PT-Agro(2009) - Michigan State University2009).pdf · 4 fAgrobacterium tumefaciens- or...
Transcript of PT-Agro(2009) - Michigan State University2009).pdf · 4 fAgrobacterium tumefaciens- or...
CSS/HRT 451 CSS/HRT 451 CSS/HRT 451 CSS451
Agrobacterium-mediated transformation
Guo-qing Song & David Douches
2
Learning Objectives
• Understand what key changes had to be made to the Agro Ti plasmid for the experiment transfer of novel genes into plants
• Understand the binary plasmid transformation system
• Understand some mechanisms of gene transfer
3
Agrobacterium Tumefaciens & Crown Gall Disease
MechanismMechanism of of Gene Transfer using Gene Transfer using AgrobacteriumAgrobacterium
Engineering binary vectors for plant transformation Engineering binary vectors for plant transformation
Transformation protocols using Transformation protocols using AgrobacteriumAgrobacterium
Factors influencing transformation efficiencyFactors influencing transformation efficiency
OUTLINECSS451
Ti-plasmidChromosomal and Vir GenesT-DNA TransferT-DNA Integration
4
Agrobacterium tumefaciens- or Agrobacteriumrhizogenes-mediated transformation is to date the most commonly used method for obtaining transgenic plants.
The tumorigenic host plant species for range A. tumefaciens include: Large number of dicots and some monocots and Gymnosperms.
Agrobacteria are naturally occurring, ubiquitous soil bornepathogens.A. tumefaciens causes crown gall disease (tumors)A. rhizogenes causes root hair disease (hairy root)Other bacterial groups also contain species capable of
interkingdom genetic exchange (Gelvin 2005).
CSS451
Why Agrobacterium?
6Stanton B. Gelvin. Nature 433: 583-584 (2005).
A.Tumefaciens & Crown Gall DiseaseA.Tumefaciens & Crown Gall Disease
http://arabidopsis.info/students/agrobacterium/
CSS451
7
Right and left border (RB, LB) sequences are the only parts of T-DNA needed to enable transfer into plants-removal of other T-DNA genes creates a disarmed plants.
GGCAGGATATTCAATTGTAAAT
GGCAGGATATTCAATTGTAAAT
Left T-DNA border
Right T-DNA border
Gene Transfer using Gene Transfer using AgrobacteriumAgrobacteriumTiTi--plasmidplasmid
8
AgropineAgropine--typetype (strain EHA105::pEHA105): (strain EHA105::pEHA105): Carry genes for agropine synthesis and catabolism. Tumors do not differentiate and die out.
OctopineOctopine--typetype (strain LBA4404::pAL4404):(strain LBA4404::pAL4404):Carry genes(3 required) to synthesize octopine in the plant and catabolism in the bacteria. Tumors do not differentiate, but remain as callus tissue.
NopalineNopaline--typetype (strain GV3101::pMP90 (pTiC58)):(strain GV3101::pMP90 (pTiC58)):Carry gene for synthesizing nopaline in the plant and for utilization (catabolism) in the bacteria. Tumors can differentiate into shooty masses (teratomas).
Gene Transfer using Gene Transfer using AgrobacteriumAgrobacterium
Agro typesAgro typesHellens et al (2000; Trends in Plant Science 5:446-451)
9
Gene Transfer using Gene Transfer using AgrobacteriumAgrobacterium
Agro typesAgro types
LBA4404: rifampicin (chromosomal) and streptomycin (on the Ti plasmid)
EHA105:rifampicin (chromosomal) and streptomycin (on the Ti plasmid)
GV3101: streptomycin 500 mg/l
Hellens et al (2000; Trends in Plant Science 5:446-451)
10
Chemoreceptor, activator of vir G Transmembrane complexHost-range specificitySite-specific endonucleaseT-DNA processing and protectionHost range specificityPositive regulator of vir B, C, D, E, F
Virulence genesvir Avir Bvir Cvir Dvir Evir Fvir G
Attachment to plant cell, vir gene regulationChromosomal genes
Chromosomal and vir genes of bacterial cells are both involved in T-DNA transfer
Gene Transfer using Gene Transfer using AgrobacteriumAgrobacteriumCSS451
Chromosomal and and VirVir GenesGenes
11
LB RBauxin cytokin opine
vir genes ori opine catabolism
T-DNA
Oncogenic genes
Disarmed TiDisarmed Ti--plasmidplasmid
14From Dr. S. From Dr. S. GelvinGelvin, , PurguePurgue UniversityUniversity
KmR
Bacterial selectable marker
Plant selectable marker
A Binary Vector MapA Binary Vector Map
15
Introduction of Binary Vector into AgroIntroduction of Binary Vector into Agro
Agrobacterium
ElectroporationElectroporationFreeze/ThawFreeze/ThawTriparentalTriparental MatingMating
Competent Agrobacterial CellsWise et al., 2006, Wise et al., 2006, AgrobacteriumAgrobacterium ProtocolsProtocols
16
ElectroporationElectroporation
Freeze/ThawFreeze/Thaw
Liquid nitrogen (196C) 3 minLiquid nitrogen (196C) 3 min--------37C 30 min37C 30 min
Introduction of Binary Vector into AgroIntroduction of Binary Vector into Agro
17
Binary Vector SystemBinary Vector System
Binary VectorBinary Vector
Binary Vector SystemBinary Vector System
Ti Helper PlasmidTi Helper Plasmid
Agro only Agro/E. Coli
19
Agro culture
Introduction of Binary Vector into AgroIntroduction of Binary Vector into Agro
Agro colonies
Agro stock(-80C with Glycerol)
20Stanton B. Gelvin. Nature 433: 583-584 (2005)
MechanismMechanism of Gene Transfer using of Gene Transfer using AgrobacteriumAgrobacterium
Passage of T-DNA from Agrobacterium cells into plant genomic DNA
CSS451
External Signals such as
Acetosyringone
►
21
Chromosomal and vir genes of bacterial cells are both involved in T-DNA transfer
The plant cell step of T-DNA transfer is poorly understood
► Entry into plant cell?
► Nuclear uptake?
► Integration into chromosome?
MechanismMechanism of of Gene Transfer using Gene Transfer using AgrobacteriumAgrobacterium------------ The Plant Cell StepThe Plant Cell Step
►►
►
CSS451
23
Regulatory Elements
Where When How much
GoSTOP
Transcription
Translation
mRNA
Protein
Promoter Gene Terminator
External Signal
Cell Receptor
Expression of the Expression of the TransgeneTransgeneCSS451
Constitutive promoters: CaMV35S, Actin, Ubi
Inducible prompters: rbcS
Tissue specific promoters: Cab
a stop codon (or termination codon): UAG (in RNA) / TAG (in DNA) ("amber"), UAA / TAA ("ochre"), and UGA / TGA ("opal" or "umber"
24
1. Agrobacteria attach to plant cell surfaces at wound sites. 2. The plant releases wound signal compounds, such as acetosyringone. 3. Vir C and/or Vir F recognize the host plant cells. 4. The signal binds to vir A on the Agrobacterium membrane. 5. Vir A with signal bound activates vir G. 6. Activated vir G turns on other vir genes, including vir D and E. 7. Vir D cuts at a specific site in the Ti plasmid (tumor-inducing), the left
order. 8. Single stranded T-DNA is bound by vir E product as the DNA unwinds
from the vir D cut site. Binding and unwinding stop at the right border. 9. Vir B + T-DNA complex is transferred to the plant cell, where it
integrates in nuclear DNA.
Zhu et al. Journal of Bacteriology (2000)
Summary: T-DNA transferSummary: TSummary: T--DNA transferDNA transferCSS451
T-DNA codes for proteins that produce hormones and opines. Hormonesencourage growth of the transformed plant tissue. Opines feed bacteria a carbon and nitrogen source.
25
Agrobacterium PreparationAgrobacterium Preparation
Temperature: 30C Medium: LB, YEB, or YEPAntibiotic: Km or based on the SMG in the vector. Time: 24-48 hr.Concentration: O.D.600=0.5-1.0
Streak the plateTemperature: 30C Medium: LB Antibiotic: Km vector. Time: 2-3 days.
Agro-transformation
26
Inoculation
Selection and regeneration
1
2
3
Re-growth
Molecular verification of gene presence & expression
Flowering and setting seeds 6
CSS451
Agrobacterium Protocols---TransformationAgrobacterium Protocols---Transformation
Co-cultivation
4
5
Tobacco Rice Tobacco Rice
PCR
SouthernBlot
27
Zhang et al. Nature Protocols 1(2) (2006)
The Floral Dip Method
Infection
Co-cultivation
A good stage for floral dipping
Agrobacterium-mediated transformation of Arabidopsis thaliana using the floral dip method
Seed setting Harvest seeds Selection
CSS451
28
Objectives:• To get familiar with A. tumefaciens-mediated transformation,
such as explants, T-DNA, infection, co-cultivation, selection, binary vector, right border and left border, selectable marker gene (SMG), markers for screening, regeneration, antibiotics, and etc.
• To understand the differences between the wild-type T-DNA and the disarmed T-DNA.
Experiment 2: Tobacco Transformation
29LBA 4404 with the Ach5 chromosomal background exhibits clumping
NOS-pro NPT II (KanR) NOS-ter 35S-pro GUS NOS-ter
pBI121
Experiment 2: Tobacco Transformation CSS451
Agro strains: LBA4404:pBI121 & ACH5
1. LBA4404 has the Ach5 chromosomal background
2. ACH5 (pTiAch5---a wild-type octopine plasmid)
3. LBA4404 (pAL4404---a disarmed octopine plasmid)
30
CSS451
Experiment 2
Plant materials: Tobacco cv. Samsun
• Sterile seedling was maintained in Magenta box GA7 containing 50 ml MS medium.• Subcuture cy cutting the internodes.• Culture conditions: 25C, 16 h-photoperiod, 35-50 µE m-2s-1.
Seedling
Mature seeds harvested from wild type tobacco plant cv. Samsun1. Surface sterilization (50% clorox + 0.02% Tween 20, 15 min; 4 washes in sterile water).
2. Seed germination on MS medium.
PlantSeed germinationSeeds
31
1
2
3 1. Selection medium: RM + 100 mg/l Km + 500 mg/l Tn
2. Subculture: every 3 wk
Selection and regeneration
1. Co-cultivation medium: RM2. Co-cultivation time: 2-4 d 3. Environmental conditions: in the dark4. Ac: 100 µM
Co-cultivation2-3 d A. tumefaciens5 d S. meliloti5 d M. loti5-11Rhizobium sp. NGR234
1. Agro concentration: O.D.600 = 0.5-0.8.2. Infection time: 10-15 min.3. Infection medium: Regeneration medium (RM)4. Acetosyringone (Ac): 100 µM
Inoculation
1. Explant size: 0.5-0.8 cm X 0.5-0.8 cm.2. To prepare the explants using sterile techniques. 3. Do not let the explants too dry.
Explant preparation
Experiment 2
32
CSS451
1. Selection medium: RM + 100 mg/l Km + 500 mg/l Tn2. Subculture: every 3 wk
Selection and regeneration
1. Co-cultivation medium: RM2. Co-cultivation time: 2-4 d 3. Environmental conditions: in the dark4. Ac: 100 µM
Co-cultivation2-3 d A. tumefaciens5 d S. meliloti5 d M. loti5-11Rhizobium sp. NGR234
1. Agro concentration: O.D.600 = 0.5-0.8.2. Infection time: 10-15 min.3. Infection medium: Regeneration medium (RM)4. Acetosyringone (Ac): 100 µM
Inoculation
1. Segments from hypocotyl, cotyledons, epicotyl, leaf, internodes and petiole (Dicot)
2. Embryogenic calluses (Monocot)3. Well developed regeneration system via either
organogenesis or somatic embryogenesis
Explant preparation