kuligowski M, et al. Activation of innate and humoral immunity in the peripheral nervous system of ALS transgenic mice. Proc Natl Acad Sci U S A 2009 Dec 8;106(49):20960-5.

5. Dibaj P, Steffens H, Zschuntzsch J, et al. In Vivo imaging reveals distinct inflammatory activity of CNS microglia versus PNS macrophages in a mouse model for ALS. PLoS One 2011;6(3):e17910.





10. Cole DS, Morgan BP. Beyond lysis: how complement influences cell fate. Clin Sci (Lond) 2003 May;104(5):455-66.




14. Stahel PF, Morganti-Kossmann MC, Perez D, et al. Intrathecal levels of complement-derived soluble membrane attack complex (sC5b-9) correlate with blood-brain barrier dysfunction in patients with traumatic brain injury. J Neurotrauma 2001 Aug;18(8):773-81.

15. Kossmann T, Stahel PF, Morganti-Kossmann MC, Jones JL, Barnum SR. Elevated levels of the complement components C3 and factor B in ventricular cerebrospinal fluid of patients with traumatic brain injury. J Neuroimmunol 1997 Mar;73(1-2):63-9.


17. Rancan M, Morganti-Kossmann MC, Barnum SR, et al. Central nervous system-targeted complement inhibition mediates neuroprotection after closed head injury in transgenic mice. J Cereb Blood Flow Metab 2003 Sep;23(9):1070-4.

Chapter 7

236

18. Anderson AJ, Robert S, Huang W, Young W, Cotman CW. Activation of complement pathways after contusion-induced spinal cord injury. J Neurotrauma 2004 Dec;21(12):1831-46.

19. Bonifati DM, Kishore U. Role of complement in neurodegeneration and neuroinflammation. Mol Immunol 2007 Feb;44(5):999-1010.

20. Annunziata P, Volpi N. High levels of C3c in the cerebrospinal fluid from amyotrophic lateral sclerosis patients. Acta Neurol Scand 1985 Jul;72(1):61-4.

21. Apostolski S, Nikolic J, Bugarski-Prokopljevic C, Miletic V, Pavlovic S, Filipovic S. Serum and CSF immunological findings in ALS. Acta Neurol Scand 1991 Feb;83(2):96-8.

22. Tsuboi Y, Yamada T. Increased concentration of C4d complement protein in CSF in amyotrophic lateral sclerosis. J Neurol Neurosurg Psychiatry 1994 Jul;57(7):859-61.

23. Goldknopf IL, Sheta EA, Bryson J, et al. Complement C3c and related protein biomarkers in amyotrophic lateral sclerosis and Parkinson's disease. Biochem Biophys Res Commun 2006 Apr 21;342(4):1034-9.

24. Lobsiger CS, Boillee S, Cleveland DW. Toxicity from different SOD1 mutants dysregulates the complement system and the neuronal regenerative response in ALS motor neurons. Proc Natl Acad Sci U S A 2007 May 1;104(18):7319-26.

25. Ferraiuolo L, Heath PR, Holden H, Kasher P, Kirby J, Shaw PJ. Microarray analysis of the cellular pathways involved in the adaptation to and progression of motor neuron injury in the SOD1 G93A mouse model of familial ALS. J Neurosci 2007 Aug 22;27(34):9201-19.

26. Woodruff TM, Costantini KJ, Crane JW, et al. The complement factor C5a contributes to pathology in a rat model of amyotrophic lateral sclerosis. J Immunol 2008 Dec 15;181(12):8727-34.

27. Heurich B, El Idrissi NB, Donev RM, et al. Complement upregulation and activation on motor neurons and neuromuscular junction in the SOD1 G93A mouse model of familial amyotrophic lateral sclerosis. J Neuroimmunol 2011 Jun;235(1-2):104-9.

28. Bahia E, I, Bosch S, Ramaglia V, Aronica E, Baas F, Troost D. Complement activation at the motor end-plates in amyotrophic lateral sclerosis. J Neuroinflammation 2016;13(1):72.

29. Scott S, Kranz JE, Cole J, et al. Design, power, and interpretation of studies in the standard murine model of ALS. Amyotroph Lateral Scler 2008;9(1):4-15.



32. Lobsiger CS, Boillee S, Pozniak C, et al. C1q induction and global complement pathway activation do not contribute to ALS toxicity in mutant SOD1 mice. Proc Natl Acad Sci U S A 2013 Nov 12;110(46):E4385-E4392.

33. Huber-Lang M, Sarma JV, Zetoune FS, et al. Generation of C5a in the absence of C3: a new complement activation pathway. Nat Med 2006 Jun;12(6):682-7.

34. Strainic MG, Liu J, Huang D, et al. Locally produced complement fragments C5a and C3a provide both costimulatory and survival signals to naive CD4+ T cells. Immunity 2008 Mar;28(3):425-35.

SUPPLEMENTARY FIGURE

Supplement Figure 1. Body weight maintained in the C6 ODN treated female SOD1G93A

mice.

Bodyweight of female (A) and male (B) SOD1G93A

mice treated subcutaneously with PBS (red) or 1

mg/kg/day C6 ODN (blue) was daily measured starting from day 50, showing that (A) female C6 ODN

-treated animals maintain the body weight considering group average body weight over time, but gain

weight at the end-stage of the disease. The vehicle control female mice drop weight at the end-stage

of the disease. (B) No difference was observed in bodyweight of the male C6 ODN -treated animals

compared to the controls.

7


237

18. Anderson AJ, Robert S, Huang W, Young W, Cotman CW. Activation of complement pathways after contusion-induced spinal cord injury. J Neurotrauma 2004 Dec;21(12):1831-46.


20. Annunziata P, Volpi N. High levels of C3c in the cerebrospinal fluid from amyotrophic lateral sclerosis patients. Acta Neurol Scand 1985 Jul;72(1):61-4.

21. Apostolski S, Nikolic J, Bugarski-Prokopljevic C, Miletic V, Pavlovic S, Filipovic S. Serum and CSF immunological findings in ALS. Acta Neurol Scand 1991 Feb;83(2):96-8.

22. Tsuboi Y, Yamada T. Increased concentration of C4d complement protein in CSF in amyotrophic lateral sclerosis. J Neurol Neurosurg Psychiatry 1994 Jul;57(7):859-61.

23. Goldknopf IL, Sheta EA, Bryson J, et al. Complement C3c and related protein biomarkers in amyotrophic lateral sclerosis and Parkinson's disease. Biochem Biophys Res Commun 2006 Apr 21;342(4):1034-9.





28. Bahia E, I, Bosch S, Ramaglia V, Aronica E, Baas F, Troost D. Complement activation at the motor end-plates in amyotrophic lateral sclerosis. J Neuroinflammation 2016;13(1):72.

29. Scott S, Kranz JE, Cole J, et al. Design, power, and interpretation of studies in the standard murine model of ALS. Amyotroph Lateral Scler 2008;9(1):4-15.



32. Lobsiger CS, Boillee S, Pozniak C, et al. C1q induction and global complement pathway activation do not contribute to ALS toxicity in mutant SOD1 mice. Proc Natl Acad Sci U S A 2013 Nov 12;110(46):E4385-E4392.

33. Huber-Lang M, Sarma JV, Zetoune FS, et al. Generation of C5a in the absence of C3: a new complement activation pathway. Nat Med 2006 Jun;12(6):682-7.

34. Strainic MG, Liu J, Huang D, et al. Locally produced complement fragments C5a and C3a provide both costimulatory and survival signals to naive CD4+ T cells. Immunity 2008 Mar;28(3):425-35.

SUPPLEMENTARY FIGURE

Supplement Figure 1. Body weight maintained in the C6 ODN treated female SOD1G93A

mice.

Bodyweight of female (A) and male (B) SOD1G93A

mice treated subcutaneously with PBS (red) or 1

mg/kg/day C6 ODN (blue) was daily measured starting from day 50, showing that (A) female C6 ODN

-treated animals maintain the body weight considering group average body weight over time, but gain

weight at the end-stage of the disease. The vehicle control female mice drop weight at the end-stage

of the disease. (B) No difference was observed in bodyweight of the male C6 ODN -treated animals

compared to the controls.

Discussion & Summary

Neuroinflammation caused by complement effects inherited and acquired

disease progression


Neuroinflammation caused by complement effects inherited and acquired

disease progression

8

Chapter 8

240


Neurodegeneration is a key aspect of a large number of diseases including;

Parkinson’s disease, Alzheimer, Amyotrophic lateral sclerosis and many more.

Although these are different diseases, they have a common feature; immune

activation and inflammation. Immune activation has physiological roles and maintains

homeostatis in the body. But unbalanced or uncontrolled activation of the immune

system may result in inflammation and pathology in different neurodegenerative

diseases.

Mechanisms underlying neuroinflammation have been a focus of research in the past

decades. Emerging evidence indicates that neuroinflammation is caused by a local

immune response and contributes to neurodegeneration. Neuroinflammation is of

interest because it might contribute to neuronal dysfunction, loss of neurons and

axons in neurodegenerative diseases due to the production of neurotoxic mediators.

A better understanding of the interaction of the inflammatory components of the

immune system with damaged or stressed tissue is crucial to determine the beneficial

effects for therapeutic strategies. A major unanswered question is whether

pharmacological inhibition of inflammatory components or inflammation pathways is

able to slow down the course of disease in man.

Both the innate and adaptive immune response are involved in neurodegeneration.

Pattern Recognition Receptors (PRRs) are an important part of the immune system.

Cells of the innate immune system express these receptors, which recognize

pathogen-associated molecular patterns (PAMPs) from pathogens or danger-

associated molecular patterns (DAMPs) from damaged or stressed tissue.

After injury or disease PRRs can trigger cells to develop an immune responses by

sensing PAMPs or DAMPs in the environment. Toll like receptors (TLRs) are

important PRRs involved in triggering the innate immune response. This leads to the

activation of transcription factor NFkb, the expression of pro-inflammatory genes,

increased levels of the inflammatory cytokines, and consequently activation of the

adaptive immune response.

The recognition of PAMPs and DAMPs include the detection of altered self cells and

discrimination from non-self that is not dangerous and pathogens [1]. When this

discrimination between dangerous signals and non- harmful signals is not made this

leads to autoimmunity.

The complement system has been regarded as a key player in adaptive immunity [2].

It is a bridge between de innate and adaptive immune response. It consists of soluble

and membrane associated proteins, that get activated via three pathways whereby

one protein promotes the sequential binding of the following protein [3]. Regardless

of the trigger, activation results in the cleavage of C3, followed by cleavage of C5 and

formation of the membrane attack complex (MAC), which forms pores in the cell

membrane resulting in lysis of the target cell. The complement system plays an

important role in the defense against pathogens by identifying, opsonizing and lysis

of the infected cells. Activation of the complement system by PAMPs induces C3

and C5 cleavage and generates anaphylatoxins C3a and C5a as well as the opsonin

C3b [4]. Different phagocytic cells take up opsonized pathogens and provoke their

lysis by MAC [5] and anaphylatoxins mediate the migration and recruitment of

immune cells to the site of infection, were acute inflammatory reaction is initiated [4,

6].

8


241


Neurodegeneration is a key aspect of a large number of diseases including;

Parkinson’s disease, Alzheimer, Amyotrophic lateral sclerosis and many more.

Although these are different diseases, they have a common feature; immune

activation and inflammation. Immune activation has physiological roles and maintains

homeostatis in the body. But unbalanced or uncontrolled activation of the immune

system may result in inflammation and pathology in different neurodegenerative

diseases.

Mechanisms underlying neuroinflammation have been a focus of research in the past

decades. Emerging evidence indicates that neuroinflammation is caused by a local

immune response and contributes to neurodegeneration. Neuroinflammation is of

interest because it might contribute to neuronal dysfunction, loss of neurons and

axons in neurodegenerative diseases due to the production of neurotoxic mediators.

A better understanding of the interaction of the inflammatory components of the

immune system with damaged or stressed tissue is crucial to determine the beneficial

effects for therapeutic strategies. A major unanswered question is whether

pharmacological inhibition of inflammatory components or inflammation pathways is

able to slow down the course of disease in man.

Both the innate and adaptive immune response are involved in neurodegeneration.

Pattern Recognition Receptors (PRRs) are an important part of the immune system.

Cells of the innate immune system express these receptors, which recognize

pathogen-associated molecular patterns (PAMPs) from pathogens or danger-

associated molecular patterns (DAMPs) from damaged or stressed tissue.

After injury or disease PRRs can trigger cells to develop an immune responses by

sensing PAMPs or DAMPs in the environment. Toll like receptors (TLRs) are

important PRRs involved in triggering the innate immune response. This leads to the

activation of transcription factor NFkb, the expression of pro-inflammatory genes,

increased levels of the inflammatory cytokines, and consequently activation of the

adaptive immune response.

The recognition of PAMPs and DAMPs include the detection of altered self cells and

discrimination from non-self that is not dangerous and pathogens [1]. When this

discrimination between dangerous signals and non- harmful signals is not made this

leads to autoimmunity.

The complement system has been regarded as a key player in adaptive immunity [2].

It is a bridge between de innate and adaptive immune response. It consists of soluble

and membrane associated proteins, that get activated via three pathways whereby

one protein promotes the sequential binding of the following protein [3]. Regardless

of the trigger, activation results in the cleavage of C3, followed by cleavage of C5 and

formation of the membrane attack complex (MAC), which forms pores in the cell

membrane resulting in lysis of the target cell. The complement system plays an

important role in the defense against pathogens by identifying, opsonizing and lysis

of the infected cells. Activation of the complement system by PAMPs induces C3

and C5 cleavage and generates anaphylatoxins C3a and C5a as well as the opsonin

C3b [4]. Different phagocytic cells take up opsonized pathogens and provoke their

lysis by MAC [5] and anaphylatoxins mediate the migration and recruitment of

immune cells to the site of infection, were acute inflammatory reaction is initiated [4,

6].

Chapter 8

242

Humans deficiencies of complement components can result in a wide range of

diseases [7, 8]. Deficiencies in the classical pathway components C1 and C4 are

associated with an increased incidence of immune complex disease and recurrent

bacterial infection. A common immune complex disease is systemic lupus

erythematosus (SLE) [9]. Complement deficiency in this case leads to the failure to

clear circulating immune complexes. Consecutively this leads to the deposition of the

complexes in tissues and an associated inflammatory response. Deficiencies for C2

are also associated with frequent bacterial infection and an increased risk of

cardiovascular disease. In addition, deficiencies in complement component C3

results in problems with the coating of pathogenic cells with opsonin to promote

phagocytosis. This deficiency can lead to severe recurrent infections, such as sepsis

early in life. On the other hand deficiencies of the components of the terminal

complement pathway (C5-C9) result in less serious infections and have a better

prognosis.

Complement also plays an important role in synapse remodeling during development,

showing a direct link between nerve elimination and complement. Activated

complement components are soluble and can drift from their site of activation to

adjacent areas, MAC can damage adjacent healthy tissue and enhance inflammation

[5, 10], thereby resulting in more tissue damage. We have shown that formation of

the MAC contributes to early clearance of myelin proteins and to axonal damage after

traumatic injury of the peripheral nerve, while inhibition of MAC formation reduces

nerve damage and improves regeneration and functional recovery [11-13]. Activation

of the complement system occurs early in the disease process and persists while

disease progresses. Regulators of the complement system permit elimination of

pathogens or dead cells without injuring the host. When this balance is disrupted,

complement activation causes injury to the host and contributes to pathology in

various diseases [14-16]. In this way complement can be a continuous source of

neuroinflammation.

Complement proteins are abundantly present in most neurodegenerative diseases

and can have pathological roles in neurological conditions offers broad scope for

therapeutic intervention. Our hypothesis is that MAC may play an important role in

nerve damage and that inhibition of MAC, using a C6 antisence/ RNA antagonist, is

protective. In this thesis I describe research in which we tested whether this is the

case in an animal model of M.leprae induced nerve damage and in the SOD1G93A

mouse model of Amyotrophic lateral sclerosis.

MAC contributes to pathology in a model of M. leprae induced nerve damage

Nerve damage in leprosy is widely regarded as an important problem in patients,

persisting long after the patients have completed treatment [17]. However, the nerve

damage should be regarded as an early sign of leprosy, because the loss of

sensation in patients with suspected leprosy is considered the hall mark of early

disease [18]. Despite advances in our knowledge of the pathogenesis of leprosy

spectrum, the understanding of the mechanisms of nerve damage in leprosy-

associated neuropathy remains poor. Progress has been limited by the lack of

established experimental models for studying leprosy-induced neuropathy. Here we

used a mouse model of M .leprae-induced nerve damage to test whether inhibition of

MAC using an C6 antisense/ RNA antagonist is protective.

8


243

Humans deficiencies of complement components can result in a wide range of

diseases [7, 8]. Deficiencies in the classical pathway components C1 and C4 are

associated with an increased incidence of immune complex disease and recurrent

bacterial infection. A common immune complex disease is systemic lupus

erythematosus (SLE) [9]. Complement deficiency in this case leads to the failure to

clear circulating immune complexes. Consecutively this leads to the deposition of the

complexes in tissues and an associated inflammatory response. Deficiencies for C2

are also associated with frequent bacterial infection and an increased risk of

cardiovascular disease. In addition, deficiencies in complement component C3

results in problems with the coating of pathogenic cells with opsonin to promote

phagocytosis. This deficiency can lead to severe recurrent infections, such as sepsis

early in life. On the other hand deficiencies of the components of the terminal

complement pathway (C5-C9) result in less serious infections and have a better

prognosis.

Complement also plays an important role in synapse remodeling during development,

showing a direct link between nerve elimination and complement. Activated

complement components are soluble and can drift from their site of activation to

adjacent areas, MAC can damage adjacent healthy tissue and enhance inflammation

[5, 10], thereby resulting in more tissue damage. We have shown that formation of

the MAC contributes to early clearance of myelin proteins and to axonal damage after

traumatic injury of the peripheral nerve, while inhibition of MAC formation reduces

nerve damage and improves regeneration and functional recovery [11-13]. Activation

of the complement system occurs early in the disease process and persists while

disease progresses. Regulators of the complement system permit elimination of

pathogens or dead cells without injuring the host. When this balance is disrupted,

complement activation causes injury to the host and contributes to pathology in

various diseases [14-16]. In this way complement can be a continuous source of

neuroinflammation.

Complement proteins are abundantly present in most neurodegenerative diseases

and can have pathological roles in neurological conditions offers broad scope for

therapeutic intervention. Our hypothesis is that MAC may play an important role in

nerve damage and that inhibition of MAC, using a C6 antisence/ RNA antagonist, is

protective. In this thesis I describe research in which we tested whether this is the

case in an animal model of M.leprae induced nerve damage and in the SOD1G93A

mouse model of Amyotrophic lateral sclerosis.

MAC contributes to pathology in a model of M. leprae induced nerve damage

Nerve damage in leprosy is widely regarded as an important problem in patients,

persisting long after the patients have completed treatment [17]. However, the nerve

damage should be regarded as an early sign of leprosy, because the loss of

sensation in patients with suspected leprosy is considered the hall mark of early

disease [18]. Despite advances in our knowledge of the pathogenesis of leprosy

spectrum, the understanding of the mechanisms of nerve damage in leprosy-

associated neuropathy remains poor. Progress has been limited by the lack of

established experimental models for studying leprosy-induced neuropathy. Here we

used a mouse model of M .leprae-induced nerve damage to test whether inhibition of

MAC using an C6 antisense/ RNA antagonist is protective.

Chapter 8

244

Previous studies showed that loss of myelin proteins can be induced by M. leprae in

the absence of lymphocytes in Rag knockout mice [19]. These data suggest the


(PAM) causing the initial damage. Mannose Binding lectin (MBL) contains

carbohydrate recognition domains. During bacterial infections MBL mediates defence

phagocytosis and extracellular complement activation via the lectin pathway.

In Chapter 2 of this thesis we demonstrated that M.leprae lipoarabinomannan (LAM)

is the most dominant activator of the complement system mainly via MBL/ the lectin

pathway. We suggest that LAM interacts with the nerve and initiates complement

activation resulting in the in situ formation of the MAC, causing nerve damage. In a

model of M.leprae induced nerve damage we show that preventing MAC formation by

antisense oligonucleotide-based therapy protects the nerve from M. leprae-induced

damage, implying a role for the complement pathway in M. leprae associated nerve

damage. Antibodies to mycobacterial antigens, such as lipoarabinomannan (LAM)

are found in leprosy patients, suggesting an immune response to the M.leprae

antigens [20]. Deposits of MAC are detected in thickened cutaneous sensory nerves

of leprosy patients, suggesting a role for MAC in leprosy pathology [21].

We explored the extent of complement deposition, including MAC, in series of nerve

biopsies from patients with full blown leprosy at either of the two poles of the disease

spectrum, showing an association between the amount of MAC deposition and LAM

immunoreactivity in nerves of leprosy patients. LAM persists in lesions of leprosy

patients long after treatment. Antigens from dead bacilli can provoke immunological


disabilities. M. leprae antigens can trigger complement activation. A previous studies

showed the localization of persisting M. leprae antigens in leprosy patients with

nerve damage, even after treatment [22, 23]. In addition, IgG anti-LAM antibody

levels remained stable or increased, while PGL-1 antibodies decreased after

treatment [24]. Both RR and ENL reactions appear to be due to the persistence of

antigens like lipoarabinomannan (LAM) or PGL-I [25]. Altogether, our findings

strongly point to an important role of complement in chronic nerve damage in leprosy.

Terminal Complement Complex elevated In Reactional Leprosy

Leprosy patients can change in clinical and immunohistopathological status during

the course of the disease. This is common for patients during or after treatment, that

could develop a reaction. Previous studies have also indicated an important role for

complement in the disease, showing a normal or increased level of complement

components by serological and pathological studies [26]. Therefore we examined

whether increased systemic levels of complement activation could be detected in

leprosy patients and whether complement products and regulators might be useful

markers of leprosy disease state. In Chapter 3 we show that the activation products

terminal complement complex (TCC), C4d and iC3b were specifically elevated in

Bangladeshi patients with reaction at intake compared to endemic controls. In

addition, levels of the regulator Clusterin were also elevated in MB patients

irrespective of a reaction. Similar analysis of the Ethiopian cohort confirmed that

irrespective of a reaction, serum TCC levels were significantly increased in patients

with reactions compared to patients without reactions. Our data also showed that

TCC levels stayed elevated after treatment, this suggests that treatment with either

MDT or steroids does not lower complement activation in reaction patients,

reinforcing the possibility that complement contributes to the nerve damage in these

8


245

Previous studies showed that loss of myelin proteins can be induced by M. leprae in

the absence of lymphocytes in Rag knockout mice [19]. These data suggest the


(PAM) causing the initial damage. Mannose Binding lectin (MBL) contains

carbohydrate recognition domains. During bacterial infections MBL mediates defence

phagocytosis and extracellular complement activation via the lectin pathway.

In Chapter 2 of this thesis we demonstrated that M.leprae lipoarabinomannan (LAM)

is the most dominant activator of the complement system mainly via MBL/ the lectin

pathway. We suggest that LAM interacts with the nerve and initiates complement

activation resulting in the in situ formation of the MAC, causing nerve damage. In a

model of M.leprae induced nerve damage we show that preventing MAC formation by

antisense oligonucleotide-based therapy protects the nerve from M. leprae-induced

damage, implying a role for the complement pathway in M. leprae associated nerve

damage. Antibodies to mycobacterial antigens, such as lipoarabinomannan (LAM)

are found in leprosy patients, suggesting an immune response to the M.leprae

antigens [20]. Deposits of MAC are detected in thickened cutaneous sensory nerves

of leprosy patients, suggesting a role for MAC in leprosy pathology [21].

We explored the extent of complement deposition, including MAC, in series of nerve

biopsies from patients with full blown leprosy at either of the two poles of the disease

spectrum, showing an association between the amount of MAC deposition and LAM

immunoreactivity in nerves of leprosy patients. LAM persists in lesions of leprosy

patients long after treatment. Antigens from dead bacilli can provoke immunological


disabilities. M. leprae antigens can trigger complement activation. A previous studies

showed the localization of persisting M. leprae antigens in leprosy patients with

nerve damage, even after treatment [22, 23]. In addition, IgG anti-LAM antibody

levels remained stable or increased, while PGL-1 antibodies decreased after

treatment [24]. Both RR and ENL reactions appear to be due to the persistence of

antigens like lipoarabinomannan (LAM) or PGL-I [25]. Altogether, our findings

strongly point to an important role of complement in chronic nerve damage in leprosy.

Terminal Complement Complex elevated In Reactional Leprosy

Leprosy patients can change in clinical and immunohistopathological status during

the course of the disease. This is common for patients during or after treatment, that

could develop a reaction. Previous studies have also indicated an important role for

complement in the disease, showing a normal or increased level of complement

components by serological and pathological studies [26]. Therefore we examined

whether increased systemic levels of complement activation could be detected in

leprosy patients and whether complement products and regulators might be useful

markers of leprosy disease state. In Chapter 3 we show that the activation products

terminal complement complex (TCC), C4d and iC3b were specifically elevated in

Bangladeshi patients with reaction at intake compared to endemic controls. In

addition, levels of the regulator Clusterin were also elevated in MB patients

irrespective of a reaction. Similar analysis of the Ethiopian cohort confirmed that

irrespective of a reaction, serum TCC levels were significantly increased in patients

with reactions compared to patients without reactions. Our data also showed that

TCC levels stayed elevated after treatment, this suggests that treatment with either

MDT or steroids does not lower complement activation in reaction patients,

reinforcing the possibility that complement contributes to the nerve damage in these

Chapter 8

246

patients. These findings imply that the analysis of the complement system might be

of value for the diagnosis and prognosis of leprosy disease status. Unfortunately, the

limitations of this study such as the samples being collected in the field situations and

the lack of EDTA in the serum samples, any elaborate interpretation regarding the

mechanism of high level of TCC in leprosy patients with reaction are not possible at

this stage of the study. The lack of especially EDTA in collection tubes might have

resulted in in vitro generation of TCC which continues in serum. On the other hand,

all the samples studied were processed similarly; therefore, any comparative values

relating the disease state is considered as true reflection. The best way forward

would be a prospective study on complement activation in leprosy, to confirm

conclusively whether circulating complement activation products such as TCC can be

applied as biomarkers for diagnosis of patients at a risk of developing a reaction.

A role for complement C3d on T cell function in leprosy

We demonstrated that M. leprae specific component LAM activates the complement

system and is associated with complement activation in nerves of leprosy patients.

Therefore, we were interested whether LAM deposition is also seen in conjunction

with the complement components C3d and MAC in the skin lesions of leprosy

patients and which cells are positive for complement activation products. This is

important to understand the role for complement in skin lesion pathology of leprosy

patients. In Chapter 4 I describe an analysis of complement and inflammatory cells in

skin lesions of leprosy patients. I demonstrate that C3d, MAC and LAM deposition

was significantly higher in the skin biopsies of multibacillary compared to

paucibacillary, with a significant association between the bacterial index/ LAM and

C3d or MAC in the skin biopsies of leprosy patients. In addition, MAC positivity was

increased in both ENL and RR skin lesions compared to non-reactional leprosy

patients.

Co-stimulation is essential for the development of an effective immune response. It

is well known that paucibacillary leprosy patients have a stronger cell mediated

immune response. For the activation of lymphocytes both antigen specific signal from

their antigen and co-stimulation are required. Co-stimulation for B cells can also be

provided by complement receptors. During an infection complement may be activated

resulting in C3b binding to the pathogens. C3b is degraded into a fragment iC3b or

C3b then cleaved to C3dg, and eventually to C3d. B cells express complement

receptor CR2 or CD21 to bind to C3d. CR2 on mature B cells forms a complex

with CD19 and CD81. This additional co-stimulation by C3d results in B-cell being

more sensitive to the antigens of this pathogen. Interestingly, different studies have

shown that a population of T cells also has a CR2 receptor for C3d binding [27-29]. In

skin lesions of paucibacillary patients we found C3d positive T-cells in and

surrounding granulomas, but hardly any MAC deposition compared to multibacillary

patients. C3d on the T-cells might be involved in co-stimulation by binding CR2 on T-

cells resulting in an enhanced cell mediated immune response in paucibacillary

patients. We considered that C3d might bind to CR2 expressed on the surface of T

cells and, by ligand–receptor interaction, result in T cell stimulation and

enhancement of the adaptive immune response. In this way, C3d might play an

important role in the inflammation in skin lesions of paucibacillary patients. Axons

were hardly detected in skin lesions of paucibacillary patients, probably the nerves

are destroyed.

8


247

patients. These findings imply that the analysis of the complement system might be

of value for the diagnosis and prognosis of leprosy disease status. Unfortunately, the

limitations of this study such as the samples being collected in the field situations and

the lack of EDTA in the serum samples, any elaborate interpretation regarding the

mechanism of high level of TCC in leprosy patients with reaction are not possible at

this stage of the study. The lack of especially EDTA in collection tubes might have

resulted in in vitro generation of TCC which continues in serum. On the other hand,

all the samples studied were processed similarly; therefore, any comparative values

relating the disease state is considered as true reflection. The best way forward

would be a prospective study on complement activation in leprosy, to confirm

conclusively whether circulating complement activation products such as TCC can be

applied as biomarkers for diagnosis of patients at a risk of developing a reaction.

A role for complement C3d on T cell function in leprosy

We demonstrated that M. leprae specific component LAM activates the complement

system and is associated with complement activation in nerves of leprosy patients.

Therefore, we were interested whether LAM deposition is also seen in conjunction

with the complement components C3d and MAC in the skin lesions of leprosy

patients and which cells are positive for complement activation products. This is

important to understand the role for complement in skin lesion pathology of leprosy

patients. In Chapter 4 I describe an analysis of complement and inflammatory cells in

skin lesions of leprosy patients. I demonstrate that C3d, MAC and LAM deposition

was significantly higher in the skin biopsies of multibacillary compared to

paucibacillary, with a significant association between the bacterial index/ LAM and

C3d or MAC in the skin biopsies of leprosy patients. In addition, MAC positivity was

increased in both ENL and RR skin lesions compared to non-reactional leprosy

patients.

Co-stimulation is essential for the development of an effective immune response. It

is well known that paucibacillary leprosy patients have a stronger cell mediated

immune response. For the activation of lymphocytes both antigen specific signal from

their antigen and co-stimulation are required. Co-stimulation for B cells can also be

provided by complement receptors. During an infection complement may be activated

resulting in C3b binding to the pathogens. C3b is degraded into a fragment iC3b or

C3b then cleaved to C3dg, and eventually to C3d. B cells express complement

receptor CR2 or CD21 to bind to C3d. CR2 on mature B cells forms a complex

with CD19 and CD81. This additional co-stimulation by C3d results in B-cell being

more sensitive to the antigens of this pathogen. Interestingly, different studies have

shown that a population of T cells also has a CR2 receptor for C3d binding [27-29]. In

skin lesions of paucibacillary patients we found C3d positive T-cells in and

surrounding granulomas, but hardly any MAC deposition compared to multibacillary

patients. C3d on the T-cells might be involved in co-stimulation by binding CR2 on T-

cells resulting in an enhanced cell mediated immune response in paucibacillary

patients. We considered that C3d might bind to CR2 expressed on the surface of T

cells and, by ligand–receptor interaction, result in T cell stimulation and

enhancement of the adaptive immune response. In this way, C3d might play an

important role in the inflammation in skin lesions of paucibacillary patients. Axons

were hardly detected in skin lesions of paucibacillary patients, probably the nerves

are destroyed.

Chapter 8

248

MAC that was found deposited on the axons and co- localizing with LAM in lesions

of multibacillary patients. This suggests that MAC is attacking the axons in skin

lesions with LAM as a trigger for complement activation.

We conclude that signatures of complement activation are abundantly present in skin

lesions of leprosy patients, even after treatment, suggesting that inflammation

triggered by complement activation might contribute to nerve damage in the lesions

of these patients and that this should be regarded as an important factor in M. leprae

pathology.

In the second part of my thesis I describe work on ALS, a progressive

neurodegenerative disease. ALS was chosen because of the previous work

describing complement activation products in both patients and animal models of this

disease.

Complement is deposited at the presymptomatic stage on motor end-plates of

SOD1G93A mice

Mechanisms leading to the neurodegenerative disease ALS are still unclear. Both cell

autonomous and non-cell autonomous mechanisms are involved in the disease [30-

32]. Different studies suggest an important role for neuroinflammation in the disease

[33-35]. The involvement of complement as an inflammatory component in the

pathogenesis of ALS in man is suggested by different researchers. Elevated levels of

complement activation products in serum and cerebrospinal fluid were detected in

ALS patients. Levels of mRNA for C1q and C4 and protein levels of complement

proteins C1q, C3 and MAC were elevated in spinal cord and motor cortex of patients

with sporadic ALS [36]. In the murine mouse model of ALS C1q and C4 were

upregulated in motor neurons [37, 38]. Other studies have also shown upregulation

of the major proinflammatory C5a receptor, during disease progression in mouse

motor neurons [39]. SOD1G93A rat treated with C5aR antagonist had an extension of

survival time and a reduction in end-stage motor scores compared to the untreated

rats. This data suggests an important role for complement in the progression of ALS

[35]. Also, increased expression of complement components C1qB, C4, factors B,

C3, C5 and a decrease in the expression of the regulators CD55 (regulator of C3)

and CD59a (regulator of MAC) was detected in the lumbar spinal cord of SOD1G93A

8


249

MAC that was found deposited on the axons and co- localizing with LAM in lesions

of multibacillary patients. This suggests that MAC is attacking the axons in skin

lesions with LAM as a trigger for complement activation.

We conclude that signatures of complement activation are abundantly present in skin

lesions of leprosy patients, even after treatment, suggesting that inflammation

triggered by complement activation might contribute to nerve damage in the lesions

of these patients and that this should be regarded as an important factor in M. leprae

pathology.

In the second part of my thesis I describe work on ALS, a progressive

neurodegenerative disease. ALS was chosen because of the previous work

describing complement activation products in both patients and animal models of this

disease.

Complement is deposited at the presymptomatic stage on motor end-plates of

SOD1G93A mice

Mechanisms leading to the neurodegenerative disease ALS are still unclear. Both cell

autonomous and non-cell autonomous mechanisms are involved in the disease [30-

32]. Different studies suggest an important role for neuroinflammation in the disease

[33-35]. The involvement of complement as an inflammatory component in the

pathogenesis of ALS in man is suggested by different researchers. Elevated levels of

complement activation products in serum and cerebrospinal fluid were detected in

ALS patients. Levels of mRNA for C1q and C4 and protein levels of complement

proteins C1q, C3 and MAC were elevated in spinal cord and motor cortex of patients

with sporadic ALS [36]. In the murine mouse model of ALS C1q and C4 were

upregulated in motor neurons [37, 38]. Other studies have also shown upregulation

of the major proinflammatory C5a receptor, during disease progression in mouse

motor neurons [39]. SOD1G93A rat treated with C5aR antagonist had an extension of

survival time and a reduction in end-stage motor scores compared to the untreated

rats. This data suggests an important role for complement in the progression of ALS

[35]. Also, increased expression of complement components C1qB, C4, factors B,

C3, C5 and a decrease in the expression of the regulators CD55 (regulator of C3)

and CD59a (regulator of MAC) was detected in the lumbar spinal cord of SOD1G93A

Chapter 8

250

mice [40]. This data points towards a disrupted regulation of the complement system

in this model.

In the SOD1G93A rodent model, an early involvement of the motor end-plate has been

shown [41, 42]. Retrograde degeneration is detected in ALS patients [43, 44]. In

addition, several physiological and morphological alterations have been reported on

the muscle end-plates from in vivo and ex vivo mouse and rat preparations [45-51].

These data suggest that some parts of ALS pathology start at the muscle end-plates

and might proceed to the spinal cord and subsequently the brain [52, 53] , ‘’a dying

back mechanism’’.

In chapter 5 we determined complement expression and activation in the SOD1G93A

mouse model of familial ALS (fALS). We show that complement components C1q

and C3 are deposited on the motor end-plates at the presymptomatic, symptomactic

and endstage of the disease. At the end stage of the disease, C3 mRNA was

upregulated in spinal cord and C3 protein accumulated in astrocytes and motor

neurons. While, complement activation products C3/C3b and C1q were detected at

the motor end-plates of SOD1G93A mice before the appearance of clinical symptoms

and remained detectable at the symptomatic stage, suggesting that complement

activation on the motor end-plates precedes neurodegeneration and plays an early

role in this model [54].

MAC deposition on motor endplates of ALS patients

In Chapter 5 we did not show deposition of MAC on motor end-plates of SOD1G93A

mice. Since our hypothesis is that MAC contributes to tissue damage in disease, we

show in Chapter 6 of this thesis that MAC is also deposited on the motor end-plates

of SOD1G93A mice at the presymptomatic stage.

We determined that complement components C1q and C3 are deposited on the

motor end-plates of SOD1G93A mice and suggest that the complement system might

play an important role in disease. An important question is whether what we observe

in a mouse model of the disease is also what happens in the patient. In Chapter 6

we show that complement activation products and regulators are deposited on the

motor end-plates of ALS patients. In intercostal muscle biopsies of ALS patients we

see two patterns of MAC immunoreactivity. On the end-plates with a weak α-BTX

immunoreactivity, strong signal for MAC immunoreactivity was seen. By contrast, a

weak MAC immunoreactivity was detected on end-plates with strong α-BTX

immunoreactivity. This is in line with a model in which MAC deposition occurs before

loss of the end-plates. Moreover, MAC was found deposited on motor end-plates that

were innervated by nerves, indicating that complement activation may precede

motor-endplate denervation. C1q, C3 and MAC were also detected on the motor

nerve-terminal and terminal Schwann cells. In general, regulators protect cells from

complement-mediated damage. We show that the regulators CD55 and CD59 are

both expressed on the motor end-plates, indicating an attempt to control the

activation. This process is probably not efficient enough because MAC can still be

detected on the α-BTX positive motor end-plates. Since a role for MAC in the

pathology of neurological disorders is suggested [55], detecting complement

deposited at the end-plates of ALS donors, before the end-plates are lost,

8


251

mice [40]. This data points towards a disrupted regulation of the complement system

in this model.

In the SOD1G93A rodent model, an early involvement of the motor end-plate has been

shown [41, 42]. Retrograde degeneration is detected in ALS patients [43, 44]. In

addition, several physiological and morphological alterations have been reported on

the muscle end-plates from in vivo and ex vivo mouse and rat preparations [45-51].

These data suggest that some parts of ALS pathology start at the muscle end-plates

and might proceed to the spinal cord and subsequently the brain [52, 53] , ‘’a dying

back mechanism’’.

In chapter 5 we determined complement expression and activation in the SOD1G93A

mouse model of familial ALS (fALS). We show that complement components C1q

and C3 are deposited on the motor end-plates at the presymptomatic, symptomactic

and endstage of the disease. At the end stage of the disease, C3 mRNA was

upregulated in spinal cord and C3 protein accumulated in astrocytes and motor

neurons. While, complement activation products C3/C3b and C1q were detected at

the motor end-plates of SOD1G93A mice before the appearance of clinical symptoms

and remained detectable at the symptomatic stage, suggesting that complement

activation on the motor end-plates precedes neurodegeneration and plays an early

role in this model [54].

MAC deposition on motor endplates of ALS patients

In Chapter 5 we did not show deposition of MAC on motor end-plates of SOD1G93A

mice. Since our hypothesis is that MAC contributes to tissue damage in disease, we

show in Chapter 6 of this thesis that MAC is also deposited on the motor end-plates

of SOD1G93A mice at the presymptomatic stage.

We determined that complement components C1q and C3 are deposited on the

motor end-plates of SOD1G93A mice and suggest that the complement system might

play an important role in disease. An important question is whether what we observe

in a mouse model of the disease is also what happens in the patient. In Chapter 6

we show that complement activation products and regulators are deposited on the

motor end-plates of ALS patients. In intercostal muscle biopsies of ALS patients we

see two patterns of MAC immunoreactivity. On the end-plates with a weak α-BTX

immunoreactivity, strong signal for MAC immunoreactivity was seen. By contrast, a

weak MAC immunoreactivity was detected on end-plates with strong α-BTX

immunoreactivity. This is in line with a model in which MAC deposition occurs before

loss of the end-plates. Moreover, MAC was found deposited on motor end-plates that

were innervated by nerves, indicating that complement activation may precede

motor-endplate denervation. C1q, C3 and MAC were also detected on the motor

nerve-terminal and terminal Schwann cells. In general, regulators protect cells from

complement-mediated damage. We show that the regulators CD55 and CD59 are

both expressed on the motor end-plates, indicating an attempt to control the

activation. This process is probably not efficient enough because MAC can still be

detected on the α-BTX positive motor end-plates. Since a role for MAC in the

pathology of neurological disorders is suggested [55], detecting complement

deposited at the end-plates of ALS donors, before the end-plates are lost,

Chapter 8

252

complement activation could be an early event in ALS and might play an important

role in the motor end-plate pathology in ALS. This observation is in line with earlier

studies suggesting a "dying-back" mechanism in ALS, meaning the disease probably

starts at the motor end-plates [52]. However, this study is performed using post-

mortem tissue and thus analysing the end stage of disease. So we cannot detect the

early changes. Although there may be some limitations to our conclusions about



C6 inhibition in female SOD1G93A mice decreases neurological disability

Complement products are abundantly present in tissue of ALS patients, including

MAC which is found in serum, cerebrospinal fluid, spinal cord, motor cortex and at

the neuromuscular junction of SOD1G93A mice and ALS patients. We propose that

MAC might be involved in causing secondary damage driving the progressive loss of

motor neuron function in ALS. Despite the evidence of complement activation in

ALS, the role of the complement system and its contribution to disease progression in

animal models for ALS is controversial [56, 57]. Therefore, we tested whether

inhibiting MAC formation with a C6 antisense/ RNA antagonist (C6 ODN) results in

a delay of disease progression in a murine model of ALS.

In Chapter 7 describes the effect of complement inhibition using 1 mg/kg/day C6

ODN in SOD1G93A mice on the survival, body weight and neurological score. No

significant effects on median onset or survival in either female or male C6 ODN

treated SODG93A mice compared to vehicle controls. The onset and survival curve of

the C6 ODN treated female SODG93A mice showed a different disease progression

compared to the controls, but there were no statistical difference in onset and

survival. . At the end-stage of the disease (day 120) the vehicle control mice dropped

in weight while the treated female SOD1G93A mice that were still alive maintained their

body weight. Interestingly, C6 ODN treated female SODG93A mice, progressed in a

manner that was slower than vehicle controls (p=0.002). Together with the

maintained body weight this suggests that these mice were performing better than

the vehicle controls.

The treated male SOD1G93A mice progressed in the same manner as the vehicle

controls. No significant effect on the onset and survival was observed compared to

the vehicle controls. In addition, the male treated SOD1G93A mice showed a decrease

in body weight similar to control and the neurological score of was not different from

the vehicle controls, suggesting no effect of treatment on the male SOD1G93A mice.

The difference in progression of the disease in treated male and female SOD1G93A

mice is probably due to the C6 mRNA levels in these animals. We treated both with

1mg/kg/day, while C6 mRNA is much lower in female than male SOD1G93A mice (ten-

fold difference). This study suggests that complement inhibition in female SOD G93A

mice might reduce disease severity, based on the results of the female SOD1G93A

mice. The lack of effects in male SOD1G93A mice prevents us to convincingly show

that the hypothesis is correct. Therefore, we suggest further investigations with a

higher concentration of C6 ODN which might have an effect on the outcome of the

disease in male SOD1G93A mice.

In summary, the data presented in this thesis shows that complement activation

occurs in various neuroregenerative conditions, both inherited and acquired. I see

associations between complement activation products and disease severity in

8


253

complement activation could be an early event in ALS and might play an important

role in the motor end-plate pathology in ALS. This observation is in line with earlier

studies suggesting a "dying-back" mechanism in ALS, meaning the disease probably

starts at the motor end-plates [52]. However, this study is performed using post-

mortem tissue and thus analysing the end stage of disease. So we cannot detect the

early changes. Although there may be some limitations to our conclusions about



C6 inhibition in female SOD1G93A mice decreases neurological disability

Complement products are abundantly present in tissue of ALS patients, including

MAC which is found in serum, cerebrospinal fluid, spinal cord, motor cortex and at

the neuromuscular junction of SOD1G93A mice and ALS patients. We propose that

MAC might be involved in causing secondary damage driving the progressive loss of

motor neuron function in ALS. Despite the evidence of complement activation in

ALS, the role of the complement system and its contribution to disease progression in

animal models for ALS is controversial [56, 57]. Therefore, we tested whether

inhibiting MAC formation with a C6 antisense/ RNA antagonist (C6 ODN) results in

a delay of disease progression in a murine model of ALS.

In Chapter 7 describes the effect of complement inhibition using 1 mg/kg/day C6

ODN in SOD1G93A mice on the survival, body weight and neurological score. No

significant effects on median onset or survival in either female or male C6 ODN

treated SODG93A mice compared to vehicle controls. The onset and survival curve of

the C6 ODN treated female SODG93A mice showed a different disease progression

compared to the controls, but there were no statistical difference in onset and

survival. . At the end-stage of the disease (day 120) the vehicle control mice dropped

in weight while the treated female SOD1G93A mice that were still alive maintained their

body weight. Interestingly, C6 ODN treated female SODG93A mice, progressed in a

manner that was slower than vehicle controls (p=0.002). Together with the

maintained body weight this suggests that these mice were performing better than

the vehicle controls.

The treated male SOD1G93A mice progressed in the same manner as the vehicle

controls. No significant effect on the onset and survival was observed compared to

the vehicle controls. In addition, the male treated SOD1G93A mice showed a decrease

in body weight similar to control and the neurological score of was not different from

the vehicle controls, suggesting no effect of treatment on the male SOD1G93A mice.

The difference in progression of the disease in treated male and female SOD1G93A

mice is probably due to the C6 mRNA levels in these animals. We treated both with

1mg/kg/day, while C6 mRNA is much lower in female than male SOD1G93A mice (ten-

fold difference). This study suggests that complement inhibition in female SOD G93A

mice might reduce disease severity, based on the results of the female SOD1G93A

mice. The lack of effects in male SOD1G93A mice prevents us to convincingly show

that the hypothesis is correct. Therefore, we suggest further investigations with a

higher concentration of C6 ODN which might have an effect on the outcome of the

disease in male SOD1G93A mice.

In summary, the data presented in this thesis shows that complement activation

occurs in various neuroregenerative conditions, both inherited and acquired. I see

associations between complement activation products and disease severity in

Chapter 8

254

leprosy and ALS. Preventing terminal pathway activation has an effect on

demyelination in a model for M. leprae induced nerve damage, and on the disease

severity in SODG93A mice. Overall, these experiments show that complement

components are putative targets for future therapies modulating disease severity.

References

1. Le FG, Kemper C. Complement: coming full circle. Arch Immunol Ther Exp (Warsz ) 2009 Nov;57(6):393-407.


3. Sarma JV, Ward PA. The complement system. Cell Tissue Res 2011 Jan;343(1):227-35.

4. Klos A, Tenner AJ, Johswich KO, Ager RR, Reis ES, Kohl J. The role of the anaphylatoxins in health and disease. Mol Immunol 2009 Sep;46(14):2753-66.


6. Hartmann K, Henz BM, Kruger-Krasagakes S, et al. C3a and C5a stimulate chemotaxis of human mast cells. Blood 1997 Apr 15;89(8):2863-70.

7. Heurich M, Martinez-Barricarte R, Francis NJ, et al. Common polymorphisms in C3, factor B, and factor H collaborate to determine systemic complement activity and disease risk. Proc Natl Acad Sci U S A 2011 May 24;108(21):8761-6.

8. Mayilyan KR. Complement genetics, deficiencies, and disease associations. Protein Cell 2012 Jul;3(7):487-96.

9. Korb LC, Ahearn JM. C1q binds directly and specifically to surface blebs of apoptotic human keratinocytes: complement deficiency and systemic lupus erythematosus revisited. J Immunol 1997 May 15;158(10):4525-8.





14. Ricklin D, Hajishengallis G, Yang K, Lambris JD. Complement: a key system for immune surveillance and homeostasis. Nat Immunol 2010 Sep;11(9):785-97.

15. Leslie M. Immunology. The new view of complement. Science 2012 Aug 31;337(6098):1034-7.

16. de Cordoba SR, Tortajada A, Harris CL, Morgan BP. Complement dysregulation and disease: from genes and proteins to diagnostics and drugs. Immunobiology 2012 Nov;217(11):1034-46.

17. Scollard DM, Adams LB, Gillis TP, Krahenbuhl JL, Truman RW, Williams DL. The continuing challenges of leprosy. Clin Microbiol Rev 2006 Apr;19(2):338-81.

18. WHO Expert Committee on Leprosy. World Health Organ Tech Rep Ser 1998;874:1-43.

19. Rambukkana A, Zanazzi G, Tapinos N, Salzer JL. Contact-dependent demyelination by Mycobacterium leprae in the absence of immune cells. Science 2002 May 3;296(5569):927-31.

8


255

leprosy and ALS. Preventing terminal pathway activation has an effect on

demyelination in a model for M. leprae induced nerve damage, and on the disease

severity in SODG93A mice. Overall, these experiments show that complement

components are putative targets for future therapies modulating disease severity.

References

1. Le FG, Kemper C. Complement: coming full circle. Arch Immunol Ther Exp (Warsz ) 2009 Nov;57(6):393-407.


3. Sarma JV, Ward PA. The complement system. Cell Tissue Res 2011 Jan;343(1):227-35.

4. Klos A, Tenner AJ, Johswich KO, Ager RR, Reis ES, Kohl J. The role of the anaphylatoxins in health and disease. Mol Immunol 2009 Sep;46(14):2753-66.


6. Hartmann K, Henz BM, Kruger-Krasagakes S, et al. C3a and C5a stimulate chemotaxis of human mast cells. Blood 1997 Apr 15;89(8):2863-70.

7. Heurich M, Martinez-Barricarte R, Francis NJ, et al. Common polymorphisms in C3, factor B, and factor H collaborate to determine systemic complement activity and disease risk. Proc Natl Acad Sci U S A 2011 May 24;108(21):8761-6.

8. Mayilyan KR. Complement genetics, deficiencies, and disease associations. Protein Cell 2012 Jul;3(7):487-96.

9. Korb LC, Ahearn JM. C1q binds directly and specifically to surface blebs of apoptotic human keratinocytes: complement deficiency and systemic lupus erythematosus revisited. J Immunol 1997 May 15;158(10):4525-8.





14. Ricklin D, Hajishengallis G, Yang K, Lambris JD. Complement: a key system for immune surveillance and homeostasis. Nat Immunol 2010 Sep;11(9):785-97.

15. Leslie M. Immunology. The new view of complement. Science 2012 Aug 31;337(6098):1034-7.

16. de Cordoba SR, Tortajada A, Harris CL, Morgan BP. Complement dysregulation and disease: from genes and proteins to diagnostics and drugs. Immunobiology 2012 Nov;217(11):1034-46.

17. Scollard DM, Adams LB, Gillis TP, Krahenbuhl JL, Truman RW, Williams DL. The continuing challenges of leprosy. Clin Microbiol Rev 2006 Apr;19(2):338-81.

18. WHO Expert Committee on Leprosy. World Health Organ Tech Rep Ser 1998;874:1-43.

19. Rambukkana A, Zanazzi G, Tapinos N, Salzer JL. Contact-dependent demyelination by Mycobacterium leprae in the absence of immune cells. Science 2002 May 3;296(5569):927-31.

Chapter 8

256



22. Shetty VP, Suchitra K, Uplekar MW, Antia NH. Persistence of Mycobacterium leprae in the peripheral nerve as compared to the skin of multidrug-treated leprosy patients. Lepr Rev 1992 Dec;63(4):329-36.

23. Shetty VP, Uplekar MW, Antia NH. Immunohistological localization of mycobacterial antigens within the peripheral nerves of treated leprosy patients and their significance to nerve damage in leprosy. Acta Neuropathol 1994;88(4):300-6.







30. Raoul C, Estevez AG, Nishimune H, et al. Motoneuron death triggered by a specific pathway downstream of Fas. potentiation by ALS-linked SOD1 mutations. Neuron 2002 Sep 12;35(6):1067-83.

31. Boillee S, Yamanaka K, Lobsiger CS, et al. Onset and progression in inherited ALS determined by motor neurons and microglia. Science 2006 Jun 2;312(5778):1389-92.

32. Di Giorgio FP, Carrasco MA, Siao MC, Maniatis T, Eggan K. Non-cell autonomous effect of glia on motor neurons in an embryonic stem cell-based ALS model. Nat Neurosci 2007 May;10(5):608-14.


34. Cozzolino M, Ferri A, Carri MT. Amyotrophic lateral sclerosis: from current developments in the laboratory to clinical implications. Antioxid Redox Signal 2008 Mar;10(3):405-43.





39. Humayun S, Gohar M, Volkening K, et al. The complement factor C5a receptor is upregulated in NFL-/- mouse motor neurons. J Neuroimmunol 2009 May 29;210(1-2):52-62.


41. Dupuis L, Gonzalez de Aguilar JL, Echaniz-Laguna A, et al. Muscle mitochondrial uncoupling dismantles neuromuscular junction and triggers distal degeneration of motor neurons. PLoS One 2009;4(4):e5390.

42. Dupuis L, Loeffler JP. Neuromuscular junction destruction during amyotrophic lateral sclerosis: insights from transgenic models. Curr Opin Pharmacol 2009 Jun;9(3):341-6.

43. Eisen A, Weber M. The motor cortex and amyotrophic lateral sclerosis. Muscle Nerve 2001 Apr;24(4):564-73.

44. Karlsborg M, Rosenbaum S, Wiegell M, et al. Corticospinal tract degeneration and possible pathogenesis in ALS evaluated by MR diffusion tensor imaging. Amyotroph Lateral Scler Other Motor Neuron Disord 2004 Sep;5(3):136-40.

45. Pagani MR, Reisin RC, Uchitel OD. Calcium signaling pathways mediating synaptic potentiation triggered by amyotrophic lateral sclerosis IgG in motor nerve terminals. J Neurosci 2006 Mar 8;26(10):2661-72.

46. Uchitel OD, Appel SH, Crawford F, Sczcupak L. Immunoglobulins from amyotrophic lateral sclerosis patients enhance spontaneous transmitter release from motor-nerve terminals. Proc Natl Acad Sci U S A 1988 Oct;85(19):7371-4.

47. Uchitel OD, Scornik F, Protti DA, Fumberg CG, Alvarez V, Appel SH. Long-term neuromuscular dysfunction produced by passive transfer of amyotrophic lateral sclerosis immunoglobulins. Neurology 1992 Nov;42(11):2175-80.

48. Appel SH, Engelhardt JI, Garcia J, Stefani E. Immunoglobulins from animal models of motor neuron disease and from human amyotrophic lateral sclerosis patients passively transfer physiological abnormalities to the neuromuscular junction. Proc Natl Acad Sci U S A 1991 Jan 15;88(2):647-51.

49. O'Shaughnessy TJ, Yan H, Kim J, et al. Amyotrophic lateral sclerosis: serum factors enhance spontaneous and evoked transmitter release at the neuromuscular junction. Muscle Nerve 1998 Jan;21(1):81-90.

50. Mohamed HA, Mosier DR, Zou LL, et al. Immunoglobulin Fc gamma receptor promotes immunoglobulin uptake, immunoglobulin-mediated calcium increase, and neurotransmitter release in motor neurons. J Neurosci Res 2002 Jul 1;69(1):110-6.

51. Muchnik S, Losavio A, De LS. Effect of amyotrophic lateral sclerosis serum on calcium channels related to spontaneous acetylcholine release. Clin Neurophysiol 2002 Jul;113(7):1066-71.

8


257



22. Shetty VP, Suchitra K, Uplekar MW, Antia NH. Persistence of Mycobacterium leprae in the peripheral nerve as compared to the skin of multidrug-treated leprosy patients. Lepr Rev 1992 Dec;63(4):329-36.

23. Shetty VP, Uplekar MW, Antia NH. Immunohistological localization of mycobacterial antigens within the peripheral nerves of treated leprosy patients and their significance to nerve damage in leprosy. Acta Neuropathol 1994;88(4):300-6.







30. Raoul C, Estevez AG, Nishimune H, et al. Motoneuron death triggered by a specific pathway downstream of Fas. potentiation by ALS-linked SOD1 mutations. Neuron 2002 Sep 12;35(6):1067-83.

31. Boillee S, Yamanaka K, Lobsiger CS, et al. Onset and progression in inherited ALS determined by motor neurons and microglia. Science 2006 Jun 2;312(5778):1389-92.

32. Di Giorgio FP, Carrasco MA, Siao MC, Maniatis T, Eggan K. Non-cell autonomous effect of glia on motor neurons in an embryonic stem cell-based ALS model. Nat Neurosci 2007 May;10(5):608-14.


34. Cozzolino M, Ferri A, Carri MT. Amyotrophic lateral sclerosis: from current developments in the laboratory to clinical implications. Antioxid Redox Signal 2008 Mar;10(3):405-43.





39. Humayun S, Gohar M, Volkening K, et al. The complement factor C5a receptor is upregulated in NFL-/- mouse motor neurons. J Neuroimmunol 2009 May 29;210(1-2):52-62.


41. Dupuis L, Gonzalez de Aguilar JL, Echaniz-Laguna A, et al. Muscle mitochondrial uncoupling dismantles neuromuscular junction and triggers distal degeneration of motor neurons. PLoS One 2009;4(4):e5390.

42. Dupuis L, Loeffler JP. Neuromuscular junction destruction during amyotrophic lateral sclerosis: insights from transgenic models. Curr Opin Pharmacol 2009 Jun;9(3):341-6.

43. Eisen A, Weber M. The motor cortex and amyotrophic lateral sclerosis. Muscle Nerve 2001 Apr;24(4):564-73.

44. Karlsborg M, Rosenbaum S, Wiegell M, et al. Corticospinal tract degeneration and possible pathogenesis in ALS evaluated by MR diffusion tensor imaging. Amyotroph Lateral Scler Other Motor Neuron Disord 2004 Sep;5(3):136-40.

45. Pagani MR, Reisin RC, Uchitel OD. Calcium signaling pathways mediating synaptic potentiation triggered by amyotrophic lateral sclerosis IgG in motor nerve terminals. J Neurosci 2006 Mar 8;26(10):2661-72.

46. Uchitel OD, Appel SH, Crawford F, Sczcupak L. Immunoglobulins from amyotrophic lateral sclerosis patients enhance spontaneous transmitter release from motor-nerve terminals. Proc Natl Acad Sci U S A 1988 Oct;85(19):7371-4.

47. Uchitel OD, Scornik F, Protti DA, Fumberg CG, Alvarez V, Appel SH. Long-term neuromuscular dysfunction produced by passive transfer of amyotrophic lateral sclerosis immunoglobulins. Neurology 1992 Nov;42(11):2175-80.

48. Appel SH, Engelhardt JI, Garcia J, Stefani E. Immunoglobulins from animal models of motor neuron disease and from human amyotrophic lateral sclerosis patients passively transfer physiological abnormalities to the neuromuscular junction. Proc Natl Acad Sci U S A 1991 Jan 15;88(2):647-51.

49. O'Shaughnessy TJ, Yan H, Kim J, et al. Amyotrophic lateral sclerosis: serum factors enhance spontaneous and evoked transmitter release at the neuromuscular junction. Muscle Nerve 1998 Jan;21(1):81-90.

50. Mohamed HA, Mosier DR, Zou LL, et al. Immunoglobulin Fc gamma receptor promotes immunoglobulin uptake, immunoglobulin-mediated calcium increase, and neurotransmitter release in motor neurons. J Neurosci Res 2002 Jul 1;69(1):110-6.

51. Muchnik S, Losavio A, De LS. Effect of amyotrophic lateral sclerosis serum on calcium channels related to spontaneous acetylcholine release. Clin Neurophysiol 2002 Jul;113(7):1066-71.

Chapter 8

258

52. Fischer LR, Culver DG, Tennant P, et al. Amyotrophic lateral sclerosis is a distal axonopathy: evidence in mice and man. Exp Neurol 2004 Feb;185(2):232-40.

53. Moloney EB, de WF, Verhaagen J. ALS as a distal axonopathy: molecular mechanisms affecting neuromuscular junction stability in the presymptomatic stages of the disease. Front Neurosci 2014;8:252.



56. Woodruff TM, Lee JD, Noakes PG. Role for terminal complement activation in amyotrophic lateral sclerosis disease progression. Proc Natl Acad Sci U S A 2014 Jan 7;111(1):E3-E4.

57. Lobsiger CS, Cleveland DW. Reply to Woodruff et al.: C1q and C3-dependent complement pathway activation does not contribute to disease in SOD1 mutant ALS mice. Proc Natl Acad Sci U S A 2014 Jan 7;111(1):E5.

Nederlandse Samenvatting

Dutch summary

52. Fischer LR, Culver DG, Tennant P, et al. Amyotrophic lateral sclerosis is a distal axonopathy: evidence in mice and man. Exp Neurol 2004 Feb;185(2):232-40.

53. Moloney EB, de WF, Verhaagen J. ALS as a distal axonopathy: molecular mechanisms affecting neuromuscular junction stability in the presymptomatic stages of the disease. Front Neurosci 2014;8:252.



56. Woodruff TM, Lee JD, Noakes PG. Role for terminal complement activation in amyotrophic lateral sclerosis disease progression. Proc Natl Acad Sci U S A 2014 Jan 7;111(1):E3-E4.

57. Lobsiger CS, Cleveland DW. Reply to Woodruff et al.: C1q and C3-dependent complement pathway activation does not contribute to disease in SOD1 mutant ALS mice. Proc Natl Acad Sci U S A 2014 Jan 7;111(1):E5.

Nederlandse Samenvatting

Dutch summary

S

Nederlandse Samenvatting - Dutch summary

260

Nederlandse Samenvatting (Dutch summary)

Lepra is een chronische infectie ziekte veroorzaakt door de bacterie Mycobacterium

leprae (M. leprae). Nog steeds treft deze ziekte jaarlijks 214.000 nieuwe patiënten.

Lepra veroorzaakt zenuwschade die kan leiden tot misvormingen en invaliditeit. Niet

alle leprapatiënten krijgen echter zenuwschade en het is onbekend waarom sommige

zieken wel zenuw problemen krijgen en andere niet.

Amyotrofische lateraal sclerose (ALS) is een progressieve neurodegeneratieve

ziekte, die leidt tot zwakte en atrofie van de skeletspieren. De voornaamste reden

van overlijden is verzwakking van de ademhalingsspieren. De ziekte wordt

veroorzaakt door het afsterven van cellen (motorneuronen) in de hersenen en het

ruggenmerg die de skeletspieren activeren. Er is geen genezende behandeling van

ALS en de verwachte levensduur na diagnose is tussen de twee en vijf jaar. Daarom

is een effectieve behandeling voor ALS dringend nodig.

Wat hebben lepra en ALS als ziekten gemeen? Neurodegeneratie en ontsteking, zijn

belangrijke elementen van beide aandoeningen. Steeds meer onderzoekers leggen

een verband tussen ontsteking en neurodegeneratie. Een ontstekingsreactie wordt in

het algemeen veroorzaakt door ons immuunsysteem. Het complementsysteem is een

onderdeel van het aangeboren immuunsysteem. Recent onderzoek uit ons

laboratorium bewees dat het eindproduct van het complement systeem, het

membrane attack complex (MAC), herstel na mechanische zenuwschade blijkt tegen

te gaan. Remming van MAC door geneesmiddelen bleek herstel na mechanische

zenuwletstel te versnellen. Onderzoek heeft aangetoond dat het complementsysteem

in bepaalde lepragevallen geactiveerd is en dat dit geassocieerd is met

ziekteverschijnselen. In het ruggenmerg en de motorische cortex van ALS patiënten

is complement ook geactiveerd. De rol hiervan is onduidelijk. In dit proefschrift willen

we de rol van complement bij het ontstaan van zenuwschade in lepra en bij het

verlies van motorische eindplaten in ALS onderzoeken. De hypothese van ons

onderzoek is dat het complementsysteem het beloop van de ziekte mede bepaalt.

Daarnaast willen we onderzoeken of complementinhibitie het ziektebeeld in lepra en

ALS verbetert. Hiervoor gebruiken we een C6 antisense oligonucleotide (C6 ODN),

dat C6 mRNA bindt en er voor zorgt dat MAC niet gevormd kan worden ( C6 is

onderdeel van het MAC complex). Dit met het idee dat C6 remming en daarmee ook

remming van MAC de schade in lepra en ALS kan beperken.

De inleiding in hoofdstuk 1 beschrijft de structuur van de zenuw en de

veranderingen die plaatsvinden bij zenuwbeschadiging en welke rol ontsteking hierbij

speelt. Daarnaast wordt er uitgelegd wat het complementsysteem is, hoe het

gereguleerd wordt en wat er gebeurt bij ontregeling van dit systeem. Tenslotte wordt

beschreven wat Lepra en ALS zijn en wat er bekend is over het complementsysteem

in deze ziekten.

Hoofdstuk 2 beschrijft het effect van C6 complement remming in een muizenmodel,

waarbij dode leprabacteriën, geïsoleerd uit leprapatiënten, geïnjecteerd worden in de

zenuw van de muis. In dit muismodel hebben we laten zien dat de C6 remming met

behulp van een C6 antisense oligonucleotide inderdaad zenuwschade kan beperken.

In vitro laten we zien dat lepra antigen lipoarabinomannan een sterke

complementactivator is. Ook laten we zien dat in zenuwbiopten van lepra patiënten

MAC zich aan de axon hecht, wat suggereert dat MAC de zenuw aanvalt. Daarom

S


261

Nederlandse Samenvatting (Dutch summary)

Lepra is een chronische infectie ziekte veroorzaakt door de bacterie Mycobacterium

leprae (M. leprae). Nog steeds treft deze ziekte jaarlijks 214.000 nieuwe patiënten.

Lepra veroorzaakt zenuwschade die kan leiden tot misvormingen en invaliditeit. Niet

alle leprapatiënten krijgen echter zenuwschade en het is onbekend waarom sommige

zieken wel zenuw problemen krijgen en andere niet.

Amyotrofische lateraal sclerose (ALS) is een progressieve neurodegeneratieve

ziekte, die leidt tot zwakte en atrofie van de skeletspieren. De voornaamste reden

van overlijden is verzwakking van de ademhalingsspieren. De ziekte wordt

veroorzaakt door het afsterven van cellen (motorneuronen) in de hersenen en het

ruggenmerg die de skeletspieren activeren. Er is geen genezende behandeling van

ALS en de verwachte levensduur na diagnose is tussen de twee en vijf jaar. Daarom

is een effectieve behandeling voor ALS dringend nodig.

Wat hebben lepra en ALS als ziekten gemeen? Neurodegeneratie en ontsteking, zijn

belangrijke elementen van beide aandoeningen. Steeds meer onderzoekers leggen

een verband tussen ontsteking en neurodegeneratie. Een ontstekingsreactie wordt in

het algemeen veroorzaakt door ons immuunsysteem. Het complementsysteem is een

onderdeel van het aangeboren immuunsysteem. Recent onderzoek uit ons

laboratorium bewees dat het eindproduct van het complement systeem, het

membrane attack complex (MAC), herstel na mechanische zenuwschade blijkt tegen

te gaan. Remming van MAC door geneesmiddelen bleek herstel na mechanische

zenuwletstel te versnellen. Onderzoek heeft aangetoond dat het complementsysteem

in bepaalde lepragevallen geactiveerd is en dat dit geassocieerd is met

ziekteverschijnselen. In het ruggenmerg en de motorische cortex van ALS patiënten

is complement ook geactiveerd. De rol hiervan is onduidelijk. In dit proefschrift willen

we de rol van complement bij het ontstaan van zenuwschade in lepra en bij het

verlies van motorische eindplaten in ALS onderzoeken. De hypothese van ons

onderzoek is dat het complementsysteem het beloop van de ziekte mede bepaalt.

Daarnaast willen we onderzoeken of complementinhibitie het ziektebeeld in lepra en

ALS verbetert. Hiervoor gebruiken we een C6 antisense oligonucleotide (C6 ODN),

dat C6 mRNA bindt en er voor zorgt dat MAC niet gevormd kan worden ( C6 is

onderdeel van het MAC complex). Dit met het idee dat C6 remming en daarmee ook

remming van MAC de schade in lepra en ALS kan beperken.

De inleiding in hoofdstuk 1 beschrijft de structuur van de zenuw en de

veranderingen die plaatsvinden bij zenuwbeschadiging en welke rol ontsteking hierbij

speelt. Daarnaast wordt er uitgelegd wat het complementsysteem is, hoe het

gereguleerd wordt en wat er gebeurt bij ontregeling van dit systeem. Tenslotte wordt

beschreven wat Lepra en ALS zijn en wat er bekend is over het complementsysteem

in deze ziekten.

Hoofdstuk 2 beschrijft het effect van C6 complement remming in een muizenmodel,

waarbij dode leprabacteriën, geïsoleerd uit leprapatiënten, geïnjecteerd worden in de

zenuw van de muis. In dit muismodel hebben we laten zien dat de C6 remming met

behulp van een C6 antisense oligonucleotide inderdaad zenuwschade kan beperken.

In vitro laten we zien dat lepra antigen lipoarabinomannan een sterke

complementactivator is. Ook laten we zien dat in zenuwbiopten van lepra patiënten

MAC zich aan de axon hecht, wat suggereert dat MAC de zenuw aanvalt. Daarom


262

suggereren we dat complement inhibitie de zenuwschade in leprapatiënten kan

beperken.

In hoofdstuk 3 worden de waarden van complement activatieproducten en

regulatoren in serum van leprapatiënten zonder en met een reactie beschreven. We

laten zien dat leprapatiënten met een reactie hogere waarden hebben voor bepaalde

complementfactoren. Metingen van complement in serum monsters van

leprapatiënten uit Ethiopië, laten zien dat TCC (niet-membraangebonden MAC)

waarden hoger zijn in patiënten met reactie dan in patiënten zonder reactie.

Daarnaast zijn drie patiënten gevolgd voor en na behandeling. Bij deze patiënten zijn

de TCC waardes niet gedaald na de behandeling. Dit is een indicatie dat

complement nog steeds geactiveerd blijft, zelfs nadat de bacterie dood is. Dit

suggereert ook dat de behandeling met een cocktail van antibiotica geen effect heeft

op complementactivatie. De regulator van TCC was hoger in leprapatiënten dan in de

controles. Onze analyse van de data suggereert dat complementfactoren in serum

van leprapatiënten waarschijnlijk kunnen bijdragen aan de diagnose en prognose van

de status van de ziekte.

Hoofdstuk 4 beschrijft de rol van het complementsysteem, de immuuncellen en het

lepra-antigen lipoarabinomannan in huidbiopten van leprapatiënten. In dit hoofdstuk

laten we zien dat er meer complementdepositie in huidbiopten van multibacillaire

patiënten is vergeleken met paucibacillaire patiënten. Ook laten we zien dat

patiënten met een ernstige vorm van lepra veel meer complement depositie hebben

in huidbiopten vergeleken met patiënten die een minder ernstige vorm hebben. De

depositie van complement activatieproducten C3d en MAC correleert sterk met de

depositie van lipoarabinomannan in huidbiopten van leprapatiënten. Dit suggereert

dat lipoarabinomannan een rol speelt bij complementdepositie in huidbiopten van

leprapatiënten. Aangezien lipoarabinomannan en MAC beide nog lang na

behandeling in huidbiopten van leprapatiënten te detecteren zijn, concluderen we dat

behandeling de ontsteking niet dempt. Een belangrijke bevinding in dit hoofdstuk is

dat complement factor C3d op de T-cellen zitten van paucibacillaire patiënten in de

granulomen. Uit de literatuur weten we dat C3d een belangrijke rol kan spelen bij het

activeren van T-cellen.

In Hoofdstuk 5 wordt de analyse van complementactivatie op de motorische

eindplaten van SOD1G93A muizen op verschillende tijdspunten beschreven. SOD1G93A

muizen vertonen naarmate ze ouder worden een ziekte die op ALS lijkt. We laten hier

zien dat op dag 126 na geboorte van de muizen het C3 mRNA op-gereguleerd is in

het ruggenmerg en dat C3 eiwit geaccumuleerd is in de astrocyten en de

motorneuronen. Daarnaast laten we zien dat complement activatieproducten C1q en

C3b/iC3b te detecteren zijn op eindplaten van SOD1G93A muizen voordat de muizen

klinische symptomen vertonen (dag 47 na geboorte). Ons idee is dat het

complementsysteem een belangrijke rol speelt bij schade aan de eindplaten in het

beginstadium van de ziekte.

Hoofdstuk 6 beschrijft de aanwezigheid van complementactivatie en

regulatieproducten op de motorische eind-platen van ALS patiënten na overlijden.

We laten zien dat complement activatieproducten C1q en MAC op de eindplaten te

detecteren zijn. MAC depositie was hoger op eindplaten die zwaar beschadigd

waren, terwijl eindplaten die minder beschadigd waren weinig MAC gedeponeerd

was. De complementregulatoren CD55 en CD59 waren beide opgereguleerd op de

eindplaten van ALS patiënten. Dit suggereert dat alhoewel er regulatie is, het

S


263

suggereren we dat complement inhibitie de zenuwschade in leprapatiënten kan

beperken.

In hoofdstuk 3 worden de waarden van complement activatieproducten en

regulatoren in serum van leprapatiënten zonder en met een reactie beschreven. We

laten zien dat leprapatiënten met een reactie hogere waarden hebben voor bepaalde

complementfactoren. Metingen van complement in serum monsters van

leprapatiënten uit Ethiopië, laten zien dat TCC (niet-membraangebonden MAC)

waarden hoger zijn in patiënten met reactie dan in patiënten zonder reactie.

Daarnaast zijn drie patiënten gevolgd voor en na behandeling. Bij deze patiënten zijn

de TCC waardes niet gedaald na de behandeling. Dit is een indicatie dat

complement nog steeds geactiveerd blijft, zelfs nadat de bacterie dood is. Dit

suggereert ook dat de behandeling met een cocktail van antibiotica geen effect heeft

op complementactivatie. De regulator van TCC was hoger in leprapatiënten dan in de

controles. Onze analyse van de data suggereert dat complementfactoren in serum

van leprapatiënten waarschijnlijk kunnen bijdragen aan de diagnose en prognose van

de status van de ziekte.

Hoofdstuk 4 beschrijft de rol van het complementsysteem, de immuuncellen en het

lepra-antigen lipoarabinomannan in huidbiopten van leprapatiënten. In dit hoofdstuk

laten we zien dat er meer complementdepositie in huidbiopten van multibacillaire

patiënten is vergeleken met paucibacillaire patiënten. Ook laten we zien dat

patiënten met een ernstige vorm van lepra veel meer complement depositie hebben

in huidbiopten vergeleken met patiënten die een minder ernstige vorm hebben. De

depositie van complement activatieproducten C3d en MAC correleert sterk met de

depositie van lipoarabinomannan in huidbiopten van leprapatiënten. Dit suggereert

dat lipoarabinomannan een rol speelt bij complementdepositie in huidbiopten van

leprapatiënten. Aangezien lipoarabinomannan en MAC beide nog lang na

behandeling in huidbiopten van leprapatiënten te detecteren zijn, concluderen we dat

behandeling de ontsteking niet dempt. Een belangrijke bevinding in dit hoofdstuk is

dat complement factor C3d op de T-cellen zitten van paucibacillaire patiënten in de

granulomen. Uit de literatuur weten we dat C3d een belangrijke rol kan spelen bij het

activeren van T-cellen.

In Hoofdstuk 5 wordt de analyse van complementactivatie op de motorische

eindplaten van SOD1G93A muizen op verschillende tijdspunten beschreven. SOD1G93A

muizen vertonen naarmate ze ouder worden een ziekte die op ALS lijkt. We laten hier

zien dat op dag 126 na geboorte van de muizen het C3 mRNA op-gereguleerd is in

het ruggenmerg en dat C3 eiwit geaccumuleerd is in de astrocyten en de

motorneuronen. Daarnaast laten we zien dat complement activatieproducten C1q en

C3b/iC3b te detecteren zijn op eindplaten van SOD1G93A muizen voordat de muizen

klinische symptomen vertonen (dag 47 na geboorte). Ons idee is dat het

complementsysteem een belangrijke rol speelt bij schade aan de eindplaten in het

beginstadium van de ziekte.

Hoofdstuk 6 beschrijft de aanwezigheid van complementactivatie en

regulatieproducten op de motorische eind-platen van ALS patiënten na overlijden.

We laten zien dat complement activatieproducten C1q en MAC op de eindplaten te

detecteren zijn. MAC depositie was hoger op eindplaten die zwaar beschadigd

waren, terwijl eindplaten die minder beschadigd waren weinig MAC gedeponeerd

was. De complementregulatoren CD55 en CD59 waren beide opgereguleerd op de

eindplaten van ALS patiënten. Dit suggereert dat alhoewel er regulatie is, het


264

systeem niet efficiënt genoeg is om de complement-gemedieerde ontsteking te

beperken.

Hoofdstuk 7 beschrijft het effect van complementremming in SOD1G93A muizen op

overleving, gewicht en neurologische score. We laten hier zien dat C6 remming geen

effect heeft op overleving, gewicht en neurologische score in mannetjes muizen. In

vrouwtjes muizen laten we zien dat C6 remming wel enig effect vertoont op

overleving en gewicht, maar niet significant verschillend van de controlemuizen.

Daarentegen, heeft C6 remming wel een duidelijke effect op de neurologische score

van vrouwtjes muizen. De behandelde vrouwtjes muizen hebben een lagere

neurologische score dan de controles. Wij denken dat de behandeling niet heeft

gewerkt bij de mannetjes muizen omdat deze tienvoudig hogere C6 waardes

hebben. Wij suggereren dat een behandeling met een hogere concentratie van C6

oligonucleotide een betere resultaat zal leveren.

In hoofdstuk 8 worden de resultaten van alle hoofdstukken gerapporteerd en

besproken.

List of publications

About the author

Dankwoord

PhD portfolio

systeem niet efficiënt genoeg is om de complement-gemedieerde ontsteking te

beperken.

Hoofdstuk 7 beschrijft het effect van complementremming in SOD1G93A muizen op

overleving, gewicht en neurologische score. We laten hier zien dat C6 remming geen

effect heeft op overleving, gewicht en neurologische score in mannetjes muizen. In

vrouwtjes muizen laten we zien dat C6 remming wel enig effect vertoont op

overleving en gewicht, maar niet significant verschillend van de controlemuizen.

Daarentegen, heeft C6 remming wel een duidelijke effect op de neurologische score

van vrouwtjes muizen. De behandelde vrouwtjes muizen hebben een lagere

neurologische score dan de controles. Wij denken dat de behandeling niet heeft

gewerkt bij de mannetjes muizen omdat deze tienvoudig hogere C6 waardes

hebben. Wij suggereren dat een behandeling met een hogere concentratie van C6

oligonucleotide een betere resultaat zal leveren.

In hoofdstuk 8 worden de resultaten van alle hoofdstukken gerapporteerd en

besproken.


About the author

Dankwoord

PhD portfolio

266



1. Heurich B, Bahia El Idrissi N, Donev RM, Petri S, Claus P, Neal J, Morgan BP, Ramaglia

V. Complement upregulation and activation on motor neurons and neuromuscular junction in

the SOD1 G93A mouse model of familial amyotrophic lateral sclerosis, 2011, J

Neuroimmunol.235(1-2):104-9.

2. Nawal Bahia El Idrissi, Pranab K. Das, Kees Fluiter, Patricia S. Rosa, Jeroen Vreijling,

Dirk Troost, B. Paul Morgan, Frank Baas , Valeria Ramaglia. M. leprae components induce

nerve damage by complement activation: identification of lipoarabinomannan as the

dominant complement activator, 2015, Acta Neuropathologica, Volume 129, Issue 5, pp 653-

667.

3. Bahia El Idrissi N, Hakobyan S, Ramaglia V, Geluk A, Morgan BP, Das PK, Baas F.

Complement Activation In Leprosy: A Retrospective Study Shows Elevated Circulating

Terminal Complement Complex In Reactional Leprosy. Clin Exp Immunol. 2016 Jan 8. doi:

10.1111/cei.12767.

4. Nawal Bahia El Idrissi, Sanne Bosch, Valeria Ramaglia, Eleonora Aronica, Frank

Baas, and Dirk Troost. Complement activation at the motor end-plates in amyotrophic lateral

sclerosis. J Neuroinflammation. 2016; 13: 72.

5. Nawal Bahia El Idrissi, Kees Fluiter, Fernando G. Vieira and Frank Baas. Complement

Component C6 Inhibition Decreases Neurological Disability in Female Transgenic SOD1

G93A

Mouse Model of Amyotrophic Lateral Sclerosis. Ann Neurodegener Dis 1(3): 1015.

About the author

Nawal Bahia el Idrissi was born on 6th of September 1985 in Amsterdam. She

graduated in 2003 at the Calandlyceum in Amsterdam. Her interest for science made

her choose for the Higher Laboratory Education at the Inholland in Alkmaar. In 2007

she graduated and decided to start a Master in Biomolecular sciences at the Free

University in Amsterdam. To learn about clinical trials and business and

communication she decided to follow a second master ‘Management Policy Analysis

and Entrepreneurship in the Health and Life Sciences’ at the Free university. For her

final internships she decided to go abroad to the La Jolla Institute for Allergy and

Immunology in San Diego. She graduated in 2009 for the Master Biomolecular

sciences. In the same year she started working at the medical department of the

pharmaceutical company Genzyme in Almere. In 2010 she graduated for the master

Management Policy Analysis and Entrepreneurship in the Health and Life Sciences.

In September 2010 she started a PhD project at the Academic Medical Center in

Amsterdam under supervision of Prof. F. Baas and Dr. P.K. Das. Where she studied

the role of complement in nerve damage in leprosy. In 2012 she applied for the

Mozaïek grant from the Netherlands Organization for Scientific Research. She wrote

a research proposal on the role of complement in Amyotrophic lateral sclerosis. After

defending the research proposal she was awarded € 200.000 based on merit. She

worked on both the leprosy and the Amyotrophic lateral sclerosis project during her

PhD, which resulted in interesting publication.

267

About the Author


1. Heurich B, Bahia El Idrissi N, Donev RM, Petri S, Claus P, Neal J, Morgan BP, Ramaglia

V. Complement upregulation and activation on motor neurons and neuromuscular junction in

the SOD1 G93A mouse model of familial amyotrophic lateral sclerosis, 2011, J

Neuroimmunol.235(1-2):104-9.

2. Nawal Bahia El Idrissi, Pranab K. Das, Kees Fluiter, Patricia S. Rosa, Jeroen Vreijling,

Dirk Troost, B. Paul Morgan, Frank Baas , Valeria Ramaglia. M. leprae components induce

nerve damage by complement activation: identification of lipoarabinomannan as the

dominant complement activator, 2015, Acta Neuropathologica, Volume 129, Issue 5, pp 653-

667.

3. Bahia El Idrissi N, Hakobyan S, Ramaglia V, Geluk A, Morgan BP, Das PK, Baas F.

Complement Activation In Leprosy: A Retrospective Study Shows Elevated Circulating

Terminal Complement Complex In Reactional Leprosy. Clin Exp Immunol. 2016 Jan 8. doi:

10.1111/cei.12767.

4. Nawal Bahia El Idrissi, Sanne Bosch, Valeria Ramaglia, Eleonora Aronica, Frank

Baas, and Dirk Troost. Complement activation at the motor end-plates in amyotrophic lateral

sclerosis. J Neuroinflammation. 2016; 13: 72.

5. Nawal Bahia El Idrissi, Kees Fluiter, Fernando G. Vieira and Frank Baas. Complement

Component C6 Inhibition Decreases Neurological Disability in Female Transgenic SOD1

G93A

Mouse Model of Amyotrophic Lateral Sclerosis. Ann Neurodegener Dis 1(3): 1015.

About the author

Nawal Bahia el Idrissi was born on 6th of September 1985 in Amsterdam. She

graduated in 2003 at the Calandlyceum in Amsterdam. Her interest for science made

her choose for the Higher Laboratory Education at the Inholland in Alkmaar. In 2007

she graduated and decided to start a Master in Biomolecular sciences at the Free

University in Amsterdam. To learn about clinical trials and business and

communication she decided to follow a second master ‘Management Policy Analysis

and Entrepreneurship in the Health and Life Sciences’ at the Free university. For her

final internships she decided to go abroad to the La Jolla Institute for Allergy and

Immunology in San Diego. She graduated in 2009 for the Master Biomolecular

sciences. In the same year she started working at the medical department of the

pharmaceutical company Genzyme in Almere. In 2010 she graduated for the master

Management Policy Analysis and Entrepreneurship in the Health and Life Sciences.

In September 2010 she started a PhD project at the Academic Medical Center in

Amsterdam under supervision of Prof. F. Baas and Dr. P.K. Das. Where she studied

the role of complement in nerve damage in leprosy. In 2012 she applied for the

Mozaïek grant from the Netherlands Organization for Scientific Research. She wrote

a research proposal on the role of complement in Amyotrophic lateral sclerosis. After

defending the research proposal she was awarded € 200.000 based on merit. She

worked on both the leprosy and the Amyotrophic lateral sclerosis project during her

PhD, which resulted in interesting publication.

268

Dankwoord

Dankwoord

Bij een proefschrift hoort natuurlijk ook een dankwoord. Ik wil iedereen bedanken die

een bijdrage heeft geleverd aan mijn onderzoek en proefschrift. Daarnaast wil ik ook

iedereen bedanken die me de afgelopen jaren heeft gesteund, geholpen en

geluisterd heeft naar mijn getetter over van alles en nog wat. Ik heb mijn

promotietraject met veel plezier doorlopen, bedankt voor alle mooie momenten!

Allereerst wil ik mijn promotor Prof. Frank Baas en mijn co-promotors Prof. Pran K.

Das en Dr. Valeria Ramaglia bedanken voor hun steun gedurende mijn

promotietraject.

Frank, bedankt dat je me in jouw lab de ruimte hebt gegeven me te ontwikkelen tot

een goede onderzoeker. Ik mocht tijd vrijmaken om een persoonlijke beurs aan te

vragen, congressen/bijeenkomsten bij te wonen en contacten te leggen met andere

wetenschappers. Onze discussies over mijn wetenschappelijke data zijn zeer

waardevol geweest voor mijn onderzoeken. Ik heb veel geleerd van jouw kritische

blik en dit waardeer ik enorm. Bedankt!

Pran, thank you for sharing your expertise on leprosy with me. I appreciate the time

and effort you invested in me. I know you don’t like to work with computers, that is

why we had long discussions over the phone about the papers before they got

published. The conversations were really informative and helped me deliver good

research. Yelling on the phone, was not really necessary. You were just in

Birmingham I can hear you through the phone, really I can!! :D

Kees, je straalt altijd een gevoel van rust uit. Bedankt dat je altijd ZEN bent geweest,

op momenten dat het even hectisch was :). Je hebt mij geleerd dat ik me niet zo druk

moet maken en dat alles goed komt! Ik heb ook veel genoten van onze interessante

gesprekken over, dat veel sporten niet gezond is en dat er niet veel voor ons zal

veranderen als Donald Trump president wordt. Ik wil je natuurlijk ook bedanken dat ik

deel uit mocht maken van een belangrijk moment in je leven, je bruiloft met Juliejet!

Valeria, thank you for introducing me to the world of complement activation in the

peripheral nerves. You were really helpful at the beginning of my PhD! I also enjoyed

the time that we spent at the gym and of course shopping for nice clothes and shoes!

Thank you!

Prof. Dirk Troost, bedankt dat je me met open armen hebt ontvangen op je afdeling.

Je stond altijd open voor het bespreken van mijn data en kwam altijd met goede

inzichten in hoe iets beter kan. Ik heb veel van je geleerd en je bent een enorme

steun geweest!

Prof. Eleonora Aronica, je stond altijd voor mij klaar zodra ik materiaal nodig had voor

mijn onderzoek. Bedankt voor de beminnelijke manier waarop je mij te hulp schoot,

zonder jou was mijn ALS onderzoek niet zo efficiënt verlopen! Grazie!

Als ik aan de neuropathologie afdeling denk, dan sta ik meteen stil bij de koffietijd.

Dirk, alle leuke verhalen over de wetenschap van tegenwoordig en jouw investment

avonturen in het buitenland vond ik geweldig!

Lieve Astrid, bedankt dat je me altijd begroette met een grote glimlach en dat er altijd

plek voor me was tijdens de koffietijd :-). Ik wil je enorm bedanken voor je oprechte

interesse in mij en mijn onderzoek. Ik heb altijd genoten van onze gezellige

gesprekjes. Je bent echt een lieverd!

René, als ik aan de neuropathologie afdeling denk dan ben jij niet te missen! Toen ik

net begon met mijn promotietraject had ik geen idee wat materiaal plakken of snijden

inhield. Bedankt dat je me de microtoom hebt leren gebruiken! Je had veel geduld en

was er altijd om mij te helpen, zelfs als je het heel erg druk had. Ik vond het jammer

dat je het AMC verliet, maar gelukkig hoefde ik je niet te missen! Samen met Loesje

pannenkoeken eten, wandelingen maken en naar Arabische muziek luisteren.

Bedankt voor alle gezellige momenten!

Jasper, bedankt voor alle gezellige gesprekken tijdens de koffietijd en natuurlijk voor

alle antilichamen die ik kwam ‘’lenen’’.

Wijze Clifton, jij bent er altijd als ik hulp of advies nodig heb! Zelfs als je geen tijd hebt

of ziek bent krijg ik nog een uitgebreide e-mail over hoe ik het beste het een en ander

kan aanpakken. Bedankt dat je me verder helpt in het leven!

Anand, zelfs bij de laatste loodjes heb jij nog de tijd genomen mijn introductie en

artikel door te lezen. Ik heb daar zeker wat aan gehad, bedankt!

269

Dankwoord

Dankwoord

Bij een proefschrift hoort natuurlijk ook een dankwoord. Ik wil iedereen bedanken die

een bijdrage heeft geleverd aan mijn onderzoek en proefschrift. Daarnaast wil ik ook

iedereen bedanken die me de afgelopen jaren heeft gesteund, geholpen en

geluisterd heeft naar mijn getetter over van alles en nog wat. Ik heb mijn

promotietraject met veel plezier doorlopen, bedankt voor alle mooie momenten!

Allereerst wil ik mijn promotor Prof. Frank Baas en mijn co-promotors Prof. Pran K.

Das en Dr. Valeria Ramaglia bedanken voor hun steun gedurende mijn

promotietraject.

Frank, bedankt dat je me in jouw lab de ruimte hebt gegeven me te ontwikkelen tot

een goede onderzoeker. Ik mocht tijd vrijmaken om een persoonlijke beurs aan te

vragen, congressen/bijeenkomsten bij te wonen en contacten te leggen met andere

wetenschappers. Onze discussies over mijn wetenschappelijke data zijn zeer

waardevol geweest voor mijn onderzoeken. Ik heb veel geleerd van jouw kritische

blik en dit waardeer ik enorm. Bedankt!

Pran, thank you for sharing your expertise on leprosy with me. I appreciate the time

and effort you invested in me. I know you don’t like to work with computers, that is

why we had long discussions over the phone about the papers before they got

published. The conversations were really informative and helped me deliver good

research. Yelling on the phone, was not really necessary. You were just in

Birmingham I can hear you through the phone, really I can!! :D

Kees, je straalt altijd een gevoel van rust uit. Bedankt dat je altijd ZEN bent geweest,

op momenten dat het even hectisch was :). Je hebt mij geleerd dat ik me niet zo druk

moet maken en dat alles goed komt! Ik heb ook veel genoten van onze interessante

gesprekken over, dat veel sporten niet gezond is en dat er niet veel voor ons zal

veranderen als Donald Trump president wordt. Ik wil je natuurlijk ook bedanken dat ik

deel uit mocht maken van een belangrijk moment in je leven, je bruiloft met Juliejet!

Valeria, thank you for introducing me to the world of complement activation in the

peripheral nerves. You were really helpful at the beginning of my PhD! I also enjoyed

the time that we spent at the gym and of course shopping for nice clothes and shoes!

Thank you!

Prof. Dirk Troost, bedankt dat je me met open armen hebt ontvangen op je afdeling.

Je stond altijd open voor het bespreken van mijn data en kwam altijd met goede

inzichten in hoe iets beter kan. Ik heb veel van je geleerd en je bent een enorme

steun geweest!

Prof. Eleonora Aronica, je stond altijd voor mij klaar zodra ik materiaal nodig had voor

mijn onderzoek. Bedankt voor de beminnelijke manier waarop je mij te hulp schoot,

zonder jou was mijn ALS onderzoek niet zo efficiënt verlopen! Grazie!

Als ik aan de neuropathologie afdeling denk, dan sta ik meteen stil bij de koffietijd.

Dirk, alle leuke verhalen over de wetenschap van tegenwoordig en jouw investment

avonturen in het buitenland vond ik geweldig!

Lieve Astrid, bedankt dat je me altijd begroette met een grote glimlach en dat er altijd

plek voor me was tijdens de koffietijd :-). Ik wil je enorm bedanken voor je oprechte

interesse in mij en mijn onderzoek. Ik heb altijd genoten van onze gezellige

gesprekjes. Je bent echt een lieverd!

René, als ik aan de neuropathologie afdeling denk dan ben jij niet te missen! Toen ik

net begon met mijn promotietraject had ik geen idee wat materiaal plakken of snijden

inhield. Bedankt dat je me de microtoom hebt leren gebruiken! Je had veel geduld en

was er altijd om mij te helpen, zelfs als je het heel erg druk had. Ik vond het jammer

dat je het AMC verliet, maar gelukkig hoefde ik je niet te missen! Samen met Loesje

pannenkoeken eten, wandelingen maken en naar Arabische muziek luisteren.

Bedankt voor alle gezellige momenten!

Jasper, bedankt voor alle gezellige gesprekken tijdens de koffietijd en natuurlijk voor

alle antilichamen die ik kwam ‘’lenen’’.

Wijze Clifton, jij bent er altijd als ik hulp of advies nodig heb! Zelfs als je geen tijd hebt

of ziek bent krijg ik nog een uitgebreide e-mail over hoe ik het beste het een en ander

kan aanpakken. Bedankt dat je me verder helpt in het leven!

Anand, zelfs bij de laatste loodjes heb jij nog de tijd genomen mijn introductie en

artikel door te lezen. Ik heb daar zeker wat aan gehad, bedankt!

270

Dankwoord

Bram, jij bent er altijd als ik iets nodig heb op de pathologie afdeling; materiaal uit het

archief, kleuringen of coupes. Je zegt nooit NEE. Ik vraag me soms af of je bang

voor me bent :D. Bedankt, je bent een held!

Zonder de hulp van en de energieke sfeer in de genoom analyse afdeling was dit

proefschrift er niet geweest. Ik wil daarom al mijn collega’s in het lab bedanken. Ik

heb veel genoten van de lab lunches, waar we allen bijeenkwamen en een gezellige

tijd hadden.

Ruud, Patrick, Linda, Ferry, Jeroen, Anneloor, Marjan, Fred, Suze, Ted, Marja en

Lydia bedankt voor alle gezellige gesprekken tijdens de koffie!

Van de ‘’oude’’ generatie PhD studenten wil ik bedanken: Marleen, Joeri, Diana,

Hyung, Judith en Yasmin.

Marleen bedankt voor de kerstmarkt wandelingen in het AMC en je mentale support

tijdens mijn promotie. Je stond altijd klaar om gezellig te babbelen over het

onderzoek, je lievelingssport en je studententijd. Ik heb erg genoten van je verhalen

en vond het een eer om aanwezig te mogen zijn op je bruiloft. Ik kom je zeker

binnenkort opzoeken als de kleine er is!

Hyung, bedankt dat je een positieve bijdrage aan de sfeer in de kamer gaf met je

gezang en je apensprongen.

Joeri, bedankt voor het samen vieren van onze verjaardagen en je leuke grappen. Ik

zal nooit meer je opmerking ’’ alles kan stuk’’ vergeten.

De ‘’nieuwe’’ generatie PhD studenten: Iliana, Johanna, Veerle, Bart, Tessa, Anna,

Ghazaleh en Celine. Dank jullie wel voor de werkgerelateerde en niet-

werkgerelateerde discussies. Ook wil ik jullie bedanken voor de gezelligheid tijdens

de ‘’pizza dagen’’ en natuurlijk alle leuke gesprekken in de ‘’pizza app’’.

Iliana, moromouuuuuu thanks for getting me so excited about the cells you see under

the microscope. I love your passion for your sections, it’s like family! I also enjoy(ed)

all our coffee breaks, great conversations and being a part of your wedding! I’m not

going to miss you, because we are good friends and we will for sure stay in touch!

Filakia!

Tessa, bedankt dat je altijd zo vrolijk en positief bent! En niet te vergeten, je niest

altijd op het juiste moment! Ik vond het leuk om in Griekenland jou en Xavier beter te

leren kennen :D.

Anna, bedankt dat je alle hoelahoep ervaringen met ons wilde delen in de aio kamer!

Lou, jouw levendigheid ga ik echt missen!! Bedankt voor de gezelligheid, je bent

zeker één van mijn favoriete collega’s :D. Ik vond het leuk om al jouw vakantie- ,

klusjes- en werkverhalen te horen. Maar, wat ik ook leuk vond waren de momenten

waarop ik jou lastig viel of andersom :- ).

Mamaaaa Mia, zonder al het werk wat jij voor het lab doet/betekent zou ik mijn werk

niet efficiënt kunnen uitvoeren. Bedankt voor alle bestellingen, notulen, oplossingen

voor alle problemen en natuurlijk dat je voor een lange tijd onze lab lunches hebt

georganiseerd! You make life easier!

Marit, ik heb je de laatste jaren leren kennen als een sterke vrouw. Bedankt voor de

gesprekken en natuurlijk je gezang op het lab!

Susan, dank je wel voor je humor en dat je me zo nu en dan een cracker met

geitenkaas voert!

Martin, jij bent echt een persoon die de juiste grappen maakt op het juiste moment!

Keep calm and ….Dank je wel daarvoor!

Olaf, bedankt dat ik altijd herinnerd werd aan lunchtijd zodra jij de aio kamer

binnenloopt!

Jelly, het is algemeen bekend, maar ik zeg het toch maar je bent knettergek!

Natuurlijk in een positieve zin :), bedankt voor al je droge humor!

Carin, bedankt dat je altijd open stond voor een gesprek en een luisterend oor bood.

Ik wil alle studenten bedanken voor hun harde werk, waarmee ze zeker een bijdrage

hebben geleverd aan mijn onderzoek.

Rob, ik wil je bedanken voor alle leuke gesprekken over je talent, koken! Ik ben blij

dat ik je een beetje kon helpen met je gerechten uit de Marokkaanse keuken!

271

Bram, jij bent er altijd als ik iets nodig heb op de pathologie afdeling; materiaal uit het

archief, kleuringen of coupes. Je zegt nooit NEE. Ik vraag me soms af of je bang

voor me bent :D. Bedankt, je bent een held!

Zonder de hulp van en de energieke sfeer in de genoom analyse afdeling was dit

proefschrift er niet geweest. Ik wil daarom al mijn collega’s in het lab bedanken. Ik

heb veel genoten van de lab lunches, waar we allen bijeenkwamen en een gezellige

tijd hadden.

Ruud, Patrick, Linda, Ferry, Jeroen, Anneloor, Marjan, Fred, Suze, Ted, Marja en

Lydia bedankt voor alle gezellige gesprekken tijdens de koffie!

Van de ‘’oude’’ generatie PhD studenten wil ik bedanken: Marleen, Joeri, Diana,

Hyung, Judith en Yasmin.

Marleen bedankt voor de kerstmarkt wandelingen in het AMC en je mentale support

tijdens mijn promotie. Je stond altijd klaar om gezellig te babbelen over het

onderzoek, je lievelingssport en je studententijd. Ik heb erg genoten van je verhalen

en vond het een eer om aanwezig te mogen zijn op je bruiloft. Ik kom je zeker

binnenkort opzoeken als de kleine er is!

Hyung, bedankt dat je een positieve bijdrage aan de sfeer in de kamer gaf met je

gezang en je apensprongen.

Joeri, bedankt voor het samen vieren van onze verjaardagen en je leuke grappen. Ik

zal nooit meer je opmerking ’’ alles kan stuk’’ vergeten.

De ‘’nieuwe’’ generatie PhD studenten: Iliana, Johanna, Veerle, Bart, Tessa, Anna,

Ghazaleh en Celine. Dank jullie wel voor de werkgerelateerde en niet-

werkgerelateerde discussies. Ook wil ik jullie bedanken voor de gezelligheid tijdens

de ‘’pizza dagen’’ en natuurlijk alle leuke gesprekken in de ‘’pizza app’’.

Iliana, moromouuuuuu thanks for getting me so excited about the cells you see under

the microscope. I love your passion for your sections, it’s like family! I also enjoy(ed)

all our coffee breaks, great conversations and being a part of your wedding! I’m not

going to miss you, because we are good friends and we will for sure stay in touch!

Filakia!

Dankwoord

Tessa, bedankt dat je altijd zo vrolijk en positief bent! En niet te vergeten, je niest

altijd op het juiste moment! Ik vond het leuk om in Griekenland jou en Xavier beter te

leren kennen :D.

Anna, bedankt dat je alle hoelahoep ervaringen met ons wilde delen in de aio kamer!

Lou, jouw levendigheid ga ik echt missen!! Bedankt voor de gezelligheid, je bent

zeker één van mijn favoriete collega’s :D. Ik vond het leuk om al jouw vakantie- ,

klusjes- en werkverhalen te horen. Maar, wat ik ook leuk vond waren de momenten

waarop ik jou lastig viel of andersom :- ).

Mamaaaa Mia, zonder al het werk wat jij voor het lab doet/betekent zou ik mijn werk

niet efficiënt kunnen uitvoeren. Bedankt voor alle bestellingen, notulen, oplossingen

voor alle problemen en natuurlijk dat je voor een lange tijd onze lab lunches hebt

georganiseerd! You make life easier!

Marit, ik heb je de laatste jaren leren kennen als een sterke vrouw. Bedankt voor de

gesprekken en natuurlijk je gezang op het lab!

Susan, dank je wel voor je humor en dat je me zo nu en dan een cracker met

geitenkaas voert!

Martin, jij bent echt een persoon die de juiste grappen maakt op het juiste moment!

Keep calm and ….Dank je wel daarvoor!

Olaf, bedankt dat ik altijd herinnerd werd aan lunchtijd zodra jij de aio kamer

binnenloopt!

Jelly, het is algemeen bekend, maar ik zeg het toch maar je bent knettergek!

Natuurlijk in een positieve zin :), bedankt voor al je droge humor!

Carin, bedankt dat je altijd open stond voor een gesprek en een luisterend oor bood.

Ik wil alle studenten bedanken voor hun harde werk, waarmee ze zeker een bijdrage

hebben geleverd aan mijn onderzoek.

Rob, ik wil je bedanken voor alle leuke gesprekken over je talent, koken! Ik ben blij

dat ik je een beetje kon helpen met je gerechten uit de Marokkaanse keuken!

272

BEDANKT ALLEMAAL!! Ik heb altijd met veel plezier met jullie samengewerkt en ga

jullie zeker missen!

Dr. Marcos Virmond, thank you for giving me the opportunity to work in your lab in

Bauru. I discovered a lot of animals on the campus and had a great time!

Patricia, thank you for all your help during my PhD and of course my experience of

celebrating Christmas in the summer with your family in Sao Paulo. Cleverson, thank

you for teaching me a lot about leprosy pathology!

Gina thank you for taking the time to make the cover for my book. It is beautiful!

Lieve Maarten, Ik was blij dat ik weer in het AMC kwam werken, dan hadden we weer

vaker contact. Dank je wel dat je me tijdens mijn stage de weg hebt gewezen op het

Virologie lab, ik heb veel van je geleerd! Vergeet niet je camera mee te nemen

tijdens mijn promotie!

Ik wil ook al mijn lieve vrienden bedanken: Monique, Yodith, Carmen, Nancy, Wilma,

Meryam, Svetle, Iliana en Ken, bedankt voor alle gezellige momenten en alle steun!

Derphartox, Q.M. Gastmann Wichers stichting, Leprastichting, bedankt voor het

financieel ondersteunen van het drukken van mijn proefschrift!

Uiteraard wil ik de NWO en de Leprastichting bedanken voor het financieren van mijn

promotietraject.

Ik wil de promotiecommissie bedanken voor de tijd die ze gestoken hebben in het

beoordelen van mijn proefschrift.

Mijn dankwoord is natuurlijk niet compleet zonder mijn lieve ouders, broer en zusje.

Ik wil hen bedanken voor alle steun tijdens mijn promotietraject en natuurlijk al de

jaren ervoor. Van jongs af aan heb ik ervan gedroomd een bijdrage te leveren aan

patiënten. Ik ben nu ´´Dr. Nawal Bahia El Idrissi´´ geworden. Mama en papa, bedankt

dat jullie me hebben geleerd dat alles mogelijk is als je er echt voor gaat! en Lieve

broer, bedankt voor al je nuchtere adviezen en humor! Zussieee, bedankt voor alle

gezelligheid die we samen hebben, films, reizen, uiteten en natuurlijk je ’’business

mind set’’, ik leer veel van je! Ik weet dat ik altijd bij jullie terecht kan en dat is fijn. Ik

hou van jullie!!

PhD portfolio

Name PhD student: N. Bahia el Idrissi

Name PhD supervisor: Prof. F. Baas

1. PhD training

Courses organized by ONWAR or AMC Year Workload (hrs)

Introductory course ONWAR 2010-2014 15

Swammerdam Lectures 2010-2016 20

AMC world of science 2010 24

ONWAR retreat 2010-2014 75

Laboratory safety 7

Laboratory animal science (art.9) 2011 100

Macroscpic, microscopic and pathologic

anatomy of the mouse

2011 32

Functional neuroanatomy 2012 40

Degenerative diseases of the nervous

system

2012 40

Grant writing March 2012 50

Molecular neurobiology 2013 56

Scientific writing in english 2014 50

BROK GCP 2016 34

Dankwoord

PhD Portfolio

273

BEDANKT ALLEMAAL!! Ik heb altijd met veel plezier met jullie samengewerkt en ga

jullie zeker missen!

Dr. Marcos Virmond, thank you for giving me the opportunity to work in your lab in

Bauru. I discovered a lot of animals on the campus and had a great time!

Patricia, thank you for all your help during my PhD and of course my experience of

celebrating Christmas in the summer with your family in Sao Paulo. Cleverson, thank

you for teaching me a lot about leprosy pathology!

Gina thank you for taking the time to make the cover for my book. It is beautiful!

Lieve Maarten, Ik was blij dat ik weer in het AMC kwam werken, dan hadden we weer

vaker contact. Dank je wel dat je me tijdens mijn stage de weg hebt gewezen op het

Virologie lab, ik heb veel van je geleerd! Vergeet niet je camera mee te nemen

tijdens mijn promotie!

Ik wil ook al mijn lieve vrienden bedanken: Monique, Yodith, Carmen, Nancy, Wilma,

Meryam, Svetle, Iliana en Ken, bedankt voor alle gezellige momenten en alle steun!

Derphartox, Q.M. Gastmann Wichers stichting, Leprastichting, bedankt voor het

financieel ondersteunen van het drukken van mijn proefschrift!

Uiteraard wil ik de NWO en de Leprastichting bedanken voor het financieren van mijn

promotietraject.

Ik wil de promotiecommissie bedanken voor de tijd die ze gestoken hebben in het

beoordelen van mijn proefschrift.

Mijn dankwoord is natuurlijk niet compleet zonder mijn lieve ouders, broer en zusje.

Ik wil hen bedanken voor alle steun tijdens mijn promotietraject en natuurlijk al de

jaren ervoor. Van jongs af aan heb ik ervan gedroomd een bijdrage te leveren aan

patiënten. Ik ben nu ´´Dr. Nawal Bahia El Idrissi´´ geworden. Mama en papa, bedankt

dat jullie me hebben geleerd dat alles mogelijk is als je er echt voor gaat! en Lieve

broer, bedankt voor al je nuchtere adviezen en humor! Zussieee, bedankt voor alle

gezelligheid die we samen hebben, films, reizen, uiteten en natuurlijk je ’’business

mind set’’, ik leer veel van je! Ik weet dat ik altijd bij jullie terecht kan en dat is fijn. Ik

hou van jullie!!

PhD portfolio

Name PhD student: N. Bahia el Idrissi

Name PhD supervisor: Prof. F. Baas

1. PhD training

Courses organized by ONWAR or AMC Year Workload (hrs)

Introductory course ONWAR 2010-2014 15

Swammerdam Lectures 2010-2016 20

AMC world of science 2010 24

ONWAR retreat 2010-2014 75

Laboratory safety 7

Laboratory animal science (art.9) 2011 100

Macroscpic, microscopic and pathologic

anatomy of the mouse

2011 32

Functional neuroanatomy 2012 40

Degenerative diseases of the nervous

system

2012 40

Grant writing March 2012 50

Molecular neurobiology 2013 56

Scientific writing in english 2014 50

BROK GCP 2016 34

PhD Portfolio

274

Presentation during Master classes Year Workload (hrs)

Master class held by Prof. Robert Modlin.

Title Presentation: The role of the complement

system in nerve damage in Leprosy.

2011 5

Pathology research day held by Prof. Eleonora

Aronica.

Title Presentation: Role for Complement in nerve

damage in leprosy.

2012 5

Master class held by Prof. Paul Morgan.

Title Presentation: Complement levels in serum

samples of leprosy patients.

2012 5

Conferences Year

PNS conference Maryland Baltimore, US 2011

Conference Complement in human diseases, Leiden, Netherlands 2011

12th Brazilian Congress of Leprosy, Maceio, Brazil 2011

XXIV International Complement Workshop, Chania, Crete, Greece 2012

International leprosy conference, Brussels, Belgium 2013

Retreats Year

FBI Immunology retreat, Egmond aan zee, Netherlands 2011

Genetics retreat 2013


Meetings Year

NLR Leprosy meeting 2010-2015

Scientific ALS meeting Utrecht (ALS centrum) 2014

Weekly departement meeting 2010-2016

Journal club 2010-2016

Groupmeetings 2010-2016

Collaborations Year Workload (hrs)

Lauro Souza Lima Institute, Bauru-SP, Brazil 2011 105

2. Teaching

Tutoring and supervising Year

Supervising bachelor students 2012-2014

Supervising Sanne Bosch: Complement activation at the end-

plates of ALS donors.

2012-2013

3. Grants

Personal grant Organization Year Amount

Mozaiekbeurs NWO 2012 € 200.000

PhD Portfolio

275

Presentation during Master classes Year Workload (hrs)

Master class held by Prof. Robert Modlin.

Title Presentation: The role of the complement

system in nerve damage in Leprosy.

2011 5

Pathology research day held by Prof. Eleonora

Aronica.

Title Presentation: Role for Complement in nerve

damage in leprosy.

2012 5

Master class held by Prof. Paul Morgan.

Title Presentation: Complement levels in serum

samples of leprosy patients.

2012 5

Conferences Year

PNS conference Maryland Baltimore, US 2011

Conference Complement in human diseases, Leiden, Netherlands 2011

12th Brazilian Congress of Leprosy, Maceio, Brazil 2011

XXIV International Complement Workshop, Chania, Crete, Greece 2012

International leprosy conference, Brussels, Belgium 2013

Retreats Year

FBI Immunology retreat, Egmond aan zee, Netherlands 2011



Meetings Year

NLR Leprosy meeting 2010-2015

Scientific ALS meeting Utrecht (ALS centrum) 2014

Weekly departement meeting 2010-2016

Journal club 2010-2016

Groupmeetings 2010-2016

Collaborations Year Workload (hrs)

Lauro Souza Lima Institute, Bauru-SP, Brazil 2011 105

2. Teaching

Tutoring and supervising Year

Supervising bachelor students 2012-2014

Supervising Sanne Bosch: Complement activation at the end-

plates of ALS donors.

2012-2013

3. Grants

Personal grant Organization Year Amount

Mozaiekbeurs NWO 2012 € 200.000

pure.uva.nl · Complement in neuroinﬂ ammation: Studies in leprosy and Amyotrophic Lateral...

Documents

Transcript of pure.uva.nl · Complement in neuroinﬂ ammation: Studies in leprosy and Amyotrophic Lateral...