Published byDr. M.M. MUSTAFFADirector

Compiled & Edited byDr. M.M. MustaffaDr. B. PadmanabanDr. V. PandeyDr. Mayil VagananMr. P. Ravichamy

Hindi Translation byDr. V. Pandey

Photographs byMr. P. Ravichamy

Cover PageDr. M.M. Mustaffa & Mr. P. Ravichamy

Correct CitationAnnual Report 2009-'10National Research Centre for BananaThayanur Post, Thogamalai RoadTiruchirapalli - 620 102Tamil Nadu

Printed atSri Sakthi Promotional Litho ProcessS.F. No. 283, Masaniamman Nagar, Anna Nagar EastCoimbatore - 641 025.Tel : 0422-2450133, 2403500E-mail : sakthi_press@yahoo.co.in

CONTENTS

Sl. No. Particulars Page No.

1. Preface

2. Executive Summary in Hindi 1

3. Executive Summary 5

4. Introduction 8

5. Research Achievements 11

5.1 Crop Improvement 11

5.2 Crop Production 23

5.3 Crop Physiology, Biochemistry and PHT 25

5.4 Crop Protection 29

5.5 Exter na lly Funded Projects 36

6. Technology Assessed and Transferred 40

7. Education and Training 41

8. Awards and Recognitions 42

9. Linkages and Collaborations in India and Abroad 44

10. Publications 44

11. Consultancy Services and Commercialization 50of Technologies

12. RAC, IMC and IRC 50

13. Trainings/ Workshops/ Seminars/ Summer Courses/ 52Meetings Attended by Scientists

14. Seminars/ Meetings/ Workshops/ Conferences/ Summer 58Institutes and Farmers Training Organized at the Centre

15. Distinguished Visitors 61

16. Empowerment of Women 62

17. Personnel 62

18. Other Informations 64

Annexure -I 65

Annexure -II 66

PREFACE

It is my pleasure to present the Annual Report for the year 2009-10. During the year, theCentre has developed many innovative technologies and products to increase the productivityand profitability of the banana farmers in India. Banana has witnessed significant increasein area and production. The production has reached 26.21 million tonnes during the lastyear. A change in the climate causing un-seasonal rains and drought was witnessed duringthe last year and the Centre has taken initiatives to mitigate the climate changes in terms ofdrought and has re-oriented the research programs accordingly.

The Centre has progressed well during the reporting period and the salient researchachievements are presented in this annual report. With an aim to reduce the cost of productionof Tissue Culture banana plants, initiatives are made to use low cost alternate materials likeR.O. water, sago and table sugar which could produce the micro-propagated plants effectivelyat a lower cost. In addition, macro propagation techniques utilizing decortication has beenstandardized for faster multiplication of traditional varieties by the farmers themselves.

The production group has come out with many improved production techniques to reducethe cost of cultivation and also to increase the productivity and profitability of the farmersespecially in Udhayam banana. Studies have indicated that use of bentonite sulphur hasincreased the fertilizer use efficiency of the applied fertilizers with higher up take of nutrients,thereby the yield can be increased. Phenotyping and molecular indicators have been identifiedfor evaluating drought resistance in banana and also for salt stress.

In the area of protection, semio-chemicals have been identified as attractant for corm andstem weevils which are the major pests in banana. α- bisabol-ol and 2-methyl-4-heptanolhave shown promising results in attracting corm and stem weevils respectively. Applicationof VAM along with Paeciliomyces lilacinus and Trichoderma viride simultaneously reduced thenematode population in Ney Poovan banana. Effective endophytic organisms have beenidentified against Fusarium pathogen. Molecular characterization of Foc pathogens has beencompleted and efforts are on for the effective control of Fusarium wilt disease in bananausing bio-control agents.

Standardized techniques for the simultaneous detections of banana viruses using RealTime PCR and poly-clonal antiserum for recombinant coat protein of Bract Mosaic Virushave been initiated. Complete genome of Bract Mosaic Virus isolated from Nendran bananahas been sequenced with 9711 nucleotides. Efforts to produce transgenic plants against bananaBunchy Top Virus in Hill Banana is in progress.

During the year the Centre has organized a Kissan Mela and "Brain Storming Session onBanana Value Addition and Post Harvest Technology" for the benefit of the farmers andentrepreneurs. Progressive banana farmers' awards were given to the farmers andentrepreneurs. In addition, the Centre has organized a "National Conference on Productionof Healthy Planting Material in Banana" at Jalgaon, Maharashtra in which more than 400farmers have participated and were benefited. One National Consultative Meeting on "Disease

diagnostics in Horticultural Crops" was organized at this Centre and more than 30 leadinghorticulture virologists have participated in the meeting.

Under HRD programme, two scientists were deputed to Guangzhou, China to attend the"International Banana Symposium on Global Perspective on Asian Challenges" and onescientist to San Diego, USA to attend "Plant and Animal Genome XVIII Conference".

The Centre has participated in many conferences and seminars for the transfer oftechnology to the farmers. One off-campus training at Agartala, Tripura and seven on-campustraining programmes were organized as a part of HRD activity and more than 8000 bananasamples were tested for viruses under contract research activity.

I specially appreciate and acknowledge Dr.B.Padmanaban, Principal Scientist,Dr.V.Pandey, Principal Scientist and Dr.M.Mayilvaganan, Senior Scientist, Chairman andmembers of the Publication Committee respectively for preparation and bringing out thisAnnual Report in a befitting manner.

I would like to place on record the guidance and encouragements received from Dr. H. P.Singh, Deputy Director General (Horticulture), ICAR and Dr. Mangala Rai, Former DirectorGeneral, ICAR, New Delhi.

(M.M. Mustaffa)Director

Tiruchirapalli

07-07-2010

NR

CB

Ann

ual

Rep

ort

2009

-'10

1

2 dk;Zdkjh lkjka’kdk;Zdkjh lkjka’kdk;Zdkjh lkjka’kdk;Zdkjh lkjka’kdk;Zdkjh lkjka’k

Vúbk\k bknSkk@

ÉkkQklYkAù .^kg lçPmZkAù||À| bk|kvPkx bkvù Avù\kv Avù 31 b^kRv#km HkTkTk

æ^Zkkx Aùk bkgCk|c PQkk ¢TP@kraK}mZk bP@ U@ä ¥aOk Vúbk\k bknSkk@ AvùTæä

Wkv†\HkZkYk bkv 72 l^kRv#km HkTkTk æ^Zk bkgCk|ckx Aùkv ÉkkÈk lAùZkk CkZkk‹ PmTk

bkkw Rbk ¢TP@PYk HkTkTk æ^Zk bkgCk|ckx Avù Mm ¢kf‘bkm ¢k‘bkm @k£Wkkv

TZko†‘\kAù ¢Y\k Aùkv - 20° bkvCk|v PkUYkkTk U@ XkOMkl@P Aù@Avù @Bkk CkZkk

¢kw@ Rkv bkv PmTk ^kakr Aùm \kYWkm ¢^klSk PAù XkOMk@Ok Avù U#FkkP~ £TkAùm

CknOkk’YkAù †bQk@Pk Aùkv Xkm bknlTk†#FkP lAùZkk CkZkk‹ AùYk \kkCkP Aùm

¥PAù bkg^kSkrTk PAùTkmAù l^kAùlbkP Aù@Tkv Avù ÓùYk Ykx .vbkk UkZkk CkZkk lAù

ÉklP\kkvYk @bkkAùakrOk ÉklAùZkk bkv Ékk¶P bkkSkk@Ok Hk\kä Lkvbk URkQkr Avù l\k.

bkkWkoRkTkk Aùk FkoOkr (13%) ¢kw@ AùkWkrTk Avù bk|kvP Avù l\k. bkkSkk@Ok

#kAùr@k (3%) bkYknlFkP URkQkr cy‹ \kAùMjm Avù Wkn@kRv Aùkv RmDkr Ék^kSkrTk Avù

l\k. bkWkbkv ¢FGk ^kplá YkkSZkYk UkZkk CkZkk‹ ^kwbAnù\k@ ¢k@WkbAnù\k@

Ykk£Aùkv@k£Hkk Aùkv ¢Avù\kv Zkk £TMkv\k WZkoKkZkl@Aù ¢Y\k ¢kw@ .HkkvbUkZkl@\kYk

Avù bkkQk lYk\kkAù@ ^kplá YkkSZkYk Avù éU Ykx ¤UZkkvCk lAùZkv HkkTkv ^kk\kv

\kAùMjm Avù Wkn@kRv Ykx lYk\kkTkv bkv Aùl\kZkkx Aùm ^kplá Ykx bkPP bknSkk@ UkZkk

CkZkk‹

@bkQkk\km .^kg TkvTæTk lAùbYkkx Ykx bkkvYkwlKAù Xko|Ok WkTkTkv Avù l\k.

lU‘\kkv@kYk ¢kSkkl@P ^kplá YkkSZkYk ¢lSkAù bkdkYk UkZkk CkZkk‹ Xk|oOkHklTkP

Aùkvakk ¢^k\kYWkTk PAùTkmAù bkv WZkn’UklRP @bkQkk\km .^kg TkvTæTk lAùbYk Avù

UkwSkkx .^kg UnlÅkZkkx U@ ÉkdkvÇk R#kk¢kvg Ykx U@mdkOk bkv ekkP cn¢k lAù ¤UHk

Avù RplìAùkvOk bkv bkXkm P@c Avù UkwSkv .Aù bkYkkTk Qkv‹

KvK}kHkkvl\kZkYk ‘\kkv@k£M (0å1%) bkv ¤UFkkl@P Avù\kv Avù WkmHkkx

Avù XkOMk@Ok U@ ¢SZkZkTk bkv UPk Fk\kk lAù XkOMk@Ok Aùm ¢^klSk WkNjTkv

bkv ¢gAnù@Ok dkYkPk AùYk ckv HkkPm cw‹ bkgAùl@P Xk|oOkkx Aùm Pn\kTkk Ykxä

HkgCk\km Avù\kv Avù Xk|oOk ¢kbkkTkm bkv ¢gAnùl@P ckvPv UkZkv CkZkv ‹ ¢Ul@U‘^k

Xk|oOkkx Ykx Awù\kbkmAù@Ok ¢lSkAù UkZkk CkZkk Hkkv lAù Ul@U‘^kPk Aùk bP@

WkNjTkv Avù bkkQk bkXkm ÉkAùk@ Avù ^kplá YkkSZkYkkx Ykx DkKPk CkZkk‹ UoOkr éU

bkv l^kAùlbkP Xk|oOkkx Ykx Awù\kbkmAù@Ok Tkc{ cn¢k Wk†\Aù ^kkv bkmSkv UkwSkv Avù êU

Ykx l^kAùlbkP ckv CkZkv ‹ ¤’Ul@^kPrTk ÉkHkTkTk U@ ¢SZkZkTk bkv UPk Fk\kk

lAù ÉkZkkvCk#kk\km Aùm R#kk¢kvg Ykx Aù\\kv Avù YkpRoPAùkx Avù Ykn@Ikk @kvCk Avù ÉklP

ÉklP@kvSkAùPk U@ U@mdkOk Avù l\k. @kvCkAùk@m $ZkoHkvl@ZkYk VoúVúogR (ÉkHkklP

bkgBZkk 1) Aùk 3% bkg^kSkrTk GlTkP æ^k Aùk Yknn@kl#kHk .^kg bAnùCk ^kplá

YkkSZkYk Ykx lYkÌkOk UZkkrÈk ckvPk cw‹

¢kTkn^kgl#kAù bkgWkgSk YkkTklFkÇk PwZkk@ Aù@Tkv Avù RplìAùkvOk bkv lAùZkv

CkZkv ¢k@†YXkAù U@mdkOkkx bkv UPk Fk\kk cw lAù lçCknlOkP .. ( AA -

.‘ZkolYkTkkKk ) ¢kw@ WkmWkm (BB - Wk\WkmlbkZkkTkk) bkYkoc Ykx YkSZkYk éU bkv

l^klXkTTkPk.g Qk{ U@TPn ¢bkYkkTk ZknYYkTkHkPk Aùm Ék^kplÅk Avù Aùk@Ok ¢k@glXkAù

bkgPlPZkkxä Hkwbkv ÉkQkYk UmNjm Aùm bkgPlPZkkxä Aùkv Xkm ¢kTkn^kgl#kAù bkgUAùr

YkkTklFkÇk PwZkk@ Aù@Tkv Ykx ^Zk^kck@ Ykx \kkZkk Hkk bkAùPk cw‹ Xkk@P

bk@Aùk@ Avù Hkw^k PAùTkmAù l^kXkkCk Aùm YkkTZkPk ÉkkÈk U@mdkOk ÉkZkkvCk#kk\kk¢kvg

Aùm YkkTkAù AùkZkr l^klSkZkkx Aùk ¢Tknbk@Ok Aù@Avùä ¢k£r .bk .bk ¢k@

lFkTcAùkx Avù ÉkZkkvCk bkv Avù\kv Aùm ¢kTkn^kgl#kAù #knáPk YkkUTkv Aùm l^klSkZkkx

Aùk YkkTkAùmAù@Ok lAùZkk CkZkk ‹

DkKTk#km\k CkkvUTkmZk Aùkvak (bkÉkvl#k^k bkWkK}w†‘K^k \kk£Wk|v@m) PAùTkmAù

Aùk ¢^k\kYWkTk Aù@Avùä KmAùkAù@Ok Avù GL^kx lRTkä Avù\kv Aùm AùkQkkvr†YWkZkYk

lAùbYk Aùm HkMjkv bkv HkMj SkWWkk bkoÇkApùlYk (ÉkwKm\kxAùbk AùkVúm) Avù 1400

bkgCk|c bQkklUP lAùZkv CkZkv cy‹ £bk bkgCk|c Ykx bkv 91 ‘\kkvTbk Aùk ÓùYkkgAùTk

lAùZkk CkZkk cw lHkTkAvù Wk\kkbK .‘bk l^k#\kvakOk bkv UPk Fk\kk cw lAù

\kCkXkCk 13% HkmTk bkoÇkApùlYk ÉklP@kvSkm Zkk ÉklP@dkk bkgWkgSkm HkmTk bkv

ÉkXkkl^kP Qkv‹ £TkYkx bkv YZkobkk ^kg#k Avù YkvKw\kkvQkkZkkvlTkTk ^kCkr (92%) ¢kw@

¢Y\kmZk Aùk£lKTkvHk ^kCkr III (75%) Avù Rkv HkmTkä ÉklPAoù\k XkkwlPAù

¢^kbQkk¢kvg bkv bkYWk†TSkP Qkv‹

Awù\kkv@mYkmlK}Aù .^kg l@Zk\k Kk£Yk Um bkm ¢k@ l^k#\kvakOkkx bkvä

Ykk£AùkvbVúm@v\\kk ZkoYZkoHkm TkkYkAù UÅkm SkWWkk @kvCkAùk@m VúVogúR bkv bkgÓùlYkP

ckvTkv Avù 10 bkv 36 DkOKkx Aùm ¢^klSk Ykxä bkVúk£rAùk@m AwùKv\kvHkä U@kt‘bkmMvHk

¢kw@ Ukt\kmlVúTkk\k ¢k‘bkmMvHk £THkk£Yk~bk Aùm bklÓùZkPk bkWkbkv ¢lSkAù

ckvTkv Aùk UPk Fk\kk‹

Vúbk\k ¤’UkRTk

"¤RZkYk" ÉkHkklP Avù UkwSkkx Aùkv AùYk Ro@Pk U@ @kvUOk Aù@Tkv bkv

UkwSkkx Aùm ¥gFkk£r Ykx WkNjkvÅk@m cn£r U@TPn Dkw@ lTkAù\kTkv Ykx l^k\kYWk (472å9

lRTk) ¢kw@ Dkw@ Avù ^kHkTk Ykx AùYkm HkWklAù ¤’UkRTk (72å1 KTkÖcvå) Ykx

Pn\kTkk’YkAù êU bkv ¢lSkAù Ro@Pk U@ @kvUOk Aùm ¢UvGk bknSkk@ RvBkk

CkZkkå Vú\k ¤’UkRTk Aùkv lAù\kkvCk|kYk ÉklP cv‘KvZk@ ÉklP lRTk Avù ¢kSkk@

U@ ¢kgAùl\kP Aù@Tkv U@ Zkc UkZkk CkZkk lAù ¢lSkAù UkwSk bkDkTkPk U@

Vú\k ¤’UkRTk (115å54 lAùCk|kÖcvåÖlRTk)ä AùYk UkwSk bkDkTkPk Aùm ¢UvGk

Pn\kTkk’YkAù êU bkv ¢lSkAù cn¢k‹ UkwSk @kvUOk Aùm bkDkTkPk WkNjTkv U@ Avù\kv

Avù HkMjkx Avù ¢kbkYkkbk Aùm lYkK~Km Ykx Ck|glQk\k bkoÇkApùlYk Aùm bkgBZkk Ykx

WkNjkvÅk@m UkZkm CkZkm ‹

"¤RZkYk" lAùbYk Aùm Uc\km @kvUOk Vúbk\k Ykx ÉklP UkwSkk 200 Ck|kYk

TkÇkHkTk + 400 Ck|kYk UkvKvl#kZkYk ^Zk^kck@ Aù@Tkv U@ UkwSkkx Aùm ¥fFkk£r

¢kw@ PTkv Aùm YkkvKk£r bkWkbkv ¢lSkAù UkZkm Ck£r ‹ ¢lSkAù ¤^kr@Aù (400

Ck|kåÖTkÇkHkTk + 500 Ck|kYk UkvKwl#kZkYkÖUkwSkk) ^Zk^kck@ Aù@Tkv U@ UÅkm Ykx

bkYUoOkr c@mlPYkk Aùm YkkÇkk (2å86 lYkCk|kå Ö Ck|kYk PkHkm UÅkm Aùk Xkk@)

bkWkbkv ¢lSkAù UkZkm CkZkm ‹ bkWkbkv ¢lSkAù Dkw@ Aùk ^kHkTk (31å1 lAùCk|kå)

400 Ck|kYk TkÇkHkTk + 400 Ck|kYk UkvKwl#kZkYk ÉklP UkwSkk Avù ^Zk^kck@ bkv

Ékk¶P cn£r‹ UkwSkkx Ykx @kbkkZklTkAù ¤^kr@Aùkx Avù ÉkZkkvCk Aùm YkkÇkk WkNjkTkv bkv

HkMjkx .^kg ¢kbkUkbk Aùm lYkK~Km Ykx HkMj Ck|glQk\k bkoÇkApùlYk Aùm bkgBZkk Ykx

AùYkm UkZkm CkZkm ‹

2

¤FFk Um .Fk YkkTk Aùm R#kk¢kvg Ykxä UkwSk @kvUOk Avù PmTk YkcmTkv Avù

WkkR 20 Ck|kYk ÉklP UkwSkk WkvTKkvTkk£K bk\Vú@ Avù YkpRk Ykx ÉkZkkvCk bkvä TkvTæTk

lAùbYk Avù UkwSkkx Aùm ¥fFkk£rä UlÅkZkkx Aùm bkgBZkkä UlÅkZkkx Aùk Anù\k

dkvÇkVú\kä ÉklP Dkw@ Vú\kkx Aùm bkgBZkkä Dkw@ Avù ^kHkTk ¢kw@ UlÅkZkkx Ykx

TkÇkHkTkä VúkbVúkv@bkä UkvKwl#kZkYkä Awù†\#kZkYkä YkvCTkml#kZkYk ¢kw@ bk\Vú@

Aùm YkkÇkk Ykx bknSkk@ RvBkk CkZkk‹ bk\Vú@ Avù bkkQk Vvú@bk bk\VvúK ¢kw@

zHkA ùbk\VvúK (Ék’ZkvAù 5 Ck|kYkÖUkwSkk) Aùk lYkK~Km Ykx ¢kw@ 0å5%Wkkv@v‘bk Avù UÅkm U@ lGMjAùk^k bkvä Dkw@ Avù ^kHkTk (12å5 lAùCk|k) Ykx

bkkSkk@Ok UkwSkkx Aùm Pn\kTkk Ykx 109å7 ÉklP#kP PAù Aùm WkNkjvÅk@m UkZkm

CkZkm‹ bk\Vú@ Avù ¤UZkkvCk bkvä Avù\kv Avù UkwSkkx Ykx UkvKwl#kZkYk FkZkkUFkZk Aùm

RdkPk Ykx Xkm bknSkk@ RvBkk CkZkk‹

¤^kr@Aù bkYkkZkkvHkTk bkYkmAù@Okkvx Avù ¢kSkk@ U@ Zkc ¢kgAùl\kP

lAùZkk CkZkk lAù Uo^kTk lAùbYk Aùm Robk@m Vúbk\k (Uc\km UvMjm) Ykx ÉklP

cv‘KvZk@ .Aù KTk Vú\k Aùm ¤UHk Ékk¶P Aù@Tkv Avù l\k. ÓùYk#k: 11å52ä

1å57 ¢kw@ 22å96 lAù\kkvCk|kYk TkÇkHkTkä VúkbVúkv@bk ¢kw@ UkvKvl#kZkYk Aùm

¢k^k#ZkAùPk ckvPm cw‹ £bkm P@c bkv AùUor@^k\\km lAùbYk Aùm Robk@m

(Uc\km UvMjm) Vúbk\k Ykx Xkm ÉklP cv‘KvZk@ .Aù KTk Vú\k Aùm ¤UHk Ékk¶P

Aù@Tkv Avù l\k. ÓùYk#k: 12å8ä 1å4 ¢kw@ 18å7 lAù\kkvCk|kYk TkÇkHkTkä

VúkbVúkv@bk ¢kw@ UkvKwl#kZkYk Aùm ¢k^k#ZkAùPk ckvPm cw‹ ¤U@kv‘P RkvTkkx

lAùbYkkx Aùm Robk@m Vúbk\k (Uc\km UvMm) Ykx lYkK~Kmä AùkWkrlTkAù BkkRkx ¢kw@

@kbkkZklTkAù ¤^kr@Aùkx Avù ^Zk^kck@ bkv lYk\kTkv ^kk\km TkÇkHkTkä VúkbVúkv@bk .^kg

UkvKwl#kZkYk Aùm YkkÇkk Avù ¢TknUkPkx Aùk Xkm ¢kgAù\kTk lAùZkk CkZkk‹

YkkTk^k YkoÇk Aùm 50 \kmK@ YkkÇkk Aùkv 500 \kmK@ UkTkm Ykx

lYk\kkAù@ä UkwSk @kvUOk Avù PmTk YkcmTkv U#FkkP bkv \kvAù@ Tkkw YkcmTkv PAù

Aùm G YkcmTkv Aùm ¢^klSk Ykx ÉklP bk¶Pkc bkYkkTknUklPAù éU bkv zbkFkk£r

UkTkm Avù bkkQk WkogR-WkogR zbkFkk£r UálP bkv ^Zk^kck@ Aù@Tkv bkvä Uo^kTk lAùbYk

Avù UkwSkkx Aùm ^kpláä Vú\kkx Aùm ¤UHk .^kg CknOk^kÅkk Ykx bknSkk@ RvBkk CkZkk

¢kw@ bkkQk-bkkQk ¤^kr@Aù Aùm ¢k^k#ZkAùPk Ykx Xkm 25 % PAù Aùm AùYkm

RvBkm CkZkm ‹ £bk P@c bkv Anù\k lYk\kkAù@ éå 45ä175Ö- ÉklP cv‘KvZk@

¢ksQkAù \kkXk Ékk¶P cn¢k lHkbkYkx éå 8ä925Ö- ¤^kr@Aùkx Aùm BkUP Ykx

WkFkP bkv ¢kw@ éå 36ä250Ö- Dkw@ Aùm WkHkTk Ykx WkNjkvÅk@m bkv #kklYk\k Qkk

‹ ÉklP UkwSkk 1å5 lAùCk|k Um .bk ¢kv 6 (.Aù P@c Aùm Anù‘AnùK Aùm

BkkR) ¢kw@ ÉklP cv‘KvZk@ 50ä000 \kmK@ Um .bk ¢kv 6 æ^kOk Avù bkkQk

¤^kr@Aùkx Aùm 75% YkkÇkk ^Zk^kck@ Aù@Tkv bkv Uo^kTk (2500 UkwSkk Ö

cv‘KvZk@) lAùbYk Avù UkwSkkx Aùm ^kkTkbUlPAù ^kplá Ykx bknSkk@ .^kg ¤UHk Ykx

32å29% PAù Aùm WkNjkvÅk@m UkZkm CkZkm ‹

UnlÅkZkkx bkv ^Zkn’UklRP UkwSkkx U@ ÉkvdkOkkx bkv UPk Fk\kk lAù 25-27°bkvCk|v ¢kwbkP PkUÓùYk .^kg 90% ¢kUvldkAù ¢kærPk U@ ÉklPbk¶Pkc bkWkbkv

¢lSkAù UlÅkZkkf (.Aù bkv ¢lSkA)ù lTkAù\k{ HkWklAù ¢kwbkP PkUYkkÇkk Ykx

25-27° bkvCk|v bkv AùYk ckvTkv bkv UlÅkZkkx Avù lTkAù\kTkv Aùm R@ Ykx AùYkm(ÉklPbk¶Pkc .Aù bkv AùYk) UkZkm CkZkm ‹

ÉklP Rbk \kkBk XkkCk UkTkm Ykx Rkv XkkCk Wk|kbkmTkkv\kk£M~bk ¢kw@ 25

XkkCk lHkWk| vl\kAù ¢Y\k Avù lYklÌkP æ^kOk Aùk l^kAùk#km\k Vú\kkx U@

lGMjAùk^k Aù@Tkv bkv “TkvZk Uo^kTk”ä “Uo^kTk” ¢kw@ “bkWkk” lAùbYkkx Avù Vú\kkx

Avù ¢kAùk@ Ykx bknSkk@k’YkAù ^kplá UkZkm CkZkm ‹ £bkm P@c bkv @kvWkbKk

Uo^kTkä TkvZk Uo^kTk ¢kw@ @bkQkk\km lAùbYk Avù l^k\kkbk#km\k Vú\kkx U@ 1å5 bkv

2å0 ÉklP#kP UkvKwl#kZkYk bk\VvúK Avù lGMjAùk^k bkv Vú\kkv Avù ¢kAùk@ Ykx

bknSkk@k’YkAù ^kplá UkZkm CkZkm‹

zbklFkP UkwSkkx Aùm Pn\kTkk Ykx (-0å27 bkv -0å36 YkvCkk UkbAù\k)

ÉkWk\k bkoBkv bkv Ck|lbkP YZkobkk Wk\WkmlbkZkkTkk HkklP ¢kw@ YkgQkTkä bkWkkä

Uo^kTkä Ck|kgM TkvTkv ¢kw@ TkvTæTk lAùbYk Avù UkwSkkx Aùm UlÅkZkkx Aùm @bk#km\kTk

lÓùZkk#km\kPk (-0å35 bkv - 0å77 YkvCkk UkbAù\k) Ykx ^kplá ¢kgAùm CkZkm‹

bkoBkk bknCk|kcm TkvTæTk lAùbYk Aùm Pn\kTkk Ykxä bkoBkk bklcaOkn “YZkobkk

Wk\WkmlbkZkkTkk” HkklP PQkk bkWkkä YkgQkTk ¢kw@ Uo^kTk ÉkHkklP Avù UkwSkkx Aùm

UlÅkZkkx Ykx Ékkv\kmTk Aùm YkkÇkk (240 - 290 lYkCk|kÖCk|kYk PkHkk Xkk@)ä

Aùkvl#kAùk lXklÅk †bQk@Pk bkoFkAùkgAù (68-70) ¢kw@ Anù\k UOkr c@mlPYkk

Aùm YkkÇkk ¢lSkAù UkZkm CkZkm ‹

Dkw@ lTkAù\kTkv ¢kw@ Vú\k Ul@U‘^k ckvPv bkYkZk bkoBkk bknCk|kcm TkvZk

Uo^kTkä TkvTæTk ¢kw@ @kvWkbKk ÉkHkklPZkkx (4å52 bkv 17å56) Aùm Pn\kTkk Ykxä

bkoBkk bklcaOkn bkWkk ¢kw@ AùUor@^k\\km lAùbYkkx Aùm UlÅkZkkx (YkSZk l#k@k .^kg

UÇk Vú\kAù) Ykx UkvKwl#kZkYk : bkkvlMZkYk Aùk ¢TknUkP ¢lSkAù (>200)

UkZkk CkZkk‹

YkpRk \k^kOkPk Aùm bknCk|kcm Ck|kgM TkvTkv lAùbYk Ykx .WklbklbkAù ¢Y\k

Avù lGMjAùk^k bkv UkwSkkx U@ ckvTkv^kk\kv YkpRk \k^kOkPk Avù ÉklPAoù\k ÉkXkk^kkx

Ykx AùYkm \kkTkk bkgXk^k ckv bkAùk‹ bkkSkk@Ok lYkK~Km Ykx £CkkZkv CkZkv UkwSkkx

Aùm ¥UvGkä YkpRk \k^kOkPk bkv ÉkXkkl^kP UkwSkkx Ykx \kCkXkCk 45 bkv 52 lRTk

l^k\kYWk bkv Dkw@ lTkAù\km‹ \k^kOkPk bknCk|kcm lAùbYkkx Aùm Pn\kTkk Ykxä bklcaOkn

“bkWkk” ¢kw@ “TkvZk Uo^kTk” lAùbYkkx Avù Vú\kkx Ykx lG\kAùk: CkoRk Aùk ¢TknUkP

¢kUvldkAù éU bkv ¢lSkAù Qkk‹ YkpRk \k^kOkPk ÉkXkkl^kP R#kk\kkx Ykx Avù\kv Avù

Vú\kkx Avù lG\kAùkx Ykx Anù\k #kAùr@k Aùm YkkÇkk ¢lSkAù UkZkm CkZkm lHkbkbkv

Zkc ÉkRs#kP cn¢k lAù ¢lP YkpRk \k^kOkPk bkv ÉkXkkl^kP R#kk¢kvx Ykx #kAùr@k

Aùk bKkFkr Ykx éUkTP@Ok ÉkXkk^km NgCk bkv Tkc{ ckv UkPk cw‹ bkoBkkCk|bP

U@TPnn l^kakkOkn @kvCk Avù \kdkOkkx bkv Ykn‘P UkwSkkx Aùm Pn\kTkk Ykxä bkoBkv bkv

ÉkXkkl^kP ¢kw@ Skk@mRk@ l^kakkOkn Avù @kvCkm \kdkOkkx bkv ÉkXkkl^kP UkwSkkx Aùm

UlÅkZkkx Ykx UOkr cl@lPYkk (3å36 lYkCk|kÖCkkYk b^kFG Xkk@) ¢kw@ Awù@kvlKTkkZkM

(0å323 lYkCk|kÖCk|kYk b^kFG Xkk@) Aùm YkkÇkk ¢UvGkApùP ¢lSkAù UkZkm

CkZkm‹

Avù\kv Avù UkwSkkx Aùm HkMjkx Ykxä HkMj SkWWkk bkoÇkApùlYk (ÉkwKm\kxAùbk

AùkVúm) Avù #knAù bkv KmAùkAù@Ok Avù 30 lRTk WkkRä bkoÇkApùlYk bknCkkcm

@kvWkbKk ¢kw@ TkvTæTk lAùbYkkx Aùm UlÅkZkkx Aùm ¢kUvldkAù ^kplá R@ Ykx AùYkm

RvBkm CkZkm HkWklAù ÉklP@kvSkm “¢Tkk£rAùkvYWkTk” .^kg “”ZkgCkYWkm Avù .Yk 5"”

lAùbYkx ¢ÉkXkkl^kP @c{‹ HkMj SkWWkk bkoÇkApùlYk Aùm bknCk|kcm “@kvWkbKk” .^kg

NR

CB

Ann

ual

Rep

ort

2009

-'10

3

“TkvTæTk” lAùbYkkx Aùm Pn\kTkk Ykx ÉklP@kvSkm “¢Tkk£rAùkvYWkTk” .^kg “ZkgCkYWkm

Avù .Yk 5” lAùbYkkx Aùm HkMkjx Ykx U@kt‘bkmMvHk £THkk£Yk Aùm lÓùZkk#km\kPk

Ykx KmAùkAù@Ok Avù bkkP lRTk WkkR PAù ¢kUvldkA éUù bkv ¢lSkAù ^kplá

UkZkm CkZkm‹ £bkm ÉkAùk@ bkv bkniCk|kcm @kvWkbKk ¢kw@ TkvTæTk lAùbYkkxx Aùm

¢Uvdkkä HkMj SkWWkk bkoÇkApùlYk ÉklP@kvSkm “¢Tkk£rAùkvYWkTk”¢kw@ “ZkgCkYWkm Avù

.Yk 5” lAùbYkkx Ykx Uk\kmlVúTkkt\k ¢k‘bkmMvHkä lVúTkkZk\k .\kkTkmTk\kk£ZkvHkä

lbkTTkvYkklZk\k ¢\Aùkvck\k lMckZkM}kvlHkTkvHkä l\k†CTkTkä l^k\kvZk lVúTkkl\k‘bkä

Ékkv.TQkkvbkkZkTkvMmTbk ¢kw@ KwlTkTk Aùm YkkÇkk Ykx Xkm Pn\kTkk’YkAù êU bkv

¢lSkAù ¢lXk^kplá UkZkm CkZkm‹

lWkTkk PTkk WkvSkAù AùmK bkv Ck|lbkP b^kbQk ¥PAùkx Aùm Pn\kTkk Ykxä

PTkk WkvSkAù AùmK bkv Ck|lbkP Avù\kv Avù PTkv Avù ¢kTPl@Aù ¢kw@ ¢k^k@Ok

XkkCk Avù ¥PAùkx Ykx U@kt‘bkmMvHkä Uk\kmlVúTkkt\k ¢kt‘bkmMvHkä lVúTkkt\k~bkä

KwlTkTk~bk ¢kw@ Ékkv.TQkkvbkkZkTkvMmTbk Aùm YkkÇkk Ykx ¢lXk^kplá UkZkm CkZkm‹

Pv\k Aùm YkkÇkk 80% bkv DkKkAù@ 60% Aù@Tkv bkvä Avù\kv Avù Voú\k

Avù ¢kFkk@ Aùm CknOk^kPkä êU ¢kw@ XkOMk@Ok dkYkPk Ykx AùYkm RvBkm Ck£r‹

AùUor@^k\\km ¢kw@ @kvWkbKk lAùbYk Avù Vú\kkx Aùkv .Aù lAù\kkvCk|kYk dkYkPk

^kk\kv \kc@Rk@ R$Pm Avù lMWWkkx Ykx Xk@Aù@ä 22° bkvCk|v Avù AùYk PkUYkkTkU@ä 11 lRTkkv PAù XkOMkl@P lAùZkk Hkk bkAùk HkWklAù bkkSkk@Ok PkUYkkÇkk

(28å5° bkvCk|v) U@ £Tk Vú\kkx Aùkv Avù^k\k Fkk@ lRTkkx PAù cm XkOMkl@P

lAùZkk Hkk bkAùk‹

bkkvlMZkYk ckZkM}k‘bkk£M (0å5% Zkk 1å0%) Avù £UFkk@ ¢Qk^kk

ZkkglÇkAù lTkaAùakrOk Aùm ¢UvGkä 0å1% bkkvlMZkYk ckZkM}k‘bkk£M Avù

£UFkk@ Aù@Tkv bkv Avù\kv Aùm AùUor@^k\\km (0å45%) ¢kw@ Uo^kTk (0å498%)

lAùbYkkx Avù UOkr^kpÅk ¢k^k@Ok bkvä #knaAù ^kHkTk Avù ¢kSkk@ U@ @v#kv Aùm

¢lSkAù £UHk Ékk¶P cn£r‹ bkkvlMjZkYk ckZkM}k‘bkk£M~ dkk@ çk@k £UFkkl@P

¢kw@ lTkaAùsakP @v#kkx Aùm ¢UvGkä ZkkglÇkAù lTkaAùakrOk ̂ kk\kv @v#kkx Ykx bkv\Zko\kkvHk

¢kw@ Uv†‘KTk Aùm YkkÇkk ¢lSkAù UkZkm CkZkm HkWklAù l\k†CTkTk Aùm YkkÇkk

dkk@ £UFkkl@P @v#kkx Ykx ¢lSkAù UkZkm CkZkm‹ UOkr^kpTP (0å672%) Aùm

¢Uvdkkä UOkr l#k@k¢kvg (1å63%) Ykx @v#kv Aùm YkkÇkk ¢lSkAù UkZkm CkZkm‹

Vúbk\k bkn@dkk

PlYk\kTkkMn Avù TkkYk‘Aù\k lHk\kv Aùm Aùkv\\km UckMjm dkvÇkkx Ykx

bk^kvrdkOk bkv \kkMTk” “UckMjm Avù\kk” .^kg AùUor@^k\\km lAùbYkkx Ykx HkMj SkWWkk

bkoÇkApùlYk .^kg bksU\k bkoÇkApùlYk Avù WkcnPkZkP bkv bkgÓùYkOk .^kg £bkAvù

Aùk@Ok £’UkRTk Ykx bkkQkrAù éU bkv AùYkm ckvTkv Aùk UPk Fk\kk‹ ÉkdkvÇk

R#kk¢kvg Ykxä Avù\kv Aùm TkvZk Uo^kTk lAùbYk Ykx ^kwbAnù\k@ ¢k@WkbkAnù\k@

YkkZkAùkv@kZkHkk Avù bkkQk Hkwl^kAù BkkRkx .^kg Hkw^k lTkZkTÇkAùkx (Umlbk\kkvYkk£bkmHk

l\k\kwlbkTkbk ¢kw@ K}k£AùkvMYkkr l^k@lM) Avù ÉkZkkvCk bkv bkoÇk ApùlYkZkkx Aùm

bkgBZkk Ykx bkkQkrAù éU bkv AùYkm RvBkm CkZkm‹ ÉkZkkvCk#kk\kk R#kk¢kvg Ykx

.†‘KTkkvYkk£lbkKmHk Aùkv HkMj SkWWkk bkoÇkApùlYk Aùkv lTkZkglÇkP Aù@Tkv Ykx

ÉkXkk^km UkZkk CkZkk‹

Uo^kTk .^kg TkvTæTk lAùbYkkx Avù DkTk AùgR bkv ^kkaU#km\k ZkkwlCkAùkx Aùkv

¢\kCk Aù@Avù UcFkkTk lAùZkk CkZkk cw‹ U@mdkOk lAùZkv CkZkv Anù\k 37

bkg#\kvlakP @kbkkZklTkAù ZkkwlCkAùkx Ykx bkv “”¢\Vúk-WkmbkkWkkv\k-¢k\k”” @bkkZkTk

Avù ÉklP DkTk AùgR WkvSkAù Aùm ¢kAùakrAù ÉklPlÓùZkk bkWkbkv ¢lSkAù Qkm ‹

U@kÌkZkm UkwSkv Avù ^kkaU#km\k ZkkwlCkAùkx Avù bkkQkä 2-lYkQkktZk\k 4-cv¶KkTkk\k

^Zk^kck@ Aù@Tkv U@ DkTk AùgR WkvSkAù bkWkbkv ¢lSkAù ¢kAùsakP cn¢k ‹ DkTk

AùgR WkvSkAù Aùm bkWkbkv ¢lSkAù Ykp’Zkn R@ (88%) ^Zko^kvl@Zkk WkvlbkZkkTkk

(.Tk ¢k@ bkm Wkm-34) ¢kw@ £bkAvù WkkR YkvKk@kZklHkZkYk ¢Tkmbkkv¶\km (.Tk

¢k@ bkm Wkm-32) Avù ^Zk^kck@ bkv UkZkm CkZkm‹

bk^kvrdkOk .^kg lYkK~Km Avù TkYkooTkkx (308) Avù U@mdkOk bkv Xkk@P Avù

U†#FkYkm DkkK Avù Avù\kk £’UkRA PlMjZkkTkAnùlMjbkk£rä .@AùktM ¢kw@

Aùkv\\km UckMjm dkvÇkkx Ykx WZko^kvl@Zkk WkwlbkZkkTkk (17 TkYkooTkkx Ykx)ä YkvKk@kZklHkZkYk

¢Tkmbkkv¶\km (25 TkYkoTkkx Ykx) ¢kw@ Wkwlbk\kbk Qkol@TklHk.†Tbkbk (24 TkYkoTkkx

Ykx) Avù UkZkv HkkTkv Aùk UPk Fk\kk‹ Ykck@kì} @kHZk Avù Hk\kCkkg^kä UnOkv ¢kw@

#kkv\kkUn@ lHk\kkx Ykv Avù\kv Avù DkTk AùgR .^kg PTkk WkvSkAù AùmK Avù UkZkv HkkTkv

Aùm Unlì cn£r‹ Ykck@kì} Avù @k^kv@ (Hk\kCkkg^k) .^kg HknTTkk@ (UnOkv) Pk\knAùkx

bkvä Vú\kkx Aùkv dklPCk|bP Aù@Tkv ^kk\kv Avù\kv Avù SkWWkvRk@ AùmK Aùm UcFkkTk

Aùm CkZkm‹

Avù\kv Avù AùgR WkvSkAù AùmK Aùkv “”Vúm@kvYkkvTk bkYkocTk PAùTkmAù ””

çk@k ¢kAùsakP Aù@Tkv Avù l\k.ä lYkK~Km Ykx bkYknlFkP TkYkm Aùm ¢^kbQkk Aùkv

.Aù Óùk†TPAù Aùk@Aù Avù éU Ykx UcFkkTkk CkZkk‹ ÉkdkvÇk R#kk¢kvg Ykx

“”¢\Vúk-WkmbkkWkkvv\k-¢k\k”” TkkYkAù .Aù @kbkkZklTkAù ZkkwlCkAù Aùkv ÉkdkvÇk

R#kk¢kvg Ykx DkTk AùgR WkvSkAù AùmMvj Aùm £U†bQklPù Avù l\k. FkvPk^kTkm

bkoFkAù Avù êU Ykx ÉkXkk^km UkZkk CkZkk‹ cvKv@kvcwWkMk£lKbk £glMAùk (@1x109

bkgÓùkYkAù #knAù Ö lYk\km) Avù Hkv\k~ lYkÌkOk bkv £UFkkl@P PTkv Aùkv WkmFkkx

WkmFk bkv VúkMjAù@ PwZkk@ lAùZkv \kYWk^kP KnAùMvj Aùkv ÉkdkvÇk R#kk¢kvg Ykx PTkk

WkvSkAù Avù lTkZkTÇkOk (60% Ykp’ZknR@) Ykx ÉkXkk^km UkZkk CkZkk‹

$ZkoHkvl@ZkYk Ykn@Ikk @kvCk ÉklP@kvSkm Avù\kv Avù 22 HkTkTkæ^Zk bkgCk|ckx

bkv lTkAùk\kv CkZkv 197 £OMkvVúkZklKAù Hkm^kkOkn¢kvg Aùm ÉkHkklPZkkx Aùkv 10

^kCkkv‰ Ykx ^kCkmrApùP lAùZkk Hkk bkAùk ‹ £TkYkx bkv 14 ÉkHkklPZkkx Tkv

$ZkoHkvl@ZkYk Ykn@Ikk @kvCkAùk@m VúVogúR Avù ÉklP Wkcn¢kZkkYkm ÉkXkk^k R#kkrZkk ‹

$ZkoHkvl@ZkYk Ykn@Ikk @kvCk ÉklP@kvSkm Avù\kv Avù 24 HkTkTk æ^Zk bkgCk|ckx

bkv .†‘KTkkvYkk£lbkKmHk ÉkHkklP Aùm Anù\k 30 bkYkHkklPZkkg l^k\kCk Aùm

CkZk{‹ £bkm P@c bkv $ZkoHkvl@ZkYk Ykn@Ikk @kvCk ÉklP@kvSkm Avù\kv Avù 13

HkTkTkæ^Zk bkgCk|ckx bkv K}k£AùkvMYkkr VúgVoúR Aùm 43 bkYkHkklPZkkg l^k\kCk Aùm

CkZk{ lHkTkYkx K}k£AùkvMYkkr l^k@lM Aùm 29ä K}k£AùkvMYkkr ck@lHk.TkYk Aùm

13 ¢kw@ K}k£AùkvMYkkr bZkoMkvAùkvzTkCkk£ r Aùm .Aù bkYkHkklP Avù éU Ykx

UcFkkTkk CkZkk‹ £Tk bkXkm Aùkv $ZkoHkvl@ZkYk Ykn@Ikk @kvCkAùk@m VúVogúR Avù

WkmHkkOkn ¢gAnù@Ok Aùkv @kvAùTkv Ykx ÉkXkk^k#kk\km UkZkk CkZkk‹

4

K}k£AùkvMYkkr Aùm 19 ÉkHkklPZkkx Ykx bkvä K}k£AùkvMYkkr ck@lHkZkvTkYkä

K}k£AùkvMYkkr bZkoMkvAùkvzTkCkk£rä K}k£AùkvMYkkr AùkvzTkCkk£r ¢kw@ K}k£AùkvMYkkr

l^k@lM ÉkHkklPZkkg $ZkoHkvl@ZkYk Ykn@Ikk @kvCkAùk@m VúVogúR Aùk WkmHkkOkn ¢gAnù@Ok

.^kg AùklZkAù ^kplá @kvAùTkv Ykx ÉkXkk^km UkZkm CkZk{‹ K}k£AùkvMYkkr VúVogúR Aùm

Fkk@ bkYkHkklPZkkg YkpRk VúkbVúkv@bk Avù l^k\kvZkTk Ykx Xkm ÉkXkk^km UkZkm Ck£‰‹

PlYk\kTkkMnä Ykck@kì} ¢kw@ lÇkUn@k Ykx bk^kvrdkOk Avù £U@kTP bkgCk|c lAùZkv CkZkv

25 TkYkooTkkx Ykx bkv K}k£AùkvMYkkr Aùm Wkk@c ¢kw@ #kkAùkOkn¢kvg Aùm ¢kL

bkYkHkklPZkkg l^k\klCkP Aùm CkZk{‹ bkYUoOkr Xkk@P bkv bkgCk|c Aùm CkZk{

$ZkoHkvl@ZkYk @kvCkAùk@m Aùm 180 bkYkHkklPZkkx Aùkv Hkw^k PAùTkmAù Avù

¢^k\kYWkTk bkv bkkP YknBZk bkYkockx Ykx ^kCkmrApùP lAùZkk Hkk bkAùk‹ CkYk\kkx Ykx

UkwSkv \kCkkTkv bkv Uc\kvä K}k£AùkvMYkkr AùkvzTkCkk£r ¢kw@ K}k£AùkvMYkkr

bZkoMkvAùkvzTkCkk£r Avù bkkQk .†‘KTkkvYkk£lbkKmHk Aùkv lYkK~Km Avù lYkÌkOk Ykx

lYk\kkTkv bkv ¥PAù bkg^ksSkP Uo^kTk lAùbYk Ykx UkwSk \kCkkTkv Avù WkkR G:

YkcmTkv PAù $ZkoHkvl@ZkYk @kvCk Avù l^kAùkbk Aùkv @kvAùk Hkk bkAùk ‹ ÉkZkkv#k#kk\kk

Aùm R#kk¢kvg Ykx AùkWkvrTMklHkYk (0å1%) Aùk £UZkkvCk $ZkoHkvl@ZkYk Ykn@Ikk

ÉkWkTSkTk Ykx ÉkXkk^k#kk\km UkZkk CkZkk‹ @kvUOk bkv Uc\kv UnlÅkZkkx Aùkv AùkWkvrTMklHkYk

(0å1%) l^k\kZkTk bkv £UFkkl@P Aù@Tkv Avù WkkR \kCkkTkvä WkpláAùk@m UkwSkkx

Ykx HkMj dkvÇk Aùm lYkK~Km Aùkv zbklFkP Aù@Tkv (@1-2 \km æ^kOk UkwSkv Aùm

2ä 4 ¢kw@ 6 Ykkbk Aùm ¢^kbQkk Ykx) ¢kw@ UkwSkv Avù PTkv Ykx KmAùkAù@Ok

(@ 2 lYk\km UkwSkv Aùm 2ä 4 ¢kw@ 6 Ykkbk Aùm ¢^kbQkk Ykx ) Aù@Tkv bkvä

ÉkdkvÇk R#kk¢kvg Ykx TkvZk Uo^kTk lAùbYk Ykx $ZkoHkvl@ZkYk Ykn@Ikk @kvCk Aùkv

ÉkXkk^k#kk\km éU bkv lTkZkglÇkP lAùZkk Hkk bkAùk cw‹

¢kTSk| ÉkRv#k Avù AùMj¶Uk ¢kw@ AùkvRo@ lHk\kkx Ykx bk^kvrdkOk bkv U@gU@kCkP

UnlÅkZkkx ¢kw@ ¥PAù bkg^ksSkP UkwSkkx bkv \kCkkZkv CkZkv Avù\kv Avù @kvUOkkx Ykx ¢Ck|

l#k@k CknFGk @kvCk l^kakkOkn Avù UkZkv HkkTkv Aùk UPk Fk\kk PlYk\kTkkM Avù

U\kTkm ¢kw@ Aùkv\\km UckMjm dkvÇkkx Ykx “”UckMjm”” lAùbYk Ykx ¢Ck| l#k@k

CknFGk @kvCk l^kakkOkn; PoPmAùkvl@Tk ¢kw@ lPéTkv\k^kv\\km lHk\kkx Ykx Skk@mRk@

.^kg bkcUÇk UFFkmAùk@m l^kakkOkn HkWklAù UnRoAùkvK~Kwä PTHkk^kn@ä AùMj\ko@

¢kw@ TkkCkUK~KmTkYk lHk\kkx Ykx ¢Ck| l#k@k CknFGk l^kakkOknä Skk@mRk@ä

bkcUÇk UFFkmAùk@m .^kg Bkm@k UFFkmAùk@m l^kakkOkn l^kbPpP éU Ykx Avù\kv Avù

UkwSkkx U@ UkZkv CkZkv‹ Uo^kTk lAùbYk Aùm Uc\km UvMjm Aùm Vúbk\k Avù Skk@mRk@

l^kakkOkn bkgÓùlYkP UkwSkkx Ykx £^kr@Aùkx Aùm ¢lSkAù YkkÇkk Aùk ÉkZkkvCk Aù@Tkv bkv

Xkm £UHk Ykx ^kplá Tkc{ ckv bkAùm HkWklAù Uo^kTk .^kg TkvTæTk lAùbYkkx Aùm

Uc\km UvMjm Avù bkcUÇk UFFkmAùk@m l^kakkOkn bkgÓùlYkP UkwSkkx Ykx £^kr@Aùkx Aùm

WkNjm cnZkm YkkÇkk Avù ÉkZkkvCk bkv £UHk Ykx bknSkk@ UkZkk CkZkk‹ #kv^kk@kZk

UckMjm dkvÇkkxä AùkvMj£rAùTkk\k ¢kw@ YkvDkk\kZk bkv bkgCk|cmP lAùZkv CkZkv Avù\kv Avù

¢Ck| l#k@k CknFGk @kvCk l^kakkOkn Avù TkYkoTkkx Ykx AùkvK ÉkmKmTk (bkmUm) HkmTk bkv

bkgWkglSkP Hkw^k ¢k†O^kAù ¢kSZkZkTkkx bkv TkYkoTkkx Ykx ¢kTkn^kgl#kAù l^kl^kSkPk Aùk

UPk Fk\kk‹

TkvTæTk lAùbYk bkv l^k\klCkP lAùZkv CkZkv bkcUÇk UFFkmAùk@m l^kakkOkn

Avù bkgUoOkr HkmTkkvYk Aùk ‘\kkvTkmAù@Ok .^kg ÓùYkkgAùTk lAùZkk CkZkk lHkbkYkx

9711 TZko†‘\kZkkvKk£M~bk UkZkv CkZkv‹ Avù\kv bkv l^k\klCkP lAùZkv CkZkv Bkm@k

UFFkmAùk@m l^kakkOkn Aùk bkmUm HkmTk AùkTbkK}‘K PwZkk@ lAùZkk CkZkk‹

bkcUÇk UFFkmAùk@m l^kakkOkn Avù UnTkbk‰ZkkvCkm ¢k^k@Ok ÉkkvKmTk Avù l\k.

Uk\km‘\kkvTk\k .OKmbkm@Yk Aùk £’UkRTk lAùZkk CkZkk ‹ ¢Ck| l#k@k CknFGk

@kvCk l^kakkOkn Avù l@¶\kmAvùHk (jl@U) HkmTk Aùkv bUaKAùk@m ^kv‘K@ Avù YkkSZkYk

bkv £#k@l#kZkk Aùkv\kk£r l^kakkOkn Ykx éUkTPl@P lAùZkk CkZkk‹ Avù\kv Avù

l^kakkOkn¢kvg Aùkv .Aù bkkQk UcFkkTkTkv Avù l\k.ä @mZk\k Kk£Yk Um bkm ¢k@

PAùTkmAù Aùk YkkTkAùmAù@Ok lAùZkk CkZkk‹

¢Ck|l#k@k CknFGk @kvCk l^kakkOkn ÉklP@kvSkm UckMjm Avù\kv Aùm K}kTbkHkmlTkAù

lAùbYk l^kAùlbkP Aù@Tkv Avù ÓùYk Ykx ÉkZkkvCk#kk\kk R#kk¢kvg Ykx ¢SZkZkTkkx bkv

52 UkwSkkx Ykx l@¶\kmAvùHk ¢kw@ Ckbk HkmTk Avù ÉklP bkAùk@k’YkAù ÉklPlÓùZkk

UkZkm CkZkm cwä £TkYkx bkv ¢kL K}kTbkHkmlHkAù UkwSkkx Tkv bkk£RTkr W\kkK

PAùTkmAù Avù ÉklP Xkm bkAùk@k’YkAù ÉklPlÓùZkk R#kkrZkm‹ Yknæk Avù XknCkPkTk

U@ ¢kSkkl@P bkv^kk¢kvg Avù ¢TPCkrPä Avù\kv Avù \kCkXkCk 7ä969 UkwSk TkYkoTkkx

Aùk l^klXkTTk l^kakkOkn¢kvg Aùm £U†bQklP Avù l\k. U@mdkOk lAùZkk CkZkk‹

^kakr 2009-10 Aùm ¢^klSk Ykxä £bk AvùTæ Avù ^kwekklTkAùkx Tkv Fkk@

@vlMZkkv ^kkPkr¢kvgä PmTk Ro@R#krTk ^kkPkr¢kvg ¢kw@ dkvÇkmZk PQkk @kaK}mZk bP@

Aùm bkkv\kc ÉkR#krlTkZkkx Ykx XkkCk l\kZkk‹ U@kbTkkPAù £UklSkZkkx Avù l\k.ä

£bk AvùTæ Avù ^kwekklTkAùkx çk@k FkkwRc dkkÇkkx Aùkv £TkAùm £TkAùm #kkvSk

Ul@Zkkv HkTkk¢kvg Ö #kkvSk Ck|TQkkx Avù l\k. U@kYk#krÖlRCR#krTk Ékk¶P cn¢k‹

£bk AvùTæ Avù ^kwekklTkAùkx Aùkv l^klXkTTk ^kwekklTkAù Ö ^Zk^kkbkklZkAù

bklYklPZkkx Ö bkgCkLTkkx çk@k G: Un@bAùk@ Ékk¶P cn.‹ AvùTæ Avù ^kwekklTkAùkx

çk@k £bk ^kakr ¢kL #kkvSk UÇkä 24 \kvBkä Ékl#kdkOk Un†bPAùk¢kvg Ykx 10

\kvBkä UnbPAùkx Ykx 14 ¢SZkkZkä ÓùYk#k: ¢TP@kraK}mZk .^kg @kì}mZk

bkYYkv\kTkkxÖbkgCkkvlíZkkxÖWkwLAùkx Ykx 12 ¢kw@ 38 bkgldk¶P \kvBk ÉkbPnPÖÉkAùkl#kP

lAùZkv CkZkv ‹ AvùTæ çk@k Hkw^k Ékkw<kvlCkAùmä Vúbk\k bknSkk@ä Vúbk\kkv’UkRTkä

UkRU bkn@dkk .^kg Vú\kkx Aùm PnMjk£r Avù U#FkkP Aùm ÉkkwSkkvlCkAùm Hkwbkv

l^kakZkkx U@ Ul@bk@ bkv Wkkc@ .Aù .^kg Ul@bk@ Avù ¢TR@ bkkP Ékl#kdkOk

AùkZkrÓùYk ¢kZkkvlHkP lAùZkv CkZkv‹ £bk ¢^klSk Ykx 13 ¢lP Ykc’^kUoOkr

^Zk†‘P .^kg 3825 ApùakAù Ö AùYkrFkk@m £bk AvùTæ U@ Xk|YkOk U@ ¢kZkv

lHkTcx AvùTæ Aùm CklPl^klSkZkkx bkv ¢^kCkP Aù@kZkk CkZkk‹ CkP ^kakr Avù

Rkw@kTk AvùTæ çk@k Anù\k éå 32ä48ä583Ö- Avù SkTk@kl#k Aùk @kHkb^k

£UkHkrTk cn¢k‹

NR

CB

Ann

ual

Rep

ort

2009

-'10

5

3 EXECUTIVE SUMMARY

CROP IMPROVEMENTIndigenous accessions (31) were collected from

primary and secondary sources and 72 exoticaccessions were received from ITC, Belgium. Genebank consisting of core germplasm collections wasestablished and 310 accessions' DNA was storedat -20ºC and their qualitatively stability over a periodof 2 - 3 years of storage was confirmed.

Tissue cultured plants of Udhayam cultivarwere supplied to progressive farmers for fielddemonstration. Use of low cost materials asalternatives in mass multiplication of Udhayamcultivar indicated Reverse Osmosis water, Sago(13%) and table sugar (3%) were equally effective.Saw dust was observed as the best medium for de-cortication in macro-propagation. Use of VAM aloneand IBA + Azospirillum in the saw dust mediaconsistently improved the bud proliferation.

Storage studies of banana seeds using 0.1%tetrazolium chloride indicated that germination percent was reduced with increase in storage period.Embryos of wild bananas germinated easilycompared to hybrid embryos. Callus induction wasmore in immature embryos and it decreased withembryo maturity irrespective of the mediacomposition. Fully matured embryos failed to inducecallus and exhibited direct regeneration intoplantlets. Incorporation of 3% Culture Filtrate(Fusarium wilt race 1) in the MS medium was foundto be optimum for screening of shoot meristems forwilt resistance under in vitro conditions.

Preliminary studies on the development ofgenetic linkage maps in Musa indicated that thoughall the AA and BB parents were moderately diverseand heterozygous F1 progenies could be useddirectly for the development of linkage maps.Protocol for genetic fidelity testing using ISSRmarkers was standardized as per the StandardOperative Procedure of DBT Accredited TestingLaboratory.

Suppressive subtractive library, containingmore than 1400 colonies, was created from P. coffeaeinoculated roots of cv. Karthombiumtham at sixdays after inoculation. From this library, 91 cloneswere sequenced. The BLAST X analysis indicatedthat 13% of putative genes were hit with resistance/defense related genes out of which two genes werehit with stress related genes namely type IImetallothionins (92%) and class III acidic chitinasegene (75%) of Musa.

Using calorimetric and Real Time PCRtechniques, the activity of scavenging enzymes like

Catalase, Peroxidase and Polyphenol oxidase wasfound to be at peak at its peak after 10-36 hrs ofinoculation with Mycosphaerella eumusae.

CROP PRODUCTIONPlanting of 'Udhayam' cultivar at closer spacing

increased plant height, delayed shooting anddecreased bunch weight but improved the fruit yieldand productivity (72.1 t/ha) when compared withwider spacing. Productivity per day basis was alsoobserved to be more at (115.54kg/ha/day) at higherplant density than lower plant density. Closerspacing recorded lowest phyllochron (6.3 days).Higher plant density increased the population builtup of root knot nematode in soil rhizosphere.

In plant crop of Udhayam, maximum plantheight and stem girth was recorded in 200g N +400g K per plant application. Total chlorophyllcontent (2.86 mg/g of fresh leaf weight) increaseddue to higher fertilizer application. Maximum bunchweight (31.1kg) was recorded at 400g N + 400 g Kper plant. Root knot nematode population inrhizosphere decreased with increasing doses offertilizers.

Under high soil pH conditions, application ofbentonite sulphur @20g/plant at three month afterplanting improved the plant height, number ofleaves, total leaf area, number of fruits, bunch weightand leaf N, P, K, Ca, Mg and S content of Nendranbanana. Application of sulphur with FeSO4 andZnSO4 (each 5 g/plant) in soil and foliar spray of0.5% borax improved the fruit yield (12.5kg) inNendran cultivar (109.7%) over control. Sulphurapplication improved the efficiency of potassiummetabolism also.

Based on fertilizer adjustment equations, it wasestimated that 11.52 kg N, 1.57kg P and 22.96kg Kis required for production of one ton fruit in firstratoon of Poovan cultivar. Similarly, 12.8kg N, 1.4kgP and 18.7kg K was required for production of oneton fruits in first ratoon of Karpuravalli cultivar. Inaddition N P K contribution from soil, organicmanure and applied fertilizer was worked out infirst ratoon crops of Poovan and Karpuravallicultivars.

Application of 50 litre of human urine dilutedwith 500 liter water over a period of six monthsstarting from three months after planting till ninthmonth daily through drip irrigation saved NPKfertilizers by 25 % and improved the plant growth,fruit yield and quality of Poovan banana. Additionalmonetary benefit of Rs 45, 175/- per hectare couldbe obtained due to saving of fertilizers (Rs. 8, 925)and increased bunch weight (Rs. 36, 250/-).

Application of 1.5 kg solid PSO6 (a type ofpoultry sludge) per plant in combination with

6

50,000 litre liquid PSO6 per hectare along with 75%recommended dose of fertilizers improved the plantgrowth and resulted in 32.29% more fruit yield ofPoovan (2500 plants/ha) cultivar.

Observations on sucker derived plants revealedthat the rate of leaf emergence was more than oneper week if temperature was more than 25-27°Ccoupled with 90% RH. Decrease in meantemperature below 25-27°C reduced the rate of leafemergence ( < one week). Combined spray of two tosix ppm brassinolides and 25 ppm GA3 ondeveloping fruits improved the fruit size of NeyPoovan, Poovan and Saba cultivars. Similarly sprayof 1.5 to 2% potassium sulphate on developing fruitsimproved the fruit size of Robusta, Poovan, NeyPoovan and Rasthali cultivars. Higher droughtstress increased the leaf osmotic potential (-0.35 to -0.77MPa) when compared with irrigated plants(-0.27 to -0.36 MPa) of Musa balbisiana species and inMonthan, Saba, Poovan, Grand Naine and Nendrancultivars. Proline content (240 - 290 μg/ g freshweight), Membrane Stability Index (68-70) and Totalchlorophyll content were higher in drought tolerantMusa balbisiana, Saba, Monthan and Poovancultivars when compared with susceptibleNendran cultivar. Drought tolerant Saba andKarpuravalli cultivars maintained higher(>200) K/Na ratio in leaf (lamina and midrib) when comparedwith susceptible Ney Poovan, Nendran andRobusta cultivars (4.52 to 17.56) at shooting andfruit maturity. Application of abscissic acid couldalleviate the adverse effects of salt stress insusceptible Grand Naine cultivar. Salt stressdelayed the shooting of banana by 45 to 52 dayswhen compared to normal plants. Salt stresstolerant Saba and Ney Poovan cultivars had higherpulp: peel ratio than susceptible cultivars under saltstressed conditions. Total sugar content in peel wasobserved to be higher than pulp due to salt stresswhich indicated the non-conversion of sugar tostarch under salt stress conditions. Increased leafchlorophyll and carotenoid content in droughtstressed and Banana Streak Virus infected butsymptom less plants was observed when comparedto plants with expressed symptoms.

Infestation of root lesion nematode (Pratylenchuscoffeae) caused decrease in Relative Growth Rate ofleaf in susceptible Robusta and Nendran cultivarsbut resistant Anaikomban and Yangambi km5cultivars remained unaffected at 30 days afterinoculation. Peroxidase activity gradually increasedup to 7th day in resistant 'Anaikomban' and'Yangambi km 5' cultivars which was more whencompared with susceptible Robusta and Nendrancultivars. Similarly, polyphenol oxidase, phenylalanine lyase, cinnamyl alchohol dehydrogenase,lignin, soluble phenolics, proanthocyanidines and

tannin content also increased due to inoculation ofroot lesion nematode in resistant 'Anaikomban' and'Yangambi km 5' cultivars when compared withsusceptible Robusta and Nendran cultivars. Thetissues of inner core and sheath infested withpseudostem weevil contained more peroxidase,polyphenol oxidase, phenols, tannins andproanthocyanidines when compared with un-infested healthy plant tissues.

Reduction in oil content to 60 per cent from 80per cent reduced the quality, appearance andstorage life of banana flower pickle. Karpuravalliand Robusta fruits packed in one kilogram capacityCorrugated Fiber Board boxes could be stored for 11days at 22°C when compared with only four daysat room temperature (28.5°C). Maximum fiber yieldfrom leaf sheath of Karpuravalli and Poovan wasrecorded in 0.1% NaOH treatment as compared toeither with 0.5% or 1% NaOH or machine extraction.Cellulose and pectin content were more in machineextracted fibers but lignin content was more in fibersextracted by alkali treatment. Leaf midrib containedmore fiber than peduncle.

CROP PROTECTIONRoot lesion nematode (Pratylenchus coffeae) and

spiral nematode (Helicotylenchus multicinctus) werewidely distributed and caused significant reductionin plant growth and yield in Ladan/ Hill bananaand Karpuravalli cultivars in Kolli hills of Namakkaldistrict of Tamil Nadu. Application of VascularArbuscular Mycorrhizae(VAM) along with bio-fertilizers and bio-control agents(Paecilomyceslilacinus & Trichoderma viride) significantly reducedthe nematode population with increased yield in NeyPoovan cultivar under field conditions.Actinomycetes were found effective in controlling theroot lesion nematode under in vitro conditions.

Volatile compounds associated with corm wereisolated and identified from Poovan and Nendrancultivars. Of the 37 semiochemicals tested, maximumolfactory response by corm weevil was recorded toα-bisabol-ol. Maximum attraction (88%) of stemweevil was recorded due to use of 2- Methyl 4-heptanol in combination with host volatiles.Maximum mortality (88%) of stem weevil wasrecorded due to application of Beauveria bassiana(NRCB-34) followed by Metarrhizium anisopliae(NRCB-32). Survey and analysis of soil samples (308)indicated the presence of Beauveria bassiana (17samples), Metarhizium anisopliae ( 25) and Bacillusthuringiensis (24 samples) in banana growing areasof Thadiankudisai, Yercaud and Kolli hills ofWestern Ghats of India. Survey revealed theinfestation of banana weevil in Jalgaon, Pune andSholapur districts of Maharashtra. Banana spottingbug damaging fruit was recorded in Raver (Jalgaon)

NR

CB

Ann

ual

Rep

ort

2009

-'10

7

and Junnar(Pune ) taluks of Maharashtra. Optimumsoil moisture was observed to be a critical factor incorm weevil attraction by aggregation PheromoneTechnique. A semiochemical " α- Bisabol-ol" wasfound effective for banana corm weevil monitoringunder field conditions. Longitudinally split bananastem traps treated with gel formulation ofHeterohabditis indica (1 x 109 Infective Juveniles/ml)were effective in killing of 60% stem weevil underfield conditions.

Endophytic bacterial strains (197) belonging to10 groups were isolated from 22 Fusarium wiltresistant banana accessions. Of these, 14 strainsshowed multiple action against Fusarium pathogen.A total of 30 isolates of endophytic Actinomycetes sppwere isolated from Fusarium wilt resistant 24 bananaaccessions. Similarly, 43 isolates of Trichoderma wereisolated from fusarium wilt resistant 13 bananaaccessions; of which 29 were T. viride, 13 were T.harzianum and one was T. pseudokoningii. All thesewere effective in inhibiting spore germination ofFusarium pathogen. Of the 19 Trichoderma spp., T.harzianum, T. pseudokoningii, T. koningii and T. viridewere found effective in inhibiting the sporegermination and mycelial growth of wilt pathogen.Four isolates of Trichoderma spp. were identified tobe effective in phosphate solublization. Surveys wereconducted in Tamil Nadu, Maharashtra and Tripuraand 12 Trichoderma spp and eight bacterial strainswere isolated from 25 samples. From 180 isolatescollected from all over India, Fusarium wilt pathogencould be classified in to seven major groups bymolecular characterization. Before planting in pots,application of Actinomycetes along with Trichodermakoningii and Trichoderma pseudokoningii, inhibited thewilt disease development up to six months in tissuecultured Poovan cultivar. Application ofCarbendazim was observed to be effective inFusarium wilt management under in vitro conditions.Carbendazim (0.1%) dipped the suckers beforeplanting followed by soil drenching in root zone @ 1-2 lit at 2,4 &6 month after planting and stem injection@2ml at 2,4&6 MAP effectively controlled theFusarium wilt disease in Ney Poovan cultivar underfield conditions.

Surveys revealed the presence of bananabunchy top virus disease in both tissue culturedand conventional suckers raised plantations inKodur and Cuddappa districts of Andhra Pradesh.Pulney and Kolli hills had incidence of bunchy topvirus on hill banana. In Tuticorin and Tirunelveli,banana streak virus and bract mosaic virusincidence were recorded whereas, in Pudukottai,Thanjavur, Cuddalore and Nagapattinum districtsbunchy top, streak, bract mosaic and cucumbermosaic viruses were observed on banana plants.Increased dose of fertilizers could not improve the

fruit yield in streak virus infected ratoon plants ofPoovan cultivar but in bract mosaic virus infectedfirst ratoon plants of Poovan and Nendran cultivars,there was improvement in fruit yield due toincreased fertilizer dose.

Molecular characterization revealed geneticvariability in respect of cp gene in bunchy top virussamples collected from Shevroy hills, Kodaikanaland Meghalaya. Complete genome of bract mosaicvirus isolated from Nendran cultivar was clonedand sequenced which had 9,711 nucleotides. A cpgene construct isolated from banana was prepared.Polyclonal anti-serum for recombinant coat proteinof bract mosaic virus was produced. Bunchy topvirus rep gene was cloned into expression vectorand transformed into Escherichia coli bacterium. RealTime-PCR technique for simultaneous detection ofbanana viruses was standardized. Staining andvisualizing different stages of chromosomes inPoovan cultivar was standardized for locatingendogenous para-retroviral sequences of bananastreak virus. In an attempt to develop transgenicHill banana resistant to bunchy top virus, laboratorystudies revealed 52 plants to be positive for bothreplicase and gus genes out of which eighttransgenic banana plants were positive to SouthernBloat Technique. Under contractual services, about7,969 banana plant samples were tested for presenceof different viruses.

Transfer of TechnologyDuring 2009-10, the scientists of the center

participated in four radio talks on All IndiaRadio,Tiruchirapalli , three television talks and 16exhibitions organized at regional or National levels.Fourteen students were guided for their project/thesis work for the award of M. Sc. Degree by thescientists of this centre. The scientists of the centergot six awards from different professional/scientificsocieties/organizations. Eight research papers, 24articles, 10 chapters in training manuals, 14chapters in books and 12 abstracts in Internationaland 38 abstracts in National Seminars/ Symposia/Conferences were presented/ published by thescientists of the center. One Off -Campus and SevenOn- Campus trainings on various aspects ofBiotechnology, Crop Improvement, CropProduction, Crop Protection and Post HarvestTechnology of banana were organized by the center.As many as 13 VIPs and 3,825 farmers / officialsvisited and were apprised of the activities of theCentre.

Revenue GenerationA total of Rs. 32. 5 lakhs was realized as revenue

by the Centre.

8

4 INTRODUCTION

The National Research Centre for Banana wasestablished on 21st August 1993 at Tiruchirapalli,Tamil Nadu by the ICAR, New Delhi with an aim toincrease the production and productivity ofbananas and plantains through mission mode basicand strategic research approaches. This Centre islocated at 11.50° N latitude and 74.50° E longitude,90 m above MSL and receives 800 mm rain annually.The climate is warm and humid and the averagemin and max temperature are 25° and 35°Crespectively. The Centre has a research farm with36 ha land and infrastructure facilities like library,meeting and exhibition halls, green houses,quarantine lab and net houses.

The Centre works on four major thrust areas ofresearch viz., Crop Improvement, Crop Production,Post-Harvest Management and Crop Protection. Ithas well-equipped laboratories for tissue culture,biotechnology, soil science, nutrient management,physiology and biochemistry, entomology,nematology, fungal, bacterial, viral pathology andpost-harvest technology research.

In late nineties, 10 collections surveys throughexplorations were made. Wild banana germplasmfrom the North - Eastern states, Western Ghats andAndaman and Nicobar islands and also exoticbanana accessions from International Transit Center(lTC), Belgium through NBPGR, New Delhi wereintroduced. The Centre has completed seven in-house research projects and 11 are in progress inthe 11th five year plan. In addition to Centre's in-house projects, 26 externally funded projects by AP-Cess fund of ICAR, NATP, DBT, NHB and INIBAPwere completed. The Perspective Plan and Vision2025 documents on the research priorities and alsoinputs from QRT and RAC were published. TheCentre conducts two meetings of Institute ResearchCouncil to review the on-going research projects andalso to incorporate the RAC recommendations. Thevision of the Centre is to increase the productionand productivity of bananas and plantains to meetthe growing need in India.

The mandates of the Centre are:

To undertake the basic and strategic researchfor developing technologies to enhance theproductivity and utilization of banana

To develop improved cultivars throughtraditional and biotechnological methods andconserve the diversity

To serve as national repository of germplasmand information related to banana and

plantain and also to disseminate theknowledge to improve the production andproductivity

To provide leadership and coordinate thenetwork research for generating locationspecific variety technology and for solvingspecific constraints on banana and plantainproduction

To collaborate with relevant national andinternational agencies in achieving the aboveobjectives.

Salient Achievements

Crop ImprovementA total of 1200 accessions have been collected

from both indigenous and exotic sources, which aremaintained in the Centre's gene bank atTiruchirapalli and the satellite gene bank at Agali.In the germplasm collection, two wild bananaspecies from Andaman and Nicobar islands and awild species viz., Musa acuminata ssp burmannicafrom TBGRI, Kerala have been added. Among thecollections, 92 accessions are highly resistant and25 are resistant to Sigatoka leaf spot disease. Thecollected germplasm has been narrowed down to310 core collection by eliminating the synonymsusing both morphotaxonamic and molecularmarkers viz., RAPD, IRAP and SSR. Use ofmicrosatellite markers led to the identification ofdiverse Pagalapahad wild x Borkal Baista andBhimthia and Beehekela parental combinations.NRCB selection Udhayam, which belongs to PisangAwak sub group, is a high yielder, tolerant toSigatoka leaf spot disease and nematodes.Embryogenic cell suspensions (ECS) for fivedifferent commercial varieties viz., Rasthali,Nendran, Ney Poovan, Robusta and Grand Nainhave been developed and regeneration protocolfrom ECS for Nendran and Rasthali has beenstandardized. Picloram based medium was foundmore efficient in the formation of somatic embryosin cvs. Rasthali and Nendran. Putative diagnosticRAPD markers linked to Sigatoka and nematoderesistance have been identified for early screeningof hybrid progenies. FHIA-23 was found highlysusceptible to pseudostem weevil in variousmultilocation trials. The NRCB has developed a'DNA Bank for Musa Germplasm' with 225accessions. A farmer's friendly method of massproduction of banana planting material called'Macropropagation' has been developed to meet theneed of small and marginal farmers.

Crop ProductionPoovan plants supplied with 20 liter water/

day/plant and 75% N (150 g N/plant) as fertigation

NR

CB

Ann

ual

Rep

ort

2009

-'10

9

increased the yield by 20% with maximum net profitand a benefit cost ratio of 1.96. A combination ofdistillery sludge 2.5 kg + 1 kg vermicompost + 1 kgneem cake + 2.5 kg poultry manure per plantrecorded the maximum growth and yield parametersin Rasthali and Karpuravalli bananas. Applicationof gypsum 2 kg/plant + FYM 15 kg/plant + 120%recommended K in saline sodic soil increased theyield by 51% over control in Nendran and Rasthalibananas. Paired row planting system, whichaccommodated 4,500 - 5,200 plants/ha, increasedthe productivity and fruit quality with 75 per centrecommended fertilizers dose as fertigation inRobusta, Grand Naine and Red Banana.Application of 15 kg rice husk ash + 25 g VAM +80% recommended NPK gave an additional profitof Rs. 32,500/ha. Soil application of Fe and B alongwith foliar spray of Zn under high pH soil condition,increased the bunch weight of Ney Poovan bananaby 43.5% over control, resulting in an additionalnet profit of Rs. 38,000/ha. Fertilizer adjustmentequations for Poovan and Karpuravalli bananaswere developed by following the Soil Test CropResponse and Targeted Yield Concept. Under highsoil pH conditions, application of bentonite sulphur@20g/plant at three month after planting improvedthe plant height, number of leaves, total leaf area,number of fruits, bunch weight and leaf N, P, K, Ca,Mg and S content of Nendran cultivar. Eight droughttolerant accessions were identified based on leafwater retention capacity. The leaf longevity wasmore in Robusta than Nendran, Rasthali and NeyPoovan banana varieties. Saba, Karpuravalli andNey Poovan have been identified as tolerantvarieties to salt stress. Drought tolerant Saba andKarpooravalli cultivars maintained higher (>200)K/Na ratio in leaf (lamina and midrib) whencompared with susceptible Ney Poovan, Nendranand Robusta cultivars (4.52 to 17.56) at shootingand fruit maturity. Disease defense and cell wallsynthesizing enzymes activities was found peakingon 7th day after infection of P. coffeae.

Post-Harvest TechnologyPre-packaging in 400 gauge LDPE bags, low

temperature storage, use of ethylene absorbents andpre-storage treatments have resulted in extensionof shelf life up to 3 months in Robusta, Grand Nain,Rasthali and Ney Poovan bananas. Several valueadded products like flower thokku, peel thokku, fruitpickle, fig, biscuits, jam, ready to serve beveragesand functional foods like chapathi, bread and healthdrink have been developed. Banana and Jamun juiceblend was the best among the blends made withother fruit juices rich in antioxidants. A recipe forbanana flower based ready to make soup has beenstandardized.

Crop ProtectionMass production technique for Paecilomyces

lilacinus, (an egg parasite of root-knot nematode)using banana petiole and pseudostem has beendeveloped. Integration of P. lilacinus with either neemcake or Tagetus or S. torvum is useful for effectivemanagement of root-knot nematode.

Swabbing 0.06% Chlorpyrifos 20 EC on thepseudostem to a height of 1.2 m during 5th and 8thmonths completely controlled BSW incidence.Treating suckers with Monocrotophos 36 EC (14ml/liter) followed by soil application of Carbofuran3G at the rate of 30 g per plant each at 4th and 7thmonths after planting found effective against cormweevil. Pseudostem split trap swabbed with chaffygrain formulation of Beauveria bassiana trappedthe stem and corm weevils better than traps swabbedwith maize flour formulation. Of the 37semiochemicals tested, maximum olfactory responseby corm weevil was recorded to ?-bisabol-ol, whichfound effective for banana corm weevil monitoringunder field conditions.

Cross reaction between race 1 and race 2 of Fochas been observed in VCG analysis. Diversity of Focisolates has been studied using RAPD, PCR-RFLPanalysis of IGS region and the sequence analysis ofrDNA-ITS region. Propiconazole (0.1%) orHexaconazole (0.1%) alternated with Chlorothalonil(0.25%) controlled Sigatoka leaf spot disease andincreased the yield significantly. Anthracnosedisease of banana was controlled by spraying of25% percent leaf extract of Solanum tarvum.Application of Trichoderma viride (109/ml) (or)Pseudomonas spp (106/ml) (or) Bacillus spp. (106/ml)(or) Propiconazole (0.1%) spray was also effectivein controlling the disease anthracnose. Use ofcarbendazim (0.1%) for dipping the suckers beforeplanting followed by soil drenching in root zone( @1-2 lit at 2,4 &6 month after planting) and steminjection(@2ml at 2,4 &6 MAP) effectively controlledthe fusarium wilt disease in Ney Poovan cultivarunder field conditions.

Polyclonal antiserum to BBTV was producedand ELISA technique has been standardized fordetection. NA probe based and PCR baseddiagnostic techniques have been developed for allthe banana viruses. A multiplex PCR technique hasbeen developed for detecting three banana virusessimultaneously. Complete genome of BSV infectingPoovan has been cloned and sequenced. Promotersequences from BBTV were cloned and sequenced.Duplex PCR for all the four viruses CMV, BBrMV,BBTV and BSV has been standardized. Real Time-PCR technique for simultaneous detection of bananaviruses was standardized.

10

Transfer of Technology

Virus free banana plants have been supplied tothe hill banana growers of lower Pulney hills.Technologies on value added products weretransferred to several clients. 22 video programmeswere recorded by Department of AgribusinessManagement, Ministry of Agriculture, New Delhifor dissemination of the technology at national level.Several trainings sponsored by NHB wereconducted for the farmers from different states.NRBC participated in the several exhibitionsorganized at the regional and national levels.

HRD and Education

The scientists have been deputed regularly toundergo training and to pursue higher studies toupdate their skill and knowledge. Under educationand training, over 450 M. Sc., B. Tech. and M. Tech.students from different universities have beenguided for their project work in various aspects ofbanana.

Linkages and Collaboration

The Centre has developed good linkages with

international institutes viz., Bioversity, France;CIRAD, France; KUL, Belgium; IAEA, Austria andQDPI, Australia. It collaborates with differentnational research institutions for different activitiesviz., NBPGR, New Delhi; BARC and CIRCOT,Mumbai; IICT, Hyderabad; IIHR, Bangalore; NHBand DBT New Delhi and all SAUs. Tissue cultureindustries involved in banana mass propagation,farmers, exporters, banana federations, StateHorticulture and Agriculture departments and self-help groups are linked with the Centre for variousresearch and developmental activities. NRCB alsoco-ordinates with AICRP (Tropical Fruits) Centersworking on banana. The Centre has MoUs withUAS, Bangalore; Bharathidasan University,Tiruchirapalli and IPIRTI, Bangalore on research,guiding students and particle board developmentrespectively.

Revenue Generation

An amount of Rs. 32.5 lakhs was generated fromvirus indexing and sale of farm producesrespectively during this reporting period.

BUDGET DETAILS (REVISED ESTIMATE) FOR THE YEAR 2009-‘10

Establishment Charges 0 274.11

OTA 0 0.04

Travelling Allowances 5.00 1.59

Other Charges 65.70 49.64

Human Resource Development 4.00 0

Equipments 48.50 0

Works 50.00 3.35

Furniture & Fixtures 0.00 0

Library books 0.80 0

Information Technology 1.00 0

Total 175.00 328.73

PLANAmount (Rs. in

lakhs)

NON-PLAN

Head of Account Amount (Rs. inlakhs)

NR

CB

Ann

ual

Rep

ort

2009

-'10

11

5.1 CROP IMPROVEMENT

5.1.1 Genetic Resource Management

Introduction

One hundred four accessions were importedfrom ITC, Belgium through NBPGR, New Delhiunder the NRCB – NBPGR – Bioversity collaborativeproject.

Collection

Exploration in North Bihar resulted in 24collections which included ABB, AAB and BBaccessions and were field planted. Seven accessionsconsisted of three landraces and four wild specieswere collected from Tripura and established in thefield genebank. Thirteen germplasm accessions werecollected from Assam Agricultural University andBidhan Chandra Krishi Viswavidhyalaya, WestBengal. Elite clones of Rasthali from AndhraPradesh and Grand Naine identified from thefarmer’s field at Thottiyam and Sivagiri areas ofTamil Nadu respectively and are being multipliedfor field evaluation.

ConservationField genebank of 345 accessions with three

replications and a separate germplasm block ofexotic accessions with 53 new collections from ITC,Belgium were planted.

Development of Musa DNA Bank andassessment of quality

DNA was isolated from 335 Core collectionaccessions and stored in the DNA bank. DNAquality and integrity was checked after a storageperiod of 2 - 3 years. The DNA has remainedqualitatively stable on storage at -20 ºC which isindicated by the high intensity of fluorescenceemitted by the stored DNA samples during agarosegel electrophoresis. Critical period for DNA storagein liquid form is yet to be assessed.

Morphotaxonomic and Molecularcharacterization

The final batch of 35 accessions of the Corecollection were characterized using ten primercombinations of IRAP markers and data wereanalysed to construct a dendrogram. IRAP markershave clearly discriminated the indigenous and exoticaccessions. (Fig 1).

5 RESEARCH ACHIEVEMENTS

Fig. 1: Dendrogram showing the diversity among corecollection accessions

Standardization of macropropagation

Preliminary studies with 12 different mediarevealed that saw dust is the best media fordecortication. Damaging of meristem was found tobe better than excavation of the complete meristemat all the stages of decortication.

Use of VAM alone and IBA + Azospirillumenhanced the number of buds proliferationconsistently. Other biofertilizers like Trichodermaviride and Bacillus subtilis were also found to bebeneficial. Plantlets of 10-15 cm with two youngleaves and 3-4 ramified roots is the apt time forrooting. Among different plant hardening mediatried, saw dust + vermicompost + sand (2:1:1) wasobserved to be the best rooting medium andestablishment of plantlets.

Screening of Musa germplasm against majornematode Pratylenchus coffeae andMeloidogyne incognita

Fifty two core collections of Musa germplasmsbelonging to 21 diploids (AB-5; AA-2 & BB-14), 28Triploids (AAA-6; AAB-15 & ABB-7), 2 Tetraploids(ABBB-2) and one hybrid (H-201) were screenedagainst root-lesion nematode, (Pratylenchus coffeae)and root-knot nematode (Meloidogyne incognita)separately in pots under shade net condition.

Evaluation of Musa germplasm fornutritional status

Nutritional status of 44 accessions withbreeding potential was analysed for macro andmicro-nutrient status including carotenoids. Thisresulted in the identification of diploid and triploidparents with better nutritional status. Nutritionaldiversity of 40 banana cultivars was studied for sixminerals and carotenoids.

12

5.1.2 Improvement of banana throughConventional Breeding

Crosses were made in 1034 bunches both atNRCB, Tiruchirapalli and Agali breeding blocks.

Of which, 237 bunches set seeds and 99 uniquecrosses produced 38,884 seeds. Only seeds of 19crosses germinated successfully. The details ofcrosses and germination are provided in Tables 1, 2and 3.

Table 2. Details of seeds set and germinated combinations

1 AA x AA 17 1 33 13

2 BB x BB 2 2 -

3 ABB x AA 18 1 10 -

4 AAB x AA 4 - -

5 ABBB x AA 3 - -

6 AAA x AA 1 - 3 -

7 AA x AAA 1 - -

8 AA x BB 2 - -

9 Rhodochlamys x Emusa 1 1 - -

10 Eumusa x Rhodochlamys - - 3 1

11 AAAA x AA - - 1 -

Sl.No.

Crosscombination

NRCB, Podhavur, Tiruchirapalli Agali , Coimbatore

No. of combinations

Seed set Germination

No. of combinations

Seed set Germination

Table 1. Details of crosses made

No. of crosses made 615 419 1,034

No. of seeds obtained 12,871 26,013 38,884

No. of combinations set seeds 111 126 237

No of unique combination 49 50 99

No. of combination germinated 5 14 19

No of seeds germinated 380 156 536

TotalParticulars NRCB breeding blockPodhavur

Agali breeding blockCoimbatore

Table 3. Details of crosses successfully germinated

Details of hybrids germinated at NRCB Details of hybrids germinated at Agali

M.ac. burmannica x Chengdawt Anaikomban x MattiPagalaphad Wild (BB) x Borkal Baista Anaikomban x Calcutta 4Elavazhai (BB) x Pagalaphad Wild (BB) Sanna Chenkadali x Calcutta 4Ankur II (ABB) x Pisang Jajee (AAw) Calcutta 4 x Pisang LilinM.velutina x Pisang Lilin Anaikomban x Pisang Lilin

Calcutta 4 x Cv. RoseCv. Rose x LairawkCv. Rose x Pisang LilinAnaikomban x Pisang LilinPisang Jajee x Calcutta 4Namarai x Pisang Lilin

NR

CB

Ann

ual

Rep

ort

2009

-'10

13

Correlation studies in bananaThe correlation studies among different banana

genome group on vegetative and fruit charactersrevealed that number of days from flowering toharvest showed a negative correlation with bunchweight (Table 4 ). This suggested that selection ofhybrids for shortest duration (Flowering to harvest)is one of the criteria for selection of high yieldinghybrids. In general, bunch weight had a positivecorrelation with al the fruit traits namely number offruits per hand, number of hands per bunch,number of fruits per bunch, fruit length, fruit weight,flesh weight and peel weight where as it had anegative correlation with pulp TSS content. A highlypositive significant correlation was observedbetween number of hands per bunch and numberof fruits per bunch, days to flowering and days toharvest as well as between fruit weight and fleshweight. A negative correlation was observedbetween fruit length and number of fruits per handwhich suggested that that selection for more numberof fruits may leads to selection of small sized fruits.

Screening of F1 progenies for droughttolerance

F1 Progenies of Karpuravalli (ABB) x Pisangjajee (AA), Matti (AA) x Anaikomban (AA),Manoranjitham (AAA) x Anaikomban (AA), Matti(AA) x Cultivar Rose(AA), Pisang Jajee (AA) x Matti

Parental polymorphism in BB genomeusing microsatellite markers

Polymorphism among the parents Karpuravalliand Pisang Jajee and their progenies were studiedusing 12 pairs of microsatellite markers. Results ofthe molecular characterization was in accordancewith morphotaxonomic characterization indicatingall the progenies were genetically closer to the femaleparent except one which was closer to the male parent(Fig. 2).

Fig. 2 Dendrogram showing the genetic relationshipamong the parents and progenies of the crossKarpuravalli x Pisang Jajee

(AA) , Anaikomban (AA) x Pisang Jajee (AA),Anaikomban (AA) x Namarai (AA) F1 progeniesand parents were screened for drought toleranceusing Relative Water Content (RWC), MembraneStability Index (MSI) parameters. All the progeniesand parents recorded higher MSI after impositionof drought at five month after planting anddifferential response towards RWC. Among thetested materials, Karpuravalli x Pisang Jajeeprogenies recorded higher RWC and Anaikomban(AA) x Namarai (AA) progenies for MSI. InKarpuravalli x Piang Jajee progenies , RWC valueswere closer to Karpuravalli and MSI with PisangJajee. Among the tested F1 progenies , Karpuravallix Piang Jajee ( 02-2/05, 02-6/05) performed wellunder drought till flowering.

Evaluation of banana germplasm againstFusarium wilt

The pot culture and field evaluation of 23parents and 10 hybrids against Fusarium diseaseshowed that out of 23 parents, five parents ( Pisangjajee, cv. Rose, Burrow Cemsa, H3 and Tongat) andout of 10 hybrids, one hybrid (13 (06/05) had noincidence of fusarium wilt under field or pot cultureconditions.

Viability studies on banana embryosStandardization of seed viability test was

carried out using 0.1% 2,3,5- triphenyl tetrazoliumchloride. Fresh seeds were cut open longitudinallyand embryos were excised and incubated in TZsolution from 0-54 hrs. Incubation for 24 hrs with0.1% TZ was found most suitable for studyingembryo viability in both varieties and hybrid seeds(Fig. 3).

Fig. 3. Testing of Seed Viability using tetrazolium chloride

Fresh Seeds 12 hrs after 24 hrs after 48 hrs after

Study on hormones on in-vitro embryogermination

Studies on the effect of hormones on in-vitrogermination of embryos using basal MS mediumfortified with 1BA (1 mg/l) and a combination ofIBA (1mg/l) + IAA (0.5 mg/l) along with control(MS medium). Results indicated that embryos ofwild bananas germinated easily with germinationrate ranging from 36.8% to 43.2% (in hybrids) and84.0% to 88.00% (in pure diploids). But in 3x X 2xcrosses, embryos failed to germinate irrespective ofmedia composition. In both pure diploids andhybrid diploids, embryo recorded 24-27 days tocomplete plantlet formation.

14

Tabl

e 4.

Cor

rela

tion

stu

dies

on

bana

na

Plan

t hei

ght (

cm)

1.00

000.

6969

*0.

6019

*0.

6104

*0.

2960

0.37

970.

1400

0.30

940.

2575

0.24

770.

3266

0.33

980.

1937

0.14

95

Pseu

dost

em g

irth

(cm

)

1.00

000.

6674

*0.

6906

*0.

5081

*0.

3417

0.14

490.

3629

0.31

610.

0764

0.13

460.

1626

0.01

950.

0795

Day

s to

flow

erin

g

1.

0000

0.97

89**

0.32

220.

2283

0.12

120.

2979

0.24

81-0

.064

20.

0275

0.09

11-0

.114

80.

2642

Day

s to

harv

est

1.

0000

0.50

81*

0.16

230.

0936

0.27

380.

2202

-0.1

062

-0.0

396

0.01

83-0

.152

40.

2907

Day

s fro

m fl

ower

ing

to h

arve

st

1.

0000

-0.2

054

-0.0

786

0.01

57-0

.022

7-0

.211

8-0

.293

2-0

.292

8-0

.217

00.

2331

Bunc

h W

eigh

t (K

g)

1.00

000.

4839

*0.

6568

*0.

6593

*0.

5621

*0.

7460

*0.

7583

*0.

4975

-0.1

977

No.

of fr

uits

per

han

d

1.

0000

0.58

01*

0.74

75*

-0.0

563

0.00

560.

0368

-0.0

796

-0.1

345

Num

ber o

f han

ds p

er b

unch

1.

0000

0.95

98**

0.15

660.

1400

0.18

33-0

.019

30.

0369

Num

ber o

f fru

its p

er b

unch

1.00

000.

1094

0.10

350.

1492

-0.0

479

-0.0

157

Frui

t len

gth

(cm

)

1.00

000.

7702

*0.

7567

*0.

6138

*-0

.236

5

Frui

t wei

ght (

g)

1.

0000

0.96

25**

0.79

56*

-0.2

402

Pulp

wei

ght (

g)

1.00

000.

6576

*-0

.207

2

Peel

wei

ght

1.00

00-0

.249

6

Pulp

TSS

(° B

rix)

1.

0000

Para

met

ers

Plan

the

ight

(cm

)

Pseu

dost

emgi

rth(c

m)

Day

sto

flow

ering

Day

s to

harv

est

Day

sfr

omflo

weri

ngto

harv

est

Bunc

hW

eigh

t(K

g)

No.

of

frui

tspe

rha

nd

No.

of

hand

spe

rbu

nch

No.

of

frui

tspe

rbu

nch

Frui

tle

ngth

(cm

)

Frui

tw

eigh

t(g

)

Pulp

wei

ght

(g)

Peel

wei

ght

Pulp

TSS

(° B

rix)

NR

CB

Ann

ual

Rep

ort

2009

-'10

15

In vitro culture and plant regeneration via indirectorganogenesis from Pisang Jajee

(A) Immature zygotic embryo(B) Primary response of embryo(C) Induction of callus(D) Callus proliferation(E) monopolar regeneration(F) First leaf emergence(G) Tissue cultured plantlet ready for rooting(H) In vitro regenerated Pisang Jajee plant regenerated

growing on soil

Fig. 4. Effect of embryo age on growth parameters

Effect of plantlet age (in embryogerminationmedium) on regeneration

Effect of age of plantlet and embryo germinationmedium on overall plant growth and finalregeneration was studied on hybrid embryosderived from Pagalaphad wild (AA) and BorkalBaista (BB). Duration of embryo held in germinationmedium exhibited a parabolic curve with respect tofinal survival. Plantlets of 80-90 days age old werethe best for shifting to primary hardening (with 5-6leaves and 3-4 roots) beyond which it reduced thesurvival drastically (Fig. 4).

Effect of seed age and soaking treatments onin-vivo seed germination and regeneration

Different seed treatments like water soaking andsoaking in GA3 for 48 hours had no significant effecton germination and other growth parameters. Theage of the seed had significant influence on all theparameters studied. Freshly harvested seedsrecorded the highest germination (77.87), earliest togerminate, to produce root and shoot and alsoexhibited minimum days for complete plantletformation (47.33 days). Even with wild hybridprogenies, age of the seed is the most crucial factordue to dormancy.

Factors affecting embryo rescue andplantlet regeneration in Musa spp.

Embryo at various stages of development (70,80, 90, 95 and 100% maturity) was initiated on MSmedium fortified with different growth regulators.The results (Fig.5 ) indicated that the effect of embryomaturity on callus induction was highly significant.Percent callus induction was more in immatureembryos (70%) irrespective of the media compositionand it decreased with embryo maturity. 100%embryos failed to induce callus and instead theyexhibited direct regeneration into plantlets(organogenesis) irrespective of media composition.

Fig. 5. Effect of different plant growth regulators onembryo germination

5.1.3 Improvement of banana throughnon-conventional approaches

Evaluation of Embryogenic Cell SuspensionCulture

Plants derived from Embryogenic CellSuspension of cv. Rasthali were compared withtissue culture raised and normal sucker raisedplants for biometric parameters. The performanceof ECS derived plants exhibited growth and yieldperformances at par with normal suckers and tissuecultured plants (Table 5). This suggests that ECScould be a better alternative for large scale in-vitromultiplication in banana.

Factors affecting longevity of EmbryogenicCell Suspension Cultures

Different factors like initial suspension density,quantity of medium used for initiation, gradualscaling up of medium, subculture period, rpmselected etc. which directly affect the longevity ofsuspension were studied. Observations revealed

16

Table 5. Comparative evaluation of ECS derived plants with sucker and tissue culture plants of cv Rasthali (1stratoon)

that in order to obtain homogenous cell lines (a)Ideal callus selection of (b) New embryogenicclusters initiation of 3-5 ml medium (c) Mediumscaling up to 15-20ml in 2-3 months and (d)Maintaining 3-5 % SCV while subculturing toincrease the proliferation rate are to be followed. Toincrease the longevity of ECS: (a) Subculture shouldbe done when cells are in exponential phase (b)Increasing the period of subculture from 2 to 10 daysbased on age of culture (c) Decreasing the rpm from70 to 50.

Viability test for ECS have been standardizedusing FDA for routine studies. Suspensionexhibiting >80% viability was used for genetictransformation, mutation and other studies. Culture

deterioration was expressed in terms of fluorescenceintensity, fresh the suspension, more is thefluorescence and dead cells were indicated as greyclumps (Fig. 6. a & b)

Identification of diverse lines of BB for usein the development of genetic linkage maps

Six BB diploids along with a AA diploid werecharacterized using 20 pairs of microsatellitemarkers to identify the most diverse parents forgenotyping work. Out of the 20 primers tested, 13primers produced discrete and reproducible bandswith an average polymorphism of 93.07% indicatingsubstantial variation at the DNA level. Resultsindicated that both the parental combinations of

(a) 8 months old suspension (b) 18 months old suspension

Fig. 6. Effect of age of culture on viability

Pseudostem Height (Cm) 298.5 282.3 291.5 290.77 NS - 3.12

Pseudostem Girth (Cm) 73.3 75.2 78.9 75.80 ** 4.5922 3.14

No. of leaves at shooting 13.6 12.7 13.16 13.15 ** 0.6038 2.38

Petiole length (cm) 55.3 53.4 52.7 53.80 ** 2.2859 2.20

Leaf Area (X 104) 13.50 12.82 12.66 12.99 NS - 5.52

Days taken for shooting 303 310.5 301.6 305.03 ** 5.5966 0.95

Days taken for bunch maturation 118.6 124.4 132.5 125.17 ** 5.6436 2.33

Duration (Days) 411.6 424.9 431.1 421.20 ** 8.3395 1.00

Bunch weight (Kg) 14.33 13.45 12.65 13.48 * 1.4963 5.75

No. of hands per bunch 7.1 6.8 7.8 7.23 NS - 10.41

No. of fruits per hand 12.3 12.4 12.6 12.43 NS - 6.85

Total no. of fruits 98.6 91.12 88.67 92.80 ** 5.3533 2.99

Parameters Sucker(T1)

T.C(T2)

ECST3

GeneralMean

Sig/N.Sig

CVCD @1 %

NR

CB

Ann

ual

Rep

ort

2009

-'10

17

Table 6. Polymorphism in various microsatellite markers

AGMI 95 / 96 0 10 10 100 AGMI 103 / 104 2 2 4 50 AGMI 105 / 106 0 7 7 100 AGMI 129 / 130 0 6 6 100 AGMI 24 / 25 0 9 9 100 AGMI 133 / 134 0 12 12 100 AGMI 123 / 124 0 5 5 100 Ma - SSR 8a / 8b 0 8 8 100 Ma - SSR 18a / 18b 0 7 7 100 Ma - SSR 24a / 24b 1 4 5 80 Mb - SSR 1 - 146 0 5 5 100 Mb - SSR 1 - 149 1 4 5 80 Mb - SSR 1 - 49 0 4 4 100 TOTAL 4 83 87 1210 AVERAGE 0.30 6.38 6.69 93.07

Primer pairs Monomorphicbands

Polymorphicband

Polymorphism (%)

Total No. ofbands

IIHR (Bhimithia x Beeheekela) and NRCB(Pagalaphad wild x Borkal Baista) were equallydiverse with 28% variation (Table 6 & 7),(Fig. 7).

Preliminary studies on the development ofgenetic linkage maps in Musa using SSRmarkers

As a whole 10 % of primers produced no bandsin M. acuminata wild Assam, Anai komban, Kanaibansi and Namarai. Of the total, 13.33 % of primersdid not produce scorable bands in M. acuminataWild Arunachal Pradesh, Lairawk, Musa acuminataAssam. Similarly, 23.3% of primers did not produceany detectable bands in Balukpong Wild while16.67% of primers did not produce any scorable

Fig. 7. Dendrogram showing the diversity among the BBparents for use in the development of genetic linkagemaps

Table 7. Clone specific bands produced in various microsatellite markers

AGMI 95 / 96 4 - - - 1 - - AGMI 103 / 104 - - - - 1 1 - AGMI 105 / 106 2 - - - - - 1 AGMI 129 / 130 4 - - - 1 1 - AGMI 24 / 25 5 - - - - - - AGMI 133 / 134 1 - - - 5 - - AGMI 123 / 124 - - - - - 1 - Ma - SSR 8a / 8b 2 - - - - - - Ma - SSR 18a / 18b 1 - - - - - - Ma - SSR 24a / 24b 1 - - - - - - Mb - SSR 1 - 146 - 3 - - - - -

Primer PairsSpecific bands

Cal-4 Andamanbalbisiana Beejikela Bhimithia Beehee

kelaBorkalbaista

Pagalaphadwild

18

bands in Chengdawat, GP-15 and Pagalapahadwild. In Musa acuminata burmaniccoides, 36.6% ofprimers did not produce any detectable bands. Asmany as 26% of primers did not detect any scorablebands in Sanna Chenkadali and Musa acuminata ssp.burmannica.

Out of 30 primers, 44.89 % of primers producedsingle bands in all AA diploids and 27% of theprimers produced double bands in 17 accessions.Only 13 % of primers produced three bands in 10accesssions excluding Musa acuminata WildArunachal pradesh, Anaikomban, Balukpong Wild,Chengdawat, GP-15, Musa acuminata ssp. burmanniccoides and Pagalapahad wild.

As a whole, 10 per cent of primers produced nobands in Attikol, Athiakol, Bhimkol (0597), BorkalBaista, Elavazhai, Jungle Kela-1, Khungsong Wildand Pagalapahad Wild (1182). Of the total 13.33per cent of primers produced no scorable bands inMusa balbisiana (Andaman), Jungle Kela-2, Musabalbisiana, Pagalapahad Wild (1184), Phirima Wildand in Sasra Bale. In all , 6.67 per cent of primersdid not produce any detectable bands in BachariaMalbhog, Beeji Kela and Manohar , while 3.33 percent of primers did not produce any scorable bands

in Maguthamang. In Bhimkol (0007) 16.67 per centof primers did not produce any detectable bands.

Out of 30 primers, 58.39 per cent of primersproduced single bands in all BB diploids, 23.15 percent of primers produced double bands in 18accessions excluding Musa balbisiana. In Musabalbisiana, all the primers produced single bands.Only 8.46 per cent of primers produced three bandsin 13 accesssions excluding Bhimkol (0597), Musabalbisiana, Pagalapahad Wild (1182), Phirima Wild,Musa balbisiana (Andaman) and Attikol (Table 8).

All AA and BB diploids tested are heterozygousexcept Musa balbisiana. It was concluded that all theAA and BB diploids could be conveniently used inconventional breeding for development ofsegregating population. Due to heterozygosity andmoderately diverse nature early generationprogenies of AA and BB diploid F1 could be usedfor development of linkage maps.

Standardization of low cost technology formicropropagation of Udhayam banana

Five cheap sources of water viz., single distilledwater, R.O. water, tank water, tap water and Cauverywater were tried, along with double distilled waterfor the tissue culture media preparation. ReverseOsmosis water and tank water were observed to bethe best substitutes for double distilled water as theper cent greening and days taken for greening ofshoot tips were at par with control (Table 9, Fig.8)Table 9. Effect of water sources on the initialestablishment of shoot meristems

1. Control (Doubledistilled water) 5.6 80

2. Single distilled 7.0 75

3. Reverse Osmosis water 5.4 75

4. Tank water 6.2 60

5. Tap water 7.8 60

6. Cauvery water 6.4 60

Level of significance ** -

CD (p = 0.01) 1.32 -

CV per cent 11.59 -

Sl.No.

Watersource

Greening(per cent)

No. of daystaken Forgreening

Table 8. Number of primers producing homo /heterozygous alleles in various BB diploids

1. 1353 23 3 0 42. 0011 18 9 0 33. 0444 14 9 4 34. 0446 18 8 2 25. 1914 17 7 4 26. 0007 19 5 1 57. 0597 20 7 0 38. 0018 12 13 2 39. 0167 17 6 4 310. 1912 21 4 2 311. 1913 19 5 2 412. 1168 13 10 4 313. 0067 17 9 3 114. 0047 19 7 2 215. 0508 26 0 0 416. 1182 23 4 0 317. 1184 14 10 2 418. 1186 23 3 0 419. 0449 19 6 1 4

Sl.No.

AccessionNo.

No. of alleles producedSingle Double No

bandsTriple

Three gelling agents namely Sago, Corn flourand Isabgol were tried at different concentrationsalong with routine agar as control. Sago at 13 percent concentration was found as the optimal dose

NR

CB

Ann

ual

Rep

ort

2009

-'10

19

Fig. 9. Effect of various concentrations of Table sugar onshoot proliferation in cultivar Udhayam

Substitution of Agar and sucrose with other lowcost alternatives has substantially brought downthe cost. Cost of the gelling agent was reduced by85.71 per cent when Sago was used as a substitutefor agar. Similarly cost of the carbon source wasreduced by 94.0 per cent when sucrose wassubstituted by table sugar. There was 83.10 per centreduction in the cost of preparation of one litre MSmedium used for tissue culture of banana cultivarUdhayam (Table 11).

Fig. 8. Effect of Tank water and different carbon sourceson shoot proliferation

since, it produced maximum greening in a shortertime like that of control medium which containedagar as gelling agent (Table 10). Minimum greening(10 - 20 %) was observed in corn flour treatmentsand drying of shoot meristems makes it unfit asgelling agent in tissue culture media. Though use ofIsabgol as an alternate gelling agent in plant tissueculture media has been reported by several workers,in the present study, it could not facilitate theinoculation of shoot meristems.Table 10. Effect of concentrations of gelling agents onthe initial establishment of shoot meristems

1. MS + 10 per cent Sago 10.6 70

2. MS + 12 per cent Sago 9.6 70

3. MS + 13 per cent Sago 9.2 80

4. MS + 10 per cent Corn flour 12.6 10

5. MS + 11 per cent Corn flour 12.8 10

6. MS + 12 per cent Corn flour 12.2 20

Level of significance ** -

CD (p = 0.01) 1.00 -

CV per cent 5.47 -

Sl.No.

Treatments Greening(per cent)

No. of daystaken Forgreening

Three different carbon sources namely sugar,Rock candy (RC) and Small candies (SC) were triedat varying concentrations namely 3%, 4% and 5%as a substitute for sucrose. These substitutes weretried in the MS media which were prepared withReverse osmosis and Tank water containing Sago(13%) as gelling agent. Among the varioustreatments tried, the treatment R.O+ Sago+ T.S at3% concentration was optimum as it produced themaximum buds (5.75 nos.) within a short span of5.00 days (Fig.9).

Commercial multiplication of UdhayamAbout 300 shoot tips of Udhayam were initiated

under in vitro multiplication and 300 plants ofUdhayam could be successfully hardened. Onehundred tissue cultured plants of cultivar Udhayamtissue cultured plants were supplied to KVK,Mohanur (Tamil Nadu) for front line demonstration.One hundred rooted Udhayam cultivar and mothercultures have been supplied to HRC, Nagicherra(Tripura) .

Table 11. Economics for the low cost alternatives fortissue culture multiplication of cultivar Udhayam

Macronutrients 2.30 2.30

Micronutrients 0.55 0.55

Organics 0.03 0.03

Iron 0.09 0.09

BAP 0.76 0.76

Ascorbic acid 0.01 0.01

Agar 35.00 -

Sucrose 22.00 -

Sago (13%) - 5.20

Table sugar (3%) - 1.32

Total 60.78 10.26

Particulars

Cost of medium (Rs. /litre)Normalmedium

Low cost medium

20

Fig.12. Amplification of RGA in cDNA and Genomic DNAby using LRRF and LRR reverse primer

5.1.4 Identification and characterizationof nematode resistance gene (s) inbanana

Creation of suppression subtractive libraryRoot RNA were isolated from P. coffeae

inoculated and uninoculated plants of cv.Karthobiumtham during 6th DAI. SuppressiveSubtractive Hybridization (SSH) library, containingmore than 1400 colonies, was created by using theseRNA. The clones were confirmed by PCR (Fig. 10)as well as Eco RI restriction analysis. A total of 91clones were sequenced and EST sequences weretrimmed by using Vec screen software and trimEST.The edited nucleotide (cDNA) sequence size rangedfrom 86 bp (S-113) to 1000 bp (S-31) with an averageread length of 400 bp based on the insert size. Thesesequences were divided into five sub groups basedon insert size (Fig. 11 & 12). Maximum number of

clones was grouped under the 80-200 read lengthfollowed by 200-300 read length (20 clones). Theresults confirmed that ligation efficiency improvedwith decreasing sequence length.

By using CAP3 software, these sequences wereclustered into 72 longest possible consensus, whichgenerated 9 contigs and 63 singletons. The BLASTX analysis revealed that 13% of putative genes werehit with resistance/defense related genes. Out ofwhich, two genes were hit with stress related genesnamely type II metallothioenins (92%) and class IIIacidic chitinase gene (75%) of Musa. Nearly 15% ofthe putative genes were hit with Musa genes, out ofwhich 50% of genes were hit with Musa acuminataBAC clone.

By using SSR primer II software, SSR primerswere designed among the 63 singletons and 9contigs. Only one primer pair was obtained fromthese consensus. It was designed in the Singleton38 for (CTT)4 repeats with the primer sequence of5 ' G G T T G G C T C C T C T T C T T C 3 ' a n d5'ATGATGACTTGGCTCTCTTG3'. The expectedsize of the amplified product was 239.

RGA studies in nematode resistantaccession

a) Isolation of RGAs from nematoderesistant cultivars

A total of 20 RGAs were isolated from theresistant cultivars namely cv. Karthobiumtham andcv. Attikol by using five different sets of primers.Out of which, only 9 had un interrupted openreading frame.

The BLAST analysis of clones obtained fromLRR forward and reverse primers revealed that theywere not hit with any of the NBS-LRR sequences.This confirmed that LRR region is highly variableand devoid of any conserved domains. But it hashit with R protein namely ubiquitin carboxyl-terminal hydrolase family protein and cysteine-typeendopeptidase/ ubiquitin thiolesterase (UBP9)mRNA. These enzymes are involved in diseaseresistance mechanism (Fig. 13).

b) Isolation of functional RGAs from cDNAFor amplifying the NBS LRR region from cDNA

of both Karthobiumthum and Attikol cultivars LRRprimer set was used. But polymorphic bandingpattern was observed only in gDNA not in cDNA(Fig. 12), Polymorphism was also observed amongthe gDNA of two cultivars, whereas in cDNA onlyone band at 400 bp alone was observed irrespectiveof cultivars. Hence cDNA amplified product of cv.Karthobiumtham alone was cloned. Based on RFLPanalysis of clones by using different enzymes, clones

Fig. 10. Colony PCR of SSH library clones with nestedprimers

Fig. 11. Number of clones having different insert sizes

NR

CB

Ann

ual

Rep

ort

2009

-'10

21

were grouped into two (Fig 13). One clone has beenselected from each group and sequenced. BothcDNA and gDNA derived sequences were analysedfor homology percentage. It was found that twosequences which are derived form cDNA and gDNAhad 100% homology whereas ,other two clones hadonly 26% homology. But the BLASTn analysisrevealed that all the sequences were hit with thesame type of putative genes.

Fig. 13.Characterization of RGAs through restriction enzymeanalysis

NBS-LRR primers have been used for amplifyingthe RGAs from cDNA and DNA of cultivarKarthobiumtham. This study revealed that thoughequal amount of template were taken from bothcDNA and DNA, the banding intensity was verylow in case of cDNA than gDNA. Different bandingpattern was observed in between genomic DNA oftwo resistant cultivars. As the amplification at 800bp was observed in only cv. Karthobiumtham bothin gDNA and cDNA.

5.1.5 Improvement of Rasthali throughinduced mutagenesis

Determination of LD50 for chemical mutagenDiethyl sulphate for the shoot meristemexplants of cv. Rasthali

The shoot meristems of cv. Rasthali were treatedwith 5, 10, 15, 20 and 25 mM for 2, 3, 4 and 5 hoursin an incubator shaker (110 rpm at 20ºC). Treatedshoot meristems were inoculated in MS mediumcontaining 4.0 mgl-1 BAP. The effect of variousconcentrations of Diethyl sulphate (DES) andincubation periods and their interaction effect onper cent gain in fresh weight (Table- 12) and daystaken for greening of shoot meristems(Fig -14) werehighly significant. But the effect of variousconcentrations of DES and incubation periods andtheir interaction effect on number of buds producedper explant were at par.

Fresh Weight Gain (FWG) was nearer to 50% inC1T5 followed by C1T3 and C1T4 and were at par.Though FWG for C4T5 (50.39 per cent) was also

Fig.14 Effect of DES on days taken for greening inproliferating buds

Table 12. Effect of DES on Fresh Weight Gain (FWG)of shoot meristems

Treatments 10 mM 15 mM 20 mM 25 mMControl 5.93 7.25 5.62 5.10

(100) (100) (100) (100)T1- 2 hrs 3.74 6.73 4.07 5.04

(63.07) (92.83) (72.42) (98.82)T2- 3 hrs 3.05 6.33 2.60 4.52

(51.43) (87.31) (46.26) (88.62)T3- 4 hrs 3.00 5.83 2.01 3.40

(50.59) (80.41) (35.77) (66.67)T4- 5 hrs 2.98 3.79 1.87 2.57

(50.28) (52.28) (33.27) (50.39)Level ofsignificance ** ** ** **CD (p=0.01) 0.15 0.27 0.12 0.27CV per cent 2.18 2.54 2.13 3.58

FWG (g) at variousconcentrations of DES

Table 13. Effect of DES on number of buds producedper explant in proliferating buds

Treatments 10 15 20 25

Control 6.15 5.25 4.75 5.00

T1 - 2 hr 5.20 5.10 4.75 4.00

T2 - 3 hr 4.15 3.75 4.20 3.50

T3 - 4 hr 3.50 3.00 2.65 2.00

T4 - 5 hr 2.10 2.00 3.15 2.15

Level ofsignificance ** ** ** **

CD (p=0.01) 0.18 0.61 0.15 0.17

CV per cent 2.40 8.88 2.11 2.85

DES Concentration (mM)

HAE III

22

close to 50, it was considered better to select a longerincubation period with lower concentration as itdecreases damage causing hydrolytic by products,which in turn improves the mutagenic efficiency.Therefore , LD50 was fixed as 10 mM DES for 5hours which produced 50% FWG over control. Thenumber of days taken for greening was minimumin control and it was maximum in C1T3, C2T4 andC3T4 and were on par. Number of buds producedper explant was always maximum in control and itdecreased as the incubation period increased at allconcentrations of DES (Table 13).

In vitro screening for Fusarium wiltresistance using Culture filtrate

Mutated shoot buds of Rasthali were inoculatedin MS medium containing 3, 6 and 9% concentrationsof Culture filtrate with twenty replications each.

Effect of culture filtrate concentrations onpercent survival was highly significant. As theconcentration of the Culture filtrate increased, the

Fig. 16. Effect of different doses of gamma irradiation onthe initial establishment of proliferating buds of cv.Rasthali

percent survival decreased. 100% survival wasobserved in control followed by 3% culture filtrate(80%), which were on par with each other (Fig.15).Hence incorporation of 3% culture filtrate in the MSmedium was determined as the optimal dose forscreening of shoot meristems for Fusarium wiltresistance under in vitro conditions.

GAMMA IRRADIATION

Proliferating budsProliferating buds obtained from the 3rd or 4th

subculture were irradiated at doses viz., 10, 15, 20and 25 Gy using the facilities available at BARC,Mumbai. Each treatment had 10 replications.

As the concentration of the Culture filtrateincreased, the percent survival decreasedsignificantly. 100% survival was observed inControl while 50% survival was observed at 20 Gy.Hence 20 Gy was determined as the LD50 forproliferating buds of cv. Rasthali (Fig. 16).

Fig. 15. Effect of different concentrations of Culture filtrateon the initial establishment of shoot tips of cv.Rasthali

NR

CB

Ann

ual

Rep

ort

2009

-'10

23

5.2 CROP PRODUCTION

5.2.1 Standardization of agro techniquesfor banana production and productivity

Standardization of spacing and nutrientrequirement for banana cv. Udhayam (ABB)

An experiment with three levels each of N andK fertilizers at four different spacing was conducted.At flowering, the closest spacing of 1.8 X 1.8 mrecorded the highest plant height (432.0 cm) whereas wider spacing of 2.1 x 2.4 m recorded the lowestplant height and maximum plant girth (94.5 cm).Among fertilizer doses, 200:400g N&K recorded thehighest plant height (426.3 cm) and plant girth (94.1cm). The number of healthy leaves at flowering wassignificantly more in plants at 2.1 x 2.4 m spacingwith 300g / N&K each plant. The plants fertilizedwith 300g N and 500g K recorded the maximumnumber of healthy leaves.

Wider spacing of 2.1X2.4m with 300:400g N&K/plant exhibited earliest flowering (413.7 days )whereas, the closest spacing ( 1.8X1.8m ) with

200:300g N&K/ plant recorded the maximum days( 501.4 days) for flowering. Among the four differentspacings, the wider spacing of 2.1X2.4m recordedthe least time for flowering (431.4 days).

At flowering stage, the highest concentration ofleaf N (2.87%) and K (2.96%) were recorded in plantsat 2.1X2.1m spacing with 400:400g N&K/ plant,while 1.8X1.8m spacing with 300g N and 500g K /plant recorded the highest leaf P content (0.58%).

Time taken for maturity ranged from 137.2 daysto 159.9 days among different treatmentcombinations. Combination of 2.1X2.4m spacingwith 200:400g N&K/plant recorded significantlyless time for maturity (137.2 days) while 2.1 x2.1mspacing with the lowest fertilizer dose of 200:300gN&K recorded the longest days for fruit maturity(159.9 days).

The bunch weight was the highest (35.7 kg) inwider spacing (2.1 X2.4m) with 300g N and 400g K/plant. Whereas closest spacing (1.8 x1.8m) withlowest fertilizer dose (200g N & 300g K/plant)recorded the lowest bunch weight (18.2 kg) (Fig. 17).

Fig. 17. Bunch weight (kg) as influenced by spacing and nutrients in Udhayam banana

Studies on the nematode populations from bothsoil and root samples revealed that population buildup of root-knot nematode, (Meloidogyne incognita)was higher in closer spacing with lower fertilizers.

With increase in dosages of N and K, significantreduction in nematode population was observed

and negligible nematode population was observedin 2.1m X 2.4m with 400g N & 500g K/ plant.

5.2.2 Studies on Micronutrient in BananaUnder micronutrient trial with Nendran,

sulphur application increased the plant growth

24

parameters like plant height, pseudostem girth, totalnumber of leaves and total leaf area significantlyover without sulphur application (7.36, 6.60, 8.0and 9.35 per cent, respectively) and increased thebunch weight significantly (38.6 %) than control.

Sulphur application increased the leaf nutrientconcentrations like N, P, K, Ca, Mg and Ssignificantly (7.2, 8.1, 11.4, 35.1, 17.6 and 42.0 percent) respectively than without sulphur application.Soil application of 5g FeSO4, 5g ZnSO4 and 5g Boraxper plant without sulphur recorded the highestbunch weight ( 9 kg) with an net additional profit ofRs. 61250/- per hectare.

Fig.18. Effect of micronutrients on yield of Nendran banana

Soil application of 5g FeSO4 and 5g ZnSO4 and0.5% foliar spray of Borax with sulphur applicationrecorded 12.5kg with net additional profit of Rs.85100/- per hectare.

With S application, the bunch weight washighly correlated with leaf S concentration (0.468**)and leaf K concentration (0.442**). But, without Sapplication, the bunch weight was highlycorrelated with leaf S concentration (0.444**) only,which indicated the role of sulphar in reducing theleaf K thus affecting the carbohydrate synthesis inleaf (Fig. 18).

5.2.3 Fertiliser tailoring equations forKarpuravalli and Poovan (ratoon-I)

Requirement of N, P2O5 and K2O for producingone ton of Poovan (ratoon-I) banana was workedout as 11.52, 1.57 and 22.96 kg, respectively. InPoovan (ratoon-I) banana production, 51.2, 37.8 and58.3 % of N, P2O5 and K2O was contributed from soilwhile, applied fertilizers contributed to an extent of58.2, 42.6 and 58.7 % N, P2O5 and K2O and fromorganic manure 18.3, 16.1 and 24.8%, N, P2O5 , K2Orespectively.

Requirement of N, P2O5, K2O for producing oneton of Karpuravalli (ratoon I) banana was workedout as 12.8, 1.4, 18.7 kg respectively. In Karpuravalli(ratoon I) banana production, 57.8, 45.2 and 40.9%of N, P2O5 and K2O from soil, while applied fertilizers

contributed 58.6, 49.6 and 76.9% of N, P2O5 and K2Oand from organic manure 16.9, 12.3 and 20.1%, N,P2O5 and K2O respectively were contributed forbanana production.

The fertilizer adjustment equations for Poovan(ratoon-I) are FN = (19.8 x T) - (0.88 x SN) - (0.31 xON); FP = (3.69 x T) - (0.89 x SP) - (0.38 x OP); FK =(39.11 x T) - (0.99 x SK) - (0.42 x OK). The fertilizeradjustment equations for Karpuravalli (ratoon-I) areFN = (21.8 x T) - (0.98 x SN) - (0.29 x ON); FP = (2.82x T) - (0.91 x SP) - (0.24 x OP); FK = (24.3 x T) - (0.53x SK) - (0.26 x OK), where, FN, FP & FK are NPKrequirement through fertilizer (kg/ha), SN, SP & SKare NPK available in the soil (kg/ha), ON, OP & OKare NPK requirement through organic manure (kg/ha) and T is yield target (t/ha).

NR

CB

Ann

ual

Rep

ort

2009

-'10

25

5.3. CROP PHYSIOLOGY, BIOCHEMISTRY AND POST- HARVESTTECHNOLOGY

5.3.1 Crop Physiology

5.3.1.1 Climatic factors on leaf developmentin Grand Naine Banana

Vegetative growth of sucker derived GrandNaine revealed that the rate of leaf production wasmore than one per week at mean diurnal temperatureof 25- 27°C with less than 90 % RH and the ratedecreased (<1 per week) at lower mean temperature(25-26°C) and RH.

5.3.1.2 Improvement of banana bunchdevelopment

Brassinolides (BR) with Gibberalic acid (GA )spray (BR 2, 4, 6, 8, 10 ppm + 25 ppm of GA) increasedthe finger length and circumference in Ney Poovan, Poovan and Saba cultivars. The response was lowat more than 8 ppm BR + GA 25 ppm.

The effect of Potassium sulphate spray (1%,1.5%, 2% and 2.5%) on bunches of cultivars Poovan,Robusta, Ney Poovan and Rasthali was moreprominent on finger circumference than length. Theeffect of spray of Potassium sulphate on fingercircumference was prominent at 1.5 % concentrationand was on par with 2.0 % concentration.

5.3.1.3 Drought stress tolerance in banana:Understanding the physiological, biochemical and molecular mechanism ofdrought tolerance

To study the mechanism of drought tolerance,four drought tolerant genotypes viz., M.balbisiana(BB), Monthan (ABB) Saba (ABB) and Poovan (AAB)and two susceptible banana genotypes, viz., GrandNaine (AAA) and Nendran (AAB) were subjectedto soil moisture deficit stress. The osmotic potentialwas higher in drought stressed plants (-0.35 to -0.77 MPa) as compared to irrigated control (- 0.27 to- 0.36 MPa) through out the treatment period (threeweeks). In M.balbisiana, the osmotic potential didnot decreases (- 0.414 MPa) significantly even afterone week of drought imposition, whereas, in allother genotypes, the osmotic potential showed anincreasing trend till the end of drought stress period.Relieving of drought stress after three weeks,indicated increase of OP in all genotypes except inNendran (susceptible cultivar). The Osmoticadjustment of M.balbisiana was not greater than othergenotypes. The proline content of M.balbisiana,Monthan, Saba and Poovan, recorded higher content(240-290 ug/g fr.wt.) than Nendran (128.30 ug/gfr.wt.). The Membrane Stability Index (MSI) recorded

higher in M. balbisiana, Monthan and Saba (68-70)than Nendran (58). Under drought stress conditions,M. balbisiana, Monthan and Saba maintained higherchlorophyll pigments, membrane stability index andvegetative growth than susceptible genotypes.

5.3.1.4 Salt stress tolerance in banana:Understanding the physiological, bio-chemical and molecular mechanism of salttolerance

Banana plants grown in the salt affected field(EC1:2.5 = 8.56; pH 8.1) were analysed for Sodium(Na+) and Potassium (K+) ions at flowering andharvest in various plant parts. At flowering stage,sodium ions in 2nd and 3rd leaf lamina stage wereanalysed in five cultivars .Among cultivars Poovan,Nendran and Robusta cultivars accumulated moreNa ions (0.25 to 0.625%) than Saba and Karpuravalli(0.001%). However, in all the varieties , Na+ ionswere found to more in leaf midribs. Karpuravallicorms accumulated significantly less Na+ ions(0.001%) as compared to other varieties (0.375 to1.875%). At harvest Na+ ions in the peel and pulpof middle hands of Saba and Karpuravalli cultivarsrecorded less (0.001 to 0.25%) than other cultivars(0.375 to 0.5%). Magnesium and Calcium weremobilized from banana corm in salt tolerantcultivars unlike susceptible cultivars.

At flowering, Saba and Karpuravalli cultivarshad higher potassium ions (K+) (6.312 -8.12%) thanremaining cultivars in leaf midrib and at harvest,the corm mobilized more K+ ions than otherdeveloping sinks. Saba and Karpuravallimaintained higher K+/Na+ ratio (> 200) in laminaand leaf midrib at flowering as well as at harvest ascompared with Poovan , Nendran and Robustacultivar (4.52 to 17.56). It was concluded that tolerantvarieties had more K+/Na+ ratio in the lamina andin the midrib at flowering and at harvest.

Salt tolerant cultivar Saba accumulated highernitrogen in 2nd and 3rd leaf petioles and high N, Pand K in inner core of corm as compared tosusceptible cultivars under field condition. The 2ndand 3rd leaf blades of Saba cultivar had very lowphosphorus content (0.001%). Higher K was in theinner core of Saba corm at harvest when comparedto all other susceptible cultivars. In salt stressimposed Grand Naine plants, treatement withAbscisisic acid (ABA) and Butylated HydroxyToluene (BHT) significantly increased carotenoidpigment content when compared with control. TheMalondialdehyde content (indication of lipidperoxidation) decreased in ABA and BHT treatedplants. The ABA treated salt stressed plants recordedhigher ascorbic acid and proline content thancontrol. Increase in Epicuticular wax in leaves wasobserved in sodium chloride salt stressed plants due

26

to ABA application. It was concluded thatapplication of ABA on plants could alleviate theadverse effects of sodium chloride salt stress.

The number of days to flowering under saltstressed condition was extended upto 45 to 52 days.There was significant increase in fruit volume,pulp/peel ratio between 30 and 60 days afterflowering in Saba and Ney Poovan cultivars whencompared with Nendran and Robustacultivars.Saba cultivar accumulated lesser totalsugar than other cultivars in pulp and peel duringfruit development. In susceptible Robusta andNendran cultivars, there was no fruit development.The total sugars content was significantly higher inpeel than pulp throughout fruit development. It wasobserved that under high salt stress condition,sugars are not properly converted into starch whichresults in lower bunch weight.

5.3.1.5 Effect of Soil moisture deficit stresson symptomatic and non-symptomatic BSVaffected Poovan banana

The BSV infected Poovan (AAB) plants (withexpressed and non expressed symptom) weresubjected to soil moisture deficit stress for threeweeks in 75 kg capacity cement pots. The totalchlorophyll (3.36 mg/g fr.wt.) and carotenoidcontents (0.323 mg / g fr.wt.) were higher in non-symptomatic plants than the drought stressedsymptomatic plants of cultivar Poovan Chlorophyll(2.537 mg / g fr.wt ) and carotenoids ( 0.030 mg / gfr.wt.). Total sugar content was analysed in thecorm of treated plants. It was recorded that waterstressed symptomatic plants accumulated two timeshigher sugar in corm than non-symptomatic plantswhile reverse trend was observed for starch content.

5.3.2 Biochemistry

5.3.2.1 Biochemical mechanism of resistanceof bananas to root leison nemotode

Physiological parameters and biochemicalcontents were studied in roots of resistant(Anaikomban and Yangambi km5) and susceptible(Nendran and Robusta) cultivars for 90 days afterinoculation with root lesion nematode, Pratylenchuscoffeae. Infestation of the nematode affected therelative growth rate of leaf area at 30 days afterinoculation in nematode susceptible Robusta andNendran cultivars but not in resistant (Anaikombanand Yangambi km5) cultivars. Relative growth ratesof plant like height, pseudostem girth andchlorophyll and carotenoid pigments due toinfestation of nematodes were not affected in all thecultivars.

Constitutively, the peroxidase activity inresistant and susceptible cultivars was 15

nanokatals/mg proteins. After inoculation withnematodes, the activity in resistant cultivarsincreased from 4th day, peaked at 7th day (218nanokatals) and subsequently decreased to 95nanokatals at 90th day. In susceptible cultivars thelevel of induction of peroxidase activity was lower(60 nanokatals) at 7th day after inoculation than theresistant banana cultivars. On 9th day, the activityof peroxidase was only 25 nanokatals in susceptiblecultivars. The constitutive activity of Poly PhenolOxidase (PPO) in resistant cultivars was more (27nanokatals) when compared to susceptible cultivars(22 nanokatals,). The PPO activities also showedsimilar trend. PPO activity in resistant varieties wasmore (170 nanokatals/mg protein) when comparedwith susceptible cultivars (80 nanokatals) at 7th dayafter inoculation of the nematode. At 90th day, thePPO activities in resistant (53) and susceptible (41nanokatals ) cultivars varied widely.

The constitutive activity of Phenyl AlanaineLyase (PAL) was more in resistant varieties (26picokatals/mg protein ) when compared with 22picokatals in susceptible cultivars before inoculationof the nematode. After inoculation, the activityincreased and peaked in resistant cultivars at 7 and10 days (177 picokatals in Anaikomban and 102picokatals in Yangambi km5. But in susceptiblecultivars, PAL activity peaked only at 7 days (46nanokatals) and further decreased till theobservation at 90 days. In both resistant andsusceptible cultivars, the PAL activity levels at 90thday was higher than the activity levels observedbefore inoculation. The constitutive activity ofCinnamyl Alcohol Dehydrogenase (CAD) was more(20 picokatals/mg protein ) in resistant varietieswhen compared with susceptible cultivars (13picokatals). After inoculation of the nematode, the

Fig.19. Cinnamyl Alcohol Dehydrogenase (CAD) in rootsof banana cultivars.

activity of CAD peaked at 7 and 10 days was veryhigh (360 picokatals in resistant Anaikomban andYangambi km5 cultivars ) when compared tosusceptible cultivars (78 picokatals ) . The inductionlevels of activity in susceptible cultivars wereseveral folds lower than the resistant varieties. From10th day, the activities of CAD decreased and even

NR

CB

Ann

ual

Rep

ort

2009

-'10

27

at 90th day, the CAD activity was more in resistantcultivars (156 picokatals ) than the susceptible (43picokatals ) cultivars (Fig.19).

At pre-inoculation stage, lignin contents in allthe four cultivars was 45 mg/g which increased inboth resistant (380 mg/g ) and susceptible (72 mg/g) cultivars at 7 days after inoculation anddecreased but remained higher than the levelsdetected before inoculation. The increase in lignincontent was nine times high in resistant but onlytwo times in susceptible cultivars at 7 days afterinoculation of the nematode. The contents of ligninat 90 days after inoculation of the nematode weremore in resistant (113 mg/g) than in susceptible (67 mg/g) cultivars. The constitutive solublephenolic content in the cultivars were between 0.043and 0.054 mg/g tissue with higher content inresistant (Anaikomban) than the susceptiblecultivars. In P. coffeae inoculated roots of Yangambikm5 and Anaikomban cultivars phenolic contentincreased (0.224 and 0.235 mg/ g) respectively after7 days which was comparatively more than thecontents in susceptible Nendran (0.072 mg/g ) orRobusta (0.085 mg/g ) cultivars. After 7 days, thephenolics in both resistant and susceptible cultivarswere found to be slowly decreasing till 90 days ofobservation. At 90th day, the differences in phenoliccontent in resistant (0.112mg) and susceptible(0.091mg) started subsiding tendency.

Constitutively, the roots of resistant andsusceptible cultivars contained 45 and 30 μg/g oftotal hydrolysable tannins, respectively. In post-inoculation, the tannins increased and reachedmaximum at 7th day with 120 μg/g root tissue inresistant cultivar and 40 μg/g in susceptiblecultivars. At 90th day, the total tannin contents were83 μg in resistant cultivars (Anaikomban andYangambi km5) and 42 μg in susceptible cultivars(Nendran and Robusta). Before inoculation, theresistant cultivars contained higher proanthocyanidins than susceptible cultivars. At 7th daysafter inoculation, the contents of condensed tanninsincreased (0.425 at A550) in both resistant orsusceptible cultivars (0.290 at A550) . From 7th dayonwards the proanthocyanidins content decreasedand was observed to be 0.389 (A550 ) in resistantand 0.283 (A550 ) in susceptible cultivars at 90th

day after inoculation.

5.3.2.2 Biochemical studies inrelation topseudostem weevil infestation

Peroxidase (PO) and Poly Phenol Oxidase (PPO)activities and phenols, tannins and proanthocyanidins contents were studied in inner sheathsand centre core of stem of Karpuravalli cultivar in

relation to pseudostem weevil infestation. Inuninfested tissues of sheaths, the activities ofperoxidase and polyphenol oxidase were 6 and 15nanokatals/mg of protein, respectively. In thetissues at the site of the infestation (feeding point ofgrubs) of the weevil, the activity levels were higherthan the un -infested tissues with 9 and 29nanokatals of peroxidase and polyphenoloxidaseactivity, respectively. In the un -infested tissues ofcore stem, the enzyme activities were 14 and 27nanokatals/mg of protein, in resistant andsusceptible cultivars respectively whereas, theactivities of peroxidase and polyphenoloxidase weremore (17 and 35 nanokatals repectively) at the siteof infestation.

Total phenols, tannins and proanthocyanidinsin un-infested inner sheaths of pseudostem were0.060 mg, 0.025 mg, 0.536mg/g (A550), respectively.At the site of infestation i. e., feeding point of weevilgrubs, the contents of phenols, tannins andproanthocyanidins were 0.072 mg, 0.041 mg and0.632 (A550)/g respectively, which were higher thanthe contents in uninfested tissues. In uninfestedtissues of core stem, the total phenols and tanninscontents were 0.075 mg and 0.04 mg/g tissue andin tissues of feeding point the phenols and tannincontents were 0.104 and 0.063 mg/g tissues.

5.3.3 Post-Harvest Technology

5.3.3.1 Re-standardization of banana flowerpickle

Flower pickles with 80% and 60% oil and 95%and 92% vinegar and replacing vinegar with citricacid (4.6%) were prepared and storage studies werecarried out. Fungal growth was observed in thepickle prepared with citric acid within a month.Though the parameters such as acidity and pH ofthe pickles prepared with reduced oil and vinegarwere similar to the control, the appearance andconsistency of the pickles prepared with reducedoil and vinegar were poor and overall acceptanceassessed by sensory evaluations differed withcontrol.

5.3.3.2 Studies on small unit packages forretail marketing of bananas

Testing the quality of Karpuravalli and Robustahands packed in 1 kg volume CFB boxes and storedat RT (28.5°C) and 22°C indicated that fruits storedat 22 °C with or without packaging had longer shelflife of 11 days against 4 days when stored at roomtemperature. The quality of fruits stored at lowtemperature had higher starch and lower sugar atthe end of storage period.

28

5.3.3.3 Evaluation of banana cultivars forfibre extraction

The fibre yield was more in Poovan thanKarpuravalli cultivar. The yield of fibre was higherby alkali treatments than the machine extraction inKarpuravalli whereas, 0.1% NaOH treatmentyielded fibre at par with machine extraction inPoovan (Table 14).

The fibre yield decreased when theconcentration of Na OH increased (0.5% or 1%).Machine extracted fibre contained higher celluloseand pectin in Karpuravalli but, machine extractedand 0.1% alkali treated fibre contained lower lignin

like substances. In Poovan, 0.1% alkali treated fibreand machine extracted fibre contained lowercellulose and lignin but higher pectin contents.

5.3.3.4 Extraction of peduncle and midribfibre

Midrib of Poovan yielded more fibre (1.63%)and peduncle yielded more fibre (0.672% whenextracted with machine followed by 0.5% alkaliboiling for 1 hr. Chemical analysis of fibres showedthat the fibre extracted from Poovan cultivarcontained 53% cellulose, 0.85% pectin and 7% ligninand the fibre extracted from peduncle contained65% cellulose, 0.075% pectin and 11.75% lignin.

Table 14. Yield and chemical properties of fibre extracted by chemical retting and machine from Poovan andKarpuravalli

Karpuravalli 0.1% NaOH 0.450 52.00 1.26 14.13

0.5% NaOH 0.326 60.66 0.73 16.03

1% NaOH 0.307 62.00 0.61 17.46

Machineextraction 0.253 65.33 2.00 12.20

Poovan 0.1% NaOH 0.498 54.66 0.75 13.30

0.5% NaOH 0.445 63.93 0.52 21.00

1% NaOH 0.435 59.66 0.58 16.30

Machineextraction 0.499 55.50 1.78 13.68

Yield (%)Dry wt.basis

Lignin(%)

Cellulose(%)

Pectin(%)

TreatmentsCultivars

NR

CB

Ann

ual

Rep

ort

2009

-'10

29

5.4 CROP PROTECTION

5.4.1 Studies on Banana Nematodes andtheir Management

5.4.1.1 Survey for nematodes in bananagrowing areas of Tamil Nadu

Survey carried out in banana growing areas ofKolli Hills revealed wide spread occurrence of root-lesion nematode (Pratylenchus coffeae) and spiralnematode, Helicotylenchus multicinctus in var.Ladan(hill banana) and Karpuravalli. The nematodepopulation varied from 90 to 420 per g and 40-120per g of root H. multicinctus and Pratylenchus coffeae,respectively. These nematodes infestation causedsignificant reduction in plant growth and yield.

Effect of VAM alone and in combination withbiofertilizers and biocontrol agents for thecontrol of major nematodes

A mixture of VAM (Glomus fasciculatum andG.mosseae) alone and in combination withbiofertilizers and biocontrol agents (Paecilomyceslilacinus and Trichoderma viride) were evaluated oncv. Ney Poovan under field conditions against majornematodes. The results revealed that significantreduction in nematode population (92%) withincreased yield (30%) was recorded in plants treatedwith VAM and two biocontrol agents together thanas individual treatment or with biofertilizers.

Evaluation of endophytic bacteria against theroot-lesion nematode

Two strains of Actinomycetes isolated from soiland leaves of banana were evaluated against root-lesion nematode, (P.coffeae) under in vitro conditionswhich revealed 100 per cent nematode mortality at100% concentration in both soil and leaves.

Studies on principal compounds ofpromising botanical Tithonia sp.

Effect of aqueous, solvent extract and individualfractions of solvent extracts of Tithonia and Tagetuswere tested against P.coffeae under in -vitro conditionsresulted in per cent mortality of nematodes in crudeextracts of methanol and ethyl acetate. Maximum ofseven fractions and a minimum of five fractions wereisolated in hexane and methanol anddichloromethane solvents respectively. Among theindividual fractions of ethyl acetate, cent per centmortality of nematode was recorded in the first fourfractions isolated in hexane, methanol anddichloromethane solvents respectively.

5.4.2 Management of Banana weevils

Isolation and identification of banana cormvolatiles

Banana corm weevil is attracted to banana cormdue to the emission of terpenoid volatilecomponents. These volatiles were utilized for weevilmanagement and volatile components werecollected by air-entrainment technique andidentified by GC/MS. The following volatilecomponents viz., Tetradecane, Pentadecane ,Hexadecane , Heptadecane and Pentadecane wereidentified from Cv.Nendran banana corm . Incv.Poovan corm, Verbenene , 1-methyl 2-Phenylcyclopropane , p-ethyl benzaldehyde , Cycloheptane, 2-caren-10-al were identified.

Screening of semiochemicals againstbanana corm weevil

Olfactory response of 37 semiochemicalsbelonging to five groups were evaluated byelectroantennography. Among the semiochemicalsmaximum olfactory response (Fig.20) was recordedin alpha-bisabol-ol (140%) followed by 3-octanone(130%) 1-hexanol (127.5%) p-anisaldehyde (125.5%)and R-carvone (125.5%) .

Fig. 20. Evaluation of semiochemicals against banana cormweevil, Cosmopolites sordidus by electroantennography. (Per cent weevil attraction).

30

Fig. 23. Olfactory response of banana stem weevil, to 2-methyl 4-heptanol

T1-Male Extract, T2-Female Extract, T3-Host Extract, T4-2-metyl 4-heptanol, T5-Male +host +2-methyl 4-heptanol, T6-Female+host+2-methyl4-heptanol, T7-Male Extract +host, T8-Female Extract +host, T9-Hostextract +2-methyl 4-heptanol, T10-control (Banana tissue cv .Nendran)

Evaluation of 2 -methyl 4-heptanol againstbanana stem weevil

A semiochemical viz., 2- methyl 4- heptanol andvolatiles released by male and female weevil andhost plant volatile (cv.Nendran ) alone and indifferent combinations was evaluated againstbanana stem weevil by various methods(Electroantennography, Y-tube olfactometry, 4 wayolfactometry, wind tunnel and field evaluation ) .

Ofactory response of 2 -methyl 4 -heptanol,volatiles of male and female weevil and host plantvolatile of cv.Nendran was screened by electroantennography. Maximum EAG response wasobserved in host volatile + 2-methyl 4 -heptanol tomale (18.830 mV ), followed by female weevils (15.816mV) . Female extract + host volatile recorded 11.829mV responses to male weevils. With male extract +host volatile, the EAG value was 8.262 mV to maleweevil. Host plant volatile indicated a maximumresponse of 7.644 mV to male weevils and 4.445 mVto female weevils. It was observed that 2-methyl-4heptanol alone evoked a low response (1.679 mV)to male and medium response (4.445 mV) to femaleweevil (Fig. ). Studies on Y-tube olfactometryindicated a maximum attraction (84 %) to 2-methyl-4-heptanol + host volatile to male and 80 per cent tofemale weevils (Fig.21).

T1-Male Extract, T2-Female Extract, T3-Host Extract, T4- 2-methyl 4-heptanol,T5-Male + host + 2-methyl 4-heptanol, T6-Female+ host+ 2-methyl4-heptanol, T7-Male Extract + host, T8-Female Extract + host, T9-Hostextract + 2-methyl 4-heptanol, T10-control (hexane).

Fig. 21. EAG response of banana stem weevil, to 2-methyl 4-heptanol.

Based on the results obtained fromElectroantennography and y-tube olfactrometry ,wind tunnel bioassay was conducted with fourtreatments. Observations on the attraction weevil to2-methyl-4 -heptanol + host volatile revealedmaximum 88 % attraction was recorded in host + 2-methyl-4 heptanol to male weevil and 83 per centfor female weevils. Host volatile of cv.Nendranrecorded 66 per cent attraction to male weevil and67 per cent to female weevils. There were nodifferences in the per cent attraction between maleand female weevil. Weevil response of 40 per cent to

male and female stem weevil was observed due to2-methyl-4 heptanol. Results indicated that weevilattraction was higher in 2-methyl-4-heptanol incombination with host volatile (Fig.21,22,23).

Fig. 22. Wind tunnel bioassay of banana stem weevil against2 -methyl 4-heptanol

T1- BT (banana tissue. Cv.Nedran), T2-2-methyl 4-heptanol, T3-BT (bananatissue. Cv.Nedran)+ 2-methyl 4-heptanol, T4-control (hexane).

Isolation, characterization and evaluation ofbiocontrol agents

Biocontrol agents evaluated against insect pestsindicated stem weevil mortality of 80 % by Beauveriabassiana (NRCB 34). Metarhizium anisopliae (NRCB32 ) indicated 62 % mortality on banana stem weeviland 48% mortality on corm weevil. Bacillusthuringiensis (NRCB 18) indicated 15 % mortalityon corm weevil and no mortality on banana stemweevil.

Survey for insect pests and biocontrolagents

During the survey, soil samples (n=308) werecollected from Thadiyankudisai (Kanalkadu),

NR

CB

Ann

ual

Rep

ort

2009

-'10

31

banana. The results on morphological studiesindicated that 13 isolates belonged to T. harzianum,29 isolates to T. viride and one isolate to T.pseudokoningii group. All the 43 isolates werescreened against fusarium pathogen under in vitrocondition by eight different methods (sporegermination, dual culture and non volatile andvolatile production for mycelial inhibition, HCNproduction, phosphate solubilization, chitinolyticactivity and IAA production). The results of in vitroscreening indicated that out of 43 isolates tested, 12isolates of endophytic Trichoderma spp. (Pcc4, Br1,Bc1, Bc2, Prr1, Cr1, Plr2, Pjr1, GVr1, Pc2, Prr2 andDsr1) had multiple actions including phosphatesolubilization. Interestingly, all these isolatesrecorded 100% inhibition in spore germination offusarium pathogen.

Evaluation of rhizospheric Trichoderma spp.against Fusarium pathogen

Trichoderma spp. isolates (19) were screenedagainst Fusarium oxysporum fsp. cubense (Foc)isolates by eight different methods. The results ofthe study indicated that among these 19 isolates,four isolates of Trichoderma spp. viz, T. harzianum,T. pseudokoningii, T. koningii and T. viride wereeffective in either inhibiting the mycelial growth orthe spore germination of the pathogen. Among thesefour effective isolates, T. harzianum isolate recorded100% inhibition of spore germination of Foc andalso maximum mycelial inhibition in dual culture(65.7%) and non-volatile production (82.5%). Thesame isolate has the ability to solublize the insolublephosphate under in vitro condition.

Identification of isolates of Trichodermaspp. for phosphate solubilization

Quantification of phosphate solubilization bydifferent effective Trichoderma spp. of rhizosphericand endophytic in nature indicated that among 29isolates, 4 isolates (Kbc1, 140c, Dsr1 and TV-NRCB1)recorded the release of more than 6 g/ml of availablephosphorus compared to control (0.9 g/ml).

Isolation of and identification of biochemical compounds from Trichoderma spp.against Fusarium wilt pathogen

Principle biochemical compounds from theculture filtrate of effective Trichoderma viride isolateNRCB-1 was isolated by NH4SO4 precipitation (20to 100% conc.) method. The inhibitory effect of theNH4SO4 precipitate against Foc under in vitrocondition by spore germination method wasobserved only at 20 and 30 % conc. The furtherpurification and identification of the compound arein progress.

Yercaud hills (Nagalur ), Kolli hills ( Solaikadu) ofWestern ghats of India resulted in the isolation ofthe following entomopathogenic microorganismsviz., Beauveria bassiana (107), Metarhizium anisopliae( 25) and Bacillus thuringiensis ( 24 ).

Survey conducted in selected banana growingareas of Maharastra (Jalgoan , Pune and Sholapurdistricts ) indicated infestations of stem weevil, cormweevil and rust thrips . Banana fruit spotting buginfestation was recorded in Raver Taluk (JalgaonDistrict) and Junner taluk (Pune District). The bugmakes small puncture using stylet and the puncturemark becomes distinct and black in colour. Theinfestation affects cosmetic value of the fruit andpulp damage as a result the farmers get less price oftheir produce.

IPM Strategy for banana corm weevilBanana corm weevil pheromone (Cosmolure)

was evaluated under field conditions whichattracted 3-36 corm weevils/ trap. Observationsindicated that optimum soil moisture is a criticalfactor in corm weevil trapping. One ml of 1 % α -bisabol-ol was identified as a semiochemical formonitoring corm weevil under field conditions.

Gel formulation of Heterorhabditis indica wasevaluated against banana corm weevil, Cosmopolitessordidus at 1 x 10 9 IJ's /ml using longitudinal splitbanana stem trap . Weevil mortality to the tune of67.0 and 60.0 per cent recorded under laboratoryand field conditions, respectively.

5.4.3 Investigation on fungal andbacterial diseases of banana and theirmanagement Fusarium wilt disease

Isolation, identification and evaluation ofendophytic Actinomycetes spp. isolatesagainst Fusarium pathogen

Thirty endophytic Actinomycetes spp. wereisolated from fusarium wilt resistant 24 accessionsof banana and evaluated against fusarium pathogenby spore germination, chitinase, siderophore andprotease production and phosphate solubilization.The result indicated that six strains producedchitinase, eight strains showed siderophoreproduction, 15 strains showed protease production,one strain showed phosphate solubilization activityseven strains showed IAA (13 ug/ml) production.Among these, five strains showed versatility inaction against fusarium pathogen.

Evaluation of endophytic Trichoderma spp.against Fusarium pathogen

Isolates of endophytic Trichoderma spp. (43) wereisolated from 13 different fusarium disease resistant

32

Survey of banana growing regions of Indiafor isolation and evaluation of effectivemicrobes against fusarium wilt pathogen

Surveys were taken up in Tamil Nadu (Salem,Nammakal and Madurai - 20), Maharastra (5) andTripura (10) and collected 25 soils samples andidentified 12 Trichoderma spp. isolates and eightbacterial isolates. The screening of these isolatesagainst fusarium wilt pathogen under in vitrocondition indicated the presence of four isolates ofbacteria and five isolates of Trichoderma spp. whichshowed multiple actions.

Molecular characterization

Molecular characterization of endophytic andrhizhospheric Trichoderma spp.

Molecular characterization of 27 endophytic and16 rhizhospheric Trichoderma spp. effective againstFusarium pathogen was carried out by rDNA-ITS -RFLP analysis using six restriction enzymes viz.EcoRI, HhaI, HinfI, TaqI, MspI, AluI. The analysisindicated the presence of totally 29 ITS genotypeswhich included both endophytic and rhizhosphericTrichoderma spp. isolates. From the phylogeneticanalysis, it was concluded that the rDNA-ITS -RFLPanalysis separated all the Trichoderma isolates intotwo major endophytic and rhizospheric groups.However, this phylogenetic analysis could notdifferentiate the Foc effective Trichoderma spp.isolates from the Foc ineffective Trichoderma spp.isolates(Fig. 24 d).

Identification and evaluation of non-pathogenic Fusarium (npf) isolates

Evaluation of 31 isolates of npf isolated from 22different fusarium wilt resistant banana accessionsagainst Foc isolate 0124 indicated three isolates(Pjr1, Cvrr1 & Dsr5) to inhibit 100% sporegermination of Foc.

Identification of effective botanicals for themanagement of wilt disease

Out of 33 medicinal plant extracts screenedagainst Foc, extracts of six plant species viz. Alpiniagalangal, Rhinacanthus nasutus, Hibiscus rosasinensis,Allium sepa x Allium sativum (Zimmu), Occimumgratissimum and Vitex leucoxylon recorded 100%inhibition of spore germination. The inhibition zonewas more than one centimeter in agar well diffusionmethod.

Evaluation of endophytic bacterial isolatesagainst wilt disease

Among the eight endophytic bacterial isolatestested initially under pot culture condition in cv.

Ney Poovan, bacterial endophyte Sac1 recordedsignificant reduction in disease score (3.5) comparedto control (4.8).Fig.24. Phylogenetic analysis of native rhizospheric and

endophytic isolates of Trichoderma spp.

D

NR

CB

Ann

ual

Rep

ort

2009

-'10

33

Evaluation of endophytic actinomycetes andrhizosphere Trichoderma spp. againstfusarium disease

Evaluation of soil application of endophyticactinomycetes strain 17r1 in combination with 6different isolates rhizospheric Trichoderma spp(isolates 140C, Tv Poovan, K2T5, T. harzianum, T.koningii, T. pseudokoningii) for the management ofFusarium wilt disease under pot culture conditionin tissue cultured banana plants cv. Grand naineindicated that the application of Actinomycetes +Rhizosphere application of Trichoderma harzianumand T. viride at the time of planting had very lowscore of 1.2 as against 3.7 in the only Foc inoculatedplants after six months of planting. The sametreatment also increased the growth parameterssuch as height (42%), girth (45%) and no. of leaves(15%).

Evaluation of endophytic actinomycetes incombination with rhizosphere Trichodermaspp. in cv. Ney Poovan

Evaluation of soil application of endophyticactinomycetes strain in combination with sixdifferent isolates of rhizospheric Trichoderma spp(isolates 140C, Tv Poovan, K2T5, T. harzianum, T.koningii, T. pseudokoningii) for the management ofFusarium disease under pot culture condition usingtissue cultured banana plants cv. Ney Poovanindicated that application of Actinomycetes +Rhizosphere application of Trichoderma koningii +T. pseudokoningii at the time of planting, recordedno incidence of the disease (ie. 100% inhibition) asagainst 4.6 score recorded in only Foc inoculatedplants after six months of planting. This wasfollowed by Actinomycetes + Trichoderma spp.isolate Tv Poovan (Score-1.4), Actinomycetes +Trichoderma spp. isolate K2T5 (Score-1.5).

Evaluation of fungicides against Fusariumwilt pathogen

Evaluation of fungicides viz., Carbendazim,Propiconazole, Difenaconazole Hexaconazole,Tridemorph and Mancozeb at five differentconcentrations (0.01 to 1%) under in vitro conditionindicated that, Carbendazim at all concentrationsshowed 100% inhibition of mycelial growth of Focwhich was followed by Difenaconazole (100%inhibition) but only at 0.5 and 1% concentration.

Evaluation of type and method of fungicideapplication against Fusarium wilt disease

Carbendazim, Propiconazole, Difenaconazole,Hexaconazole, Tridemorph and Mancozebfungicides were tested under Fusarium sick plot

condition by six different methods of applicationviz, Dipping the suckers at the time of planting,drenching the soil around the pseudostem on 2nd

4th and 6th month after planting, stem injection on2nd 4th and 6th month after planting, dipping +drenching, dipping + injection and drenching +injection and dipping + drenching + injection in cv.Ney Poovan (AB) suckers. The results indicated thatCarbendazim applied as dipping the suckers +drenching + injection at 2nd, 4th and 6th month afterplanting recorded an internal score of 1.3 as against4.00 in control.

SIGATOKA LEAF SPOT PATHOGENS

Isolation and identification of leaf spotpathogen

Live samples of banana leaf affected by leaf spotpathogen were collected from Tamil Nadu,Maharashtra and Tripura and seventy sampleswere isolated from different varieties of banana suchas Nendran, Rasthali, Ney Poovan, Poovan,Williams, Robusta, Grand Naine, Nendran, RedBanana, Dwarf Cavendish, Karpuravalli, Hillbanana, Monthan, Kachkel, Sabari, NendraKunnan, Musa balbisiana, Vannan, Ladan etc. on thebasis of spore characters, were confirmed asMycospharella eumusae.

Molecular characterization sigatoka leafspot pathogen

The rDNA- ITS sequencing of 18 isolates ofSigatoka leaf spot pathogen confirmed all theseisolates were belong to Mycospharella eumusae. Allthese sequences were submitted in Genbank.However, some of these isolates (Sirumalai, Nendrakunnan, Vannan, Ladan and Nendran) are alsogiving positive reaction to the M. fijiensis specificprimer obtained from Queensland Department ofPrimary Industries, Australia and work is inprogress.

Diversity analysisThe phylogenetic analysis carried out using

these sequences indicated that there are two majorgroups among 18 isolates of M. eumusae. Other twoisolates (11M and 8M) obained from var. Sahaji andVannan respectively, were separated as a distinctgroup from the two major groups of M. eumusaeisolates.

Isolation and identification of effectivemicrobes for the management Sigatoka leafspot disease

Eighty endophytic and five epiphytic bacterialisolates and 27 isolates of epiphytic fungi were

34

Fig. 25. Management of BBrMV through application ofhigher dose of fertilizer in cv. Nendran

isolated from different parts of banana resistant toleaf spot disease. These were evaluated againstSigatoka leaf spot pathogen M. eumusae. The resultsshowed that among 88 isolates, four isolates showedinhibition of more than 95% spore germination, twostrains showed mycelial inhibition, one strainshowed IAA production, eight strains showedsiderophore production and nine strains showedHCN production. Among these, Klebsiella (6Mb),Micrococci (2M), Actinomycetes (14 Mb) andepiphytic Bacillus spp. (1Eb) were found to beversatile in inhibiting the Mycospharella spp. underin vitro condition

Evaluation of botanicals against Sigatoka leafspot disease

Out of 32 botanicals screened under in vitroconditions indicated only three plant extracts viz.Cassia senna, Rhinacanthus nasutus and Allium sepa xAllium sativum (Zimmu) were found effective againstM. eumusae with 100% inhibition of sporegermination in comparison to other extracts.

RHIZOME/ CORM ROT DISEASE

Development of integrated managementpractices for the control of Erwinia rotdisease

The observations on disease incidence andgrowth parameters indicated that use of healthysuckers + soil application of bleaching powder @ 4g /plant applied at 0th + 1st + 2nd + 3rd + 4th monthafter planting + growing three crops of sunn hempin the interspaces recorded maximum reduction ofdisease incidence (66. 66 %) and maximum increasein plant growth parameters such as height (50.06%),girth (36.31%), number of leaves (7.07%) and leafarea (79.18%) followed by use of healthy suckers +soil application of Pseudomonas fluorescens +Trichoderma viride @ 2 l/plant @ 50g/lit at 0th + 2nd

+ 4th + 6th MAP + growing three crops of sun hempin the interspaces.

POST HARVEST DISEASES

Isolation and identification of bio-chemicalcompounds from the extract of Solanumtorvum for the management of post-harvestdiseases of banana

Principle compounds from the effective plantextract Solanum torvum were isolated by preparativeTLC. Totally 16 compounds were isolated andpurified. The efficacy analysis of each compoundagainst mycelial inhibition of Colletotrichum musaeunder in vitro condition indicated that among the16 bands, band number 16 (Rf value 0.70) recorded

100% inhibition of mycelial growth followed byband number B10 (Rf value 0.38) and B 12 (Rf value0.49) which recorded 93.75%. The inhibitory effectlasted upto 11 days after the application of thecompounds.

5.4.4 Studies on viral diseases and theirmanagement

Survey for viral diseases

Surveys were conducted in Kodur andCuddappa districts of Andhra Pradesh andobservations indicated higher incidence of BBTV (1to 90.5%) both in tissue culture grown and ratooncrop of conventional sucker grown plants. Theincidence of BBTV in Pulney hills (Kodaikanal) andKolli hills was 14 to 72% and one to 19 %,respectively in Hill banana. In Tuticorin andTirunelveli districts of Tamil Nadu, the incidencewas 1.0 to 32.5 % and 1.0 to 13.33 per cent for BSVdisease and BBrMV disease, respectively. Pudukotai,Thanjavur, Cuddalore and Nagapattinam districtsof Tamil Nadu indicated the incidence BBTV, BSV,BBrMV and CMV to the tune of 1.69, 5.48, 21.25 and0.13 per cent, respectively

Management of viral diseases by nutrition

In ratoon crop of BSV infected Poovan, there wasno response with the application of increased doseof fertilizer whereas in case of BBrMV infected ratooncrop, there was an increase in yield (11.61%) withincreased dose of fertilizers. In the 2nd crop ofNendran, application of 125 and 150 kg RDFincreased the bunch yield to an extent of 4.5 and7.94 %, respectively (Fig . 25).

Bun

ch W

eigh

t

Treatments

Molecular Characterization of bananaviruses

Sequence analysis of BBTV coat protein (cp) andreplicase (rep) gene from different isolates viz.,Karnataka, Maharashtra, Bihar, West Bengal,Kerala, Gujarat and Delhi were amplified and

NR

CB

Ann

ual

Rep

ort

2009

-'10

35

sequenced to study the genetic diversity BBTV. BBTVisolates of Shevroy hills, Kodaikanal and Meghalayahad considerable variability with respect to cp genebut not in rep gene. Complete genome of BBrMVfrom infected Nendran cultivar was cloned andcharacterized. The 5' UTR, P1, HC-Pro, P3, 6K1, C1,6K2, VPg, NIa-Pro, NIb, CP and 3' UTR regions werecloned and sequenced. The viral genome contained9711 nucleotides. The variability ranged from 91-97% as compared with the published completegenome sequence of a BBrMV Philippines isolate.Partial BSV fragments were amplified from 18isolates collected from Tirunelveli, Tuticorin andCuddalore districts of Tamil Nadu and sequenced.The sequence analysis revealed that there was lessvariability among these isolates in contrast toisolates of Karur and Thanjavur districts.

In silico analysis for integrated BSV sequencesin BAC clones was done and designed primers foramplification of integrated sequences. Using theseprimers, the fragments were amplified, cloned andsequenced from cv. Poovan samples. A cp geneconstruct for Cucumber Mosaic Virus -Bananaisolate was prepared. This construct wastransformed into E. coIi and mobilized intoAgrobacterium strain LBA 4404.

Production and use of polyclonal antiserumfor recombinant viral protein

DAC-ELISA was standardized using polyclonalantiserum raised from recombinant cp of CMV andvalidated the technique using field collected samples.Polyclonal antiserum for recombinant coat proteinof BBrMV was produced. BBTV rep gene was clonedinto Expression vector and transformed into E. coli.The MBP tagged fusion protein was expressed byinduction using IPTG. The expressed protein was ininsoluble fraction and expressed master rep proteinof BBTV was confirmed through SDS-PAGE analysisand western blotting techniques using MBP specificpolyclonal antiserum.

Diagnostic techniques for banana virusesMultiplex RT-PCR was standardized for

detecting all the four banana viruses which includeDNA viruses. The total RNA was isolated fromplants infected with DNA viruses and PCR wasperformed after reverse transcription. A duplex RT-PCR to detect BBTV and BSMysV was developedand validated using field and commercial tissuecultured banana samples. This technique is reliable,sensitive and does not amplify integrated bananastreak viral sequences. Direct Binding PCR forBSMysV and BSOLV was compared using threedifferent makes of PCR tubes and results revealedthat there was no significant difference amongsttubes for capturing the DNA.

5.4.5 Host- virus interaction in Banana

Developing severity index for BSV

The incidence of streak virus disease expressionincreased in Poovan cultivar due to possibleepisomal virus released from integrated sequencesin the fifth ratoon crop. However the rate of increasewas not substantial over the years. RNAi hairpinconstruct derived from sense replicase gene of BBTValong with antisense truncated rep fragment (450bp)was developed.( Fig. 26).

Fig. 26.RNAi hairpin construct

As a pre-requisite for Fluorescent in situHybridization (FISH) to locate endogeneous para-retroviral sequences (EPRV's) of BSV in banana andplantain, a technique was standardized for stainingand visualizing different stages of chromosomes incv. Poovan and other 'B' genome harboring clones.The technique of Fluorescent Staining with DAPI forobserving chromosome was standardized.

In silico analysis of intergenic region of BSMysV-Try isolate (EU 140339) was done in search of plantCIS acting elements. Putative promoter elementspresent in the intergenic region was most similar towidely used promoter derived from 35 S CaMV. Co-cultivation of leaf disc and infiltration methods oftransient gus assay for BSV derived promoters in N.benthamiana was done using GUS as reporter gene.Preliminary result showed good expression of GUSgene with BSV promoter comparable with CaMVpromoter. When BSMysV symptomatic plants weresubjected to water stress, more mortality was recordedthan non-symptomatic, non stressed plants.

To study the integration of BSMysV genome inPoovan banana, a southern blotting analysis usingprobe of 589bp size of RT/RNase - BSMyV labeledwith 32P was done. Only in three symptomaticsamples, the bands corresponding to episomal viralgenome of BSMyV got hybridized with the probe.

36

5.5 EXTERNALLY FUNDED PROJECTS

5.5.1 Transgenic in crops - FunctionalGenomics (Sigatoka and Drought)

Sigatoka (Mycosphaerella eumusae)

Real time PCR studies

Real time PCR studies revealed that the peaklevel of expression of scavenging enzymes likecatalase, peroxidase and polyphenol oxidase wasobserved from 10 hrs to 36 hrs after infection byMycosphaerella emusae.

Suppressive Subtractive Hybridizationstudies

Subtractive hybridization studies with resistant(Manoranjitham) and susceptible cultivar (Robusta)which resulted in the identification of 254 ESTsresponsible for Sigatoka resistance.

Majority of identified ESTs were Metallothioneins (10. 9 - 42.51 %). Physiological regulatoryproteins like Cystine Protease (23 - 8.97%), RubiscoActivase B (15 - 5.85%) and Cytochrome C Oxidase(7 - 2.73%) were identified to be functioning inadverse / altered physiological conditions to bioticstresses. Serine / Threonine Kinase (15 - 5.85%),Catalase II (4 - 1.56%), AMP protein (3 - 1.17%) etc.were identified as they were induced during bioticstresses. Patens Predicted Proteins (14 - 5.46%) werealso found. Sixty four new ESTs (24.96%) wereisolated which did not align with any of the ESTsavailable with the GenBank.

All the isolated ESTs were subjected forBLASTX and functionally important 254 weredeposited at NCBI-Genbank (NCBI Accn. Nos. -GT067848 to GT06788; GT086299 to GT086405;GT153720 to GT153739; GT153740 to GT153761;GT153911to GT153943; GT154752 to GT154769).

Drought studies

Real Time PCR studies

Based on the real time PCR studies carried outwith few scavenging enzymes like peroxidase,catalase, superoxide dismutase and poly phenoloxidase indicated 30% field capacity optimum toinduce drought conditions in cvs. Nendran andCalcutta 4.

5.5.2 Induced mutation- A cropimprovement strategy for developingDwarf and Sigatoka leaf spot resistantbanana cv. Grand Naine (funded by Dept.Atomic Energy, Mumbai)

Irradiation of proliferating buds andembryogenic cell suspension

Both embryogenic cell suspension andproliferating meristems of cv. Grand Naine wereirradiated at 10- 50 Gy using 60Co source at SBI andBARC .Cell clusters (ECS) irradiated below 30 Gyproduced somatic embryos but failed to develop intoplantlets whereas ECS irradiated at doses at 30 Gyand above failed to produce somatic embryos inregeneration medium.Based on the results obtainedfrom preliminary study, the plantlets obtained afterirradiation of shoot tips and ECS of cv. Grand Nainewere screened for positive mutants (resistant toSigatoka leaf spot).

Screening irradiated plantlets for Sigatokaresistance

Irradiated plants were hardened and challengedwith Mycosphaerella eumusae (Septoria leaf spot).Symptom expressions were visible after 50 days ofinoculation. Twenty two plants out of 107 showedpartial tolerance with 10% expression of spots overcontrol.

Development of markers for dwarfnessA total 50 samples each of normal and dwarf

types were collected and subjected to RAPD analysisfor developing SCAR markers using 32 randomoligonucleotide primers from Operon TechnologiesInc. (Alamada, CA). 20 primers resulted in consistentand informative profiles. Out of 20 OPA-05 (OperonTech., 5'- AGGGGTCTTG-3') amplified , a band of900 bp in single plant corresponded to dwarfism.Hence, the above amplicon as identified as a discreteband which could be used as a diagnostic markerafter converting it into SCAR and reconfirmationusing the same sample.

Regeneration and safety duplication ofpriority Musa collections (Funded byGCDT/ Bioversity, France)

The work on first set of sixty accessions wasinitiated in vitro in four replications. Afterconfirming the survival under in vitro and freenessfrom field born bacterial contamination, two cultureseach of sixty accessions were shifted to NBPGR, NewDelhi during June 2009 to January 2010.

NR

CB

Ann

ual

Rep

ort

2009

-'10

37

5.5.3 Accreditation Test Laboratory forCertification of Tissue culture raisedplant material NCS-TCP (Funded byDBT, New Delhi)

Standardization of protocol for geneticfidelity testing using ISSR markers

Attempts were made in the present the study tostandardize the concentration of template andprimer to refine the protocol given in SOP-ATL forgenetic fidelity testing using ISSR markers.Accordingly 5 different concentrations of templateviz. 5, 10, 15, 20 and 25 ng and 4 differentconcentrations of primers viz., 0.5, 1.0, 1.5 and 2.0μM were tried. 20 ng template and 0.5 μM primerproduced the best banding profile. Hence PCR wascarried in a 25 μl reaction containing 20 ng ofgenomic DNA, 1X PCR buffer (Genei, India), MgCl20.5mM, 200 μM each of four dNTPs, 2.0U of Taqpolymerase (Genei, India) and 0.5 μM of ISSR primer.Secondly, the annealing temp. for various ISSRprimers were standardized erature on gradient PCR(Table No. 15).

plants without urine application (control). The sametreatment recorded more Total Soluble Solids (TSS)(16.3%) and high TSS/acidity ratio (51.9%) but lessacidity (30.4%) than control. The highest bunchweight (23.9kg) was recorded with application of50 litres of urine per plant along with 75% RDKalone and it was followed by 22.5kg withapplication of 50 litres of urine with 100% RDKalone. Application of 100% NPK alone (withouturine) recorded a bunch weight of 21kg. Applicationof 50 litres of urine along with 75% RDK alone couldaccrue an additional net profit of Rs. 45,175/- perhectare as compared to 100% (RDN+RDP+RDK)alone (how much ), ie., normally grown Poovanbanana without urine application of which Rs.36,250/- is due to increased bunch weight and Rs.8,925/- is due to saving in 100% N and P fertilizersand 25% K fertilizers in Poovan banana cultivation.

5.5.5 Effect of PSO6 - Solid and liquidorganic manures on Ney Poovan banana

The experiment was conducted at two locationsViz., Kattuputhur and Thottiyam on Ney Poovanbanana.

Location : KattuputhurSignificant variations due to effects of NPK x

PSO6 interaction on the bunch weight was observedand it varied from 10.50kg to 15.34kg . The highestbunch weight (15.34 kg) was observed withapplication of 1.5kg solid PSO6 + liquid PSO6 alongwith 75% NPK and was 35.3% more than control(11.34kg). The highest bunch weight was at par(15.16kg) with application of 1.5 kg solid PSO6along with 75% NPK. The highest Benefit/Cost ratio(B:C ratio) of 2.07 was observed with application of75% recommended NPK along with 1.5kg solidPSO6 alone and also the same Benefit/Cost ratio of2.07 was arrived with application of 75%recommended NPK along with 1.5kg solid PSO6 +liquid PSO6. It was also found that application of1kg solid PSO6 along with 75% recommended NPKrecorded a B:C ratio of 1.94 and it was at par with100% NPK application alone. Thus, application of1kg solid PSO6 could save 25% NPK fertilizers toproduce banana yield with the same B:C ratio asthat with 100%NPK alone.

Location : ThottiyamThe bunch weight varied significantly from

10.90 to 14.42kg. The lowest bunch weight (10.90kg) was recorded with application of liquid PSO6without any NPK fertilizer which was at parwithout PSO6 and NPK. The maximum bunchweight (14.42kg ) was recorded with application of1.5kg solid PSO6 + liquid PSO6 with 75% NPK to atune of 32.29% over control.

Minor modifications were made in the PCRprogramme suggested by SOP-ATL and it consistedof an initial denaturation at 94ºC for 5 min, followedby 40 cycles of denaturation at 94ºC for 45 sec,annealing at specific temp for 45 sec, followed byextension at 72ºC for 2 min and terminated by afinal extension of 72ºC for 10 min followed byincubation at 4ºC.

5.5.4 Utilisation of human urine as liquidorganic manure in Poovan bananacultivation

Application of 50 litres of human urine (1:10urine : water) per plant with 75% of RDF wassuperior by recording more plant height (32.1% ),more pseudostem girth (25.6%), more number ofleaves (71.5%) and more leaf area (68.8%), more leafnitrogen (25.0%) more phosphorus (52.6% ) andmore leaf potassium (6.5%) than normally grownbanana plants without urine application (control).The same treatment recorded 43.6% more leafcalcium concentration, 34.5% more magnesium and44.8% more sulphur than normally grown banana

S.No. ISSR primer Annealing temp.(°C)1. UBC 807 46.82. UBC 808 50.63. UBC 836 43.74. UBC 811 46.1

Table No. 15

38

The maximum Benefit/Cost (B:C ratio) ( 2.00 )was recorded with the application of liquid PSO6along with only 50% recommended NPK followedby application of 1.5kg solid PSO6 along with 75%recommended NPK fertilizers(1.95) in Ney Poovanbanana.

5.5.6 Network Project on Transgenic inCrops

Developing transgenic banana resistant toBSV and BBTV (cp mediated)

Out of 256 shoot tips co-cultivated withAgrobacterium harbouring the pBINAR BBTV coatprotein, only eight survived in the selection medium.Out of eight, two PCR positive plants were hardenedand transferred to transgenic glass house.

Eight transgenic plants were obtained throughin planta transformation. Totally 60 explants wereused in planta method. Eight plants obtained werePCR positive and 54 were negative. The total DNAisolated from 10 PCR positive plants were blottedonto NCM for southern analysis and two of theplants were positive.

Development of transgenic Hill bananaresistant to BBTV (rep mediated)

Totally 82 putative transgenic plants werescreened for the presence of replicase and scorablemarker, gus by PCR. Among those plants, 52 plantswere positive for both replicase and gus. Southernanalysis using radio-labelled replicase probes wasdone for PCR positive plants. Among 52 plants, 10were positive for southern analysis.

5.5.7 ATL scheme for virus indexing

Testing of tissue cultured banana plantsagainst viruses

Totally 7,969 samples were diagnosed for thepresence of banana viruses. The total samples testedfor the presence of BBTV was 4097, BSMysV was1337, BBrMV was 2033 and CMV was 502 for CMV.

5.5.8 Harnessing arbuscular mycorrhizaefor bio-fertilization in horticultural crops

Evaluation of Arbuscular Mycorrhizae Fungi(AMF) and AMF associated bacterial isolatesagainst soil borne diseases

Survey were conducted in Tamil Nadu(Tiruchirapalli, Thanjavur, Pudukottai, Madurai,Virudhunagar, Cuddalore and Salem),Maharashtra (Jalgon) and Tripura states and 52 soilsamples were collected from rhizosphere region of

different varieties of banana. From these samples,43 isolates of Glomus spp. were isolated. The pureculture of all these isolates were initially massproduced using onion as funnel culture and thentransferred to pots raised with maize for furthermass production. The soil analyses forquantification of Glomus sp. spores indicated thatthere were 175 spores/ 100g of soil and the VAMcolonization was about 54.8% in a month.

Besides, soil samples were also collected fromrhizosphere region of 18 different banana accessionsat NRCB, Tiruchirapalli, which were found resistantto Fusarium wilt disease. The isolation of VAM fromthese soil samples indicated that the Glomus spp.was dominant and about 50 to 125 spores/ 100 gmof soil were present.

Totally 10 MHB isolates were isolated fromMycorrhizae spores obtained from the soil samples.

With regard to isolation of AMF associatedbacteria, totally 182 bacterial isolates were isolatedfrom the rhizosphere soil samples collected fromdifferent banana growing regions. Among these, 23were Azotobacter, 16 were phosphate solubilizing,22 were potash solubilizing and 10 were chitinolyticbacteria.

The evaluation of these bacteria againstFusarium wilt isolates (VCG 0124) by sporegermination method indicated that the isolates Jal1, 5, Pc1, TR1, TR4a, and TR4b recorded 100%inhibition of spore germination under in vitrocondition.

54 isolates of AMF bacteria and 16 isolates ofphosphate solubilizing bacteria evaluated and 19and seven were positive for siderophore production.

Among 150 isolates of AMF bacteria evaluatedfor IAA production, the MHB isolate Pc1 showed100% inhibition of spore germination of Fusariumwilt pathogen and maximum (64 g/ ml) productionof IAA.

Among 54 isolates of AMF bacteria screened forHCN production, only two isolates showed positivereaction.

5.5.9 ICAR - Outreach projects onPhytophthora, Fusarium and ralstoniadiseases in horticultural and field crops

Isolation, characterization and evaluation ofendophytic bacterial isolates with multipleactions against Fusarium pathogen

Endophytic bacterial strains (197) were obtainedfrom Fusarium wilt disease resistant 22 Musa

NR

CB

Ann

ual

Rep

ort

2009

-'10

39

Fig.27a.Characterisation of FOC isolates of cv. Monthan byISSR analysis using UBC 861 primer

accessions. The colony morphology andbiochemical characterization led their classificationin to 10 different groups of bacteria viz., Bacillus,Staphylococcus, Micrococci, Pseudomonas,Actinomycetes, Azotobacter, Klebsilla, Serratia,Enterobacter and Citrobacter. The evaluation of these197 endophytic bacteria against Fusarium wiltpathogen by 9 different methods indicated that 15strains recorded 100% inhibition of sporegermination, 10 strains recorded more than 80%mycelial inhibition, 12 strains recorded HCNproduction, 6 strains recorded maximum chitinaseproduction, 2 strains recorded positive forphosphate solubilization, 17 strains recordedprotease production, 30 strains recordedsiderophore production, 15 strains showed IAAproduction. Among these effective strains, 14 strainsshowed multiple actions against fusarium diseasepathogen.

Molecular characterization of Fusarium wiltisolates by ISSR analysis

Molecular characterization by ISSR analysiswas carried out for 180 isolates of Foc obtained fromdifferent parts of the banana growing regions of thecountry by using ISSR primer UBC 861. The resultof the study based on phylogenetic analysisindicated that there are 7 major groups present inFoc isolates of India. This ISSR analysis has clearlydistinguished the Foc isolates based on the varietyfrom which it was isolated. Interestingly, the virulentisolate of Foc from var. Robusta and Poovan werefound to be same through ISSR analysis. It was alsoobserved that there was wide variation among theisolates of Foc isolated from each variety. This studyalso clearly indicated that the effective managementpractices are also to be evolved depending on thestrains present in each banana growing regions (Fig.27 a&b).

Fig.27b.Phylogenetic analysis of FOC isolates of cv. Monthan

40

6 TECHNOLOGY ASSESSED AND TRANSFERRED

Exhibitions

Radio TalksJeyabaskaran, K.J. Fertilizer management in

banana (Q & A) (in Tamil), broadcasted on 19. 6.2009 from AIR, Tiruchirapalli.

Jeyabaskaran, K.J. Fertiliser management inbanana (in Tamil) - a Live Phone in Programme.broadcasted on 19. 1. 2010 from AIR, Tiruchirapalli.

Padmanaban, B. Integrated management ofinsect pests of banana (Q & A) (in Tamil) broadcastedon 11. 3. 2010 from AIR, Tiruchirapalli.

Kumar, V. Weed management in bananacultivation (in Tamil broadcasted on 10 .3.2010 fromAIR, Tiruchirapalli.

Television TalksPadmanaban, B. Management of banana

weevils (in Tamil). Telecasted in Makkal TV on 12. 6.2009.

Jeyabaskaran, K.J. Use of human urine in bananacultivation (in Tamil). Telecasted in Makkal TV on20. 7. 2009.

Kumar, V. Modified high density planting forenhancing production and productivity of banana.Telecasted in Makkal TV on 21. 3. 2010.

Sl.No.

Name of the Events

01 Sangam Horticulture- NHB and ICAR, Pragati 22-24, May 20092009 Maidan, New Delhi

02 National Seminar on ICAR & State Agril. Dept. 27-30, May 2009Agriculture- 2009 Mahmada, Pusa, Bihar

03 Banana Festival- 2009 Tamil Nadu Tourism 25-26, May 2009Development Corporation,Chennai, Tamil Nadu

04 Exhibition-cum- Thiruvarur Tree Growers 3-5, August 2009Workshop on Tree Association, ThiruvarurBreeding TamilNadu

05 Kissan Mela cum NRCB, Tiruchirapalli 21, August 2009Exhibition- 2009

06 Kissan Mela- 2009 Sugarcane Breeding Institute, 16-19, SeptemberCoimbatore, Tamil Nadu 2009

07 Second National Production of Healthy Planting 03-06, OctoberConference on Banana, Material in Banana AIPUB, 2009

NRCB and Jain Irrigationsystem Pvt Ltd, Jain Hills,Jalgaon, Maharashtra

08 Technology Week KVK, TNAU, Sirugamani, 10, October 2009Tiruchirapalli, TN.

09 Technology Week Saraswathi KVK, Puluthery, 10, October 2009Karur, TN.

10 Recent advances in NRC Banana and Govt. of Tiripura 21-24, October 2009production and post at Nagichara, Agartalaharvest technology onbanana

11 Seminar cum IIHR & Hithkary Nursery 28, October 2009Exhibition on Banana Bangalorecultivation

Organised by/venue Date(s)

NR

CB

Ann

ual

Rep

ort

2009

-'10

41

Sl.No.

7 EDUCATION AND TRAINING

Organised by/venue Date(s)Name of the Events

12 Agri. Expo 2010 Dinamalar and TNAU, Trichy 20-24, January 2010Tamil Nadu

13 National Kissan Mela- IIVR, Varanasi, UP. 30&31, January 2010 2010

14 Rastriya Kissan Mela- NRC for Citrus, Nagpur 21&22, February 2010 2010 Maharastra

15 National Conference on Govt. of India and ICAR, 11-14, March 2010Production of Seed and NASC, New DelhiHealthy PlantingMaterial Managementin Horticultural Crops

16 National Seminar on Sri Sankara Educational Trust 27&28, March 2010Banana Processing & and NRCB, TiruchirapalliValue Addition Tamil Nadu

All scientists of NRC Banana were activelyinvolved in impart training on Improved ProductionTechnology including Post Harvest Managementand Value Addition in Banana to the bananafarmers/entrepreneurs/horticultural officers/college students etc. from banana growing states inthe country during the period under report.

Dr. H. P. Singh, DDG (Hort) visiting the NRCB stall andexplaining the activities of NRCB to visitors during theSangam Horti-2009 at New Delhi on 22.5.2009.

Mr.K.S. Sripathy I.A.S, Chief Secretary and Mr. V. IraianbuI.A.S., Secretary, TTDC, Govt. of Tamil Nadu visiting theNRCB stall during the Banana Festival at Chennai on25.5.2009.

Field visit by Dr. M.M. Mustaffa and Dr. V. Pandey duringoff-campus training at Tripura

In addition, the students were involved infollowing project guidance to the M.Sc/ M.Phil.students of Bharathidasan University. The followingstudents were guided during the period

Participants of Improved production technology including post harvestmanagement and value addition in banana

42

M. Malathi M. Phil. Screening for Novel Transcripts in Subtracted cDNA Dr. S. UmaLibrary against Sigatoka Leaf Spot Disease in Banana

B. Sandhya M. Sc. EST based probing and identification of genes(Glyoxalase) for yellow Sigatoka leaf spot resistance inbanana

G. Paul Ebenezer M. Sc. Developing salt stress lines in banana through in-vitroscreening of shoot meristem

M. Manikandan M. Sc. EST based probing and identification of novel cDNAsagainst yellow Sigatoka resistance in banana cv. Robusta

P. Lakshmi Kanthan M. Sc. Development of cDNA library from Mycosphaerella infected leaves of cv. Robusta

S. Jothi Priya M. Sc. EST (Metallothionein) Based Probing for Identificationof Novel Transcripts Against Yellow SigatokaResistance in Banana cv. Robusta

R. Hemalatha M. Sc. Developing salt tolerant lines in banana (cv. Robusta)through in vitro screening of shoot meristem

C. Menaka M. Sc. Isolation and characterization of resistance gene analoguesfrom fusarium wilt resistant cultivar of banana (Musa sp.)

R. Priyadharsini M. Sc. Cloning and characterization of differentially expressedgenes from nematode resistant cultivar

S. Rohini M. Sc. Isolation of Functional Resistance Gene Analoguesfrom Fusarium Resistant Cultivar of Banana (Musa sp.)

S.R.Remya M. Sc. Preliminary studies on the development of genetic linkagemaps in banana using SSR markers and time lagassessment of DNA quality stored in DNA bank.

T. Muthulakshmi M. Sc. Identification of heterozygous M. acuminata (AA) parentsand their phylogenetic analysis using SSR markers andtime lag assessment of DNA quality stored in DNA bank.

M. Saranya M. Sc. Preliminary trials on the use of low cost alternatives inbanana tissue culture of variety Udhayam.

S. Praveena M. Sc. Studies on refinement of tissue culture protocol in bananavariety Udhayam

Dr. M. S. Saraswathi

Dr. S. Backiyarani

Student Name Degree Project Title Guide Name

8 AWARDS AND RECOGNITIONS

Awards

International‘Best Poster Award’ was given to the paper

entitled ‘Seed as an alternative source of DNA formolecular research of inaccessible wild Musaspecies’ authored by S. Uma, M.S. Saraswathi andD. Anto in the ISHS/ ProMusa banana symposiumon Global perspectives on Asian challenges heldbetween 14 & 18, September 2009 at Guangzhou,China.

NationalDr. S.Uma was awarded the ‘Punjabrao

Deshmukh Best woman Agricultural Scientist

award- 2009 during ICAR Foundation Day on 17thJuly 2009 at NAAS New Delhi.

Dr. S. Uma receiving Best Women Agricultural ScientistAward - 2009

NR

CB

Ann

ual

Rep

ort

2009

-'10

43

Dr. S.Uma was awarded the ‘Best WomanResearcher Award’ during Agri- Expo 2010 on 24th;January 2010 sponsored by national daily -Dinamalar and TNAU, Coimbatore.

Dr. S.Uma was awarded the ‘Life timeAchievement award for germplasm conservation inMusa’ during the Mupperum Vizha – PasumaiVazham –organised by the All India Radio (Ministryof Broadcasting, Coimbatore, Tamil Nadu, India on6th December 2009.

Dr. V. Pandey (Principal Scientist-Hort.) wasconferred with the Fellow of the Indian Society forHorticultural Research and Development.

Dr. V. Pandey (Principal Scientist-Hort.)received the Award for Best Poster PaperPresentation. Inter-space utilization in Youngmango orchard for pine apple production underwater saving irrigation and soil moistureconservation techniques. National Symposium onConservation Horticulture held at Dehradun duringMarch 21-24, 2010.

Dr.M.S.Saraswathi was awarded the ‘Best Ph.DDissertation Award’ by AIPUB in the SecondNational Conference on ‘Production of HealthyPlanting Material in Banana’ held at JISL, Jalgaonduring 2 -4, October 2009.

RecognitionsDr. B.Padmanaban Co-chaired the session on

'Quality Management' during the 2nd NationalConference on banana on 'Production of healthyplanting material in banana' organized by AIPUBand NRCB, Trichy, held at Jain Hills, Jalgaon,Maharashtra from 3-6th October 2009.

Dr.B.Padmanaban acted as rapporteur for thesession on Insect Pest Management during the 16thgroup meeting of the AICRP (TF), held at KAU,Thrissur from 16-19th November 2009.

Dr.B. Padmanaban was nominated as a Memberof the Board of Examiners for doctoral thesis of Ph.Dscholars of University of Kerala,Thiruvananthapuram and Bharathiar University,Coimbatore.

Dr. B. Padmanaban was nominated as ExecutiveCommittee Member and Joint Secretary of theAIPUB, Tiruchirapalli.

Dr. S.Uma has been recognised as the invitedmember of Institute Biosafety Committee ofBharathidasan University, Tiruchirapalli.

Dr. S.Uma compiled and presented the'Progress of Regeneration systems in varioushorticultural Crops' during the 2nd nationalconference on Horticultural Biotechnology held atIIHR, Bangalore , 28th October 2009.

Dr. S.Uma worked as rapporteur for theconcluding session during the 2nd nationalconference on Horticultural Biotechnology held atIIHR, Bangalore from 29th October 2009.

Dr. S.Uma Co-chaired the session on 'QualityPlanting Material Management' along with Dr.Mathura Rai (Director, IIVR- Chair) and Dr. NKMohan, Ex Dean AAU, Assam uring the 2ndNational Conference on banana on 'Production ofhealthy planting material in banana' organized byAIPUB and NRCB, Trichy, held at Jain Hills,Jalgaon, Maharashtra from 3-6th October 2009.

Dr. S.Uma acted as co-chair person for the firstsession on Banana Varietal development during the16th group meeting of the AICRP (TF), held at KAU,Thrissur from 16-19th November 2009.

Dr. R.Selvarajan was nominated to act asexternal examiner to conduct viva-voice exam for aPh.D scholar at Mangalore University.

Dr. R.Selvarajan was nominated by DBT, to actas selection committee member for selection ofresearch fellows and technical assistant for the DBT(GOI) project at Bharathidasan University, on 18thAugust, 2009.

Dr.R.Thangavelu and Dr.M.M.Mustaffareceived award for the book entitled ‘Vazhaisakupadiyil pudhiya thozhilnutpangal’ (in Tamil)from the Govt.of Tamil Nadu for the year -2009.

44

Developed linkages with Global Crop TrustDiversity Trust, Rome, and two projects havebeen funded for three years.

Collaborated with NBPGR for testing thebanana germplasm before in vitroconservation and cryo-preservation forinternational exchange.

Colloborated with AICRP-Centres for virusindexing of germplasm conserved in the fieldgene bank of respective centres.

NRCB and CPCRI worked together to find outthe presence of Phytoplasma from the root wiltaffected coconut trees and the samples werecollected from Kayankulam and Kasaragodand proved the presence of Phytoplasmathrough PCR for the first time.

9 LINKAGES AND COLLABORATIONS IN INDIA

AND ABROAD

1 0 PUBLICATIONS

Research PapersManimekalai, R., Soumya, V. P., Sathish Kumar, R.,

Selvarajan, R. Reddy, K., Thomas, G. V.,Sasikala, M., Rajeev, G. and Baranwal, V. K.2010. Molecular detection of 16SrXI groupphytoplasma associated with root (wilt)disease of coconut (Cocos nucifera) in India -Disease notes. Pl. Dis. 94(5):636.

Nithya Devi, A., Ponnuswami, V., Sundararaju, P.,Van den Bergh, I. and Kavino, M. 2009.Histopathological changes in banana rootscaused by Pratylenchus coffeae, Meloidogyneincognita and Radopholus similis andidentification of RAPD markers associatedwith P. coffeae resistance. Acta Hort. 828: 283-290.

Padmanaban, B., Thangavelu, R., Gopi, M. andMustaffa, M.M. 2009 Effect of massmultiplication media on sporulation, fieldefficacy and shelf life of Beauveria bassianaagainst rhizome and pseudostem weevils ofbanana. J. Biol. Control. 23(3): 277-283.

Selvarajan, R. Suganya Devi, P. Thangavelu, R.Kumudha, R. and Mustaffa, M. M. 2009.Genetic diversity among Fusarium oxysporumf.sp. cubense race-1 isolates. In: Banana NewInnovations (Eds. Singh, H.P. and Musatffa,M.M.). Westville Publishing House, NewDelhi. pp: 308-313.

Selvarajan, R., Balasubramaniyan, V., Jeyabaskaran,K. J., Pandey, S. D. and Mustaffa, M. M. 2009.Management of bract mosaic disease throughhigher dose of fertilizer in banana cv. NeyPoovan (AB). Ind. J. Hort. 66(3): 301-305.

Sundararaju, P. 2009. Vertical and horizontaldistribution of plant parasitic nematodesassociated with banana. Ind. J. Nematol. 39: 80-84.

Sundararaju, P. and Thangavelu, R. 2009. Influenceof Pratylenchus coffeae and Meloidogyne incognitaon the Fusarium wilt complex of Banana. Ind.J. Nematol. 39: 71-74.

Thangavelu R. and Mustaffa, M. M. 2010. First reportof corm rot disease caused by Sclerotium rolfsiiin banana. Aust. Pl. Dis. Notes. 5: 30-33.

Popular ArticlesJeyabaskaran, K. J., Mustaffa, M. M., Anitha Sree, T.

and Murugan, V. 2010. Bio-fertilisers inbanana cultivation (Tamil), Dinamalar(Tiruchirapalli and Vellore editions), 31. 03.2010.

Mayil Vaganan, M. and Mustaffa, M. M. 2010.Improved post-harvest managementtechniques and value addition in banana.Souvenir: National Seminar on BananaProcessing and Value Addition, 27&28, March.Tiruchirapalli, Tamil Nadu. 67-75.

Mayil Vaganan, M., I. Ravi and Mustaffa, M. M. 2009.Post-harvest management and value additionin banana. Souvenir: National Conference onA Road Map to Emerging Trends in FoodProcessing and Marketing, 17&18, Sept.,PAJANCOA, Karaikal, Puducherry. 5-8.

Mustaffa, M. M., Kumar, V., Jeyabaskaran, K. J. andPandey, V. 2009. Nutrition and WaterManagement for Micro Propagated Plants.Souvenir: Second National Conference onBanana, 3-6 Oct., Jalgaon, Maharashtra, pp.51-61.

Mustaffa, M.M. and Mayil Vaganan, M. 2009.Production, processing and utilization ofbanana fibre. In Book of Papers of InternationalConference on Emerging Trends in Production,Processing and Utilization of Natural Fibres.16-18, April. Mumbai, Vol. 2. 544-550.

Padmanaban. B. 2009. Insect pest management inmicro propagated banana through eco-friendly methods. Souvenir: Second Nationalconference on Production of Healthy PlantingMaterial in Banana, 3-6 Oct., Jalgaon,Maharashtra.

Padmanaban. B. 2010. Integrated pest managementin Banana, National Seminar on Banana

NR

CB

Ann

ual

Rep

ort

2009

-'10

45

processing and value addition. 27-28 March,Tiruchirapalli, T. N. p. 24-27.

Pandey, V., Kumar, V., K. Jeyabaskaran, K. J. andMustaffa, M. M. 2010. Improved mat andbunch management technologies for banana.Souvenir: National Seminar on BananaProcessing and Value Addition. 27-28, March,Tiruchirapalli, Tamil Nadu, pp: 31-41.

Pandey, V., Kumar, V., Jeyabaskaran, K. J. andMustaffa, M. M. 2009. Improved mat andbunch management technologies for micropropagated banana. Souvenir: SecondNational Conference on Production of HealthyPlanting Material in Banana, 3-6 Oct., Jalgaon,Maharashtra, pp: 62-71.

Pandey, V., and Mustaffa, M. M. 2010. R&D inBanana: A Flag bearer in Golden Revolution.Souvenir: National Symposium onConservation Horticulture, Mar 21-24,Dehradun, Uttarkhand.

Ravi, I., Mayil Vaganan, M. and Mustaffa, M. M.2010. Effect of abiotic stress on bananaproduction. Souvenir: National Seminar onBanana Processing and Value Addition,27&28, March, Tiruchirapalli, Tamil Nadu. 50-53.

Ravi, I., Mayil Vaganan, M. and Mustaffa, M. M.2010. Ethylene: A natural fruit ripeninghormone. Souvenir: National Seminar onBanana Processing and Value Addition,27&28, March. Tiruchirapalli, Tamil Nadu. 63-66.

Saraswathi, M. S. and Uma, S. 2010. Significance ofgenetic fidelity testing in tissue culturedbananas. Souvenir of the National Seminar onBanana Processing and Value addition. 27-28, March, Tiruchirapalli,, Tamil Nadu.

Selvarajan, R. 2009. Ensuring quality of micropropagated plants through virus indexing.Souvenir: Second National Conference onBanana, 3-6, Oct., Jalgaon, Maharasthra, pp.39-50.

Selvarajan, R. 2009 and Mustaffa, M. M. 2010. Havequality planting material for more bananas.Ind. Hort. pp.27-30.

Selvarajan, R. 2010. Diagnostics for clean plantingmaterial in banana. Souvenir: NationalConference on Production of Quality seeds andPlanting material - Health Management inHorticultural Crops, 11-14 March, New Delhi.p.114-123.

Selvarajan, R. 2009 2010.Current status of diagnosticinitiatives and uses for diseases in fruit crops.National Consultative Meeting on diseaseDiagnostics for Horticultural Crops during 22-

24, Jan. p. 3-12.Selvarajan, R. 2010. Future research needs on

disease diagnostics in Banana. NationalConsultative Meeting on Disease Diagnosticsfor Horticultural Crops, 22-24, Jan., NRCB,Trichy, p. 51-53.

Selvarajan, R. and Mustaffa, M. M. 2010. Bananabunchy top disease. Banana virus disease Factsheet -1

Selvarajan, R. and Mustaffa, M. M. 2010. Bananastreak disease. Banana virus disease Factsheet -2

Selvarajan, R. and Mustaffa, M. M. 2010. Bananabract mosaic disease. Banana virus diseaseFact sheet -3

Selvarajan, R. and Mustaffa, M. M. 2010. Bananamosaic or infectious chlorosis. Banana virusdisease Fact sheet -4

Sundararaju, P. 2010. Management of Plant ParasiticNematodes for the Production of QualityBanana. Souvenir: National Seminar onBanana Processing and Value Addition, 27-28 March, Tiruchirappalli, Tamil Nadu, pp:19-23.

Uma, S and Saraswathi, M.S. 2009. Ensuring Geneticfidelity in micropropagated bananas.Souvenir: Second National Conference onProduction of Healthy Planting Material inBanana, 3-6, Oct., Jalgaon, Maharashtra.

Uma, S. and Saraswathi, M.S. 2009. Growth ofbanana industry in India. Souvenir: NationalSeminar on Banana Processing and Valueaddition, 27-28, March, Tiruchirapalli,, TamilNadu.

Uma, S., Saraswathi, M.S. and Kalpana, S. 2009.Multiple utilities of banana fibre. Souvenir:National Seminar on Banana Processing andValue addition, 27-28, March, Tiruchirapalli,,Tamil Nadu.

Chapters in Training ManualBackiyarani, S and Uma, S. 2009. In vitro

conservation and cryopreservation techniquesin banana and plantains. In: Manual of theICAR sponsored short course on 'In vitrotechniques and application of molecularmarkers in banana', 21-30 November 2009,NRCB, Tiruchirapalli.

Backiyarani, S. 2009. Molecular confirmation ofgenetic transformation. In: Manual of the ICARsponsored short course on 'In vitro techniquesand application of molecular markers inbanana, 21-30 November 2009, NRCB,Tiruchirapalli.

46

Saraswathi, M.S. 2009. DNA barcoding -applications and limitations. In: Manual of theICAR sponsored short course on In vitrotechniques and application of molecularmarkers in banana, 21-30 November 2009,NRCB, Tiruchirapalli.

Saraswathi, M.S. 2009. Marker systems and theirapplications. In: Manual of the ICARsponsored short course on In vitro techniquesand application of molecular markers inbanana, 21-30 November 2009, NRCB,Tiruchirapalli.

Saraswathi, M.S. and Durai, P. 2009. Identificationof varieties of Tripura. In: Manual of the Govt.of Tripura sponsored training programme onRecent advances in Production and PostHarvest Technology of Banana, 21-24, October2009, Agartala, Tripura.

Saraswathi, M.S. and Uma, S. 2009. Advances inmicro and macropropagation of banana. In:Manual of the Govt. of Tripura sponsoredtraining programme on Recent advances inProduction and Post Harvest Technology ofBanana, 21-24, October 2009, Agartala,Tripura.

Uma, S and Saraswathi, M.S. 2009. Developmentand applications of Embryogenic CellSuspensions in banana and plantains. In:Manual of the ICAR sponsored short courseon In vitro techniques and application ofmolecular markers in banana, 21-30 November2009, NRCB, Tiruchirapalli.

Uma, S and Saraswathi, M.S. 2009. SomaclonalVariations in tissue culture industry and itsapplications. In: Manual of the ICARsponsored short course on In vitro techniquesand application of molecular markers inbanana, 21-30 November 2009, NRCB,Tiruchirapalli.

Uma, S. 2009. Exposure to national and internationalfunding agencies and collaborations inbanana and plantains research. In: Manual ofthe ICAR sponsored short course on 'In vitrotechniques and application of molecularmarkers in banana, 21-30 November 2009,NRCB, Tiruchirapalli.

Books/ Book ChaptersMustaffa, M.M, Sundararaju, P., Padmanaban, B.,

Kumar, V., Thangavelu R. and Jeyabaskaran,K. J. 2009. Handbook on Special TechnicalGuidelines for Banana cultivation (Tamil),IFFCO and NRCB , Tiruchirapalli, p 64.

Nandhini. P., Ravi. I and Narayana C. K. 2009.Carbohydrate Hydrolyzing and Antioxidativeenzymes in banana Fruits. In: Banana-New

Innovations. H.P. Singh and M.M. Mustaffa(Eds.), Westville Publishing House, New Delhi,pp 265-267.

Ravi, I., and Mustaffa, M. M. 2009. Musa GermplasmInformation System (MGIS)- Role of NationalResearch Centre for Banana, Thiruchirapalli.In: Information technology Applications inHorticultural Crops, P.M.Govindakrishnan,et.al.,(Eds.). Malhotra Publishing House, NewDelhi. pp. 317-318.

Ravi., I and Uma, U. 2009. Screening of bananagermplasm for drought tolerance. In: Banana,New Innovations. H.P. Singh andM.M.Mustaffa (Eds.) Westville PublishingHouse, New Delhi, p. 109-111.

Selvarajan, R., Rajmohan, R., Balasubramanian, V.,Rajesh, T., Uma S. and Mustaffa, M. M. 2009.Establishment of Embryogenic cellsuspensions for development of TrasngenicHill banana resistant to Banana Bunchy topvirus. In: Banana - New Innovations (Eds. H.P.Singh and M.M. Mustaffa.), pp. 54-58.

Selvarajan, R., 2009. Virus indexing in productionof quality planting material. In: Banana - NewInnovations (Eds. H.P. Singh and M.M.Mustaffa.), pp. 299-303.

S e l v a r a j a n , R . , S a n t h a n a l a k s h m i , K . , B a l asubramanian, V., Mohana, S., Indumathi, S.,Suganya Devi, P. and Mustaffa, M. M. 2009.Molecular characterization of BSV infectedbanana using ISSR markers In: Banana - NewInnovations (Eds. H.P. Singh and M.M.Mustaffa.): pp.304-307.

Selvarajan, R., Thangavelu, R., Suganya Devi, P.,Kumudha, R., Sailakshmi, S. and Mustaffa, M.M. 2009. Genetic diversity among Fusariumoxysporum f.sp. cubense race-1 isolates. In:Banana - New Innovations (Eds. H.P. Singhand M.M. Mustaffa.): pp. 308-313.

Paper Presented in Conferences /Symposia / Seminars / Workshops/Meeting etc.

InternationalBackiyarani, S., Uma S., Anuradha, C., Saraswathi,

M. S. and Arunkumar, G. 2010. Developmentof RGA-CAP markers for genetic mapping ofcandidate resistance Genes(s) in Musa. Proc.Plant & Animal Genomes XVIII Conference,January 9-13, 2010 Town & Countryconvention Center, San Diego, CA.

Backiyarani, S., Uma, S. Sundararaju, P. MayilVaganan, M., Saraswathi M. S. and Jeeva, S.2009. Time course expression studies of

NR

CB

Ann

ual

Rep

ort

2009

-'10

47

defense gene in banana against Pratylenchuscoffeae for creation of subtractive cDNA library.International conference on GlobalPerspectives on Asian Challenges on Bananaproduction, held at Guangzhou, China during14-17, September 2009

Durai, P., Uma, S., Saraswathi, M. S., Jayabalan, N.and Mustaffa, M.M. 2009. Studies onintersectional relationship between Eumusaand Rhodochlamys of the genus Musa usingmorphotaxonomy and microsatellite markers.International conference on GlobalPerspectives on Asian Challenges on Bananaproduction, held at Guangzhou, China during14-17, September 2009.

Padmanaban. B., Uma, S. and Mustaffa, M. M. 2009.Evaluation of host reaction of Musa germplasmto the Banana corm weevil, Cosmopolitessordidus. International ISHS -ProMusaSymposium: Global Perspectives on AsianChallenges, held at Guangzhou, China during14-17, September 2009.

Ravi, I., Mustaffa, M. M., and Mayil Vaganan, M.2009. Effect of soil moisture deficit stress onphysiological and biochemical parameters ofbanana plants. International Conference onGlobal Perspectives on Asian Challenges onBanana Production, held at Guangzhou,China during 14-17, September 2009

Saraswathi, M.S., Uma, S., Prasanya Selvam, K.,Ramaraj, S., Durai, P. and Mustaffa, M. M.2009. Robustness of IRAP and RAPD markersystems in studying the intra-group diversityof Musa Cavendish (AAA) clones. Internationalconference on Global Perspectives on AsianChallenges on Banana Production, held atGuangzhou, China during 14-17, September2009

Saraswathi, M. S., Uma, S., Vadivelu, E., Durai, P.,Siva, S. A., Rajagopal, G., and Sathiamoorthy,S. 2009. Diversity analysis of Indian cookingbananas through morphotaxonomic andmolecular characterization. Internationalconference on Global Perspectives on AsianChallenges on Banana production, held atGuangzhou, China during 14-17, September2009

Uma S., Kasin, Y.A., Sudhakar, B, Saraswathi, M.S.,Backiyarani, S. and Saravankumar, A. S. 2010.Assessment of optimum drought conditionsusing Real time PCR based Assay forfunctional genomics studies in banana. In:Proc. Plant & Animal Genomes XVIII Conference,9-13, Jan., San Diego, CA

Uma S., Sudhakar, B, Thangavelu, R., Backiyarani,S., Saraswathi, M. S. and Saravankumar, A. S.2010. Differential gene expression analysis forSigatoka (Mycosphaerella eumusae) inresistant Musa acuminate cv. Manoranjitham(AAA). Proc. Plant & Animal Genomes XVIIIConference. 9-13, Jan., San Diego, CA.

Uma, S., Akbar, A., Saraswathi, M.S. andUdhayaanjali, K. 2009. Synchronization ofsomatic embryos by liquid medium-basedprotocol for 'Rasthali' (Musa,AAB).International conference on GlobalPerspectives on Asian Challenges on Bananaproduction, held at Guangzhou, China during14-17, September 2009

Uma, S., Mustaffa, M. M., Saraswathi, M. S. andDurai, P. 2009. Exploitation of diploids inIndian banana breeding programmes.International conference on GlobalPerspectives on Asian Challenges on Bananaproduction, held at Guangzhou, China during14-17, September 2009

Uma, S., Saraswathi, M. S. and Anto, D. 2009. Seedas an alternative source of DNA for molecularresearch of inaccessible wild Musa species.International conference on GlobalPerspectives on Asian Challenges on Bananaproduction, held at Guangzhou, China during14-17, September 2009

NationalBackiyarani, S., Uma, S. Saraswathi, M. S., Mustaffa,

M. M. and Anuradha, C. 2009. Application ofBioinformatics in banana-Status andprospects. National Symposium on Recentglobal developments in the Management ofPlant Genetic Resources, held at New Delhiduring 17-18, December 2009.

Backiyarani, S., Uma, S., Anuradha, C., Saraswathi,M. S. and Arunkumar, G. 2009. Cloning andcharacterization of resistance gene likesequences in banana. Second NationalConference on Production of Healthy plantingmaterial in banana, held at Jalgaon,Maharashtra during 3-6 October 2009.

Backiyarani,, S., Uma, S., Saraswathi, M. S. Mustaffa.M. M. and Anuradha, C. 2009. Application ofbioinformatics in banana-status andprospects. National symposium on RecentGlobal Developments in Managements ofPlant Genetic Resources, held at New Delhiduring 17-18, December 2009.

Backiyarani, S., Uma, S., Anuradha, C., Saraswathi,M. S. and Arun Kumar, G. 2009. Cloning andcharacterisation of resistance gene-like

48

sequences in banana. Second NationalConference on Production of Healthy PlantingMaterial in Banana. held at Jalgaon,Maharashtra during 3-6 October 2009.

Dayarani, M., Dhanarajan, M. S., Dharini, T.,Saraswathi, M. S. and Uma, S. 2009. Diversityand phylogenetic analysis of the genus Musa.National Symposium on Recent globaldevelopments in the Management of PlantGenetic Resources, held at New Delhi during17-18, December 2009.

Jeyabaskaran, K. J., Mustaffa, M. M., Anitha Sree, T.and Subburaman, M. M. 2009. Utilisation ofhuman urine as liquid organic manure inbanana cultivation. Second NationalConference on Production of Healthy PlantingMaterial in Banana, held at Jalgaon,Maharashtra during 3-6 October 2009.

Kumar, V., Mustaffa, M. M. and Jeyabaskaran, K. J.2009. Effect of different plant densities andlevels of fertigation on growth, flowering andyield of banana cv. Grand Nain under wetlandconditions. Second National Conference onProduction of Healthy Planting Material inBanana, held at Jalgaon, Maharashtra during3-6 October 2009.

Kumar, V., Kalaiselvi, R., Jeyabaskaran, K. J. andMustaffa, M. M. 2009. Studies on soil microbialand nutritional changes as influenced byspacing, plant density and fertigation in therhizosphere of banana cv. Grand Naine (AAA).Second National Conference on Production ofHealthy Planting Material in Banana, held atJalgaon, Maharashtra during 3-6 October 2009.

Mayil Vaganan, M., Preetha, P., Ravi, I., andMustaffa, M. M. 2009. SDS-PAGE analysis ofdifferentially regulated proteins in salt-sensitive banana cultivars. Second NationalConference on Production of Healthy PlantingMaterial in Banana. held at Jalgaon,Maharashtra during 3-6 October 2009.

Mayil Vaganan, M., Ravi, I., Elavarasi, P.,Sundararaju, P. and Mustaffa, M. M. 2009.Phenolics and defense enzymes in bananasand their relationship to nematode resistance.Second National Conference on Production ofHealthy Planting Material in Banana. 3-6, Oct.,Jalgoan, Maharashtra

Mustaffa, M. M. Kumar, V., Subramanian, A. R. andJeyabaskaran, K. J. 2009. Influence of organicand inorganic nutrition on growth and yieldperformance of banana cv. Grand NaineSecond National Conference on Production ofHealthy Planting Material in Banana, held atJalgaon, Maharashtra during 3-6 October 2009.

Mustaffa, M. M., Kumar, V., Subramanian, A. R. andJeyabaskaran, K. J. 2009. Studies on shelf lifeof fruits as influenced by organic andinorganic nutrition in banana cv. GrandNaine. Second National Conference onProduction of Healthy Planting Material inBanana, held at Jalgaon, Maharashtra during3-6 October 2009.

Narayana, C. K., Ravi, I., and Mustaffa, M. M. 2009.Effect of modified atmospheric packaging onchilling injury and quality of Neypoovanbanana. Second National Conference onProduction of Healthy Planting Material inBanana, held at Jalgaon, Maharashtra during3-6 October 2009.

Padmanaban, B., Lakshmi Balaji, A. and M. M.Mustaffa, 2009 Sucker treatment and soilapplication to control banana corm weevil,Cosmopolites sordidus Germar (Coleoptera:Curculionidae). Second National conferenceon Production of Healthy Planting Materialin Banana, 3-6, Oct., Jalgoan, Maharashtra.

Padmanaban, B., Jaffar Sadik and Mustaffa, M. M.2009. Screening of semiochemicals againstbanana corm weevil, Cosmopolites sordidusGermar (Coleoptera: Curculionidae)underfield conditions. Second National conferenceon Production of Healthy Planting Materialin Banana, held at Jalgaon, Maharashtraduring 3-6 October 2009.

Palanichamy, S. Padmanaban, B. and Mustaffa, M.M. 2009. Orientation response of Bananastem weevil, Odoiporus longicollis (Olivier)(Coleoptera: Curculionidae) to selectedcultivars of banana. Second Nationalconference on Production of Healthy PlantingMaterial in Banana, held at Jalgaon,Maharashtra during 3-6 October 2009.

Ravi, I., Gomathi, R., Kalaivani, R., Priya, J., MayilVaganan, M. and Mustaffa, M. M. 2009. Roleof stress hormone and antioxidativecompounds on NaCl stress tolerance in tissueculture plants of banana. Second NationalConference on Production of Healthy PlantingMaterial in Banana. held at Jalgaon,Maharashtra during 3-6 October 2009.

Ravi, I., Mayil Vaganan, M., Kalaivani, R., andMustaffa, M. M. 2009. Effect of salt stress onfruit growth and carbohydrate accumulationin different banana cultivation. NationalConference on Frontiers in Plant Physiologytowards Sustainable Agriculture, Jorhat,Assam during 5-7, November 2009.

Ravi, I., Savithri, M., Kalaivani, R., Priya, J., MayilVaganan, M. and Mustaffa, M. M. 2000. Effect

NR

CB

Ann

ual

Rep

ort

2009

-'10

49

of ABA and antioxidative compounds on soilmoisture stress tolerance in tissue cultureplants of banana. Second National Conferenceon Production of Healthy Planting Materialin Banana. held at Jalgaon, Maharashtraduring 3-6 October 2009.

Santhi, V. P., Kumar, N., Jeyabaskaran, K. J. andKumar, V. 2009. Effect of cement kiln flue dustas a source of potassium on changes in leafand fruit nutrient composition of banana cv.Poovan (AAB) and Karpuravalli (ABB).Second National Conference on Production ofHealthy Planting Material in Banana, held atJalgaon, Maharashtra during 3-6 October 2009.

Santhi, V.P., Kumar, N., Jeyabaskaran, K. J. Kumar,V. and Mustaffa, M. M. 2009. Effect of cementkiln flue dust as a source of potassium on drymatter production and distribution of differentstages of banana cv. Poovan (AAB). SecondNational Conference on Production of HealthyPlanting Material in Banana, held at Jalgaon,Maharashtra during 3-6 October 2009.

Saraswathi, M. S., Uma, S., Agrawal, A. and Durai,P. 2009. Genetic stability of the cryopreservedcooking banana cv. Sommarani Monthan asassessed by random markers. In: Proc. of theSecond National Conference on Production ofHealthy Planting material in banana, held atJalgaon, Maharashtra during 3-6 October 2009.

Saraswathi, M.S., Uma, S., Ramaraj, S., Durai, P. andPunniakotti, E. 2010. Characterization of RedBanana and their Green variants using RAPDmarkers. National Conference on Productionof Quality seeds and Planting material-Healthmanagement of Horticultural crops held atNew Delhi during 11-14, March 2010.

Selvarajan, R. 2010. Banana viruses andcertification- State of art in India. NationalConference on Production of Quality seeds andPlanting material- Health Management inHorticultural Crops, held at New Delhi during11-14, March 2010.

Selvarajan, R. 2010. Current status of diagnosticinitiatives and uses for diseases in fruit crops.National Consultative Meeting on DiseaseDiagnostics for Horticultural Crops, held atTiruchirapalli during 22-24, January 2010.

Selvarajan, R. 2010. Future research needs ondisease diagnostics in Banana, NationalConsultative Meeting on Disease Diagnosticsfor Horticultural Crops held at New Delhiduring 11-14, March 2010.

Selvarajan, R. 2010. Elimination of viruses inmicropropagation of banana plants. Second

National Conference on Banana, held atJalgaon, Maharashtra during 3-6 October 2009.

Selvarajan, R. 2009. Viral disease management inmicro and macro-propagated plants for highproductivity In: Second National Conferenceon Banana, held at Jalgaon, Maharashtraduring 3-6 October 2009.

Sundararaju .P, B. Padmanaban, , Jaffar Sadik andHemalatha, S. 2009. Screening of Tithoniadiversifolia leaf extracts on the mortality of Rootlesion nematode, Pratylenchus coffeae. SecondNational conference on Production of HealthyPlanting Material in Banana, held at Jalgaon,Maharashtra during 3-6 October 2009.

Sundararaju, P. and Mustaffa, M. M 2010. HealthManagement in Banana: Novel approaches forproduction of nematode free quality plantingmaterial. National Conference on Productionof Quality Seeds and Planting Material-HealthManagement in Horticultural Crops, held atNew Delhi during 11-14, March 2010.

Uma, S. 2009. Recent trends and issues in productionof quality planting material in banana andplantains. Second National Conference onProduction of Healthy Planting Material inBanana, held at Jalgaon, Maharashtra during3-6 October 2009.

Uma, S., Saraswathi, M.S., Mustaffa, M.M. andDurai, P. 2010. Conservation strategies to savetrait specific banana landraces and wildspecies from extinction. National Symposiumon Conservation Horticulture, held atDehradun during 21-23, March 2010.

Uma, S., Saraswathi, M. S., Karthick, L. and Siva, S.A. 2010. Development of SCAR marker linkedto the somaclonal variant-floral deformity inmicropropagated banana using RAPD.National Conference on Production of Qualityseeds and Planting material-Healthmanagement of Horticultural crops, held atNew Delhi during 11-14, March 2010.

Uma, S., Saraswathi, M. S., Lakshmi, S. and Akbar,A. 2009. Assessing the genetic fidelity in cv.Rasthali derived from three different explantsusing random markers. In: NationalConference on Production of Healthy Plantingmaterial in banana, held at Jalgaon,Maharashtra during 3-6 October 2009.

Uma, S., Singh, H.P. and Mustaffa, M. M. 2010. Needfor revamping banana seed industry in India.In: National Conference on Production ofQuality seeds and Planting material-Healthmanagement of Horticultural crops, held atNew Delhi during 11-14, March 2010.

50

1 1 CONSULTANCY SERVICES AND

COMMERCIALISATION OF TECHNOLOGIES

Resource generation through contractservice-virus testing in banana

Tissue culture banana plants and mother plantsuckers from 19 tissue culture industries wereindexed with ELISA, PCR and NASH technology atthe Centre. In this financial year 7,969 samples hadbeen tested for the presence of virus, out of which4097 is for BBTV, 1337 for BSV, 2033 for BBrMV and502 for CMV and approximately an amount ofRs.16,68,748 has been received by the centre duringthe period under report under contract service forvirus indexing.

Evaluation of new fungicide, Pyraclostrobin,against Sigatoka leaf spot diseases of banana, anamount of for Rs. 1,37,000/- was generated.

Revenue generated from students project works- Rs. 3,40,000/-.

1 2 RAC / IMC / IRC MEETINGS

RAC MeetingThe first meeting of the newly constituted

Research Advisory Committee under thechairmanship of the Dr.P. Rethinam was held on 7and 8, December 2009. This was the 11th RACmeeting of the Centre, which commenced with fieldvisit of Chairman and members of the Committeeand with the Director and Scientists of the Centre toResearch Farm in the morning of 7th December, 2009.The Chairman and members reviewed the ongoingexperiments in the field. The Director and Scientistsexplained various ongoing research activities in thefarm. All the experiments under various projectswere explained to the RAC Chairman and membersby the concerned scientists. The Chairman andmembers of the RAC appreciated about the wellmaintenance of research farm and the research workunder different programmes. After the field visit, theRAC visited all the research laboratories to see theinfrastructure facilities available and wereexplained on the research activities by therespective scientists.

Dr. M.M. Mustaffa, Director, National ResearchCentre for Banana, Trichy after welcoming theChairman and members of RAC, gave a brief

account on the salient research achievements madeby the NRCB during the last one year. The ActionTaken Report on the recommendations of 10th RACwas presented by Dr. B. Padmanaban, MemberSecretary-I/c. The Chairman and the members weresatisfied with the action taken on therecommendations of previous RAC meeting andapproved the minutes of 10th RAC. This wasfollowed by presentations by Head of Sections onthe various research activities on banana.

RAC Members visit the NRCB research farm

Dr. P. Rethinam Chairing the RAC meeting

1. Dr.P. Rethinam Chairman2. Dr. Y.N. Reddy Member3. Dr. B.M.C. Reddy Member4. Dr. R.. Palaniappan Member5. Dr. K.V. Ramana Member6. Dr. Rema Menon Member7. Dr. M.M. Mustaffa Member8. Prof. B. Sivarama Krishnan IMC Member9. Dr.B. Padmanaban Member

Secretary (IC)

Sl. No. Name Position

NR

CB

Ann

ual

Rep

ort

2009

-'10

51

IMC Meeting

The twelfth meeting of the InstituteManagement Committee was held on 9.12.09 underthe chairmanship of Dr.M. M. Mustaffa, Director. Inthe meeting, the following policy decisions werediscussed and recommended for approval by theCouncil: Annual Plan Budget: 2009-'10; Recognitionof Authorized Medical Attendants for the benefit ofstaff and family members and Post-facto approvalfor dropping of some equipments.

IRC Meeting

The Fourteenth Institute Research CouncilMeeting was held on 4 and 5, March 2010. Thesalient research achievements of previous year andtechnical programmes for the next year werepresented by respective project leaders of instituteand externally funded projects. The Director andChairman of IRC reviewed the researchachievements made under each project and gavecritical inputs for refinement of the researchprogrammes.

Sl. No. Name & Address Position

1. Dr.M.M. Mustaffa, Director, NRCB,Tiruchirapalli. Chairman

2. Dr.N. Kumar, Dean (Hort), TNAU, Coimbatore. Member

3. Shri. S. Robert Vincent, DDH,Tiruchirapalli. Member

4. Dr.C.K. Narayana, Head-PHT, IIHR, Bangalore Member

5. Dr. Sukhada Mohandos, Principal Scientist, IIHR, Bangalore Member

6. Dr.S. Uma, Principal Scientist, NRCB, Tiruchirapalli Member

7. Dr.V. Pandey, Principal Scientist, NRCB, Tiruchirapalli Member

8. Shri. K.K. Hamza, F & AO, SBI, Coimbatore Member

9 Prof. S. Sivarama Krishnan, M/s. Shankara Group, Tiruchirapalli Non-official Member

10. Dr. S. Backiyarani, I/c.- AFAO, NRCB, Tiruchirapalli Special Invitee

11. Shri.B.Vijayakumar, AAO, NRCB, Tiruchirapalli Member -Secretary

Dr. M.M. Mustaffa, Director, NRCB Chairing the 12th

IMC Meeting

52

1 3 TRAININGS/ WORKSHOPS/ SEMINARS/ CONFERENCES/ WINTER & SUMMER COURSES/ MEETINGS

ATTENDED BY SCIENTISTS

Title of the Programme/ VenueScientist Period

M. M. Mustaffa International Conference on Natural Fibre, 16-18.4.2009Mumbai.

Brainstorming Session on Management of 21.4.2009Horticultural Crops Genetic Resources, NBPGR,New Delhi.

Research Council Meeting of Directorate of Oil 21.4.2009Palm, Palode , Thiruvananthapuram.

Swadesh Prem Jagriti Sangosthi-2009, Mahmada, 28-30.4.2009Samastipur, Bihar.

Stakeholders Meeting on Production and 10.5.2009Marketing of Banana - ETA Star Groups, Chennai.

ICAR Foundation Day - Directors' Conference, 16 &17.6.2009ICAR, New Delhi.

Brainstorming Session on Horticulture 8.8.2009Development in Kodagu, CHES-IIHR, Chethalli,Karnataka.

Workshop on IT Application in Horticultural 24 & 25.8.2009Crops, CPRI, Shimla.

Third Consortium Advisory Committee of NAIP 27.8.2009Fibre Project, CIRCOT, Mumbai.

National Seminar on Enhancing Agricultural 29&30.8.2009Productivity and Profitability, CMFRI, Kochi

ISHS/ProMusa Symposium on Global 14-19.9.2009Perspective on Asian Challenges, Guangzhou,China.

Second National Conference on Banana - Jalgaon 3-6.10.2009Maharastra.

Scientific Advisory Committee Meeting/ Farmers 13.10.2009Meet - Saraswathi KVK, Karur, T.N.

Scientific Advisory Committee Meeting, 14.10.2009 KVK, Perambalur

National Conference on Natural Fibres - 26 & 27.10.2009ANGRAU, Hyderabad

National Seminar on Horticulture Biotechnology, 28 & 29.10.2009IIHR, Bangalore

Review Meeting - Mega Project on Natural Fibre, 31.10.2009ICAR, New Delhi

NR

CB

Ann

ual

Rep

ort

2009

-'10

53

Bioversity - SANPGR Meeting, 3 & 4.11.2009NASC, NewDelhi

National Conference on KVK-2009, TNAU, 6-7.11.2009Coimbatore

16th Group Meeting AICRP (TF) KAU, Thrissur, Kerala 16-19.11.2009

P. Sundararaju Banana Grower's Meet, Jalgaon, Maharshtra 2. 4. 2009

Second National Conference on Banana, Jalgaon, 3-6.10.2009Maharashtra.

ICAR Zonal Technology Management & 12 &13.2010Business Planning and Development Meeting-cum-Workshop 2009-10, Central Institute ofFisheries Technology, Cochin, Kerala

National Workshop for the Sensitization of the 19.3.2010ARIS in-charges about the uniformity guidelinesfor websites, NBPGR, New Delhi.

National Seminar on Banana Processing and 27&28.3.2010Value Addition, Tiruchirappalli, T. N.

Integrated Pests Management Farmers' Field 30.3.2010School (IPM-FFS) on Banana at PerunthalaivarKamaraj Krishi Vigyan Kendra (PKKVK),Kurumbapet, Pondicherry.

B. Padmanaban Brainstorming session on Sucking insect pests 11-12.6.2009 and mealy bugs held at CISH, Lucknow.

Organic farming workshop held at Yercaud, T. N. 18.7.2009

Brain Storming session on coconut root wilt 21.8.2009disease, NRCB, Tiruchirapalli.

II National conference on Production of Healthy 3-6.10.2009Planting Material in Banana held at Jalgaon.

Group discussion of the AICRP and Adhoc 16-19.11.2009schemes on tropical fruits held at KAU, Thrissur.

Interactive meeting on management of 5&6.12.2009mealybugs, IIHR, Bangalore.

Brainstorming session on the application of 27-28. 3.2010Nanotehnology in Agricultural Sciences, CIAE,and Mumbai.

S. Uma Preliminary meeting on Developing DUS 23.4.2009procedure for Agri, Horti and Grass crop species,NAAS, New Delhi.

ICAR Foundation Day ceremony, NAAS 17.7.2009complex, New Delhi.

Second National Conference on Production of 03-6.10.2009Healthy Planting material in banana, Jalgaon,Maharashtra.

International conference on Global Perspectives 14-17.10.2009on Asian Challenges on Banana production,Guangzhou, China.

54

8th PROMUSA - Meeting of Crop Improvement 18.10.2009working Group, Guangzhou, China

National Seminar on Horticultural Biotechnology, 28 & 29.10.2009 IIHR, Bangalore.

16th group meeting of the AICRP (TF), KAU, 16-19.11.2009Thrissur, Kerala

Project Appraisal Committee meeting of the PPV 17. 3.2010and FRA and presented the proposal onNetworking on development of DUS guidelinesfor banana, New Delhi.

Project proposal on Managing Changing needs:Innovative research using fruit tree germplasm 18.3.2010for adapting to climate change and improve fruitgrowers 'livelihoods', BIOVERSITY- South AsiaRegional Office, New Delhi

National Seminar on Banana Processing and 27&28.3.2010Value addition, Tiruchirapalli, Tamil Nadu

V. Pandey National Conference on Banana, Jalgaon, 29 &30 .5.2009Maharashtra

Banana Farmers' Seminar organized by SBI, 7.7.2009Alangudi Branch, Alangudi, Pudukottai.

Brain Storming Session on Post Harvest 21.8.2009Technology and Value Addition in Banana atNRC for Banana, Tiruchirapalli.

National Conference on Banana, Jalgaon, 3-4.10.2009Maharashtra

National Symposium on Conservation 21-24.3.2010Horticulture, Dehradun

National Seminar on Banana Processing and 27-28.3.2010Value Addition- Entrepreneur to Enterprise,Tiruchirapalli, T. N.

Workshop on Organic Farming at Yercaud 18.7.2009Salem

XVI Biennial Group Meeting of AICRP on 16-19.11.2009Tropical Fruits at KAU, Thrissur, Kerala

Course on Creative Writing in Agriculture at 5-9.10.2009IIMC, New Delhi

Course on Vigilance Administration at NAARM, 29-31.10.2009Hyderabad

I. Ravi Workshop on Information Technology 24 &25.8.2009 applications in Horticultural crops, CPRI, Shimla

Training on Molecular Markers: Discovery and 18-22.1.2010Validation Central Plantation Crop ResearchInstitute, Kasaragod, Kerala

Reviewing the Progress of Foreign Aided 9.9.2009Projects, New Delhi

National Conference on Frontiers in Plant Physiology 5-7. 1.2010towards Sustainable Agriculture, AAU, Jorhat

NR

CB

Ann

ual

Rep

ort

2009

-'10

55

Brainstorming Session on Application of 27& 28.3.2010Nanotechnology in Agriculture Sciences, CIFEMumbai

R. Thangavelu Banana Grower's Meet, Jalgaon, Maharashtra 2.4.2009

Second National Conference on Production of Healthy 3-6.10.2009Planting Materials in Banana, Jalgaon, Maharashtra

R. Selvarajan Workshop on Organic Farming at Yercaud 21.6.2009Salem

Review committee meeting of DBT sponsored 6 &7.7.2009net work project on Development of virusresistant transgenic crops, M.K.U, Madurai.

3rd Institute biosafety committee meeting, 13.8.2009NRCB, Tiruchirapalli

International Workshop on Banana Bunchy Top 24-28.8.2009Disease (BBTD) and Banana Xanthomonas Wilt(BXW), Arusha, Tanzania

National conference on Quality Production of 3-6.10.2009Healthy Planting Material in Banana, Jalgaon,Maharashtra.

A training programme on Recent advances in 20-23.10.2009EST analysis and their annotation, IISR, Calicut.

Second National Seminar on Horticultural 28-30.10.2009Biotechnology, IIHR, Bangalore.

XVI Biennial Group Discussion on AICRP on 16-19.11.2009Tropical Fruits held at KAU, Thrissur

National Conference on Production of Quality 4.3.2010seeds and Planting material- HealthManagement in Horticultural Crops, New Delhi.

National Seminar on Banana Processing and 27-28.3.2010Value Addition, Tiruchirappalli, T. N.

V. Kumar Inter-state Horti. Fair-SANGAM 2009, New Delhi 22-24.5.2009

National Conference on Technology-Led Economic 29 & 30.5.2009Development of Horticulture for Rural Development,PUSA, Samastipur, Bihar

Banana Farmers Seminar organized, Alangudi, 7.7.2009Pudukottai.Banana Festival, Chennai

Brain Storming Session on Post Harvest 21.8.2009Technology and Value Addition in Banana,NRC Banana, Tiruchirapalli

Interaction Meeting on Tools and Machinery for 18 &19.12.2010the development of Horticulture, CPCRI, Kasaragod

National Seminar on 'Banana Processing and 27 & 28.3.2010Value Addition- Entrepreneur to Enterprise' atTiruchirapalli

M. Mayil Vaganan Post-harvest management and value addition in 2.6.2009banana at Meeting of farming for export, CIAL, Cochin

56

Global scenario of banana and value added 18.7.2009products of banana at Export seminar for agricultureand food products, Krishnagiri, Tamil Nadu.

Brainstorming Session on 'Post-Harvest 21. 8.2009Management including Handling, Storage andRipening of Banana', NRCB, Tiruchirapalli.

Post-harvest technologies and value addition in 17&18.9.2009banana at National Seminar on A road map toemerging trends in food processing and marketing,PAJANCOA, Karaikal, Puducherry.

Value addition and value added products of 14.10.2009banana at Technology week celebration,Sarasvathi KVK, Puzhutheri, Karur, Tamil Nadu.

Improved post-harvest technologies in banana 28.10.2009and value addition in banana in Training onimproved cultivation practices including post-harvest technologies, NRCB, Trichy.

Training on In-vitro techniques and application of 21-30.11.2009molecular markers in banana plantains, NRCB,Tiruchirapalli.

Extraction of quality fibre form banana at SHG 22.12.2009training on banana products, Sarasvathi KVK,Puzhutheri, Karur, Tamil Nadu.

Value addition in banana. At Training on 10.2.2010improved cultivation practices includingpost-harvest technologies, NRCB, Trichy.

Meeting-cum-Workshop on 'Zonal Technology 12 &13.3.2010Management & Business Planning Development',CIFT, Cochin

Value addition and value added products of 16.3.2009banana at Farmers field school, PerunthalaivarKamarajar KVK, Puducherry.

Brainstorming Session on Application of 27 & 28.3.2010Nanotechnology in Agriculture Sciences andpresented a concept note on Banana flavonoidsand fructans in nanoform as nutraceuticals,CIFE, Mumbai

K. J. Jeyabaskaran Organic Farming-Workshop at Yercaud and delivered 18.07.09a lecture on “Organic farming in banana

”.Second National Conference on Production of Healthy 3-6.10.2009Planting Material in Banana, Jalgaon, Maharashtra.

National Ecosan Manual Workshop organized by 26 & 27.11.2009UNICEF for DDWS, GOI at New Delhi.

Workshop on Role of potassium nutrition to sustain crop 22.1.2010production in Tamil Nadu organized by Faculty ofAgriculture, Annamalai University, Chidambaram.

Meetings on Level-I and Level-II experts of Kisan 10.9.2009,Call Centre at TNAU, Coimbatore 11.1.2010 and

12.3.2010

NR

CB

Ann

ual

Rep

ort

2009

-'10

57

S.Backiyarani Brainstorming session on Application of 27-28.3.2010Nanotechnology in Agricultural Sciences, CIE,Mumbai

Zonal Technology Management & Business 12-14.3.2010Planning and Development Meeting - cum-Workshop, CIFT, Kochi, Kerala

Training programme on Bioinformatics 27.1- 2.2.10component, IISR, Calicut, Kerala

XVIII International Conference on Plant & 9-13.1.2010 Animal Genomes, San Diego, CA, USA

National Seminar on Horticultural Biotechnology, 28-29.10.2009IIHR, Bangalore, Karnataka

Second National Conference on Production of 3-6.10.2009Healthy Planting material in banana, Jalgaon,Maharashtra

Nineth meeting of the Task Force on Plant 16.4.2009Biotechnology, DBT, New Delhi

M. S. Saraswathi Nineth meeting of the Task Force on Plant 6.4.2009Biotechnology, DBT, New Delhi.

Oil Palm interface meet, NRCB, Tiruchirapalli 29.4.2009

Apex body meeting of the DBT-ATL, DBT, NewDelhi. 11.8.2009

Review meeting of the foreign aided projects, 9. 9.2009IARI, New Delhi

National Seminar on Banana Processing and 27-28.3.2010Value addition, Tiruchirapalli, Tamil Nadu

Bio-informatics training on Molecular markers 18-22.1.2010: Discovery and validation, CPCRI, Kasaragod, Kerala

Second National Conference on Production of 3-6.10.2009Healthy Planting material in banana, Jalgaon,Maharashtra.

Review meeting of externally funded projects 9-11.9.2009NARS Complex, New Delhi.

Review meeting of the DBT - ATL, DBT 7-8. 8.2009Complex, New Delhi.

C. Anuradha A short course on in vitro techniques and 21-30.11.2009applications of molecular markers in banana andplantain, NRCB, Tiruchirapalli.

National Consultative Meeting on Disease 22-24.1.2010Diagnostics for Horticultural Crops, NRCB,Tiruchirapalli.

A training programme on Protein structure 15-19.2.2010prediction and docking, TNAU, Coimbatore

Brainstorming session on Application of 27&28. 3.2010Nanotechnology in Agricultural Sciences,CIFE, Mumbai

58

14 SEMINARS/ MEETINGS/ WORKSHOPS/

CONFERENCES/ SUMMER INSTITUTES ANDFARMERS TRAINING ORGANIZED AT THECENTRE

National Conference on BananaA National Conference on 'Production of

Healthy Planting Material in Banana' wasorganized by the Association for the Improvementin Production and Utilization of Banana (AIPUB)and National Research Centre for Banana (NRCB),Tiruchirapalli. The conference was hosted by M/sJain Irrigation Systems Ltd. (JISL), Jalgaon,Maharashtra. The conference was organized at JainHills, Jalgaon during 3-6 October, 2009. Theconference was participated by more than 450delegates representing research scientists,entrepreneurs, extension workers, farmers andgovernment officials from 10 banana growing statesin the country. Large number of representativesfrom tissue culture companies participated in thisconference.

The conference was started on 3rd morningwith welcome address to the guests and dignitariesby Shri Atul Jain, Director, JSIL. The OrganizingCommittee Chairman, Dr. M.M. Mustaffa explainedabout the activities of the AIPUB and also theobjective of this conference. Prof. Rony Swennen,KUL, Leuven, Belgium, who was the guest of honourof the inaugural function spoke about theimportance of germplasm and its need forconservation and storage for posterity. He alsoemphasized the importance pests and diseasesaffecting banana and more than Rs. 8,000 millionare lost, due to the pests and disease problems.Hence, there is a need to develop resistant varietiesagainst viral diseases and progress has been madethrough transgenic to develop resistant varieties.

The Inaugural address was given by Dr.H.P.Singh, DDG (Hort.), ICAR, the Chief Guest of

the function. In his address,he informed that Indiaproduces the maximumproduction but the qualityof the banana is poor and isnot suitable for exportmarket. In addition, due toimproper post harvest

Dr. H.P. Singh, DDG (Hort.) ICAR New Delhidelivering the inaugural address in the

Second National Conference on Banana

handling, the export is very negligible (0.01%). Butsmaller countries like Philippines are exporting tothe tune of 26%. In China and Philippinesinfrastructure facilities like conveyor belts,motorized cable, crates packing, trolley andrefrigerated vans have been developed for properhandling and storage of banana. Storage of bananaat 13°C, enhances the shelf life and also suitable forexport. Even though, there is a great potential forvalue addition, not much progress has been madein this aspect. The NRC Banana has developed morethan 15 value added products but the adoption ofvalue addition in very low in Maharashtra, in spiteof four universities are located in Maharashtra.There is a great scope for banana wafer (chips) tothe tune of Rs. 500 crores and also for banana winemaking. He also emphasized the importance ofglobal warming in banana production and drewthe attention of the farmers about the wide spreadoccurrence of Sigatoka leaf spot disease incidencein Jalgoan during 2008, which was not observedfive years back. Because of the global warming thebanana producing area may shift to subtropicalregion, which is at present not suitable for bananacultivation.

The Chief Guest of the function, Dr.H.P.Singhreleased two publications viz., Souvenir of the 2ndNational Conference and Abstract booklet. Dr.Singh conferred the 'Kadali Puraskar' Award for2009 to Prof. Rony Swennen, KUL, Leuven, Belgiumfor his contributions in banana germplasmconservation and cryo-preservation. Dr.D.P. Ray,VC-OUAT was also awarded the 'Kadali Puraskar'Award for his outstanding contributions for thedevelopment of horticulture and particularly forbanana in Orissa state.

Dr. H.P. Singh giving away " Kadali Puraskar" award toProf. Rony Swennen

Dr. M.M. Mustaffa,Chairman Organizing

Committee

NR

CB

Ann

ual

Rep

ort

2009

-'10

59

The Nalla Vazhai Award which recognizes thecontribution of entrepreneur, extension workers andbanana growers in production and utilization ofbanana was presented to Dr. Karianna, anentrepreneur and nursery man from Bangalore andShri A.P. Karuppaiah, a progressive farmer andentrepreneur from Chinnamanur, Theni Dist. fortheir significant contribution in adoption ofimproved production and post harvesttechnologies. A special Appreciation prize wasgiven to Mr. Nathar Meeran, Uthmapalayam, TheniDist. for his significant contribution in bananaproduction by adopting hi-tech productiontechnologies.

The Best Dissertation Award was conferred toDr. M.S. Saraswathi for her Ph. D. thesis work on'Morpho-molecular characterization and Markerbased screening for BSV integrants in B-genome richMusa germplasm'. On this occasion, the AIPUBconferred 'Fellow of AIPUB 2009' to Dr. Agustin B.Molina, Regional Coordinator, BAPNET,Philippines in-absentia for his life time contributionmade in banana research and development.

The 'Life Time Achievement Award' wasconferred upon Shri Bhawarlal H.Jain, Chairman,Jain Group of Companies, Jalgaon for hisoutstanding contribution and visionary leadershipto agriculture in general and banana cultivation inparticular. The second 'Life Time AchievementAward' was conferred upon to Dr. C.D. Mayee,Chairman, Agricultural Scientists RecruitmentBoard, New Delhi for his outstanding contributionto agriculture and education.

Dr. H.P.Singh was conferred 'Achievers Award'by the Banana Growing Association of India for hisoutstanding contribution to the horticultureespecially banana, which has improved thelivelihood of millions of people and has set a tonefor golden revolution in India.

In the Presidential address Shri. Bhawarlal Jainspoke about the role of Jain Irrigation in bananaproduction and the measures taken by the companyin the production of tissue culture plants which hasrevolutionized the production scenario of banana

Kissan MelaThe National Research Centre for Banana

(NRCB), Tiruchirapalli celebrated its 16thFoundation Day on 21. 8. 2009 organizing a'Brainstorming Meet' with a theme on 'Post-HarvestManagement including Handling, Storage andRipening of Bananas. The brainstorming sessionconsisted of eight technical sessions on pre- andpost-harvest management of banana produces, anexhibition, demonstration of post-harvestmanagement practices, field visit and an interactivesession. More than 200 banana farmers andentrepreneurs participated in the meet. Dr. H. P.Singh, Deputy Director General (Horticulture),ICAR, New Delhi was the Chief Guest and alsochaired the inaugural function. Dr. M. M. Mustaffa,Director, NRCB welcomed the gathering of bananafarmers and entrepreneurs.

In his presidential address, Dr. Singhcongratulated the farmers for making India as thenumber one country in production of banana andexhorted the farmers to adopt the technologiesdeveloped by the NRCB in managing the post-harvest stages of banana fruits to minimize the lossesdue to poor handling of bananas and to getmaximum return from banana cultivation. Anexhibition was also arranged including variousresearch institutes located in southern part of India,private fertilizers, pesticides, tissue culturecompanies other input agencies participated.

Dr. H.P. Singh receiving " Achievers Award "

in India, particularly in Maharashtra state.

At the end, Dr. P.Sundararaju, organizingSecretary proposed a vote of thanks to thedignitaries, participating farmers, delegates and allparticipants.

The Second National Conference on Bananawas concluded in the afternoon of 5th October, 2009with plenary session. The Session was chaired byDr. Mathura Rai, Director, IIVR, Varanasi. Dr. M.M.Mustaffa, Director-NRCB acted as the co chairman.Dr. P. Sundararaju, acted as convenor. Thechairman's of various committees presented therecommendations of various sessions.

Dr. H. P. Singh, DDG (Hort.), ICAR, New Delhi deliversinaugural address at the Brainstorming Meet

60

National Consultative Meeting on DiseaseDiagnostics for Horticulture Crops

A National consultative meeting on DiseaseDiagnostics for Horticulture Crops was held atNational Research Centre for Banana, Tiruchirapalli,Tamil Nadu, and India from January 22-24, 2010.The conference was organized jointly by NationalResearch Centre for Banana, Tiruchirapalli, TamilNadu and Indian Institute of Spice Research, Calicut,Kerala. Dr. H. P. Singh, Deputy Director-General(Horticulture) of the Indian Council of AgriculturalResearch inaugurated the event and released fourBanana virus diseases fact sheet and a book oftechnical papers. The meeting was presided by Dr.M. M. Mustaffa, Director, NRCB, Tiruchirapalli andDr. M. Anandaraj, Project Coordinator, Spices andDr. B.P. Singh, Joint Director, CPRI, Modipuram spokein the inaugural session.

The meeting was aimed at to take the stock ofmolecular diagnostics research activities in different

List of Trainings Offered

horticultural crops under NAR system and to identifythe future research needs on diagnostics for majordiseases of important horticultural crops. About 35leading scientists from various ICAR institutes andSAU's of NARS participated in the meeting. The threeday meeting had three major sessions tackling variousissues viz., 1) Current status, initiatives and uses ofdiagnostics, 2) Review of the work in the ongoingprojects on disease diagnostics and 3) Future needs.Twenty three lead papers were presented by invitedspeakers working on disease diagnostics in varioushorticultural crops. Diagnostic techniques developedby NRCB for four major banana viruses have widelybeen utilized for certification of TC plants underNational Certification System for Tissue Culture raisedplants. This programme has been implemented asstate of art model in India. Many such diagnostictechniques have also been developed for citrus, potato,tuber crops, spice, vegetables and ornamental crops.Road maps have also been developed for different virusdiagnostics and it was decided to augment theproduction of diagnostic kits so that the techniquewould be cost effective. These technologies would becommercialized for adoption widely in the tissueculture and seed industries for the production ofquality planting material in many horticultural crops.

ICAR sponsored short course on In vitrotechniques and application of molecular markersin banana and plantains was organized in the CropImprovement Division during 21-30, Nov. 2009 withDr.S. Uma as Course Director and Dr.M.S.Saraswathi and Dr.S. Backiyarani as Coursecoordinators.

Sl.No. Topic Date Participants

01 Improved production technology including 20-27.7.2009 Keralapost harvest management and valueaddition in banana

02 Short-term training programmes on 20-27.7.2009 All StatesPreparation of Value Added Products frombanana

03 Recent Advances in Production and Post 21-24.10.2009 Tripura.Harvest Technology of banana

04 Improved production technology including 26-30.10.2009 Assampost harvest management and valueaddition in banana

05 Improved cultivation Practices and Post 23-28.11.2009 BiharHarvest Technology in Banana

06 A short course on productions of Value 04-11.1.2010 Tamil Naduadded products from banana

07 Improved production technology including 08-13.2.2010 Madhyapost harvest management and value Pradeshaddition in banana

08 Banana Processing and Value Addition- 27&28.3.2010 All StatesEntrepreneur to Enterprise

Dr. H. P. Singh, DDG (Hort.), delivering the inauguraladdresss in the National consultative meeting on DiseaseDiagnostics for Horticulture Crops

NR

CB

Ann

ual

Rep

ort

2009

-'10

61

1 5 DISTINGUISHED VISITORS

Sl. No. Name & Address Date

1. Dr. R. Shankar, Prof. & Head Dept. of Sociology,Bharathidasan University, Tiruchirapalli. 25.4.2009

2. Dr. N. Jayabalan, , Prof. & Head, School of Plant Science,Bharathidasan University, Tiruchirapalli. 25.4.2009

3. Dr. C. Devakumar, Principal Scientist, IARI, New Delhi 5.6.20094. Dr. H. P. Singh, DDG (Hort), ICAR, New Delhi 13.7.20095. Dr. H. P. Singh, DDG (Hort), ICAR, New Delhi. 21.8.20096. Dr. G.V. Thomas, Director, CPCRI, Kasaragod, Kerala. 21.8. 20097. Dr. M. Kochubabu, Director, DOR, Pedavegi, AP. 21.8. 20098. Dr. S. K. Naskar, Director, CTCRI, Tiruvandram, Kerala. 21.8. 20099. Dr. M. J. Modayil, Member, ASRB, ICAR, New Delhi . 02.9.200910. Dr. A. Karmugilan, Director of Seed Certification, Coimbatore. 17.12.200911. Dr. N.K. Tyagi, Member, ASRB, New Delhi. 18.12.200912. Shri. Rajaram IAS, Managing Director - TANCEN, Chennai 22.10.200913. Dr. M. Anandaraj, Project Coordinator, Spices . 22.1.201014. Dr. B.P. Singh, Joint Director, CPRI, Modipuram. 22.1.201015 Dr. H. P. Singh, DDG (Hort), ICAR, New Delhi 24.1.2010

Farmers visitMore than 3825 banana farmers, Agricultural & Horticultural Officers, Self Help Group members and

students visited the Centre.

Dr. H. P. Singh, DDG (Hort.), ICAR, New Delhi reviewingthe progress of research works with the Director andScientists of the Centre on 13.7.2009

Dr. M. J. Modayil, Member, ASRB, New Delhi visitingPHT laboratory of the Centre on 02.9.2009

Horticultural Officers from various districts ofTamil Nadu visited NRCB for one day training programme

Banana Farmers from Theni District, Tamil Nadu on oneday Training programme

62

1 6 EMPOWERMENT OF WOMEN

More than 350 women students studying inHorticulture, Agriculture, Microbiology,Biotechnology and Veterinary from Universities andcolleges located in different places visited NRCBand learned about NRCB activities.

During foundation day celebration Ms.Andalof Kuzhumani was honoured for her contributionsin Banana value addition and manufacture ofhandicrafts items from banana fiber.

Six self-help group comprising 250 womenparticipated in one day training programme onBanana value added products and fiber extraction

1 7 PERSONNEL

Scientific Staff

Dr. M. M.Mustaffa Director

Dr. P. Sundararaju Principal Scientist

Dr. B. Padmanaban Principal Scientist

Dr. S. Uma Principal Scientist

Dr. V. Pandey Principal Scientist (from 11.5.2009)

Dr. I. Ravi Senior Scientist

Dr. R. Thangavelu Senior Scientist

Dr. R. Selvarajan Senior Scientist

Dr. V. Kumar Senior Scientist

Dr. M. Mayil Vaganan Senior Scientist

Dr. K. J. Jeyabaskaran Senior Scientist

Dr. S. Backiyarani Senior Scientist

Dr. M. S. Saraswathi Scientist (Sr. Scale)

Mr. R. Natarajan Scientist

Dr. C. Anuradha Scientist (from 18.6.2009)

Name Designation

Women Self help groups visited NRCB TrainingProgramme on Value Added Banana Products

Appointments1. Dr. Vikramaditya Pandey joined as Principal

Scientist (Hort.) from Indian Institute ofHorticulture Research (Regional Station)Bhuvaneshwar w. e. f. 11. 5. 2009.

2. Dr. C. Anuradha has been appointed asScientist (Plant Biotechnology) w. e. f. 18. 6.2009

Promotions1. Mr. D. Ramachandramurthi, T-3, Technical

Assistant (Civil Overseer) promoted to T4 w.e. f.,11.8.2008.

2. Dr. S. Backiyarani, Senior Scientist cleared herprobation w.e.f .,29.8.2009.

3. Mr. R. Mohanraj, SSG-III (Supporting Staff)promoted to SS-IV, w. e. f., 6.1.2010

NR

CB

Ann

ual

Rep

ort

2009

-'10

63

Technical Staff

Mr. S. Palanichamy T-5 Technical Officer

Mr. P. Durai T-5 Technical Officer

Mr. P. Ravichamy T-4 Tech. Asst. (Journalism)

Mrs. T. Anitha Sree T-4 Lab. Technician

Mrs. C. Sagayam Jacqueline T-4 Computer Programmer

Mr. D. Ramachandramurthi T-3 Civil Overseer

Mr. R. Pitchaimuthu T-3 Field Technician

Mr. N. Marimuthu T-3 Field Technician

Mr. V. Selvaraj T-3 Lab. Technician

Mr. T. Sekar T-3 Lab. Technician

Mr. K. Kamaraju T-3 Lab. Technician

Mr. A. Subramanian T-2 Driver

Mr. P. Mohan T-2 Tractor Driver

Mr. V. Manoharan T-2 Driver

Name Designation

Administrative, Audit & Accounts and Supporting Staff

Administrative, Audit and Accounts

Mr. B. Vijayakumar Asst. Administratative Officer

Mrs. C.Gomathi Asst. Fin. & Ac. Officer

Mr. M. Krishnamoorthy Per. Asst. to Director

Mr. R. Krishnamurthy Assistant

Mr. R. Neela Mega Shyamala Kannan Steno Gr. III

Mr. R. Sridhar Steno Gr. III

Mrs. S. Durgavathy Upper Division Clerk

Mr. M. Devarajan Lower Division Clerk

Supporting

Mr. R. Mohanraj Mali SSG-III

Mr. V. Pandiyan Mali SSG-III

Mr. V. Thangaraju Messenger SSG-II

Mr. P. Kamaraj Mali SSG-II

Mr. V. Ganesan Mali SSG-I

Mr. C. Kumaran Mazdoor SSG-I

Mrs. K. Mariammal Safaiwala SSG-I

Name Designation

64

Hindi Week

The Hindi Week was observed from 23 - 29, September 2009. Various competitions such as reading,writing, speaking, translation from Hindi to English and vice versa and elocution were held during theperiod. Hindi week meeting was celebrated on 29.9.2009, wherein Mr. S. Chandrasekaran, Secretary-OLIC,Southern Railway, Tiruchirapalli Zone was the Chief Guest and Dr. M.M. Mustaffa, Director, NRCB presidedover the function. In his speech, Mr. Chandrasekaran has observed that as an Indian national, one shouldlearn Hindi as it is spoken more or less throughout the country. He also emphasized that knowledge ofHindi has personal advantage in addition to official benefit. Finally, the Chief Guest distributed the pricesto the winners of various competitions held in Hindi.

18 OTHER INFORMATIONS

NR

CB

Ann

ual

Rep

ort

2009

-'10

65

ANNEXURE - I

List of On-going Institute Projects

I. Crop Improvement1. 2000711002 : Crop improvement of banana through conventional breeding

M.M. Mustaffa

2. 2000711003 : Crop improvement of banana through non-conventionalbreedingS. Uma

3. 2000711004 : Improvement and management of banana genetic resourcesin Indian subcontinentS. Uma

4. 2000711005 : Identification and characterization of nematode resistancegenes in bananaS. Backiyarani

5. 2000711006 : Improvement of Rasthali through induced mutagenesisM.S. Saraswathi

II. Crop production6. 2000713001 : Standardization of agro-techniques for banana production

and productivityV. Kumar

7. 2000713004 : Studies on micronutrients in bananaK.J. Jeyabaskaran

8. 2000713006 : Fertilizer tailoring for targeted banana yield and sustainablesoil healthK.J. Jeyabaskaran

9. 2000716001 : Studies on physiology of flowering and fruit development inbananaI. Ravi

10. 2000716002 : Salt stress tolerance in banana: Understanding thephysiological, biochemical and molecular mechanism of salttoleranceI. Ravi

11. 2000716003 : Drought stress tolerance in banana: Understanding thephysiological, biochemical and molecular mechanism ofdrought toleranceI. Ravi

12. 2000716004 : Physiological and biochemical mechanism of nematodes andpseudostem weevil resistance and identification of 'biomarkermetabolites' in bananaM. Mayil Vaganan

III. Crop Protection13. 2000715006 : Management of Banana weevils

B. Padmanaban

14. 2000715002 : Studies on banana nematodes and their managementP. Sundararaju

15. 2000715003 : Investigation on fungal and bacterial diseases of banana andtheir managementR. Thangavelu

66

ANNEXURE – II

Meteorological Data

April 2007 36.7 25.0 85.0 -

May 2007 38.1 25.3 77.2 17.8

June 2007 38.3 26.2 75.6 -

July 2007 37.6 26.6 75.5 -

August 2007 36.5 26.4 79.4 58

September 2007 35.1 25.1 78.8 -

October 2007 35.1 24.8 89.1 -

November 2007 30.8 23.6 81.5 239

December 2007 28.1 22.6 91.3 57

January 2008 29.4 20.0 89.8 -

February 2008 33.8 21.7 87.2 -

March 2008 36.3 24.1 88.5 -

RelativeHumidity (%)Month Max. Temp.

(oC) Min. Temp.(oC) Rain Fall(mm)

16. 2000715005 : Studies on viral diseases of banana and their managementR. Selvarajan

17. 2000715007 : Host-virus interactions in Banana: Molecular mechanismsof resistance and susceptibility, latency, integration andepisomal expression of EPRV'sR. Selvarajan