prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF...
Transcript of prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF...
![Page 1: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/1.jpg)
![Page 2: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/2.jpg)
![Page 3: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/3.jpg)
![Page 4: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/4.jpg)
![Page 5: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/5.jpg)
![Page 6: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/6.jpg)
![Page 7: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/7.jpg)
![Page 8: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/8.jpg)
![Page 9: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/9.jpg)
![Page 10: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/10.jpg)
![Page 11: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/11.jpg)
i
GENETICS OF LEARNING
DISABILITIES
By
SYEDA MARRIAM BAKHTIAR
School of Biotechnology,
National Institute for Biotechnology and Genetic Engineering
(NIBGE), Faisalabad
&
Quaid-i-Azam University, Islamabad, Pakistan
2014
![Page 12: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/12.jpg)
ii
Genetics of Learning
Disability
A dissertation submitted for partial fulfillment of the degree of
DOCTOR OF PHILOSOPHY
IN
BIOTECHNOLOGY
By
Syeda Marriam Bakhtiar
School of Biotechnology,
National Institute for Biotechnology and Genetic Engineering (NIBGE),
Faisalabad
&
Quaid-i-Azam University, Islamabad, Pakistan
2014
![Page 13: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/13.jpg)
iii
DECLARATION
I hereby declare that the work presented in the following thesis is my own effort,
except where otherwise acknowledged, and that the thesis is my own composition.
No part of this thesis has been previously presented for any other degree.
Syeda Marriam Bakhtiar
![Page 14: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/14.jpg)
iv
Dedicated to
TO MY FAMILY
Who offered me unconditional love and support throughout the course of
this thesis. Specially to my Father, who taught me that the best kind of
knowledge to have is that which is learned for its own sake, and to my
Mother, who taught me that even the largest task can be accomplished if it is
done one step at a time. And to all those - who knowingly and
unknowingly- led me to an understanding of some of the more subtle
challenges to our ability to thrive.
![Page 15: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/15.jpg)
v
Use it …… to understand more about disease, prevent genetic diseases
coming into existence and possibly finding a way to cure them
J D Watson
![Page 16: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/16.jpg)
vi
![Page 17: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/17.jpg)
vii
![Page 18: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/18.jpg)
viii
TABLE OF CONTENTS
1
1.1
1.2
1.3
1.4
1.5
1.6
1.7
1.8
2
2.1
2.2
2.3
2.4
2.5
2.6
2.7
3
3.1
3.2
Acknowledgments………………………………………………………………… X
List of tables ………………………………………………………………………… XII
List of figures………………………………………………………………………… XIV
List of abbreviations………………………………………………………………XVII
Abstract……………………………………………………………………………… .XIX
INTRODUCTION
Characteristics of Pakistani Population ……………….………………..
Genetic disorders and analysis techniques ………………………..…..
Learning disability ……………………………………………………….………
Stuttering…………………………………………………………………………….
Microcephaly……………………………………………………………………….
ASPM ………………………………………………………………………………..…
Dyslexia……………………………………………………………………………….
Objectives of the study……………………………………………….………..
MATERIALS AND METHODS
Family Identification and data collection……………………………….
Genomic DNA extraction..............................................................................38
Karyotyping.......................................................................................................39
Linkage Analysis..............................................................................................40
Mutation Analysis…………………………………………………………………
Genome wide screening (SNP6)…………………………………………….
Taqman Copy Number Assay………………………………………………..
RESULTS AND DISCUSSIONS
Family A………………………………………………………..…………………….
Family B………………………………………………………………………………
![Page 19: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/19.jpg)
ix
3.3
3.4
3.5
3.6
4
Family C …………………………………………………………………………… ……..
Family D……………………………………………………………………………………
Family E……………………………………………………………………………………
Family F and Family G………………………………………………………… …….
REFERENCES …………………………………………………………………………
![Page 20: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/20.jpg)
x
ACKNOWLEDGEMENTS
All the praises be to Almighty Allah, who is merciful, gracious, and whose bountiful
blessings enabled me to persuade higher ideals of life and bestowed upon me bodily
potential and mental faculties. All regards and respects to the Holy Prophet Mohammad
PBUH for enabling us to recognize our creator and guiding mankind towards the
straight path of life.
I would like to express my deep and sincere gratitude to my Supervisor, Dr. Shahid
Mahmood Baig, Head of Health Biotechnology Division (HBD) and Group Leader
Human Molecular Genetics Laboratory, National Institute for Biotechnology and
Genetic Engineering (NIBGE) Faislabad. His wide knowledge and logical way of
thinking have been of great value for me. His understanding, encouragement and
personal guidance have provided a good basis for the present thesis.
I owe my most sincere gratitude to Prof. Niels Tommerup, who gave me the opportunity
to work in the Wilhelm Johansen Center (WJC) for Functional Genomics, PANUM
Institute, Copenhagen University, Copenhagen, Denmark, and also for his valuable
advice, discussions and guidance. I am deeply grateful to Prof. Lars Hansen for his
detailed and constructive comments, and for his important support throughout this
work at WJC. I would like to thank Prof. Klaus W Kjaer for his importatnt input and
very useful discussions for this study at WJC.
I am grateful to Dr. Zafar .Mehmood Khalid, Director NIBGE, for providing me the
opportunity to work in the Institute and for supportive cooperation. My sincere thanks
to Dr. Fazli Rabbi Awan, Senior Scientist HBD for his support and cooperation. Special
thanks to Mr. Naveed Altaf Malik , Senior Scientist, HBD, for his friendly moral support.
My warm thanks are due to Professor Dr. Fayyaz Chaudary, Ex-Dean Department of
Biological Sciences, Quaid-i-Azam University (QAU), and Professor Dr. Abdul Hameed,
Dean Department of Biological Sciences, QAU for their kind support and cooperation
throughout this study.
![Page 21: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/21.jpg)
xi
I am deeply indebted to my seniors Dr. Farooq Muhammad, Dr Mahmood Rasool , Dr.
Sadia Nawaz, Dr. Iram Anjum and Aysha Azhar for devoting their precious time to solve
my problems during different stages of research . I am thankful to my colleagues
especially , Shoaib ur Rehman, Ilyas Ahmed and Muhammad Tariq for their friendly
behavior, support and cooperation throughout this study. Cordial thanks to Usman
Raza, Scientific Assistant, and my juniors Lab fellows Tahir, Jamil and Ambrin, for their
help and support.
Special thanks to my friends both in QAU and NIBGE, Hina Naseem, Mehreen Aun,
Sarmad, Fozia, Maryam, Tehmeena, Sadia, Nosheen and Farzana for providing me moral
support. I take this opportunity to thank my fellows and friends in Denmark who made
my stay there memorable and pleasurable
Last but not least I am grateful to my loving family who always prayed for me and
helped during the course of this work. I cannot find any words which can express
thanks to my parents whose prayers carved my way to success. It is a pleasure to thank
those who made this thesis possible especially my siblings Luqman, Arooj and Sahar as
their encouragement and support from the begining to the final level enabled me to
complete this task. Thanks to my husband Amjad Ali who provided me any sort of
support whenever required during this study.
May Allah almighty bless all of them and grant me strength to attain the level of their
expectations from me.
Syeda Marriam Bakhtiar
![Page 22: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/22.jpg)
xii
LIST OF TABLES
Table 1 Loci reported for Familial stuttering..........................................14
Table 2 Loci reported for autosomal recessive primary
microcephaly (MCPH)................................................................20
Table 3 Loci reported for Dyslexia............................................................24
Table 4 Standard solutions used in DNA extracti.....................................39
Table 5 Composition of Master mix used for P........................................41
Table 6 Thermal cycling conditions used for PCR..................................41
Table 7 Primers’ sequences of microsatellite markers used
for stuttering and microcephaly..................................................42
Table 8 Sequencing primers for ASPM..................................................46
Table 9 Sequencing primers for SOX3...................................................48
Table 10 Sequencing primers for ARX3 poly A repeats........................48
Table 11 Sequencing primers for GPRASP2............................................48
Table 12 Composition of Master mix used for PCR..............................49
Table 13 Thermal cycling conditions for sequencing amplification…49
Table 14 Composition of Exo-SAP treatment.........................................50
Table 15 Master mix for sequencing PCR................................................50
![Page 23: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/23.jpg)
xiii
Table 16 Thermal cycling conditions used for sequencing....................51
Table 17 Taqman Copy Number Assay reaction mix for
real time PCR.............................................................................53
Table 18 Settings for real time PCR used in Taqman assay..................54
Table 19 Settings for Taqman Copy Number assay................................54
Table 20 Settings for Taqman Copy Number Reference Assay............54
Table 21 Parameters for real time PCR instrument..................................55
Table 22 List of genes present at 18p11.32-p11.31..................................77
Table 23 Candidate Homozygous regions found in Family G
after SNP6 analysis.....................................................................80
Table 24 List of candidate genes present in 2p12 homozygous
region in Family F .....................................................................81
Table 25 Positions of candidate regions reported on
short arm of chromosome 2 for dyslexia ................................82
![Page 24: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/24.jpg)
xiv
LIST OF FIGURES
Figure 1 Anatomy of Human Brain..............................................................9
Figure 2 Interspecies comparison of the predicted
abnormal spindle protein..............................................................22
Figure 3 Pedigree of Family A with autosomal recessive
primary microcephaly...................................................................28
Figure 4 Pedigree of Family B with autosomal recessive
primary microcephaly...................................................................29
Figure 5 Pedigree of Family C with autosomal recessive
primary microcephaly...................................................................30
Figure 6 Pedigree of Family D with autosomal recessive
primary microcephaly...................................................................32
Figure 7 Pedigree of Family E indicating X-linked stuttering .................34
Figure 8 Pedigree of Family F with autosomal recessive dyslexia.........36
Figure 9 Pedigree of Family G with autosomal recessive dyslexia.........37
Figure 10 Representative DNA sequence chromatogram from
Family A. .....................................................................................57
Figure 11 Representative DNA sequence chromatogram from
Family B. .....................................................................................58
![Page 25: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/25.jpg)
xv
Figure 12 Representative DNA sequence chromatogram from
Family C. ...................................................................................59
Figure 13 Graphical representation of the MCPH5 locus.q31.3
at chromosome 1........................................................................61
Figure 14 Analysis of copy numbers by Taqman probe assay..............62
Figure 15 Analysis of two Taqman probes Hs03084432 and
Hs03084882.................................................................................63
Figure 16 A) Position of deletion on chromosome1. B) position
of deletion with respect to ASPM. C) SNPs and CNVs
indicating the borders of the deletion. D) CNVs at the
left border of the deletion. E) SNPs at the right border
of the deletion. F) primers’ position designed for
breakpoint mapping......................................................................65
Figure 17 Window of UCSC genome browser indicating
two candidate regulatory regions present in the
deleted fragment..........................................................................66
Figure 18 Loop back hypothesis for enhancer element and
binding to ASPM promoter........................................................68
Figure 19 Gene network for lysosomal protein.........................................70
![Page 26: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/26.jpg)
xvi
Figure 20 Position of candidate genes and markers on
X-chromosome...............................................................................71
Figure 21 Pedigree of Family E segregating X-Linked recessive
form of familial stuttering.. ...........................................................72
Figure 22 Graphical representation of results of Affymetrix SNP6 .......71
Figure 23 Graphical representation of results of Affymetrix SNP6
analyzed by Chromosome analysis suit indicating
homozygous regions on chromosome 18 ...................................75
Figure 24 Window of UCSC genome browser indicating
candidate region revealed by autozygosity mapping
in Family E....................................................................................77
Figure 25 Karyogram of affected individual from the
family F indicating normal karyotype.........................................79
Figure 26 Karyogram of affected individual from the
family G indicating normal karyotype.........................................79
Figure 27 Graphical representation of results of Affymetrix
SNP6 analyzed by Chromosome analysis suit
indicating homozygous regions on chromosome 2....................81
![Page 27: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/27.jpg)
xvii
LIST OF ABBREVIATIONS
ADHD Attention Deficit Hyperactivity disorder
ASPM Abnormal Spindle like microcephaly associated genes
bp Base pairs
cM Centi Morgan
CNVs Copy Number Variations
CSF Cereberospinal fluid
DNA Deoxyribonucleotide acid
dNTPs Deoxy nucleotide triphosphates
EDTA Ethylene diamine tetra acetate
EST Expressed sequence tag
HC Head circumference
Kb Kilo bases
KDa Kilo Daktons
LD Learning Disability
LOD Logarithm of odds ratio
MCPH Primary Microcephaly
Mg Milligram
MIM Mendelian Inheritance in Man
ml Milliliter
mM Millimolar
mRNA Messenger Ribonucleic Acid
MRI Magnetic Resonance imaging
![Page 28: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/28.jpg)
xviii
ng Nanogram
NJCLD National Joint Committee on Learning Disability
NMR Nuclear Magnetic Resonance
OFC Occipital Frontal Head Circumference
PCR Polymerase Chain Reaction
pH potential of Hydrogen Ion
RNA Ribonuclease acid
RPM Revolution per minutes
SD Standard Deviation
SNP Single Nucleotide Polymorphism
STG Superior Temporal Gyrus
STRs Short Tandem Repeats
SLI Specific language Impairment
STG Superior Temporal Gyrus
UV Ultra Violet
VNTRs Variable Number of Tandem Repeats
°C Degree centigrade
µl Microlitre
µM Micromole
θ Theta (Recombination fraction)
![Page 29: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/29.jpg)
xix
ABSTRACT
Learning disability also referred as learning disorder or learning difficulty, is a
classification characterized mainly by the person’s difficulty in learning and
meeting milestones resulting in diverse etiology and patho-physiology. These
disorders can make it difficult for a person to learn quickly or in the same manner
as someone who is not affected by a learning disability. Usually these disorders
are outcome of defects in brain’s ability to receive and process information.
People with a learning disability have trouble performing specific skills or
completing tasks if left to figure things out by themselves or if taught in
conventional ways. Learning disabilities tends to run in families; therefore
genetics is believed to be one of the culprits. However, the form of learning
disability in parents may appear slightly different in child. A parent who has a
writing disorder may have a child with an expressive language disorder which
indicates that there may not be a direct link, but a general brain dysfunction may
be inherited.
The objective of the present study was to identify and characterize genetic
mutations responsible for various forms of learning disabilities which will enable
many families to get more appropriate diagnostic investigations and the possibility
of understanding the cause of disability in the child. In this study a total of 35
inbred families were identified and sampled from various regions of Pakistan
suffering with range of learning disabilities including microcephaly (20 families),
dyslexia (14 families) and stuttering (1 family). All analyzed families were
consanguineous and of Pakistani origin. For the identification of key genetic
variants in families suffering with learning disability linkage analysis, genome
![Page 30: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/30.jpg)
xx
wide SNP analysis and copy number variation were performed, which lead to the
characterization of two known mutations c.9557C>G and c.3978G>A and one
novel mutation c.6131C>T ASPM gene, mutations in this gene are reported to be
the most common cause of microcephaly in Pakistan.
An enhancer element was also found in one of the families suffering with mild
form of microcephaly. This regulatory region is present 1.2 Mb downstream to
ASPM gene which loops back to allow transcription of gene. This enhancer is
present in region which is deleted in all affected individuals of the family. This
regulatory region is a cis acting element and possesses c.FOS and HeyI elements
which are complementary to ASPM promoter. In a genome wide linkage scan of
an apparently X linked family suffering with speech disorder, a risk locus for
stuttering in Pakistani families at 18p11.32-11.31 is mapped which contains seven
candidate genes but no mutation is found so far. In two families with autosomal
recessive dyslexia four candidate loci for dyslexia at 2p, 1p, 2q and 4q were also
found by Affymetrix SNP 6.
The present data extends our knowledge and understanding of the genetic and
molecular spectrum of learning disabilities. There are many disorders associated
with congenital defects to learn cognitive behaviors and it is necessary to setup a
correct diagnosis to avoid unnecessary and ineffective treatment options.
Knowledge of specific risk factors may improve our ability to design proper
strategies to cope with the impact of disease.
![Page 31: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/31.jpg)
Chapter 1 INTRODUCTION
Genetics of Learning Disabilities 1
1 INTRODUCTION
1.1 CHARACTERISTICS OF PAKISTANI POPULATION
Despite the technological progress in mapping and sequencing of human genome and remarkable
advances in the application of molecular methods in medicine, molecular genetics research in the
field of child development and psychopathy is comparatively new in part. Although family
studies have provided considerable evidence that genetic influence play an important role in the
development of child behavior and cognition. The ignorance could be because of difficulties in
defining childhood disorders and scarcity of genetically informative families.
Pakistan, a unique country in the world with population size of 180 million with almost 70% of it
living in villages holding small area of land and engaged in small scale agriculture farming and
livestock business, just 30% population living in cities are engaged in services department and
small business to earn their living. Literacy rate is about 40% which is far low as compared to
many other developing countries (Bittles, 2001). Pakistani population is characterized by large
family size and high rate of inbreeding because of a strong tradition of marrying within the same
caste or tribe and consanguineous marriages are part of culture and tradition. In addition to high
frequency of consanguinity the lack of public health measures directed at the prevention of
congenital and genetic disorders, inadequate perinatal and prenatal health care, particularly in
low income groups pose a major risk factor for developing various diseases. Services for the
prevention and control of genetic disorders are restricted by certain cultural, legal and religious
limitations, for example, the cultural fear of families with genetic diseases to be stigmatized
within their community similarly, the social restrictions on selective termination of pregnancy of
an affected fetus (Alwan et al., 1997). As a consequence, large inbred families suffering from a
variety of diseases can be found commonly in Pakistan. Recessively inherited disorders are not
rare and account for a substantial proportion of physical and mental handicap.
![Page 32: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/32.jpg)
Chapter 1 INTRODUCTION
Genetics of Learning Disabilities 2
1.2 GENETIC DISORDERS AND ANALYSIS TECHNIQUES
To better adapt the environment, nature allows new combinations of the genome by mixing the
hereditary material during every meiotic recombination. The term mutation usually implies
change in the nucleotide sequence of single gene, altering their coding information. Mutation is
one of the three vital processes; the others being recombination and random chromosome
assortment at fertilization, which lead to the molecular individuality of a person. These changes
in the sequence of DNA could benefit the organism, but sometimes also cause disease. Any
disease which could be caused by the changes in genome is referred as genetic disorder. Genetic
disorder could be monogenic (single gene disorder) or complex (involving multiple genes and
nongenetic factors). Mode of inheritance of genetic disorders could be autosomal or X-linked,
and phenotypically it could be recessive or dominant. There are many different approaches
which could be used to study whether genetic factors play a role in the susceptibility of a given
disease. Linkage analysis and association studies are two common methods which are exploited.
Both of these approaches utilize known genetic markers and polymorphisms which correlate
with genetic loci constituting the heritable component of the trait of interest.
On average, the DNA sequence from two randomly chosen individuals differs only in 0.1%. If
the variation occurs in a human population with frequency of ˃0.01 it is called as DNA
polymorphisms. Single nucleotide polymorphism (SNPs) is the most common form of genetic
variations present in the human genome. SNPs are important for the constitution of phenotypic
variation or genetic diversity in the human species but to a certain extent influence susceptibility
to disease (Przeworski et al., 2000). Repetitive sequences including short tandem repeats (STRs)
or variable number of tandem repeats (VNTRs), constitute another form of genetic variation.
They can range from di-nucleotide repeats to duplications which are several Kb in size.
Microsatellites or short tandem repeats (STR) are short sequences made up of 2-4 nucleotides
which repeat continuously for different lengths and the number of repeats is often highly
polymorphic. Majority of the microsatellites are in noncoding regions, and up to 80 different
alleles may exist at a single microsatellite locus (Sebat et al., 2004). Copy number variations
(CNVs) result in gain or loss of a certain DNA segment, this DNA segment could be a gene or a
regulatory element, ranging from 1 Kb to 3 Mb in size (Iafrat et al., 2004).
![Page 33: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/33.jpg)
Chapter 1 INTRODUCTION
Genetics of Learning Disabilities 3
1.3 LEARNING DISABILITY
Learning disability is a descriptive concept, not a disorder. A long held (and totally valid) view
has been that the conditions leading to severe and profound learning disability have identifiable
pathologies, including genetic disorders. Learning disability (sometimes called as learning
disorder or learning difficulty) is a classification including several disorders in which a person
has difficulty learning in a typical manner, usually caused by defects in brain’s ability to receive
and process information. The phrase learning disability became prominent in the 1980s. It is
broad in scope, covering general conditions such as Down syndrome, microcephaly (MCPH) as
well as more specific cognitive or neurological conditions such as dyslexia and attention deficit
disorder. In emphasizing the difficulty experienced rather than any perceived ‘deficiency’ it is
considered less discriminatory and more positive than other terms such as mentally handicapped,
and is now the standard accepted term in official context.
According to American National Joint Committee on Learning Disability [NJCLD (1980)], the
term learning disability is defined as “A heterogeneous group of disorders manifested by
significant difficulties in the acquisition and use of listening, speaking, reading, writing,
reasoning or mathematical abilities. These disorders are intrinsic to the individual and presumed
to be due to Central Nervous System (CNS) dysfunction. Even though a learning disability may
occur concomitantly with other handicapping conditions (e.g. sensory impairment, mental
retardation, social and emotional disturbance) or environmental influences (e.g. cultural
differences, insufficient/inappropriate instruction and psychogenic factors etc), it is not the direct
result of those conditions or influences.”
Mild to moderate learning disability has been seen as largely socio-cultural and multi-
factorial/polygenic in origin. Secondly, familial disorders associated with learning disability
often do not show simple Mendelian inheritance. Partial penetrance, parent-of-origin effects and
anticipation occur, and in some cases can occur together (Walter, 2000). Learning disabilities fall
into two categories: verbal learning disability results in difficulty with words, both spoken and
written while non verbal learning disability causes difficulty in processing what is been seen.
![Page 34: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/34.jpg)
Chapter 1 INTRODUCTION
Genetics of Learning Disabilities 4
1.3.1 LEARNING AND COGNITION IN HUMAN BRAIN
The human brain weighs only about 1400g, yet it contains more than 100 billion neurons. In
addition, each neuron may have from 1000 to 10,000 synaptic connections with other nerve cells.
There may be as many as 100 trillion synapses in the brain. Performance of even a simple task
involves multiple areas of brain, although each function is localized to a specific brain area, but
since many units are involved, widely distributed brain areas take part in mental tasks. Therefore,
brain process, stores, and retrieves information in different ways to suit different needs. For
example in learning of language, the role of two cerebral hemispheres differs anatomically,
chemically and functionally. In 90 percent of the population, the left hemisphere is superior at
producing language and in performing other tasks that require rapid changes overtime. But if a
damage occurs to the dominant hemisphere, some language functions can be acquired by the
opposite hemisphere, the younger the patient, the greater the transfer function (Widmaier et al.,
2004).
To date, little is known regarding the neural bases of cognition in normally developing children.
In order to address the neural circuits underlying cognitive development, a means of assessing, in
vivo, the developmental physiological course of the behavior is needed. In the case of
Microcepahly, ASPM, CDK5RAP2, CENPJ, STIL and WDR62 are expressed in fetal brain
during neurogenesis (Kumar et al., 2009, Bond et al., 2002). ASPM, CDK5RAP2 and CENPJ all
have roles in centrosome or mictotubule formation and can affect neurogenic mitosis by
influencing the spindle pole and astral microtubule network (Fong et al., 2008).the function of
microcephaly genes are consistent with the developmental mechanisms proposed to have
facilitated brain expansion. The phenotypes exhibited by individuals with microcephaly show
that these loci affect cortical surface area, not thickness, consistent with a role in regulating the
size of the neural progenitor pool (Desir et al., 2008). Developmental dyslexia is a most
common learning disorder and evidence suggest that early brain development is altered in
dyslexic readers. Genetic studies implicate genes associated with neuronal migration and axonal
guidance (Galaburda et al., 2006), and electro physiological data suggest that a deficit in the
perception of speech sounds is present in infants who became dyslexic readers (Molfese 2000).
Functional neuroimaging studies of dyslexic readers have reported atypical activation in 3
![Page 35: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/35.jpg)
Chapter 1 INTRODUCTION
Genetics of Learning Disabilities 5
cortical regions: the temporoparietal area, the inferior frontal gyrus ad the fusiform gyrus (Simos
et al., 2002). Specific Language Impairment (SLI) involves abnormal development of brain
structure that constitutes the procedural memory system. This system is composed of a network
of interconnected structures rooted in frontal/basal ganglia circuits; sub serves the learning and
execution of motor and cognitive skills (Ullman and Pierpont, 2005).
1.3.2 GENERAL STRUCTURE OF THE BRAIN
The brain is protected by the scalp with its hairs, skin, fat and, other tissues, and by the cranium.
Brain floats shockproof in cerebrospinal fluid and is encased by three layers of protective
membranes called cranial meninges. It directly covers and is attached to the surface of the brain
and dips down into the fissures between the raised ridges of the brain. Within the brain there is a
series of connected cavities called ventricles. A network of blood vessels called a choroid plexus
is formed in several places where the ependyma contacts the pia mater. Each cranial ventricle is
filled with cerebrospinal fluid (CSF) and is lined by cuboidal epithelial cells (Gerard and
Nicholas, 1987). CSF is a clear, colorless liquid that is similar to blood plasma. It conveys excess
components and unwanted substances away from the extra cellular fluid and into the venous
portion of the blood circulatory system.
The brain is technically called the encephalon. It has four major divisions; brainstem,
cerebellum, cerebrum and diencephalon (Figure 1).
1.3.2.1 Brainstem
Brain stem is the stalk of brain, and it relays messages between the spinal cord and the
cerebellum. Its three segments are the midbrain, pons and medulla oblongata. Deep within the
brain stem is a slender network of neurons and fibers called reticular formation. The medulla
oblongata is connected to the pons by longitudinal bundles of nerve fibers. Just superior to the
medulla oblongata is the pons, so named because it forms a connecting bridge between medulla
oblongata and mid brain, the uppermost portion of brain stem (Wildmaier et al., 2004).
1.3.2.2 Cerebellum
The cerebral cortex is corrugated, with long, parallel ridges called folia cerebelli, which are more
regular than the gyri of the cerebral cortex. The cerebellum integrates the contractions of skeletal
![Page 36: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/36.jpg)
Chapter 1 INTRODUCTION
Genetics of Learning Disabilities 6
muscles in relation to each other as they participate in a movement or series of movements
(Elaine et al., 2007). The main role of cerebellum is to regulate balance, timing and precision of
body movements and positions. It processes input from sensory receptors in the head, body, and
limbs. Through connections with the cerebral cortex, vestibular system, and reticular formation,
the cerebellum refines balance and coordinates muscular movements. The much larger lateral
lobe or hemispheres of the cerebellum help smooth out muscle movement.
1.3.2.3 Cerebrum
The largest and most complex structure of the nervous system is the cerebrum. It consists of two
cerebral hemispheres. Each hemisphere is composed of a cortex, white matter, and basal ganglia.
Each of the first four lobes of cerebrum contains special functional areas, including speech,
hearing, vision, movement and the appreciation of general sensations. The cerebellum has a
surface covering of gray matter called the cerebral cortex. The cortex is thin convoluted covering
containing over 50 billion neurons and 250 billion glial cells (estimated to be 70 % of the brain
cells), the raised ridges of the cortex are called convolutions or gyri, which are separated by slit
like grooves called sulci. Extremely deep cerebral grooves or depressions are called fissures
(Keith and Arthur, 1999). The cerebral hemispheres are separated by the longitudinal fissure, and
the cerebrum is separated from the cerebellum by the transverse cerebral fissure. Beneath the
cortex lies a thick layer of white matter. The thalamus is functionally integrated with the cerebral
cortex in the highest sensory and motor functions of the nervous system.
Each cerebral hemisphere is subdivided into six lobes; the frontal, parietal, temporal, occipital,
and limbic lobes, and the insula. The frontal lobe is involved with two basic cerebral functions,
the motor control of voluntary movements, including those associated with speech and the
control of emotional expressions and moral and ethical behavior. The parietal lobe is concerned
with the evaluation of the general senses. It integrates the general information that is necessary to
create an awareness of the body and its relation to its external environment. The temporal lobe is
the lobe located closest to the ears. It has critical functional roles in hearing, equilibrium, and to a
certain degree, emotion and memory. Occipital lobe, although it is relatively small, it is
important because it contains the visual cortex. It is made up of several areas organized for
vision and its associated forms of expression. Limbic lobe is the ring of cortex, located on the
medial surface of each cerebral hemisphere and surrounding the central core of the cerebrum.
![Page 37: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/37.jpg)
Chapter 1 INTRODUCTION
Genetics of Learning Disabilities 7
The limbic system is a ring of structures encircling the brainstem. It is defined in functional
terms as an assemblage of cerebral, diencephalic, and midbrain structures that are actively
involved in memory and emotions and the visceral and behavioral responses associated with
them (Solms, 2002).
1.3.2.4 Diencephalon
The diencephalon is the deep part of the brain, connecting the midbrain with the cerebral
hemispheres. It houses the third ventricle and is composed of the thalamus, hypothalamus,
epithalamus, and ventral thalamus. The pituitary gland is connected to the hypothalamus (Donna
et al., 1995).
1.3.3 DEVELOPMENT OF BRAIN
The central nervous system appears at the beginning of the third week as slipper-shaped plate of
thickened ectoderm, the neural plate, in the middorsal region in front of the primitive pit. Its
lateral edges soon elevate to form the neural folds. With further development, the neural folds
elevate more, approach each other in the midline, and finally fuse, forming the neural tube.
Fusion begins in the cervical region and proceeds in cephalic and caudal directions (Kenneth,
2004). At the cranial and caudal ends of the embryo, fusion is delayed, and the cranial and caudal
neuropores temporarily form open connections between lumen of the neural tube and the
amniotic cavity. Closure of the cranial neuropore proceeds cranially from the initial closure site
in the cervical region, and forms a site in the forebrain that forms later (Gerard and Nicholas,
1987). This later site proceeds cranially to close the rostralmost region of the neural tube and
caudally to meet advancing closure from the cervical site. Final closure of the cranial neuropore
occurs at the 18 to 20 somite stage (25th
day); closure of the caudal neuropore occurs
approximately 2 days later.
The cephalic end of the neural tube shows three dilations, the primary brain vesicles: forebrain
(prosencephalon), midbrain (mesencephalon), and hindbrain (rhombencephalon).
Simultaneously, it forms two flexures: the cervical flexure at the junction of the hindbrain and
the spinal cord, and the cephalic flexure in the midbrain region. When the embryo is 5 weeks old,
the prosencephalon consists of two parts: the telencephalon, formed by a midportion and two
lateral outpocketings, the primitive cerebral hemispheres, and the diencephalon, characterized by
![Page 38: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/38.jpg)
Chapter 1 INTRODUCTION
Genetics of Learning Disabilities 8
outgrowth of the optic vesicles (Adel and Ronald, 2005). A deep furrow, the rhombencephalic
isthmus, separates the mesencephalon from the rhombencephalon.
The rhombencephalon also consists of two parts: the metencephalon, which later forms pons and
cerebellum, and the myelencephalon. The boundary between these two portions is marked by the
pontine flexure. The lumen of the spinal cord, the central canal, is continuous with that of the
brain vesicles. The cavity of the rhombencephalon is the fourth ventricle, that of the
diencephalon is the third ventricle, and those of the cerebral hemispheres are the lateral
ventricles. The lumen of the mesencephalon connects the third and fourth ventricles. This lumen
becomes very narrow and is then known as the aqueduct of sylvius. The lateral ventricles
communicate with the third ventricle through the interventricular foramina of monro (Sadler et
al., 2000).
![Page 39: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/39.jpg)
Chapter 1 INTRODUCTION
Genetics of Learning Disabilities 9
Figure 1: Anatomy of Human brain: Adapted from Widmaier et al., (2004).
![Page 40: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/40.jpg)
Chapter 1 INTRODUCTION
Genetics of Learning Disabilities 10
1.4 STUTTERING
Language is truly a unique human gift and a complex process that enables communication and
social functioning. Most children acquire language naturally in the sequence of listening,
speaking, reading and writing. Failure in any of these processes may lead to lifelong socio-
economic and mental health consequences (Gayan et al., 1999). Among many causes of
language disability, dyslexia is the most common one. It is referred as a difficulty in learning to
read and spell despite adequate education, intelligence and socio-cultural opportunities and
without any sensory deficits (Shaywitz et al., 1998). Dyslexia is the most common subtype of
learning disabilities with a prevalence ranging from 5-10 per cent. The central difficulty in
dyslexia is the phonological awareness deficit (Roongpraiwan et al., 2002).
Specific language impairment (SLI) is diagnosed when a child is significantly delayed in speech
and language development despite having normal hearing, normal intelligence and no known
neurological problems. Research involving molecular genetics and /or pedigree analysis depends
crucially on having good measures for the phenotype under investigation. An imprecise
diagnosis of the phenotype can result in a genetically heterogeneous sample which will in turn
significantly impact on the research (SLI Consortium, 2004). Unfortunately, the SLI phenotype
by its very nature is heterogeneous. The disorder is diagnosed on the basis of (i) a low score on a
subset of language tests from a battery assessing receptive, expressive and phonological skills
and (ii) no other impairment that could potentially explain poor performance (Bishop, 2001).
The familial stuttering project is a part of a larger project to study Pakistani families with mild to
moderate learning disability. This project includes dyslexia as the most common learning
disability and neuro-developmental disorder, Attention Deficit Hyperactivity Disorder (ADHD),
which can be found in approximately 20% of the cases with dyslexia plus other childhood
developmental disorders showing clinical co-morbidity. The focus on developmental and
neurological disorders sharing clinical co-morbidity is relatively new, although family studies
have provided considerable evidence that genetic elements play an important role in the
development of child behavior and cognition, and the stuttering is just one phenotype in this
clinical very broad group of developmental disorder.
![Page 41: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/41.jpg)
Chapter 1 INTRODUCTION
Genetics of Learning Disabilities 11
Developmental stuttering is a communication disorder that begins in early childhood and is
characterized by involuntary disruptions in the fluency of verbal expression. The most typical
core behaviors are repetitions of sounds or syllables and articulatory fixation, resulting in blocks
or prolongations of sounds (Suresh et al., 2006). The overt symptomology of the disorder is
characterized by excessive repetitions of sounds, syllables, and monosyllabic words, as well as
sound prolongations and complete blockage of the vocal tract. Any of these characteristics may
be accompanied by physical tension or movements, especially in the head and neck areas
(Conture and Kelly, 1991).
Stuttering, also known as stammering is a common speech disorder that has been recognized
since antiquity and affects all populations and language groups (Bloodstein et al., 2008). Familial
aggregation of stuttering has been extensively documented, with an increased incidence of
almost 15% in first degree relatives of probands; as compared with a 5% life time risk in general
population (Ambrose et al., 1993). The underlying causes are unknown, but twin studies,
adoption studies (Felsenfeld et al., 1997), and family studies (McFarlane et al., 1991) strongly
support genetic contribution in the etiology of stuttering. Stuttering is typically found in young
children and affects at least 15 % of those in age range of 4 to 6 six years, and the stuttering
resolves later leading to a population prevalence of 1 to 2 % (OMIM 184450).
The onset of stuttering usually occurs in childhood, between the ages of 3 and 6 years, with
reported rates of natural, unassisted recovery of almost 75% (Yairi and Ambrose, 1999). An
investigation into the relationship between persistence and recovery in stuttering, with the use of
pedigree and segregation analysis, suggested that the two phenomena are not genetically
independent disorders, though the persistence of stuttering may require the transmission of
additional genetic factors (Raza et al., 2012).
The superior temporal gyrus (STG) encompasses the primary auditory cortex and is believed to
be a major anatomical substrate for speech, language and communication (Rajarethinam et al.,
2000). The STG connects to the limbic system (hippocampus and amygdala), the thalamus and
neocortical association areas in the prefrontal cortex, all of which have been implicated in
schizophrenia (Hajeck et al., 1997). A variety of brain imaging tools have documented structural
(MRI or DTI), chemical (MRSI), functional (rCBF, PET, fMRI), and temporal (EEG, ERP, MSI)
differences dyslexics and good readers are often associated with phonological processing (Eckert
![Page 42: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/42.jpg)
Chapter 1 INTRODUCTION
Genetics of Learning Disabilities 12
et al., 2003). The left and right inferior frontal gyrus (IFG) may participate in an executive
function panel for coordinating phonological and orthographic processing, respectively; in
children deactivation of right IFG was associated with improvements in phonological decoding.
The left IGF and its connections to cerebellum may function as the phonological loop in working
memory (Richard et al., 2006).
Stuttering is one of many complex disorders showing striking sex differences in severity and /or
prevalence. There is a significant sex bias in the incidence of stuttering, with a male to female
ratio of 2:1 during childhood increasing to 4:1 to 5:1 in adulthood. The increased polarity with
age of affected males versus female suggests that recovery from stuttering is considerably more
frequent in girls than in boys (Yairi and Ambrose, 2005).
1.4.1 LOCI REPORTED FOR STUTTERING
Genetic-linkage studies have provided evidence of linkage with numerous loci (Shugart et al.,
2004) but the studies are complicated by the high rate of spontaneous recovery in this disorder,
especially among females (Yairi et al., 1999) and by the likelihood of non-genetic and
heterogeneous causes. These factors make it probable that unaffected persons can carry
mutations associated with stuttering (i.e. may have non-penetrate mutations) and that affected
persons may not carry such mutations (i.e. may represent pheno-copies). Table 1 summarizes
various loci reported to be linked with familial stuttering.
1.4.1.1 Loci for X-Linked Stuttering
Two loci are so far reported for X-linked stuttering associated with other genetic abnormalities.
The locus Xp22.13 (MIM:309510) is associated with a syndrome of mild to moderate mental
retardation and episodic dystonic movements of hands referred as Partington Disease. In the
original Australian family reported by Partington et al. (1988), and in the unrelated Belgian
family reported by Frints et al. (2002) and Stromme et al. (2002), an expanded alanine repeat in
the ARX gene. The polyA expansion was due to the 24-bp duplication. The other locus Xq26.3
(MIM 313430) where stuttering is coupled with X-Linked mental retardation and isolated growth
hormone deficiency reported by Hamel et al. (1996), while Laumonnier et al. (2002) identified a
33 bp duplication (711-743 dup) in the SOX3 gene.
![Page 43: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/43.jpg)
Chapter 1 INTRODUCTION
Genetics of Learning Disabilities 13
1.4.1.2 Autosomal Loci for Stuttering
Four loci are described for the stuttering phenotype, 18p11.3-p11.2 (STUT1, MIM 184450),
12q24.1 (STUT2, MIM 609261), 3q13.2-q13.33 (STUT 3, MIM 614655) and 16q12.1-q23.1
(STUT4, MIM 614668) and putative disease genes at the STUT2 locus and two other loci have
been reported (Kang et al., 2010). The disease displays very high genetic heterogeneity and is
associated both with autosomal recessive, autosomal dominant as well as with a sex-modified
autosomal dominant inheritance (McFarlane et al., 1991).
STUT 1
Familial persistent stuttering STUT1 located 18p11.3-p11.2 (MIM 184450) has been suggested
as susceptibility loci by Shugart et al. (2004). They performed a genome wide linkage survey
and used non-parametric analysis methods to identify genomic regions of interest. According to
them, major hindrance in genetic studies of stuttering include highly distorted sex ratio, an ability
to ascribe a mode of inheritance, the high frequency of the trait in ‘normal’ young children, and
greatly variable expression within families.
STUT 2
Familial persistent stuttering STUT2 located at 12q24.1 (MIM 609261) was refined to a 10 Mb
region between D12S101 and D12S1597 by Kang et al. (2010), in a large consanguineous
Pakistani family with stuttering. They identified E1200K variant in GNPTAB gene and also
found three variants each in GNPTG and NAGPA genes, present on locus 16p13.3, and
concluded that variations in genes governing lysosomal metabolism may be susceptibility factors
for non syndromic stuttering.
STUT 3
Familial persistant stuttering STUT 3 locus (MIM 614655) was identified genome wide linkage
analysis followed by fine mapping in a consanguineous Pakistani family with stuttering Raza et
al., (2010) found linkage to a region on chromosome 3q13.2-q13.33. Sequencing of DRD3 gene
was done but no mutation or variation was identified.
![Page 44: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/44.jpg)
Chapter 1 INTRODUCTION
Genetics of Learning Disabilities 14
STUT 4
Familial Persistant stuttering locus STUT 4 (MIM 614668) in region 16q12.1-q23.1 was located
by genome wide linkage analysis followed by fine mapping in Pakistani kindred with stuttering
(Raza et al., 2012)
Table 1: Loci reported for Familial Stuttering
Chromosome Position Gene Reference
Chr:X Xp22.13 ARX Partington et al., 1988
Chr:X Xq26.3 SOX3 Laumonnier et al., 2002
Chr:18 18p11.3-p11.2 No gene identified yet Shugart et al., 2004
Chr:3 3q13.2-q13.33 No gene identified yet Raza et al., 2010
Chr:12 12q24.1 GNPTAB Kang et al., 2010
Chr:16 16q12.1-q23.1 No gene identified yet Raza et al., 2012
1.5 MICROCEPHALY
Microcephaly is defined as small cranium with significantly reduced occipito-frontal head
circumference (OFC) of more than two standard deviations (SD) below the mean for age, sex,
and ethnicity (severe Microcephaly OFC < -3 SD). Autosomal recessive primary Microcephaly
(MCPH) is a condition where fetal brain growth is significantly reduced (as is head size
throughout the life), brain architecture is normal, and there is no apparent abnormalities in other
body systems (Woods et al., 2005). The incidence of Microcephaly at birth, as evaluated in birth
defect register world-wide, varies from 1.3 to 150 per 100,000 live births, depending on the
population and the applied SD threshold to define Microcephaly (source: International
Clearinghouse for Birth Defects Surveillance and Research, 2006 report;
http://www.icbdsr.org/). Primary, non syndromic Microcephaly has an incidence of 1:30,000 to
1:250,000 live-births.
![Page 45: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/45.jpg)
Chapter 1 INTRODUCTION
Genetics of Learning Disabilities 15
Microcephaly can be acquired (caused by environmental factors like congenital infection with
toxoplasma, maternal alcohol overconsumption during pregnancy etc.) or hereditary in origin
and can become apparent congenitally (primary Microcephaly) or postnatal (secondary
Microcephaly). Microcephalia vera (true Microcephaly) is a loosely defined, historical term
referring to children with isolated, non syndromal congenital Microcephaly. This term was
coined without consideration of etiology or neuropathology, and is still applied, however, in a
narrower sense, to designate patients with non-syndromal autosomal recessive Microcephaly
without lisssencephaly or pachygyria. The initial definition of autosomal recessive primary
Microcephaly (MCPH) has proved useful to both clinicians and researchers as it is easy to
identify an individual with a small but structurally normal brain, a mild to moderate mental
retardation but otherwise normal in appearance, health and neurological functioning (Cox et al.,
2006).
1.5.1 CLINICAL FEATURES AND PHENOTYPE OF MCPH
The term “microcephaly” refers to clinical findings: a head circumference (HC) significantly less
than expected for an individual’s age and sex. HC is used as surrogate measurement of brain
size; however, it is only imperfectly correlated with brain volume. Other methods have been used
(e.g., NMR), but HC remains the common, simple method for evaluating gross brain size,
although it needs to be accurately measured and charted relative to age and sex. An HC of three
standard deviations below the mean (-3SD) is usually the cut-off for defining microcephaly
(Baraiser, 1990). However, it is becoming clear that the true phenotype spectrum of patients with
MCPH gene mutations is wider than indicated by previous publications which for the most part
provide no detailed phenotype information. In individual patients, the OFC is still in the normal
range (around -2 SD) at birth followed by a development of a Microcephaly within the first year
of life (Passemard et al., 2009). MCPH may already be evident by the 24th
week of gestation
through ultra sound and /or MRI analysis (Tunca, 2006). It has been demonstrated recently that
neurological features can indeed occur in patients with MCPH due to ASPM gene mutations.
These include speech delays, hyperactivity and attention deficit, aggressiveness, focal or
generalized seizures, delay of developmental milestones and pyramidal signs (Passemard et al.,
2009). Imaging studies reveal typically brains of ‘normal architecture’ but of reduced size. The
latter is particularly evident in the cerebral cortex, which shows a simplified cerebral cortex
![Page 46: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/46.jpg)
Chapter 1 INTRODUCTION
Genetics of Learning Disabilities 16
structure, and there is also a slightly reduced white matter volume. Individual patients with
MCPH provide evidence of periventricular neuronal heterotopias suggesting neuronal migration
defects (Woods et al., 2005).
As phenotype , the term “true microcephaly” used for the sloping forehead as defining feature;
however, as it is not seen in all cases of Microcephaly so a new diagnostic label “Autosomal
recessive primary microcephaly” shortened to MCPH was been used (MIM#251200). The initial
defining clinical features of MCPH in the studies by Jackson et al. (2002) and Roberts et al.
(2002) were:
1. Congenital microcephaly at least 4SD below age and sex means.
2. Mental retardation but no other neurological findings, such as spasticity, seizures, or
progressive cognitive decline.
3. Normal height and weight, appearance, and results on chromosome analysis and brain
scan.
NMR and CAT scans of the brain show that MCPH causes a central nervous system of reduced
size, with the greatest effect on the cerebral cortex (Bond et al., 2003). The timing of the
reduction in growth has been elucidated by ultra sound of affected pregnancies. Normal head
measurements are found up to 20 week of gestation, whereas a decreased HC is seen by 32 wk.
after birth, HC lies between -4 and -12 SD (Tolmie et al., 1987). Subsequent to MCPH gene
discovery, genotype/phenotype studies showed that the original MCPH diagnostic criteria
required revision. The original definition excluded seizures, height reduction, and abnormal
cytogenetic findings, these features have now been reported in some cases of MCPH, and the
diagnosis of MCPH is no longer excluded by their presence. Therefore MCPH was redefined as:
1. Congenital microcephaly, with HC at least 4SD below age and sex means.
2. Mental retardation but no other neurological findings, such as spasticity, or progressive
cognitive decline. Fits are unusual but do not exclude the diagnosis.
3. For the majority of people with MCPH, normal height, weight, appearance, chromosome
analysis, and brain scan are reported. For people with MCPH1 mutations, a reduction in
height may be found, but the HC will always be significantly more reduced than height;
on NMR scan, some MCPH1 patients show evidence of periventricular neuronal
![Page 47: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/47.jpg)
Chapter 1 INTRODUCTION
Genetics of Learning Disabilities 17
heteropias suggestive of neuronal migration defects; and cytogenetic analysis may
indicate an increased proportion of prophase like cells (Woods et al., 2002).
1.5.2 MCPH GENES AND PATHOMECHANISMS
MCPH can be caused by recessive mutations in up to seven genes (Table 2) encoding
microcephalin (MIM#251200) MCPH1 (Jackson et al., 2002), Cyclin Dependent Kinase 5
regulatory associated protein 2 CDK5RAP2 (MIM#604804) MCPH3 (Bond et al., 2005),
abnormal spindle like, Microcephaly associated ASPM (MIM#608716) MCPH5 (Pattison et al.,
2000), Centromeric Protein J CENPJ (MIM#608393) MCPH6 (Leal et al., 2003), SCL/TAL1-
interrupting locus STIL (MIM#612703) MCPH7 (Kumar et al., 2009) as well as linkage to two
loci with newly discovered genes 19q13.1-13.2 (Roberts et al., 1999) WDR62(MIM#604317)
MCPH2 (Nicholas et al. 2010) and 15q15-q21 (Jamieson et al., 1999). MCPH4 (MIM#604321)
CEP152 (Guernsey et al. 2010) Further genetic heterogeneity likely exists as about 20-30 % of
families with MCPH do not show linkage to any of the currently known loci (Kaindl et al.,
2009).
Unexpectedly most of the known MCPH genes, CDK5RAP2, ASPM and CENPJ (better known
as CPAP), encode centrosomal proteins, highlighting the importance of the centrosome in
neurogenesis (Zhong et al., 2006). All the MCPH proteins identified are ubiquitously expressed
and have a centrosomal association for at least part of the cell cycle; suggesting knowledge of a
centrosomal association might provide guidance in the selection of candidate genes. Despite this,
a common mechanism explaining the role of the MCPH genes in neurogenesis has yet to emerge.
All four known MCPH proteins are also present in the midbody (the microtubular structure
linking daughter cells at the final stage of cytokinesis) and have apparently diverse roles:
microcephalin in DNA repair and chromosome condensation, CDK5RAP2 and CENPJ in
centriole/centrosome replication, and ASPM in modulating the plan of cytokinesis in neural
precursors (Graser et al., 2007).
1.5.2.1 MCPH1 (8p23)
The MCPH1/ Microcephalin gene is a 14 exon gene that encodes an 835 amino acid protein on
chromosome 8p23. It was identified by positional cloning within an ancestral haplotype shared
![Page 48: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/48.jpg)
Chapter 1 INTRODUCTION
Genetics of Learning Disabilities 18
by two consanguineous Pakistani families (Jackson et al., 2002). Mutations in MCPH1 gene are
an infrequent cause of MCPH; however, some studies have defined a broader phenotype for the
MCPH1 gene than that described for other MCPH genes. For example, premature chromosome
condensation (PCC) syndrome has been shown to be allelic to MCPH1 primary microcephaly.
The defining features of this disorder are: significant Microcephaly, short stature and an unusual
cytological cellular phenotype of excess prophase like cells in conjunction with recurrent poor
banding quality (Neitzel et al., 2002).
The human phenotype due to MCPH1 mutations may be caused by defective cell cycle
checkpoint control and DNA repair. Cell cycle checkpoints are regulatory pathways that govern
the order and timing of cell cycle transitions to ensure completion of one cellular event prior to
commencement of another one. These checkpoints control mechanisms are linked to those of
DNA damage repair as, in response to DNA damage, the cell cycle needs to be delayed until the
damage is repaired to restore the integrity of the organism or; if repair is not possible, arrested
with subsequent induction of cell death (Bork et al., 1997).
1.5.2.2 MCPH2 (19q13.1-q13.2)
This region was first reported by Roberts et al. (1999) as a candidate region for MCPH. The
minimum critical region containing the MCPH2 locus was defined by the polymorphic markers
D19S416 and D19S420, spanning a region of approximately 7.6 cM. Recently, Nicholas et al.
(2010) reported WDR62 mutations associated with spindle pole.
1.5.2.2 MCPH3 (9q33.3)
The MCPH3 locus harbours the 34-exon gene cyclin dependent kinase 5 regulatory associated
protein 2 [CDK5RAP2 (Bond et al., 2005)]. It has been recently reported that CDK5RAP2 is
required for spindle checkpoint regulation, as loss of function leads to chromosome mis-
regulation and reduced expression of the spindle checkpoint proteins BUBR1 (budding
uninhibited by benzimidazoles 1 homolog beta) and MAD2 (mitotic arrest-deficient 2) via
interaction with their promoters and transcription regulation in Hela cells. Chromosomes
segregation is initiated by activation of the spindle checkpoint target APC (anaphase promoting
complex), which functions as an E3 ligase when bound to its activator CDC20 and drives cells
![Page 49: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/49.jpg)
Chapter 1 INTRODUCTION
Genetics of Learning Disabilities 19
from metaphase into anaphase by inducing degradation of securin and mitotic cyclins (Zhang et
al., 2009).
1.5.2.3 MCPH4 15q15-q21
A novel locus was reported at 15q15-q21 in a consanguineous Moroccan family by Jamieson et
al. (1999). While recently, Guernsey et al. (2010) reported homozygous and compound
heterozygous mutations in CEP152 gene in three unrelated patients from Eastern Canada.
1.5.2.3 MCPH5 1q31
Homozygous mutations of the MCPH5 gene, also known as abnormal spindle-like
Microcephaly-associated gene (ASPM), are the most common cause of the MCPH phenotype.
ASPM plays a role in mitotic spindle function including orientation of cleavage plane. The
spindle apparatus dictates the plane of cell cleavage, which is critical in the choice between
symmetric or asymmetric division. Spindle positioning is controlled by an evolutionary
conserved pathway. ASPM localizes to the centrosome in the interphase and to mitotic spindle
poles, from prophase through telophase, in murine embryonic neuroepithelial (NE) cells and
primary stem cells as well as progenitor cells of the mammalian brain. ASPM maintains
symmetrical cell divisions and is down regulated with the switch from proliferative to
neurogenic divisions (Fish et al., 2006).
1.5.2.4 MCPH6 13q12.2
The human centromeric protein J gene encodes CRNPJ, also referred to as centrosomal P4.1-
associated protein (CPAP), LAG-3-associated protein (LAP) or LYST-interacting protein 1
(LIP1). CENPJ plays a role on centrosome and spindle function. The protein shows centrosomal
localization throughout the cell cycle in a microtubule-independent way and is associated to the
y-tubulin complex. It has been suggested that CENPJ regulated microtubule dynamics at the
centrosome, and such a precise regulation of microtubule assembly and disassembly at
kinetochore and centrosomes is thought to be important for the maintenance of the spindle
structure and chromosome segregation during mitosis (Hung et al., 2004).
![Page 50: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/50.jpg)
Chapter 1 INTRODUCTION
Genetics of Learning Disabilities 20
1.5.2.5 MCPH7 1p32
The human SCL/TAL1-interrupting locus gene encodes STIL, also referred to as SCL-
interrupting locus (SIL). STIL is an immediate early gene that encodes a cytosolic protein of 150
KDa whose function is not fully understood and which lacks homology to any known protein
families or motifs. Two isoforms have been reported (Karkera et al., 2002). STIL is expressed
throughout the cytosol with increased expression in the perinuclear region that probably plays a
role in mitotic entry (cell cycle progression in the perinuclear region that likely plays a role in
mitotic entry in cell cycle progression during G2-M), apoptosis control and centrosome function.
In HeLa and HEK293T cells, endogenous STIL was detected at the poles of the mitotic spindle
in the metaphase (where the microtubules coalesce adjacent to the centrosome), while cells in the
anaphase did not show this localization and interphase cells expressed almost no STIL
(Campaner et al., 2005).
Table 2: Loci reported for Autosomal Recessive Primary Microcephaly (MCPH)
Locus Position Gene Reference
MCPH1 8p23 Microcephalin Jackson et al., 2002
MCPH2 19q13.1-q13.2 WDR62 Nicholas et al., 2010
MCPH3 9q33.3 CDK5RAP2 Bond et al., 2005
MCPH4 15q15-q21 CEP152 Guernsey et al., 2010
MCPH5 1q31 ASPM Bond et al., 2002
MCPH6 13q12.2 CENPJ Hung et al., 2004
MCPH7 1p32 STIL Campaner et al., 2005
![Page 51: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/51.jpg)
Chapter 1 INTRODUCTION
Genetics of Learning Disabilities 21
1.6 ASPM
In the evolutionary lineage leading to Homo sapiens, one of the most notable trends is the
dramatic enlargement of the brain, specially the cereberal cortex, and the site of higher cognitive
functions (Finlay and Darlington, 1995). Anatomy, physiology and behavior have been major
focus of efforts to study evolution of brain. By contrast, genetic basis of brain evolution remain
poorly explored. Because the genes implicated in MCPH; including ASPM, are specifically
involved in determining cerebral cortex size, it is tempting to speculate that these genes may also
play a role in the evolutionary enlargement of the human cerebral cortex (Evans et al., 2004).
Consistent with the function of human ASPM in controlling brain size, the mouse ASPM gene is
expressed prominently at the site of cerebral cortical neurogenesis (Bond et al., 2002), and the
Drosophila homolog, ASPM, encodes microtubule-binding protein required for proper mitotic
spindle organization during neuroblast proliferation (Do Carmo et al., 2001).
ASPM is found to be widely expressed in fetal and adult human tissues with lower levels in adult
tissues. ASPM is up-regulated in human ovarian and uterine cancer tissues. ASPM gene contains
28 exons and spans 62 kb of genome sequence on chromosome 1 region 1q31. The predicted
full-length protein contains 3477 aminoacids and has a calculated molecular mass of 410 kD.
ASPM contains two conserved regions termed ASPM N-Proximal (ASNP) repeats, and more
than half of the protein consists of 81 C-Terminal calmodulin-binding IQ motifs of variable
length. Western blot analysis identified several predicted alternatively spiced ASPM variants
with fewer IQ motifs. Immunostaining of cultured human cells revealed that ASPM was
localized in the spindle poles during mitosis (Kouprina et al., 2005). Interspecies comparisons of
the predicted abnormal spindle proteins (Fig. 2) indicate that they are notably conserved overall,
but show a consistent correlation of greater protein size with larger brain size. Both the putative
amino terminal microtubule binding region of asp and a putative calponin homology domain are
conserved in Aspm and ASPM (Saunders et al., 1997).
![Page 52: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/52.jpg)
Chapter 1 INTRODUCTION
Genetics of Learning Disabilities 22
Figure 2: Interspecies comparison of the predicted abnormal spindle proteins: Genomic
structure of ASPM; phylogenetic comparison of the primary structure of asp, Aspm and ASPM;
a, Genomic structure of ASPM, containing 10434 bp and 28 exons. The four premature stop
codons that cause protein truncations in individuals with MCPH are marked with asterisks. The
primary mouse-human difference is marked by a gray box. Dotted lines mark the exons
comprising each domain of the ASPM protein. b, the predicted sizes and domains of abnormal
spindle proteins in Homo sapiens, Mus musculus, D.melanogaster and C.elegans (m.musculus
and C. elegans protein sequences are predictions). The putative microtubule-binding domains
(gray box), calponin-homology domain (hatched box), multiple IQ calmodulin-binding domains
(filled bars) and terminal region (diagonal striped box) are shown for each. Adapted from Bond
et al. (2002).
1.7 DYSLEXIA
Affecting more than 5% of the school age children, dyslexia is the most common learning
disorder. Developmental dyslexia is a specific disorder in learning to read and spell in spite of
adequate educational resources, normal intelligence, no obvious sensory deficits and adequate
socio-cultural opportunity. The impairment in dyslexia appears to be in phonological processing,
which interferes with the function of the linguistic system at the higher level, such as semantics
(Shaywitz, 1998). Functional brain imaging studies have shown that dyslexic subjects have a
common neuro-anatomical basis (Paulesu et al., 2001). Dyslexia is a multi-factorial, or complex
phenotype, the genetic basis of which has been established in a number of twin and family based
![Page 53: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/53.jpg)
Chapter 1 INTRODUCTION
Genetics of Learning Disabilities 23
studies (Fisher and De Fries 2002). In addition to its complex etiology, dyslexia displays a wide
spectrum of phenotypes, which could also reflect incomplete penetrance, and / or the effect of
influencing environmental factors.
Specific reading problems in dyslexia include difficulties in single word decoding, processing
new words, and making distinction between similarities and differences, also dyslexics’ shows
reversal and transposition of words and letters (Artigas-Pallares, 2009). They also have
difficulties in map reading, confusion with left and right and fail to become right or left handed.
There is no single test for dyslexics. Diagnosis involves an evaluation of medical, cognitive,
sensory processing, educational and psychological factors. It is usual to undergo vision, hearing
and neurological examinations to see whether another disorder may be causing or contributing to
poor reading ability.
Although the presence of strong genetic influences on reading related disabilities is evident, but
the mode of inheritance of dyslexia remains unclear. Autosomal dominant, autosomal recessive
and polygenic models, as well as genetic heterogeneity have been suggested (Ging-Yuek et al.,
2004). As reading is a complex task, this disability could arise from deficiencies in one or more
cognitive processes. Due to this complex nature, identification of dyslexia genes is difficult task
and it is most likely to be influenced by the interaction of many genetic and environmental
factors (Fisher, 1999).
The risk of dyslexia is more in relatives of dyslexics compared to the general population.
Familial clustering in dyslexia was recognized a few years after the first description of the
disorder by Hinshelwood in 1895. A child with an affected parent has a risk of 40-60% of
developing dyslexia. The risk is increased when other family members are also affected (Zeiger
et al., 2005).
Several phenotypes have been found in dyslexics but the etiological link between these related
phenotypes and genotypes is yet to be established. Thus isolation and analysis of the genetic
variants will initiate a new phase of research which will provide a more fundamental
understanding of the nature of dyslexia, eventually leading to an early diagnosis, risk estimation,
better methods of treatment and prevention (Pushpa and Ramachandra, 2006).
![Page 54: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/54.jpg)
Chapter 1 INTRODUCTION
Genetics of Learning Disabilities 24
1.7.1 LOCI REPORTED FOR DYSLEXIA
Linkage and association studies have investigated dyslexia both as a categorical trait and as a
composite condition, with several independent components analyzed contributing to the disorder.
To date, nine (DYX1-DYX9) chromosomal regions have been confirmed (Table 3). Four
candidate genes for the susceptibility of developing dyslexia have been suggested.
Table 3: Loci reported for Dyslexia
Locus Position Gene Reference
DYX1 15q21 DYX1C1 Smith et al.,1983
DYX2 6p22.2 DCDC2, KIAA0319 Meng et al., 2005, Francks et al., 2004
DYX3 2p16-p15 - Petryshen et al., 2002
DYX4 6q11.2-q12 - Petryshen et al., 2001
DYX5 3p12-q13 ROBO1 Nopola-Hemmi et al., 2001
DYX6 18p11.2 - Fisher et al., 2002
DYX7 11p15.4 DRD4 Hsiung et al., 2004
DYX8 1p36-p34 - Rabin et al., 1993
DYX9 Xq27.3 - De Kovel et al., 2004
![Page 55: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/55.jpg)
Chapter 1 INTRODUCTION
Genetics of Learning Disabilities 25
1.8 OBJECTIVES OF THE STUDY
A screening program for genetic carriers is a systematic attempt to identify and counsel as many
people at genetic risk in a population as possible specially people with the family history. An
Islamic ruling (‘Fatwa’) in 1990 allows termination of pregnancy in the first 120 days after
conception if the fetus is diagnosed beyond doubt to be affected with a severe malformation that
is not amenable to treatment (Consang.net) and the Law in Pakistan allows it.
When a gene for a recessive disorder is present in a family, the diagnosis of the disease in a child
serves as a marker of the extended family that is at increased genetic risk. In communities where
a high level of consanguinity exists and large families are common. Family oriented screening
offers an alternative to population screening for identifying current and future couples at risk of
producing affected children. This approach is particularly suitable to populations with a high
level of consanguinity and clustering of rare genetic diseases in certain communities or families.
It produces a high yield of information on carriers and couples at risk, family members
understand this condition because if they already have experience of having an affected child in
the family. Usually one gene variant is present in a given family or tribe, simplifying and
reducing the cost of DNA based diagnosis (Ahmed et al., 2002; Baig et al., 2008). This strategy
is being successfully used in the case of hemoglobanopatheis in this country.
Therefore, this study is designed with the following objectives:
1. To determine the phenotypic and genetic variability in Learning Disabilities among
Pakistani families.
2. To identify the loci/genes involved in Learning Disabilities in Pakistani population.
3. To identify the mutations in families affected with learning disability.
4. Elucidation of genetic mechanism of disease.
![Page 56: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/56.jpg)
Chapter 2 MATERIAL AND METHODS
Genetics of Learning Disabilities 26
2 MATERIALS AND METHODS
2.1 FAMILY IDENTIFICATION AND DATA COLLECTION
Approval for the study was obtained from Institutional Research Ethics Committee of National
Institute for Biotechnology and Genetic Engineering (NIBGE), School of Biotechnology, Quaid-
i-Azam University, Islamabad, Pakistan. In this study, a total of 20 consanguineous families
diagnosed with autosomal recessive primary Microcephaly (MCPH) and 15 consanguineous
families with provisional diagnosis of Dyslexia or Autism spectral disorders were ascertained
from different regions of Pakistan. Families selected for this study were ascertained with the help
of physicians, clinical laboratories, and hospitals, institutions for special children, school
teachers and resource persons who collaborate with Human Molecular Genetics Laboratory
(HGML) NIBGE in order to identify consanguineous families with inherited disorders. Informed
consent was taken from all the families under study after explaining the purpose and expected
benefits of this research project. Families were visited at their residence and relevant clinical
information was carefully collected to exclude involvement of any environmental factors.
Clinical history was recorded for both affected and unaffected individuals, standardized
questionnaire was filled and proper diagnosis was carried out with the help of the clinician,
neurologist, radiologist, psychiatrist, psychologist or speech therapist etc. collaborating in this
study.
After having informed consent from all members taking part in the study, pedigrees were drawn
during field sampling trips with information collected from elders of family, relatives and family
friends. An extensive pedigree was constructed for each family for genetic inference by standard
method (Bennett et al., 1995). Pedigree information was collected from the family members and
constructed by interviewing multiple family members. Pedigrees were drawn by using Cyrillic
software, version 2.1.3 (Cherwell Scientific Publishing Ltd, Oxford, UK). Photographs of all the
affected members were taken for record and for further molecular analysis blood samples were
taken from the normal and affected family members to extract genomic DNA.
Peripheral venous blood samples were taken from both affected and normal family members,
using 5-10 ml sterile syringes or multiple sampling needles and immediately transferred to 5-10
![Page 57: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/57.jpg)
Chapter 2 MATERIAL AND METHODS
Genetics of Learning Disabilities 27
ml sodium EDTA vacutainers. Blood samples were kept at 4°C till DNA extraction at HGML,
NIBGE.
2.1.1 FAMILY A
Family A originated from Bahawalnagar District of Southern Punjab Pakistan. This pedigree had
three loops originated from same forefather and eight affected individuals born from
consanguineous marriages. A total of 10 individuals were sampled, four of which were affected.
Pedigree show autosomal recessive mode of inheritance. All the affected individuals showed
head circumference (HC) 7-8 SD below age and sex related mean in the population. All the
unaffected siblings and parents of the affected individuals showed normal head circumference.
Affected individuals have mild mental retardation with some aggressive behavior but able to do
self care. Apart from microcephaly and mental retardation associated with it, affected individuals
had no other clinical malformations and symptoms. Figure 3 shows pedigree of the family where
square represents male and circle represents female, solid symbols indicate phenotypically
affected individuals, horizontal line indicates marriage and two horizontal lines indicate
consanguineous marriage. Roman numbers indicate generation while Arabic numerals indicate
sample within a particular generation.
2.1.2 FAMILY B
Family B is small with only two affected individuals whose parents were first degree cousins.
Family was sampled from Bahawalnagar and both affected individuals revealed no other clinical
malformation, symptoms or apparent physical deformity. As both parents of affected children are
normal therefore autosomal recessive mode of inheritance is deduced. Figure 4 shows pedigree
of the family where square represents male and circle represents female, solid symbols indicate
phenotypically affected individuals, horizontal line indicates marriage and two horizontal lines
indicate consanguineous marriage. Roman numbers indicate generation while Arabic numerals
indicate sample within a particular generation.
![Page 58: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/58.jpg)
Chapter 2 MATERIAL AND METHODS
Genetics of Learning Disabilities 28
A
B
Figure 3: Pedigree of Family A with autosomal recessive primary microcephaly. A)
Pedigree of family indicating autosomal recessive mode of inheritance. Solid symbols represent
affected subjects, while the open symbols represent normal individuals. Roman numerals
indicate generation number. B) Pictures of representative affected individuals of the family
showing slopping foreheads.
![Page 59: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/59.jpg)
Chapter 2 MATERIAL AND METHODS
Genetics of Learning Disabilities 29
A
B
Figure 4: Pedigree of Family B with autosomal recessive primary microcephaly. A)
Pedigree of family indicating autosomal recessive mode of inheritance. Solid symbols represent
affected subjects, while the open symbols represent normal individuals. Roman numerals
indicating generation number B) Picture of representative affected individual of the family
indicating slopping foreheads.
![Page 60: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/60.jpg)
Chapter 2 MATERIAL AND METHODS
Genetics of Learning Disabilities 30
2.1.3 FAMILY C
Family C sampled from Qasoor Central Punjab region has six affected probands in two loops.
Pedigree shows autosomal recessive mode of inheritance as parents are normal. Sample III: 7; 40
years of age (HC 42cm) 5 SD below and sample III: 8; 45 years of age (HC 42 cm) 5 SD below
than the mean for age and sex, both these affected individuals showed no sign of seizers or
epilepsy but unable to speak properly despite normal hearing. All unaffected individuals show
normal head circumference. Affected individuals were able to do self care but unable to
communicate properly. Figure 5 shows pedigree of the family where square represents male and
circle represents female, solid symbols indicate phenotypically affected individuals, horizontal
line indicates marriage and two horizontal lines indicate consanguineous marriage. Roman
numbers indicate generation while Arabic numerals indicate sample within a particular
generation.
Fig. 5: Pedigree of Family C with autosomal recessive primary microcephaly: Pedigree of
family indicating autosomal recessive mode of inheritance. Solid symbols represent affected
subjects, while the open symbols represent normal individuals. Roman numerals indicate
generation number.
![Page 61: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/61.jpg)
Chapter 2 MATERIAL AND METHODS
Genetics of Learning Disabilities 31
2.1.4 FAMILY D
Family MCP 85 originated from Bahawalnagar, South of Punjab. This family had three loops
originated from same forefathers with five affected individuals resulting from consanguineous
marriages. Family chart or pedigree show autosomal recessive mode of inheritance. In branch I
(central), two non-microcephalic individuals suffered from blindness. All affected individuals
show head circumference less than expected age and sex mean in the population. Sample VII:8 7
years of age (HC:34cm) 8 SD below; sample VII:9 5 years of age (33cm) 7SD below; sample
VII:1 16 years of age (43 cm) 5 SD below; sample VII:2 18 years of age (45 cm) 4 SD below,
sample VII:3 22 years of age (46.5cm) 4 SD below and sample VIII:1 7 years of age (41cm) 5
SD below mean for age and sex. All the normal siblings and parents had normal head
circumference. In addition to small head, affected individuals had very mild mental retardation
and were able to do self care. Figure 6 shows pedigree of the family where square represents
male and circle represents female, solid symbols indicate phenotypically affected individuals,
horizontal line indicates marriage and two horizontal lines indicate consanguineous marriage.
Roman numbers indicate generation while Arabic numerals indicate sample within a particular
generation.
![Page 62: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/62.jpg)
Chapter 2 MATERIAL AND METHODS
Genetics of Learning Disabilities 32
A
B
Figure 6: Pedigree of Family D with autosomal recessive primary microcephaly: A)
Pedigree of family indicating autosomal recessive mode of inheritance. Solid symbols represent
affected subjects, while the open symbols represent normal individuals. Roman numerals
indicate generation number. B) Photographs of representative affected individuals from the
family indicating sloping foreheads.
![Page 63: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/63.jpg)
Chapter 2 MATERIAL AND METHODS
Genetics of Learning Disabilities 33
2.1.5 FAMILY E
This family was sampled from Bahawalnagar South of Punjab. Family suffered with speech
difficulty and stutter with repetition of words. Affected individuals were offspring of
consanguineous union. They showed no other physical deformity, tics or mental disability.
Parents are normal and all affected are males and pedigree analysis indicates X-linked recessive
mode of inheritance. Their social behavior was normal and they did not show any sign of
aggression or communication disorders. Stuttering frequency increases during excitement.
Parents were normal and show no sign of stuttering. Figure 7 shows pedigree of the family where
square represents male and circle represents female, solid symbols indicate phenotypically
affected individuals, horizontal line indicates marriage and two horizontal lines indicate
consanguineous marriage. Roman numbers indicate generation while Arabic numerals indicate
sample within a particular generation.
![Page 64: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/64.jpg)
Chapter 2 MATERIAL AND METHODS
Genetics of Learning Disabilities 34
Figure 7: Pedigree of Family E with Stuttering: Pedigree of family indicating X-Linked
inheritance. Solid symbols represent affected subjects, while the open symbols represent normal
individuals. Roman numerals indicate generation number.
![Page 65: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/65.jpg)
Chapter 2 MATERIAL AND METHODS
Genetics of Learning Disabilities 35
2.1.6 FAMILY F
Family F is small with only three affected individuals, sampled from District Rawalpindi, North
of Punjab. Three affected individuals born from consanguineous marriage. Both parents and two
siblings appear to be normal and show no sign of learning disability. Affected children were
physically normal and show no sign of mental disability, able to do self care but slow learners.
They were not aggressive or hyperactive. Had some difficulty in reading and writing despite of
normal eye sight and hearing. They also had some speech problems as they were not able to
communicate properly. Pedigree analysis indicate autosomal recessive mode of inheritance.
Figure 8 shows pedigree of the family where square represents male and circle represents female,
solid symbols indicate phenotypically affected individuals, horizontal line indicates marriage and
two horizontal lines indicate consanguineous marriage. Roman numbers indicate generation
while Arabic numerals indicate sample within a particular generation.
![Page 66: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/66.jpg)
Chapter 2 MATERIAL AND METHODS
Genetics of Learning Disabilities 36
Figure 8: Pedigree of Family F with Dyslexia: Pedigree of family indicating autosomal
recessive mode of inheritance. Solid symbols represent affected subjects, while the open symbols
represent normal individuals. Roman numerals indicate generation number.
![Page 67: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/67.jpg)
Chapter 2 MATERIAL AND METHODS
Genetics of Learning Disabilities 37
2.1.7 FAMILY G
This small family with three affected individuals was sampled from District Rawalpindi. They
were diagnosed with dyslexia by the speech therapist at National Institute of Rehabilitation
Medicine (NIRM), Islamabad. Parents were first degree cousins and show no sign of disease. All
affected children were not able to speak properly; joined Special Children School but unable to
read or write. They were able to do self care and were neither hyperactive nor aggressive.
Pedigree show autosomal recessive mode of inheritance. Figure 9 shows pedigree of the family
where square represents male and circle represents female, solid symbols indicate phenotypically
affected individuals, horizontal line indicates marriage and two horizontal lines indicate
consanguineous marriage. Roman numbers indicate generation while Arabic numerals indicate
sample within a particular generation.
Figure 9: Pedigree of Family G with Dyslexia. Pedigree of family indicating autosomal
recessive mode of inheritance. Solid symbols represent affected subjects, while the open symbols
represent normal individuals. Roman numerals indicate generation number.
![Page 68: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/68.jpg)
Chapter 2 MATERIAL AND METHODS
Genetics of Learning Disabilities 38
2.2 GENOMIC DNA EXTRACTION
DNA was extracted from whole blood using standard Phenol: Chloroform method (Sambrook et
al., 1989). Composition of solutions is given in Table 4. The protocol employs 0.75 ml of blood
in 1.5 ml micro centrifuge tube, 0.75 ml of Solution A was added, tube gently vortexed and kept
for 10 minutes at room temperature. Then centrifuged at 13000 rpm for 15 minutes and
supernatant was discarded. Pellet was re-suspended in 400 µl of Solution A and tube was again
centrifuged at 13000 rpm for 10 minutes. After discarding supernatant and re-suspension of
pellet in 500 µl of Solution B, 25 µl of 10% SDS and 8µl of proteinase K were added in the tube.
Tube was then left in heating block at 65°C for 3 hours. After incubation 0.5 ml of solution C+D
were added with gentle vortexing and tube was centrifuged at 13000 rpm for 15 minutes to get
rid of proteins. After centrifugation upper aqueous phase was separated carefully, 500 µl of
Solution D was added and after mixing, tube was again centrifuged at 13000 rpm for 15 minutes.
The upper aqueous phase was separated again, 55 µl of 3M Sodium Acetate Solution was added
and DNA precipitated by adding 500 µl of Isopropanol kept at -20°C. Precipitated DNA was
pelleted by centrifuging at 13000 rpm for 10 minutes. Supernatant was discarded and DNA
washed with 400 µl of 70% ethanol stored at -20°C. After centrifugation at 13000 rpm for 10
minutes supernatant was discarded and pellet was vacuum dried to remove residual ethanol.
DNA pellet was re-suspended in TE buffer or double distilled deionized water and stored at 4°C.
Genomic DNA was quantified using NanoDropTM 1000 Spectrophotometer at 260 nm
wavelength. Each DNA sample was diluted to 50 ng/μl final concentration for amplification of
genomic fragment using polymerase chain reaction (PCR). The quality of extracted DNA was
evaluated in 1 % agarose gel electrophoresis using ethidium bromide (0.5 μg/ml).
![Page 69: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/69.jpg)
Chapter 2 MATERIAL AND METHODS
Genetics of Learning Disabilities 39
Table 4: Standard solutions used in DNA extraction
Solution Composition
Solution A 0.32 M Sucrose, 10 mM Tris-HCl, 5 mM MgCl2, 1 % v/v Triton X-100, pH 7.4-
7.6
Solution B 10 mM Tris-HCl, 400 mM NaCl, 2 mM EDTA, pH 7.4-7.6
Solution C Phenol equilibrated with Tris-HCl containing Hydroxyqinoline and
mercaptoethanol (pH 7.6-8.0).
Solution D Chloroform:Isoamyl alcohol (24:1)
2.3 KARYOTYPING
Karyotyping was performed to exclude the presence of chromosomal aberrations. For
karyotyping, samples were collected in lithium heparin vacutainers and shifted to laboratory
immediately. Tubes were allowed to stand for half an hour to allow gravity sedimentation of
blood cells and 0.8 ml of whitish portion was taken later on in 10 ml of RPMI 1640 medium. The
contents were mixed gently, 100 µl of PHA-P solution was added and incubated for 71.5 hours at
37°C. After incubation, 40 µl of pre-warmed (37°C) colcimed was added to the culture and
mixed gently. Mixture was incubated again for 30 minutes.
To harvest lymphocytes, blood culture was removed from incubation and mixed gently. Entire
content was shifted from culture flask to Falcon tube and centrifuged at 500-900 rpm for 10
minutes. Supernatant was removed and 1ml of hypotonic KCl solution was added to the pellet.
After resuspension of pellet, 9 ml of KCl solution was added. Solution was thoroughly mixed,
and incubated at 37°C for 20 minutes. Then few drops of fixative (chilled absolute methanol and
glacial acetic acid in 3:1 ratio) were added. Mixture was then centrifuged for 10 minutes at 500-
900 rpm. After centrifugation supernatant was discarded. For fixing, 10 ml of fixative was added
to the tube and mixed well.
![Page 70: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/70.jpg)
Chapter 2 MATERIAL AND METHODS
Genetics of Learning Disabilities 40
Factory pre-cleaned, frosted slides were taken and few drops of the mixtures were dropped from
18 inches to ensure proper dispersal on slide. Slides were placed overnight at 65°C and stained
with Geimsa.
2.4 LINKAGE ANALYSIS
Linkage analysis can localize a disease causing gene to a region of a chromosome without
knowledge of its function. When the abnormal gene product responsible for a given genetic
disease is not known, one would like to know first the location of the responsible gene within the
genome. The strategy of locating the gene to a single chromosome and then to as specific a
region as possible within the chromosome is referred to as ‘linkage analysis’.
2.4.1 HAPLOTYPING USING 3FP SYSTEM
Amplification of microsatellite repeats was performed for genotyping. UCSC genome browser
(http://genome.ucsc.edu/) was used for localization of microsatellite marker loci and
identification of transcripts in the candidate region. Fluorescent labeled primers were used for
amplification of microsatellite markers by adding an 18-bp extension sequence to the 5' end of
each forward primer to allow amplification by third primer which was FAM labeled at 5' end for
allele detection in ABI 1310 XL genetic analyzer (Applied Biosystems). Table 7 shows the
sequences of the primers used. 1% Agarose gel was used to test the amplification of products
with 100bp ladder. Gel was visualized at, 30V Transilluminator (SynGene).
![Page 71: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/71.jpg)
Chapter 2 MATERIAL AND METHODS
Genetics of Learning Disabilities 41
Table 5: Composition of Master mix used for PCR
Forward primer 2.4 pmol
Reverse primer 6 pmol
FAM labeled primer 10 pmol
dNTP 200 µl of each
Taq DNA polymerase 1.2U
Buffer 1X
Template DNA 50 ng
MgCl2 1.5 mM
Total Volume 12 µl
Table 6: Thermal cycle conditions used for PCR
Step Temperature °C Duration No. of Cycles
Denaturation 95 5 min 1
Denaturation
Touchdown Annealing
Extension
95 30 sec
30 45-60 30 sec
72 30 sec
Denaturation 95 30 sec
8 Annealing 50 30 sec
Extension 72 1 min
Final extension 72 5 min 1
![Page 72: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/72.jpg)
Chapter 2 MATERIAL AND METHODS
Genetics of Learning Disabilities 42
Table 7: Primers’ sequences of microsatellite markers used for stuttering and
microcephaly
Locus Marker Forward primer Reverse primer
MCPH1 D8S1742 Tgaccggcagcaaaattgcccccaccaagacaca ctcaagggatatgaagggca
D8S277 tgaccggcagcaaaattgccaggtgagtttatcaattcctgag tgagaggtctgagtgacatccg
MCPH2 D19S416 tgaccggcagcaaaattgcctgtcccagagagacccta aagagagtgtgccatttgct
D19S425 tgaccggcagcaaaattgccacaggtgtgcataaaag gccatgtgactgtagcaga
D19S224 tgaccggcagcaaaattgaacaccattcctcatcttcc cccaggccctatctga
D19S897 Tgaccggcagcaaaattgaggatttccccaacagc tgcacattacagtgtgagacag
D19S420 Tgaccggcagcaaaattgctggggcaggagcact gcttaccaaacctaaaggatgtc
MCPH3 D9S258 tgaccggcagcaaaattggctagagatgcccttgagtg aggatttatagaaagtccaaaaccc
D9S1823 tgaccggcagcaaaattgactaccattgacattattatgtgc gttggattcatcttggattc
MCPH4 D15S222 Tgaccggcagcaaaattgcctcagcgtcctctcttg ctggtcactgtctgtcctgt
D15S962 Tgaccggcagcaaaattgaattctgctcattgggg ggatattttggaactgcact
MCPH5 D1S1660 tgaccggcagcaaaattgtgctatcctctcaccagtga gtctgaagttcatgggaacg
D1S1723 tgaccggcagcaaaattgaactgtgtccagcagcaact tatgtgcctgttgtgtgcat
MCPH6 D13S742 tgaccggcagcaaaattgtccagcctggtcaacacag tccagacttcccaattcagg
D13S283 tgaccggcagcaaaattgtctcatattcaatattcttactgca gccattccaagcgtgt
MCPH7 D1S2797 tgaccggcagcaaaattgatcacatcacacacaatgactgtgg tgtccattcaaaggattggtctc
D1S2733 tgaccggcagcaaaattgtgcggcgagacagacatc aggaccagcgtgtgcgt
Chr. X DXS6807 tgaccggcagcaaaattggagcaatgatctcatttgc aagtaaacatgtataggaaaaagct
DXS8051 tgaccggcagcaaaattgccagaaatgagcgattattg tttttgaactaagaacctggag
DXS987 tgaccggcagcaaaattggttgagataatgaggccagt ttaaaagcctggttcttctaa
DXS8027 tgaccggcagcaaaattggtgagacgctgtcttgg agctgctgtactaataacatagg
DXS8056 tgaccggcagcaaaattgcctgggaggtggaggt gggcataagtggcttcg
DXS6787 tgaccggcagcaaaattgcaacattttgccaaaattcc agatgacaggttgatgggtg
![Page 73: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/73.jpg)
Chapter 2 MATERIAL AND METHODS
Genetics of Learning Disabilities 43
DXS1068 tgaccggcagcaaaattgcctctaaagcatagggtcca cccatctgagaacacgctg
(Continued….)
Locus Marker Forward primer Reverse primer
DXS1003 tgaccggcagcaaaattgttcacccatagaagccgt Ccattcctcactggcaa
DXS8032 tgaccggcagcaaaattgattttattttgctttgtatttggc Ctcctagaacagtacctgacacg
DXS1194 tgaccggcagcaaaattgacacaacttgaaactgctga Gtatgttgccacagaaacc
DXS7131 tgaccggcagcaaaattgggaatagtaagctctggggc Gtcccctctaaatgatgcaa
DXS1225 tgaccggcagcaaaattgattggcaacacaaaggg Atcctggatggaaggact
DXS1209 tgaccggcagcaaaattgtctatcactatatatatgctatccc Atggagaacagattattggt
DXS8077 tgaccggcagcaaaattgacatttttatgacattaaacacaca Caaaattttccagtgaagtcat
DXS8063 tgaccggcagcaaaattgaaaatcggtgattaggaaaataca Cctccagcagccaaag
DXS1106 tgaccggcagcaaaattgtatgagaactccctaaacaaa Tgatgcaccaaatacca
DXS1001 tgaccggcagcaaaattgtacaagtaaccctcgtgaca Gttatggaatcaatccaagtg
DXS8038 tgaccggcagcaaaattggtggactgtctccgtaacc Ccaagatgtgagcatttttc
DXS1062 tgaccggcagcaaaattggagatgtgtgaccttgagcact Gttgcctgttaagcactttgaatc
DXS8013 tgaccggcagcaaaattgccaacccaactgtctatcaa Gtttggttttccattcctga
DXS984 tgaccggcagcaaaattgtttctgtctgccaagtgttt Tactgngccctactccattc
DXS8073 tgaccggcagcaaaattggaaaatgtctggtgtgctac Atatctcagggctagagtcc
DXS1073 tgaccggcagcaaaattgggctgactccagaggc Ccgagttattacaaagaagca
DXS1062 tgaccggcagcaaaattggagatgtgtgaccttgagcact Gttgcctgttaagcactttgaatc
DXS1192 tgaccggcagcaaaattggttgccaactgctggaacg Tgtggtgcagggaagcc
DXS8013 tgaccggcagcaaaattgccaacccaactgtctatcaa Gtttggttttccattcctga
DXS8106 tgaccggcagcaaaattgcttgcacttgctgtgg Agctgtagagttgaggaatg
DXS8028 tgaccggcagcaaaattgtgatgacactcggactgc Gaaataataatacttgccttgcct
DXS998 tgaccggcagcaaaattgcagcaatttttcaaaggc Agatcattcatataacctcaaaaga
DXS1193 tgaccggcagcaaaattgaattctgactctggggc Ttattttaaggtgagtatggtgtgt
DXS8061 tgaccggcagcaaaattggcttgaagtgtccatgaggtatc Agaagctgatgtgctccctg
![Page 74: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/74.jpg)
Chapter 2 MATERIAL AND METHODS
Genetics of Learning Disabilities 44
2.4.2 PREPARATION OF SAMPLES FOR ABI 3130 XL GENETIC ANALYZER
For size separation of fragments at ABI 3130 XL genetic analyzer, 0.5 -1 µl of fluorescently
labeled PCR product was mixed with 0.5 µl of size standard LIZ-600 (Applied Biosystems) and
10 µl of Hi-Di Formamide in 96 well loading plates. Mixture was denatured and analyzed using
Peak Scanner software v.1.0 (Applied Biosystems).
2.4.3 LOD SCORE CALCULATION
Genetic linkage is statistically measured by logarithm of odds (LOD) score and is derived from
the log 10 ratio between the likelihood that two loci are linked rather than unlinked. For a
Mendelian character, linkage is said to be accepted or significant when LOD score greater than 3
indicating 1000 times greater odds that the loci are linked, and rejected when LOD score less
than -2 indicating 1:100 against linkage. LOD score values between -2 and 3 are said to be
inconclusive (Latherop and Lalouel, 1984). Linkage analysis can be executed as a two-point or
multipoint analysis. In practice, this ratio is calculated for several values of recombination
fraction (q). The frequency of one recombination event in 100 meioses equals a map distance of
one centi Morgan [1 cM 0.01q (Ott, 1991)]. One cM correlates to approximately 1 Mb in
physical distance, but it varies between males and females and depends on chromosomal
location. The estimate for linkage is the sum of LOD scores at given recombination fraction in
single family. The LOD score calculation is dependent on both the penetrance of the disease
phenotype and mode of inheritance.
Two point linkage analyses were carried out using Program LIPED Version for IBM PC/XT
(Ott, 1991). Multipoint linkage analysis was performed using easy LINKAGE (Hoffmann and
Lindner, 2005). MLINK program of FASTLINK computer package was used to calculate two
point LOD score at different values of Ө (Probability of recombination) assuming an autosomal
recessive mode of inheritance for families with autosomal recessive inheritance. Equal male to
female recombination rate, full penetrance and a disease allele frequency of 0.001 was selected.
![Page 75: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/75.jpg)
Chapter 2 MATERIAL AND METHODS
Genetics of Learning Disabilities 45
Equal allele frequencies of the genotyped markers were used in the calculations. Marker order
and their maps distance were based upon Marshfeild genetic map
[http://www.marshfeild.org/genetics/, (Broman et al., 1998)].
2.4.4 HAPLOTYPE ANALYSIS
Closely adjacent alleles can be co-inherited as haplotype, which can be used for evaluating
association between the ancestral mutation and the haplotype upon which it arose. Subsequently,
the haplotype consists of several markers; haplotype analysis can increase power in statistical
calculation (Bostein and Risch, 2003).
2.5 MUTATION ANALYSIS
After establishment of linkage with particular loci, families were subjected to direct sequencing
of candidate genes to identify the pathogenic mutations. Web based software Primer3
(http://frodo.wi.mit.edu/) was used to design oligonucleotide sequencing primers. Primers were
designed to amplify coding exons and exon-intron boundaries. Same primers were used for both
PCR amplification and sequencing. Tables 8-11 show the sequencing primers used for mutation
analysis.
![Page 76: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/76.jpg)
Chapter 2 MATERIAL AND METHODS
Genetics of Learning Disabilities 46
Table 8: Sequencing primers for ASPM
Exon Forward primer Reverse primer Product size
1 Ccaagagccacccacagtta actcccacgacctctacagc 579
2 Tcccaaagactcctctgcaa aattaagcagatagggtaggagaaa 471
3a Cgtacagagagtggcaagca ggaaatgcagaagagcagaaa 460
3b aattctagttcattattagctccatga caagcttgtgaaaacttggcta 425
3c Ctctggtacaggtggccttc cccaactgttcttcaact 625
3d Gctctgagggagaaaaatgg tcctaaattttctgcagttcagg 419
3e cagcaaaagcaaagaaaaatca gcttcagttgctcggaaaag 386
4 Ttcttccaggctgtta agtgcgtggagtacag 358
5 catttaggctaatgaacagggaat cccaaaatgctttcagctct 434
6 caccacacatacacacaagaagg gagctaacaggttgcgatga 633
7 Tgtcattacgtgcaacacca gctgccaaaaatcccacata 526
8 Gggtggaggaagggagagta tcctgagctttgtctttttgc 508
9 Ggactcaccagacaggcatt tcccatagagatattgggagga 475
10 Cattgatgtaccacttccctga aagttggaaatatgtatgaagtttgc 502
11 Cgctattttccaaagcaacc tacttgccgactatggagca 479
12 Tcacagttactggggcaaaa gattccggcaataagtcgtc 404
13 Tcatttgagggaaagtttgct gtttgcctttggggaaaaa 557
14 Gcaggtattccaccaaggtc tgtgccatgctctcacataa 599
15 Atccaaaagccttgcacaaa cgcaaactggttcagtggta 473
16 Acctccccaacccaaaatac gaccttggtggaatacctgct 461
17 Agccttctgctgaacaccat cgacatgcctggaattatca 535
18a Gcttgaaagcaccgaaatct ttggatggatttctgaattgg 631
18b Aaaatcgaactctgtcttgtctca tgcaaagagcttttagagaatgg 392
![Page 77: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/77.jpg)
Chapter 2 MATERIAL AND METHODS
Genetics of Learning Disabilities 47
18c Gcagctgctcttaaatgcaaa gctgcagccattcaattaca 500
18d Ttcttcctctgattgacctgtg gatgcaagccaggaaaatg 456
(Continued…)
Exon Forward primer Reverse primer Product size
18e Gcagcttgatgttcccttct accttgtccgaaagcagatg 478
18f Ttttgaatcagaagagcagctt gatggtacagggcgtacaaga 439
18g Cacgctgcattttaccttga caaaggcaacataaatgtgcta 580
18h gcagttttcttgagagagaggaa gaagacatattcaacacatgcaca 538
18i Taagggttgcagaggaatgc gcaaagatactgggcaatgaa 581
18j Gcccactgaagcttttggta ccaagcaaatagagctgcaa 633
18k Gcctctaaaagcagcctgaa gacaatggcattctgctgtg 667
18l Tgatagcagctcttttctgctg cagggccaaagttgattatga 488
18m Tggaagataaatggtcacctca tggtcacaagaaaactggaaa 468
19 gaaaatatcaacaaaaccaacca caccactgttctcagaagactca 486
20 ttgactgaaatagatgtgtgtgaaa cttctttcgtgtgcgtgtgt 451
21 Tgacagtcagtgctcttgtcac acccttggcttacaccttca 583
22 ggtgaaaggctaaatgttgtacg tgctttctacactctgagttatgagtt 488
23 Tgagttattctaccggctaatgc aatgcctctgtggaaagctg 453
24 Actctgggccatgttctcac tggtcgataaatgctgtcca 573
25 Tttcatcctaagactcttgcaca cctttctgccattcttgagg 435
26 Gcaaaaagcaggtttgaaca aaagtcctttgcacttgctg 447
27 Accaaacattccattcttattca gcgacagagcaagagagacc 451
28 tgataaaaatgaagaatgtaatgaaca tgaagttctcccacctctttg 400
![Page 78: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/78.jpg)
Chapter 2 MATERIAL AND METHODS
Genetics of Learning Disabilities 48
Table 9: Sequencing primers for SOX3
Forward Primer Reverse Primer
Sox3_1 Agggctccccgaactttt gcttgtgtgggtgtccctac
Sox3_2 gagtcccagggccttttc gcggtcggtacttgtagtcc
Sox3_3 gaacgccttcatggtatggt catgtcgtagcggtgcat
Sox3_4 gcgcctggacacgtacac ggtggcaggtacatgctgat
Sox3_5 tgcagtacagcccaatgatg cccgacagctacagcaaaac
Sox3_6 ctgacccacatctgagcac aaccacgaggaaaacagacg
Sox3_7 cactcctcctcctgagttcc gcttgaaaaccctgaaacaaa
Sox3_8 tttctgccgtgatctgtttg tcaccagtagttaaaaggaaacca
Table 10: Sequencing primers for ARX3 poly A repeats
Exon Frorward Primer Reverse Primer
ARX_ex2_polyA cctccttgggtgacagctc Gctcccctaagagcagcag
Table 11: Sequencing primers for GPRASP2
Exon Forward Primer Reverse Primer
GPRASP2_ex5_1 cagctgtcccacctagcatt ctcttccccagccttctttt
GPRASP2_ex5_2 tgtggttgaggtttagactacgg tctgcctgtgacactgcttc
GPRASP2_ex5_3 agtaggtggcgctcgttcta gtctgatgtttagccctgtgc
GPRASP2_ex5_4 gagtctgggttctggtcagc tcctcaaacctgggttcttg
GPRASP2_ex5_5 taagcagtcctgggttttgc agtgacctcgtcccaggttt
GPRASP2_ex5_6 gagatgaggcctgctttgac Aaggatcccgaattttgtcc
GPRASP2_ex5_7 cgggaaattcgagagcatc Aaggagagaaacccggacat
![Page 79: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/79.jpg)
Chapter 2 MATERIAL AND METHODS
Genetics of Learning Disabilities 49
GPRASP2_ex5_8 gtgaggaaacccttgcacat Ccacctcaggatcattttgg
GPRASP2_ex5_9 gtcttgagccgcttatttctg Gaagggtcacttatgccaattt
GPRASP2_ex5_10 caaactcttgttttgagctgga Tcagggcccacaataatctc
2.5.1 DNA SEQUENCING
Sequencing of the entire candidate regions was performed using POP-7 polymer and an array
length of 36cm in an ABI 3130XL genetic analyzer (Applied Biosystems). Protocol followed for
performing sequencing is as following:
2.5.1.1 PCR Amplification of the region
Polymerase chain reaction (PCR) was performed using a standard protocol in order to amplify
genomic fragments for sequencing. Primers used for sequencing are summarized in Table 8.
Primers were designed in a way that the product size does not exceed 500 bp. Composition of
master mix and thermal cycling conditions used are summarized in Table 12 and 13 respectively.
Table 12: Composition of Master mix used for PCR
Primers 10-20 pmol of each
dNTPs 200 µl of each
Taq DNA polymerase 1U
PCR Buffer 1X
Template DNA 50 ng
MgCl2 1.5 mM
Total Volume 25 µl
Table 13: Thermal cycling conditions of sequence amplification
Step Temperature °C Duration No of Cycles
Denaturation 95 5 min 1
Denaturation 95 30 sec
![Page 80: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/80.jpg)
Chapter 2 MATERIAL AND METHODS
Genetics of Learning Disabilities 50
Touch Down Annealing
Extension
52-66 30 sec 40
72 30 sec
Final extension 72 7 min 1
For highly GC rich regions denaturation was performed at 98ºC and hot start Taq Polymerase
used with Betain and DMSO (Qiagen).
2.5.1.2 Preparation of PCR products for sequencing
PCR products were checked on 1% agarose gel electrophoresis. PCR product was treated with
Exonuclease I and Shrimp alkaline Phosphate in a volume of 5 µl. Volume of PCR product
depends on the intensity of bands visualized on agarose gel. Samples were then incubated
initially at 37°C for 15 minutes and then shifted to 80°C for 20 minutes.
Table 14: Composition of Exo-SAP treatment
PCR product 0.5 – 1 µl
Exo I 0.25 µl
SAP 0.25 µl
Double Distilled Deionised water 5.58 µl
2.5.1.3 Sequencing PCR reaction
BigDye terminator V.1.1 Cycle Sequencing Kit (Applied Biosystems) was used for sequencing
PCR reaction. Sequencing PCR was performed as follows:
2.5.1.4 Sequencing PCR Master Mix
After treatment with Exo-Sap (Table 15) to the amplified product, BigDye amplification was
performed (Table 16).
Table 15: Master mix for sequencing PCR
Exo-Sap treated template 5 µl
Primer (10 pmol) 0.25 µl
![Page 81: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/81.jpg)
Chapter 2 MATERIAL AND METHODS
Genetics of Learning Disabilities 51
Deionized distilled water 2.25 µl
5X sequencing Buffer 1.5 µl
BigDye reaction mix 1.0 µl
Total volume 10 µl
Table 16: Thermal cycling conditions used for sequencing
Step Temperature °C Duration No of cycles
Denaturation 95 1 min 1
Denaturation 95 10 sec
25 Annealing 50-60 10 sec
Extension 60 4 min
2.5.1.5 Purification of sequencing PCR products
To precipitate the purified DNA, 96 well plate containing samples was spin down for 20 sec at
3000 rpm. Lid was removed carefully and 1µl of 3M Sodium Acetate, 1µl of 125 mM EDTA
and 25 µl of 96% ethanol were added in each sample. After leaving at room temperature for 15
minutes, plate was centrifuged at 4000 rpm for 30 minutes. All the supernatant was discarded
and 60 µl of 70% ethanol was added in each sample and again centrifuged at 4000 rpm for 10
minutes. After discarding supernatant, plates were placed upside down on blotting paper and
centrifuged to get rid of excess ethanol at 170 rpm for 1 minute. Pellet was dried at 65°C in oven
for 15 minutes. 10 µl of Formamide was added in each well followed by brief spin to collect the
entire sample at the bottom of tube and analyzed in ABI 3130 XL genetic analyzer.
2.5.1.6 Sequencing data analysis
Sequences were analyzed initially by Sequencing Analysis 5.2 (Applied Biosystems). Analyzed
sequences were viewed by using ChromasPro v.1.43 software by aligning them with control
sequences obtained from www.ncbi.nlm.nih.gov. The obtained sequences were analyzed in silico
for mutations.
2.5.1.7 Restriction analysis
![Page 82: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/82.jpg)
Chapter 2 MATERIAL AND METHODS
Genetics of Learning Disabilities 52
Restriction analysis was performed using appropriate restriction enzymes selected by using
online web based software NEB cutter V2.0 (http://tools.neb.com/NEBcutter2/index.php). Each
restriction digestion reaction was carried out using appropriate buffer according to
manufacturer’s instructions. Restriction fragments were analyzed by horizontal gel
electrophoresis using 2-3% agarose gel.
2.6 GENOME WIDE SCREENING (SNP6)
Genome wide scan was performed by homozygosity/autozygousity mapping using single
nucleotide polymorphism or SNPs (Lander and Kruglyak, 1995). Homozygosity mapping is
employed in rare recessive diseases as a useful tool due to the fact that recessive disease alleles
appear homozygous in families due to intact genetic segments inherited as a result of
consanguinity. SNPs genotyping was carried out for affected individuals by using the GeneChip
Human Mapping 6.0 array (Affymatrix) with NSPI enzyme according to manufacturer’s protocol
(www.affymatrix.com). Following enzyme digestion with NSPI, genomic DNA (250 ng) was
ligated to adaptors that recognized the cohesive four base pair overhangs. Fragments of different
sizes/length obtained by restriction enzyme digestion were substrates of adapter ligation.
Adapter-ligated DNA fragments ranging in size from 200-1100 bp were amplified by adapter
sequences and recognized by generic primer. Amplification of DNA was followed by
fragmentation, labeling and hybridization to GeneChip Human Mapping 6.0 array (Affymatrix),
scanned by using scanner and analyzed on computer. Array image data was acquired and
analyzed with Affymetrix GeneChip Operating Software (GCOS) 1.4. Median physical distance
measured between the SNPs was 2.5 kb and average distance was 5.8 kb. Average
heterozygosity of SNPs was 0.30. the plateform consists of 906,600 SNPs including Tag SNPs,
SNPs from X and Y Chromososmes, Mitochondrial SNPs, and SNPs in recombination hot spots.
Platform also contains 946,000 copy number probes. AutoSNPa (Carr et al., 2006) software was
used for the homozygosity mapping and sorting of genomic regions with cutoff value 30-90 on
the basis of homozygous region obtained with more homozygosity more cutoff value. SNP allele
calling was done with Affymetrix GeneChip Genotyping Analysis Software (GTYPE) 4.1.
Chromosome analysis suit was used to visualize the results. To get inference related to Copy
![Page 83: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/83.jpg)
Chapter 2 MATERIAL AND METHODS
Genetics of Learning Disabilities 53
Number first signal intensities were calibrated and genotype calls were computed into birdseed
files, these signals intensities were converted to copy number calls. Genotyping Console
Software from affymetrix was used to analyze LOH and Copy Number variations. Further
analysis of selected regions was carried out by genotyping all family members using
microsatellite markers and PCR amplification.
2.7 TAQMAN COPY NUMBER ASSAY
To perform copy number assay by TAQMAN, DNA was quantified and each sample was diluted
to final concentration of 5 ng/µl with nuclease free water. Along with samples non template
control was also used to show the background fluorescence and for the detection of
contamination. Four replicates of each sample including non template control were used.
Taqman Copy number assay reaction mix used for real time PCR is summarized in Table 17.
The probes used for analysis are:
Hs03084882_cn
Hs03084432_cn
Table 17: Taqman Copy number assay reaction mix for real time PCR
2X taqman Genotyping Master Mix 10.0 µl
Taqman Copy Number assay , 20X working stock 1.0 µl
Taqman Copy Number Reference Assay 20 X 1.0 µl
Nuclease free water 4.0 µl
Total Volume 16.0 µl
Taqman Copy Number assay and the Taqman Copy Number reference assays were completely
thawed and gently vortexed to mix them. Tubes were briefly spun to bring contents to the bottom
of tube. Taqman genotype master mix was swirled to mix thoroughly. Required volumes of
reaction components were combined in microcentrifuge tubes. Tubes were inverted and flicked
to mix the contents thoroughly, then centrifuged briefly.
![Page 84: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/84.jpg)
Chapter 2 MATERIAL AND METHODS
Genetics of Learning Disabilities 54
In each well of the reaction plate, 16 µl of reaction mix was added and 4 µl of genomic DNA
was added per well to make total sample volume to 20 µl. Reaction mix and DNA were mixed
by pippeting up and down several times. Plate was sealed and briefly centrifuged to bring all the
components at the bottom of the wells. Wells were inspected to ensure the uniform reaction
volume.
Settings used to carry out real time PCR are summarized in Table 18, while Table 19 and Table
20 summarise settings for Taqman Copy number assay and Taqman Copy number Reference
assay respectively.
Table 18: Settings for Real Time PCR used in Taqman assay
System 7300/7500/7500 Fast System (SDS Software v1.X)-Absolute
quantitation plate document) Version 1.3.1
Run Standard mode
Reaction Plate 96 well
Ramp speed/model Standard
Table 19: Settings for Taqman Copy Number assay
Detector name FAM
Target name N/A
Reporter FAM
Quencher none
Table 20: Settings for Taqman Copy Number Reference Assay
Detector name VIC
![Page 85: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/85.jpg)
Chapter 2 MATERIAL AND METHODS
Genetics of Learning Disabilities 55
Target name N/A
Reporter VIC
quencher TAMRA
Plate was loaded on Real Time PCR machine and reaction carried out using following
parameters (Table 21):
Table 21: Parameters for Real Time PCR
Stage Temperature °C Time
Hold 95 10 min
1 Cycle 95 15 sec
40 Cycles 60 60 sec
2.7.1 ANALYSIS OF RESULTS
In the Real Time PCR software, results were analyzed with manual Ct threshold-0.2, autobase
line –on. Copy number analysis was performed using Copy Caller Software (Applied
Biosystems). The system compares the test sample with reference and calculates the possible
copies of the segment. Graphical Interface represents the possible copies of the segment in form
of bars
![Page 86: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/86.jpg)
Chapter 3 RESULTS AND DISCUSSION
Genetics of Learning Disabilities 56
3 RESULTS AND DISCUSSION
For the families diagnosed with a mild mental retardation and microcephaly, in which all
affected individuals were able to do self care but had learning deficiency of speech and other
cognitive behaviors, possible linkage to known MCPH loci was performed using highly
polymorphic microsatellite markers (Table 7). As mutations in ASPM gene are reported to be the
most frequent cause of microcephaly in Pakistan (Gul et al., 2006); therefore, these families were
tested for homozygosity in all affected individuals with microsatellite repeat markers flanking
ASPM. Markers include D1S2757, D1S2816, D1S1660, D1S2622, D1S373, D1S1723 and
D1S2655. Out of 20 families with MCPH, six families were linked to ASPM. This observation is
a deviation from what is expected from families affected with microcephaly in Pakistani
population, where 60 to 70 % of the families are usually reported, reason for this deviation could
be small family size and in sufficient number of samples collected from each family for analysis.
Results observed in these families are reported in publication (Hussain et al., 2013). In case of
Family D linkage to ASPM locus was not carried out because of a single sample (sample V:1).
This phenotypically unaffected individual (mother of affected persons in left loop (Figure 6)
appeared to be homozygous at ASPM locus excluding the locus as candidate in this family.
Remaining families were genotyped with markers from all seven MCPH loci and none of them
show linkage to any of those. Bi-directional sequencing was performed using fluorescent dye
chain termination technique on an ABI prism 3130 XL sequencer. Sequences were analyzed by
using chromasPro software version (ChromasPro 1.34) and were compared to reference
sequences (http://www.ncbi.nlm.nih.gov/ and http://genome.ucsc.edu/).
3.1 FAMILY A
Pedigree of the family suggested autosomal recessive mode of inheritance so homozygosity
mapping using STR markers was used to find linkage region. As initiation clinical investigation
indicated microcephaly so the family was tested with markers selected for reported MCPH loci
(Table 7). This large Family with seven affected individuals showed linkage to ASPM gene at
MCPH 5 locus with LOD score of 3. All 28 exons of the gene including exon intron boundaries
were sequenced bi-directionally (Sequences of the primers given in Table 8). Analysis of
sequences (Figure 10) revealed a novel mutation in ASPM gene at position c.6131C>T in exon
![Page 87: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/87.jpg)
Chapter 3 RESULTS AND DISCUSSION
Genetics of Learning Disabilities 57
18, which cause change in protein sequence p.Q2051X resulting in truncated protein with 2051
amino acids. Variation was confirmed in all affected individuals by using FatI restriction
enzyme. This mutation is a novel mutation and results in an early stop codon resulting in non
functional ASPM protein and ultimately resulting in abnormal neurogenic mitosis. The protein
change p.Gln2051* is located in IQ motif of ASPM protein, this motif serves as binding site for
different EF-hand proteins including the essential and regulatory myosin light chains, calmodulin
and CaM like proteins (www.ebi.ac.uk/interpro). Truncation at this site makes ASPM protein
incabable of interacting with cytoskeleton proteins and proper cleavage plane for cell division is
not ensured resulting in asymmetrical cell division.
Figure 10: Representative DNA sequence chromatogram from exon 18 of ASPM gene in
homozygous affected individual from Family A. Highlighted nucleotide shows site of nonsense
mutation c.6131C>T.
3.2 FAMILY B
Family B is small with only two affected individuals having normal parents so the autosomal
recessive mode of inheritance was deduced. This small family with just two affected individuals
showed linkage to ASPM gene in MCPH5 region. Therefore, all 28 exons of the gene and intron-
exon exon boundaries were sequenced (Table 8). On analysis of sequences, a nucleotide variant
c.9557C>G was found in exon 23 (Figure 11). This variation causes a nonsense mutation
p.S3186X resulting in a truncated protein with 3186 amino acids. Mutation was found to be
homozygous in both affected individuals. This mutation is recurrent mutation in Southern Punjab
and has already been reported (Bond et al., 2002; Muhammed et al., 2009). This mutation also
![Page 88: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/88.jpg)
Chapter 3 RESULTS AND DISCUSSION
Genetics of Learning Disabilities 58
results in truncated ASPM protein by an early stop codon in IQ motif of protein. As discussed in
case of family A, truncation at this motif results in inability of ASPM to interact with
cytoskeleton proteins and make spindle fibers during neurogenesis resulting in asymmetrical cell
division. So far this mutation is reported from five different families from various regions of
Pakistan.
Figure 11: Representative DNA sequence chromatogram from exon 23 of ASPM gene in
homozygous affected individual from Family B. Highlighted nucleotide shows site of nonsense
mutation c.9557C>G
3.3 FAMILY C
Family C has six affected individuals in two loops but samples from only one loop were
available. As both parents of the family were dead so homozygosity mapping with the STS
markers was skipped and affected individuals were directly sequenced. Two other families with
just one affected individuals were also sequenced directly for ASPM, resulting in total six
affected individuals from three different families. In exon 17 of gene ASPM at locus MCPH5,
c.3978G>A was found (Figure 12). This variation results in nonsense mutation p.T1326X
causing protein truncation just after 1326 amino acids. This truncated mutation is also found in
IQ motif of the ASPM protein and also results in asymmetrical cell division at the time of
neurogenesis. These families were sampled from Southern Punjab but this recurrent mutation has
already been reported (Muhammed et al., 2009; Gul et al., 2006; Gul et al., 2007; Bond et al.,
2002; Kouser et al., 2010). So far thirty two different families are reported from Pakistan
carrying this mutation and all these families were sampled from same geographical region and
![Page 89: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/89.jpg)
Chapter 3 RESULTS AND DISCUSSION
Genetics of Learning Disabilities 59
the same mutation is also reported in two Indian families which suggests a founder mutation with
a common ancestral origin in Pakistan. Interestingly another mutation c.3979C>T is also been
reported (Hussain et al., 2013) indicative of a mutational hotspot in exon 17.
Figure 12: Representative DNA sequence chromatogram from exon 17 of ASPM gene in
homozygous affected individual from Family C. Highlighted nucleotide shows site of nonsense
mutation c.3978G>A
3.4 FAMILY D
This family was sampled from South Punjab and has three loops. As all individuals show
microcephaly so linkage analysis was performed using markers for all seven MCPH loci (Table
7). The family appeared to be linked with ASPM gene at chromosome 1 MCPH5 locus, but
mother in left loop (Sample V:1) who was phenotyppicaly unaffected found genetically
homozygous at this locus, therefore family was considered to be excluding this loci. As deviation
of only one individual could not be significant therefore, in order to avoid any chance of error,
ASPM gene was sequenced in selected individuals but no mutation was found.
To have a broader picture, only selected samples from family were subjected to genome wide
scan by Affymetrix SNP6. Selected samples included V:1 as she is the phenotypically unaffected
female who has homozygosisty at ASPM locus, her affected son VII:1 was also selected.
Another loop comprising unaffected father VI:7 and his unaffected wife VI:6 and their twi
affected children VII:9, VII:8 and unaffected children VII:10, VII:7. Genome wide search was
carried out by homozygosity mapping also known as autozygosity mapping (Lander and Bostein,
1987). Homozygosity mapping takes advantage of families that are genetically homozygous for
![Page 90: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/90.jpg)
Chapter 3 RESULTS AND DISCUSSION
Genetics of Learning Disabilities 60
recessive disease alleles by virtue of consanguinity. Genome wide search was carried out using
single nucleotide polymorphisms (SNPs) which provide to date the most powerful tool for
association and linkage studies. The SNP array 6.0 is the most powerful solution with 1.8 million
genetic markers (906,600 SNPs and 946,000 CNVs). The array contains a total of 946,000 non
polymorphic copy number probes. These probes, 744,000 originally selected for their spacing
and 202,000 selected based on known copy number changes reported in the Toronto Database of
Genomic Variants (DGV), enable to detect denovo copy number changes and perform
association studies by genotyping both SNP and known copy number polymorphism (CNP) loci
(McCrroll et al., 2008). The median inter-marker distance over all, combining 108 million SNPs
and copy number markers CNVs is less than 700 bases.
Results were analyzed by using Genotyping Console software (Applied Biosystems) and then
viewed by Chromosome Analysis Suit (Applied Biosystems). As pedigree of family indicates
autosomal recessive mode of inheritance, therefore family was analyzed to find a homozygous
region but not a single candidate region was found by homozygosity mapping. SNP6 analysis
revealed presence of homozygosity around ASPM gene in affected individuals including VII:1,
VII:9 and VII:8, in case of Sample V:1, phenotypically un affected female with affected son,
had a small homozygous region around ASPM and this confirmed the results of microsatellite
marker. By evaluating deletion and insertion using CNV calls of SNP6.o array A deletion of
44,589 bp was found at chromosome 1 between 194,096,943-194,141,531, 1,178,350 bp
downstream to ASPM gene in a gene desert segregating with the disease in family. LOD score of
5.5 was calculated for this deletion. Figure 13 represents the Homozygosity and deletion present
in this family.
![Page 91: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/91.jpg)
Chapter 3 RESULTS AND DISCUSSION
Genetics of Learning Disabilities 61
Figure 13: Graphical representation of the MCPH5 locus.q31.3 at chromosome 1. Purple
horizontal bars indicate homozygous regions; green bars indicate deletion in heterozygous
condition while yellow bars indicate deletion in homozygous form. Roman Integers represents
the generation and Arabic numerals represent the sample number within a particular generation.
This high LOD score of 5.5 makes this deletion a powerful candidate as cause of disease.
Therefore, to cross check the deletion and presence of deletion in other family members Taqman
Copy Number Assay was performed. In order to perform Taqman assay nine samples wer
selected from the family representeing all three loops. Samples included affected VII:1 and his
un affected mother V:1 from first loop, an affected girl VIII:1 was slected from second loop, and
to represent loop three normal parents VI:6, VI:7, two affected siblings VII:8, VII:9, and two
unaffected siblings VII:7, VII:10 were sleceted. Copy number variations are important
polymorphisms that can influence the expression of genes within and close to the rearranged
region. This allows transcription levels to be higher or lower than those that can be achieved by
control of transcription of a single copy. Recently, CNVs have been associated with genetic
diseases such as cancer, immune disease and neurological disorders. Taqman copy number
assays are designed to detect and measure copy number variation in the human genome using
real time PCR and un- quenching of fluorescent probes for the target sequence (Mayo et al.,
![Page 92: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/92.jpg)
Chapter 3 RESULTS AND DISCUSSION
Genetics of Learning Disabilities 62
2010). Two probes Hs03084882_cn and Hs03084432_cn, present within the deleted region but
near the borders were selected. Real time PCR was used to analyze the Copy number. Results
were analyzed and viewed on software Copy Caller V.1.0 (Applied Biosystems). All affected
individuals ( VII:1, VII:9, VII:8 and VIII:1) show zero copy number around these probes,
confirming the deletion of the segment from the samples while parents (V:1, VI:6, VI:7) and
normal sibling (VII:10) showed copy number one while normal sibling (VI:7) show copy
number two (Figure 14). All these observation completely endorsed SNP6 results completely.
Figure 14: Analysis of copy numbers by Taqman probe assay Hs03084432. Sample 1-3 show
affected individuals which carry deletion in homozygous form, sample 4-6, 8 show carriers of
deletion in heterozygous form, sample 7 contains both copies of probe means no deletion.
![Page 93: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/93.jpg)
Chapter 3 RESULTS AND DISCUSSION
Genetics of Learning Disabilities 63
Figure 15: Analysis of two Taqman probes Hs03084432 in blue and Hs03084882 in cyan
color. Samples 1, 2, 3, and 11 are affected individuals and show zero copy number of probes.
Samples 4, 5, 6 and 10 show 1 copy number, while all the other samples from control population
show copy number more than 1.
To analyze frequency of deletion in general population, this deletion was screened using
Chromosome analysis suit for SNP6 data of almost 50 samples from Pakistani and Danish
population as well. None of the samples indicated presence of the deletion. Taqman Copy
Number assay was also performed for some of the random unaffected non microcephallic
individuals from Southern Punjab to exclude the polymorphism. These samples included Ctr:1,
Ctr:2, Ctr:3, Ctr:4, Ctr:5, Ctr:6, Ctr:7, and Ctr:8. To check samples from family in same
experimental conditions all available affected samples ( VII:1, VI:2, VI:3, VII:9 and VII:8) as
well as all available unaffected samples ( VI:6, VI:7, V:1, VII:10, VII:7, VI:6) were analysed.
The results confirm presence of deletion only in the family and no other sample was found from
![Page 94: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/94.jpg)
Chapter 3 RESULTS AND DISCUSSION
Genetics of Learning Disabilities 64
control population to have this deletion mutation (Figure 15). After confirmation of deletion as a
candidate cause of disease, break points of the deletion were mapped. As SNP 6 analysis exploits
SNPs as well as Copy number polymorphisms. So one end of the deletion was reported between
two Copy number probes CN_461130 and CN_461131 at point 194, 096,943 and the other end
was reported between two SNPs SNP-A-2036204 and SNP-A-8374585 at position 194,141,531.
Figure 16 depicts the position of deletion on chromosome 1. Forward primers for mapping the
deletion was designed on one side between CN-461130 and CN-461131 while on other side
reverse primers were designed between SNP-A-2036204 and SNP-A-8374585. Different sets of
primers were used to check amplification of the region (Figure 16). Amplification was expected
in samples with deletion as without deletion product is too long to be amplified even with long
PCR.
![Page 95: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/95.jpg)
Chapter 3 RESULTS AND DISCUSSION
Genetics of Learning Disabilities 65
Figure 16: A) Position of deletion on chromosome1. B) position of deletion with respect to
ASPM. C) SNPs and CNVs indicating the borders of the deletion. D) CNVs at the left
border of the deletion. E) SNPs at the right border of the deletion. F) primers’ position
designed for breakpoint mapping.
![Page 96: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/96.jpg)
Chapter 3 RESULTS AND DISCUSSION
Genetics of Learning Disabilities 66
Genome wide scan (GWS) routinely implicates variations within gene desert and other types of
non-coding DNA in the etiology of disease (Liu et al., 2011). While the presence of non-
annotated transcripts or non-coding RNAs may explain some of the non-coding disease
associations. These observations also have been interpreted as evidence that many of the
associated non coding regions harbor variants that alter the activity of long-range cis regulatory
elements controlling gene expression. Enhancers are such type of long-range elements,
functioning over up to mega base long genomic distances to regulate the temporal and tissue
specific expression patterns of their target genes (Nobrega et al., 2003). The deleted region was
searched in UCSC genome browser to look for the presence of conserved regions and to find any
regulatory region (Figure 17). Two candidate regions were found as possible regulatory regions.
Figure 17: Window of UCSC genome browser indicating two candidate regulatory regions
present in the deleted fragment.
![Page 97: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/97.jpg)
Chapter 3 RESULTS AND DISCUSSION
Genetics of Learning Disabilities 67
Gene regulation involves a complex interplay between the proximal promoter and distal genomic
elements (such as enhancers) which work in concert to drive precise spatio-temporal gene
expression. The experimental localization and characterization of gene regulatory elements is a
very complex and resource-intensive process. Such cis-acting regulatory elements can be located
upstream or downstream or within introns of the transcription unit (Howard and davison, 2004).
Locating the components of the developmental regulatory code in the human genome is a central
pre-occupation of genomics, and the first barrier to identifying human-specific regulatory
changes relevant to human evolution. Cis-acting regulatory DNA elements, such as promoters,
enhancers and insulators play an essential role in establishing precise
temporal and tissue-specific
gene expression patterns. They are frequently conserved among species and may be located as
far as 1.5 Mb in either direction. Several studies have identified such elements as essential
regulators of developmental gene expression, that have the potential to switch genes off and on
in particular types of cells/tissues during certain developmental time points. Given the
importance of gene regulation in development, it is expected that a large number of
developmental defects are caused by mutations affecting such regulatory elements (Dathe et al.,
2009).
Zinc finger protein CCCTC-binding factors (CTCF) play a critical role in transcription regulation
in vertebrates. CTCF is identified to be the vertebrate insulator protein (Bell et al., 1999) and so
far it remains as the only major protein implicated in establishment of insulators in vertebrates
including those involved in regulation of gene imprinting and mono-allelic gene expression
(Felsenfeld et al., 2004). There has been a great interest in identifying where potential insulators
are located in the eukaryotic genome, because knowledge of these elements can help understand
how cis-regulatory elements coordinate expression of the target genes. Kim et al. (2007) have
located the sites of CTCF binding in the human genome using chromatin immune-precipitation
followed by detection with genome-tiling microarrays. The region between ASPM and the
suspected regulatory region was scanned for the insulator elements and no CTCF or insulator
element was found in this region.
![Page 98: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/98.jpg)
Chapter 3 RESULTS AND DISCUSSION
Genetics of Learning Disabilities 68
I assume that as the mutations of the gene ASPM in homozygous form, in most cases frame shift
or nonsense mutation resulting in null alleles (no functional protein product) lead to
microcephaly. If the enhancer element is embedded in the deleted region 1.2 Mb downstream for
ASPM then no transcription of the ASPM takes place without the enhancer elements. So if
deletion is present in heterozygous form means one copy of the enhancer element is present, it is
sufficient to promote the transcription of ASPM to get normal phenotype. In case both copies of
enhancer are deleted then the result is a complete lack of transcriptional activity of ASPM or just
a minor activity. Therefore, the hypothesis in this case is looping back structure for the enhancer
element 1.2 Mb downstream to ASPM, and without this loping back there would be no
transcription (Figure 18). The enhancer element present in this deleted region is a cis-acting
element and c.FOS and Hey1 are possible elements as they are found both in ASPM promoter
and deleted region.
Figure 18: Loop back hypothesis for enhancer element and binding to ASPM promoter. Cis
acting enhancer element present in the deleted region containing cFOS and Hey1, also present in
ASPM promoter region loops back and bind with ASPM promoter to start transcription.
![Page 99: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/99.jpg)
Chapter 3 RESULTS AND DISCUSSION
Genetics of Learning Disabilities 69
3.5 FAMILY E
This family affected with stuttering was sampled from Bahawalnagar, Southern Punjab. Pedigree
analysis show 8 affected male individuals. Three affected siblings have three affected maternal
uncles indicating a well defined X-linked recessive mode of inheritance. Therefore, X
chromosome was scanned to find the causative sequence variant in the family. There are two
genes reported to be associated with X-linked stuttering SOX3 and ARX.
SOX3 belongs to a gene family related to SRY, the testis determining gene. Bylund et al. (2003)
found that SOX1, SOX2 and SOX3 were co-expressed in self-renewing progenitor cells and
acted to inhibit neuronal differentiation. On the basis of sequence homology, SOX3 is closely
related to SOX1 and SOX2, and the products of all 3 genes belong to the SOXB1 subfamily and
are expressed throughout the developing central nervous system (Collingnon et al., 1996).
Sequence variations in SOX3 results in stuttering associated with hypopituitarism (Solomon et
al., 2004). Three exons and exon-intron boundaries of SOX-3 as a candidate gene were
sequenced (Table 9), but no sequence variant was found to be a cause of stuttering in this family.
Other candidate gene ARX (aristaless-related homeobox gene) was found to be associated with
Partington disease (Frints et al., 2002). Expansion in Alanine repeats due to the duplication of 24
bp results in mild to severe mental retardation (Partington et al., 2004). So primers were
designed to sequence poly adenine repeats (Table 10), no duplication was found in the family.
As both candidate genes present on X-chromosome show no sequence variant segregating with
disease in the family; therefore, third candidate gene GPRASP was selected from gene network
and found closely related to function with already reported genes causing stuttering in Pakistani
population (GNPTAB,) on chromosome 12 and (GNPTG, NAGPA) on chromosome 16 (Kang et
al., 2010). Gene regulatory network is a collection of DNA segments in the cell which interact
with each other and with other substances in the cell, thereby governing the rates at which genes
are transcribed into mRNA. GNPTAB, GNPTG and NAGPA are reported to encode enzymes
that generate the mannose-6-phosphate signal, which directs a diverse group of hydrolases to the
lysosome. Deficits in this system are associated with the mucolipidoses, rare lysosomal storage
disorders that are most commonly associated with bone, connective tissue and neurological
symptoms. Using KEGG (http://www.kegg.jp/ ), an online available tool to study gene networks,
![Page 100: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/100.jpg)
Chapter 3 RESULTS AND DISCUSSION
Genetics of Learning Disabilities 70
GPRASP2 located on X-Chromosome was found to be present on regulatory network of
GNPTAB (Figure 19).
Figure 19: Gene network for lysosomal protein, red circle is candidate gene on X-
Chromosome GPRASP2 found related to already reported gene GNPTAB involved in stuttering.
Nodes in the network denote genes.
Sequencing of exons and exon-intron boundaries of GPRASP2 generated no sequence variant
responsible for the disease. Therefore, after exclusion of three candidate genes, equally spaced
markers were also designed to map whole X-chromosome especially dense around candidate
genes to find if any of the regulatory regions involved. Chromosome mapping is the assignment
of genes to specific locations on a chromosome, using STS markers linkage maps are constructed
which does not show the physical distances between genes but rather their relative positions, as
determined how often two genes loci are inherited together. Table 7 summarizes STS markers
chosen for mapping X-Chromosome. Haplotypes were constructed and analyzed to find any
candidate loci. Figure 20 depicts position of markers and genes on Chromosome X.
![Page 101: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/101.jpg)
Chapter 3 RESULTS AND DISCUSSION
Genetics of Learning Disabilities 71
Figure 20: Position of candidate genes and markers on X-chromosome.
![Page 102: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/102.jpg)
Chapter 3 RESULTS AND DISCUSSION
Genetics of Learning Disabilities 72
Figure 21: Pedigree of Family E segregating X-Linked recessive form of familial stuttering.
Microsatellite markers on chromosome X used for mapping and linkage analysis are indicated to
left. The disease associated haplotype is shown beneath each symbol.
![Page 103: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/103.jpg)
Chapter 3 RESULTS AND DISCUSSION
Genetics of Learning Disabilities 73
Haplotype is a combination of alleles at different loci on the chromosome that are transmitted
together. A haplotype may be one locus, several loci or an entire chromosome depending on the
number of recombination events that have occurred. Haplotype is often referred to an individual
collection of short tandem repeats (STR) allele mutations within a genetic segment. To perform
haplotyping for the family understudy selected samples including un affected grandparents (V:4,
V:3), un affected parents (VI:1, VI:2) affected maternal uncle (VI:3) and affected brothers
(VII:1, VII:2 and VII:3) were selected. A set of 20 microsatellite markers for X-chromosme
(Table 7) were used. After haplotyping no candidate region was found to be involved in
stuttering and segregating with disease in this family (Figure 21). As male are hemizygous for X-
chromosome, no significant achievement was made using this methodology, a large haplotype
block was observed. Therefore, to do fine mapping and also to find indels in X-chromosome
SNP6 analysis was performed for the whole family. SNPs were chosen as marker of choice due
to their abundance in the genome, their bi-allelic nature, and because they are stably inherited
from generation to generation (Brookes, 1999). Affymetrix SNP6 array was performed and
results were analyzed using Chromosome Analysis Suit software. Homozygosity mapping
revealed absence of any candidate region on the chromosome therefore the results were analyzed
to see any deletion or insertion in chromosome X. Neither any deletion nor insertion segregating
with the disease in the family was found indicating absence of any susceptibility locus on
Chromosome X (Figure 22).
![Page 104: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/104.jpg)
Chapter 3 RESULTS AND DISCUSSION
Genetics of Learning Disabilities 74
Figure 22: Graphical representation of results of Affymetrix SNP6 analyzed by
Chromosome analysis suit indicating homozygous regions and indels on X-chromosome. Results
indicate absence of any candidate region or indel on the chromosome segregating with disease.
A trait which appears only in male could be X-linked, refers to traits carried on X-chromosome,
or the trait could be sex-limited. Sex limited trait or sex influenced trait refers to special cases in
which sex hormones or other physiological differences between male and female alter the
expressivity and penetrance of a gene. The incidence of stuttering has always been reported to be
higher in males than in females. Many reasons are under consideration for this unequal sex ratio;
however, environmental factors are considered most important (Kidd et al., 1978). Since no
candidate region or gene was found on X-chromosome; therefore, considering stuttering as sex
limited trait in this family, SNP6 data was analyzed for other chromosomes. A sole homozygous
region of 1,041,131 bp was found on chromosome 18 at position, 2,865,432 to 3,906,562
between SNP_A-8393251 and SNP_A-8503775 by autozygosity mapping (Figure 23).
![Page 105: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/105.jpg)
Chapter 3 RESULTS AND DISCUSSION
Genetics of Learning Disabilities 75
Figure 23: Graphical representation of results of Affymetrix SNP6 analyzed by
Chromosome analysis suit indicating homozygous regions on chromosome 18. Results indicate
homozygous region of 1,041,131 bp at position 18p11.3.
This homologous region residing on locus 18p11.32 – 18p11.31 overlaps with familial persistent
stuttering STUT 1 locus 18p11.3 – 18p11.2 and also with Dyslexia DYX-6 locus 18p11.2.
Linkage studies have implicated the 18p11.2 region in susceptibility to bipolar disorders and
schizophrenia with a parent-of-origin effect (Corradi et al., 2005).
UCSC genome browser (Figure 24) indicated the presence of seven candidate genes in the
homozygous region of 1,041,131 bp (Table 22). EMILIN2 encodes for an elastic fiber interacting
protein that confers elasticity to the extracellular matrix. Gene product is deposited extracellular
as a fine network; it is broadly expressed in connective tissues, has cell adhesion promoting
functions and particularly abundant in blood vessels, skin, heart, lung, kidney, and cornea
suggesting its fundamental role in process of elastogenesis in association with other extracellular
matrix constituents (Bressan et al., 1983; Colombatti et al., 1988).
![Page 106: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/106.jpg)
Chapter 3 RESULTS AND DISCUSSION
Genetics of Learning Disabilities 76
LIPN2 belongs to a family of nuclear proteins and there is no systemic characterization of this
gene. Three closely related members of the Lipin family; Lipin-1, Lipin-2, and Lipin-3 have
been identified in both mouse and human. Lipin-1 (LIPIN1) was originally characterized as a
candidate gene for mouse lipodystrophy and played an important role in lipid metabolism
(Peterfy et al., 2001).
MYOM1 is a structural constituent of the cytoskeleton thought to integrate the thin and thick
filaments while conferring elasticity to the M-band of the sarcomere in striated muscle (Trinick,
1991). It is member of immunoglobin super family, and binds extracellular matrix proteins
(Diamond et al., 1991), also plays an important role in the assembly and stabilization of
myofibrils (Speel et al., 1998).
MRCL2 and MRCL3 are myosin regulatory subunits which share nearly 100% identity at the
protein level and greater than 94% identity at the nucleotide level. Di-phosphorylation of the
myosin regulatory light chain subunit is thought to play a role in regulation of filament assembly
and reorganization of muscle cells (Iwasaki et al., 2001).
TGIF is a DNA binding homeo-domain protein that belongs to the three amino acid loop
extension homeobox family (Wotton et al., 1999). It is a transcription repressor with multiple
actions, including a role in retinoid-responsive transcription (Bertolino et al., 1995).
DLGAP1 is a member of the PSD95 domain containing family of molecules that are collectively
known as ‘Chapsyns’ for their function as a channel associated proteins. Chapsyns are generally
known to have one to three conserved domains: a binding domain found in the amino or carboxyl
regions, a sulfhydryl group, and a guanylate kinase domain in the carboxyl region (Kim et al.,
1997).
All these genes show diverse functions and on the basis of function none of them could be
chosen as candidate gene, therefore, sequencing of all the genes was tried and no mutation was
detected in coding regions of these genes. These genes are either involve in muscular movement,
extracellular and intracellular cytoskeleton components and ion channels involved in cell
signaling. All these genes could have possible impact on the phenotype as this complex
phenotype involves both muscular movements and neural coordination.
![Page 107: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/107.jpg)
Chapter 3 RESULTS AND DISCUSSION
Genetics of Learning Disabilities 77
Figure 24: Window of UCSC genome browser indicating candidate region revealed by
autozygosity mapping in Family E. Figure indicated presence of seven genes in the region.
Table 22: List of genes present at 18p11.32-p11.31
Gene Location Function Reference
EMILN2 2,837,028-2,904,090 Elastin Microfibril Interfacer 2;
highly expressed in fetal heart and
adult lung
Doliana et al., 2001
LPIN2 2,906,992-3,001,945 Mutations result in lipodystrophy:loss
of body fat, fatty liver. Similar to
KIAA0249
Reue et al., 2000
MYOM1 3,056,805-3,210,106 Myomesin 1; interconnects the major
structure of sarcomeres
Vinkemeier et al.,
1993
MRCL 3,237,528-3,246,234 Myosin regulatory light chain,
involved with actin cytoskeleton
Sitek et al., 2005
MYL12B 3,252,611-3,268,282 Myosin Light Chain; regulate activity
of non muscle Myosin
Iwasaki et al., 2001
TGIF1 3,402,072-3,448,406 Homodomain protein that act as
transcriptional repressors and co
repressors in retinoid and
transforming growth factor
Shen and Walsh,
2005
DLGAP1 3,488,837-3,835,296 Ion cluster protein associated with
NMDA receptors and concentrated in
synaptic junctions
Kim et al., 1997
![Page 108: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/108.jpg)
Chapter 3 RESULTS AND DISCUSSION
Genetics of Learning Disabilities 78
3.6 FAMILY F and G
Developmental dyslexia is a distinct learning disability with unexpected difficulty in learning to
read despite adequate intelligence, education, environment and normal senses. The impairment in
dyslexia appears to be in phonological processing, which interferes with the function of the
linguistic system at the higher level, such as semantics (Shaywitz, 1998). Dyslexia is a multi
factorial, or complex phenotype, in addition to which dyslexia displays a wide spectrum of
phenotypes, which could also reflect incomplete penetrance, and/or the effects of environmental
factors.
Out of 14 families which were sampled at the start, only two families gave some interpretable
results. The rest of families were not linked to any of the known loci, neither gave any region of
homozygosity upon SNP analysis, the reason for this could be misdiagnosis, small sample size,
in complete peneterance or phenocopies. the present families are among few small families in
which dyslexia is inherited as autosomal recessive trait. The dyslexia was mild and two males
and one female were affected in each family. A single affected female excludes the possibility of
X-linked inheritance. As inheritance of dyslexia is complex and also the effects of sex
differences in penetrance, heterogeneity, absence of a definitive diagnostic test and age
compensation all complicate an exact mode of inheritance. Therefore, it was planned to go for
genome wide scan directly but cytogenetic analysis was performed to exclude any possibility of
gross deletions or insertion, chromosomal translocations and other chromosomal aberrations.
Cytogenetic analysis refers to analysis of metaphase chromosomes which are Giemsa stained.
Karyotyping is performed to examine chromosomes in an individual as it allows to count the
number of chromosomes and to look for structural changes in chromosome. The karyogram of
Family F (Figure 25) and Family G (Figure 26) showed no chromosomal aberration.
![Page 109: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/109.jpg)
Chapter 3 RESULTS AND DISCUSSION
Genetics of Learning Disabilities 79
Figure 25: Karyogram of affected individual from the family F indicating normal karyotype.
Figure 26: Karyogram of affected individual from the family G indicating normal karyotype.
![Page 110: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/110.jpg)
Chapter 3 RESULTS AND DISCUSSION
Genetics of Learning Disabilities 80
In case of family G, genome wide scan using Affymetrix SNP6 revealed no insertion or deletion
segregating with disease. The homozygosity mapping revealed three candidate homozygous
regions (Table 23) for dyslexia. On chromosome 1, between SNP_A-8700768 and SNP_A-
8351538 at position 83,661,163 to 105,378,977 a homozygous region of 21,961,815 bp contains
more than 1000 genes and coding sequences. The second homozygous region of 1,038,076 bp
was found between SNP_A-8462392 and SNP_A-8606876 at position 121,709,335 to
122,747,410 at chromosome 2. This region comprises five genes and 10 coding sequences. The
third homozygous region present on chromosome 4 spans 804,033 bp at position 98,712,229 to
99,516,261 between SNP_A-8304054 and SNP_A-8583337. This region comprises two coding
sequences. Genome wide homozygosity mapping did not identified any region with highly
significant statistical support for harboring dyslexia or autism susceptibility loci.
Table 23: Candidate Homozygous regions found in Family G after SNP6 analysis
Locus Position Size
1p21.1-p31.1 83,661,163 – 105,378,977 21,961,815 bp
2q14.2-q14.3 121,709.335 – 122,747,410 1,038,076 bp
4q22.3-q23 98,712,229 – 99,516,261 804,033 bp
Affymetrix SNP6 assay for the family F neither indicated a deletion nor an insertion segregating
with the disease. Homozygosity mapping of the family show a homozygous region of 1,144,107
bp found at chromosome 2 between SNP_A-8596121 and SNP_A-1862419 at position
79,428,624 to 80,542,730 (Fig 27). The region has two genes; CTNNA2 and LRRTM1 (Table
24).
![Page 111: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/111.jpg)
Chapter 3 RESULTS AND DISCUSSION
Genetics of Learning Disabilities 81
Figure 27: Graphical representation of results of Affymetrix SNP6 analysed by Chromosome
analysis suit indicating homozygous regions on chromosome 2 in Family F. Results indicate
homozygous region of 1,144,107 bp at position 2q14.
Table 24: List of candidate genes present in 2p12 homozygous region in Family F
Gene Location Function Reference
CTNNA2 79,593,634-80,729,416 Catenin, Alpha-2; Cadherin-
Associated protein Mutations
cause abnormally motile
dendritic spine heads in
mouse
Claverie et al., 1993
LRRTM1 80,382,514-80,384,998 Leucine-rich repeat
transmembrane protein 1:
show parent of origin
association with human
handedness and
schizophrenia. An important
candidate for
neurodevelopment disorders
and human cognitive and
behavioral evolution.
Lauren et al., 2003
![Page 112: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/112.jpg)
Chapter 3 RESULTS AND DISCUSSION
Genetics of Learning Disabilities 82
The loci linked to dyslexia was found corresponding DYX3 the previously defined region (Table
25) of 5,493,396 bp region on short arm of Chromosome 2. This locus was first reported by
Fagerheim et al. (1999) for autosomal dominant dyslexia in Norwegian family. They reported
the candidate gene to be present between marker D2S2352 and D2S1337 at chromosomal
position 53,729,382 to 59,222,777. Petryshen et al. (2002) provided further evidence for the
DYX3 dyslexia locus. They reported this candidate region of 3,428,093 bp between marker
D2S2352 and D2S378 at position 53,729,382 to 57,157,474. No candidate gene was found in
both reports. Kaminen et al. (2003) performed a genome wide scan of 38 patients from Finland
and found a region of 200,327bp at 2p11 corresponding to this locus at position 75,095,638 to
75,295,964. They reported maximum LOD score at marker D2S286. They excluded TACR1 as a
candidate in the region. Peyrard-Janvid et al. (2004) mapped the locus to 11,955,428 bp region at
2p12-2p11.2 between markers D2S2116 and D2S2181 at position 76,502,585 to 88,458,012.
This region included CTNNA2 among the candidate genes.
Table 25: Positions of candidate regions reported on short arm of chromosome 2 for
dyslexia
Reference Location STS markers with
maximum LOD
score
Position Size
Fagerheim et al., 1999 2p16.1-p16-2 D2S2352-D2S1337 53,729,382-59,222,777 5,493,396 bp
Petryshen et al., 2002 2p16.1-p16-2 D2S2352 - D2S378 53,729,382-57,157,474 3,428,093 bp
Kaminen et al., 2003 2p13.1 D2S286 75,095,638-75,295,964 200,327 bp
Peyrard-Janvid et al., 2004 2p12-2p11.2 D2S2116-D2S2181 76,502,585-88,458,012 11,955,428 bp
Anthoni et al., 2007 2p12 D2S286 75,715,742-75,794,122 78,381 bp
Sample 7 of family F was indicated unaffected in the pedigree and apparently unaffected but the
SNP6 array indicated homozygous region. As dyslexia is a complex disorder in which
environment plays an important role in addition to unavailability of a proper diagnostic test, sex
differences in penetrance and also age compensation. Anthoni et al. (2007), reported MRPL19
and C2ORF3 genes as possible candidates present in the region and found maximum LOD score
between SNP rs1859708 and rs3755477. They sequenced MRPL19, C2ORF3, CTNNA2 and
![Page 113: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/113.jpg)
Chapter 3 RESULTS AND DISCUSSION
Genetics of Learning Disabilities 83
LRRTM1 genes but found no mutation responsible for disease in all of these genes. The LOD
score was maximum for MRPL19 and C2ORF3. The candidate region found in family F is
3,247,898 bp from the linkage peak reported by Anthoni et al. (2007). It is suggested that this
difference may be caused by dissimilar sample sets, diagnostic criteria, or results may in fact
reflect the presence of one and the same locus. Alternatively, it is possible that there are indeed
two different but closely located genes for dyslexia.
The present data extends our knowledge and understanding of the genetic spectrum of Learning
disabilities. There are many disorders associated with congenital defects to learn cognitive
behaviors and it is necessary to setup a correct diagnosis to avoid unnecessary and ineffective
treatment options. All analyzed families were consanguineous and were of Pakistani origin.
Presence of novel and recurrent mutations as well as identification of enhancer element for
ASPM will help to design improved strategies of genetic counseling for Pakistani families with
MCPH keeping in view the strong tradition of cousin marriages in this population. The results
found for stuttering and dyslexia families suggest that the close proximity of several linkage
signals to regions previously identified in other learning disorders raises the possibility that many
learning disability phenotypes may share at least some susceptibility loci in common, while there
may be other genes that are unique to each disorder. It is challenging to identify the genetic
variations present in the candidate regions narrowed down by homozygosity mapping, but the
identification and characterization of genes implicated in susceptibility to the specific learning
disability could have a profound impact on our understanding of the primary etiology of the
disorder. A better understanding of specific risk factors may improve our ability to design proper
strategies to cope with the impacts of disorder. New sequencing techniques along with functional
and bioinformatic analyses can facilitate identification of specific sequence variants causing the
disability. Ultimately, genetic counseling, carrier screening and prenatal diagnosis can be
provided in order to control the severe learning disabilities.
![Page 114: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/114.jpg)
Chapter 4 REFERENCES
Genetics of Learning Disabilities 84
4. REFERENCES
Adel KA, Ronald AB 2005, Functional Neuroanatomy: text and atlas, 2nd Edition Mc Graw
Hill, New York
Ahmed S, Saleem M, Modell B, Petrou M. Screening extended families for genetic hemoglobin
disorders in Pakistan. N Engl J Med 2002; 347: 1162-8
Alwan A, Modell B. Community control of genetic and congenital disorders. Alexandria:
Eastern Mediterranean Regional Office, World Health Organization, 1997; (EMRO
Technical Publication 24)
Ambrose N, Cox NJ, Yairi E. The genetic basis of persistent and recovered stuttering. J Speech
Lang Hear Res 1997; 40: 567-580
Ambrose N, Yairi E, Cox NJ. Genetic aspects of early childhood stuttering. J Speech Hear Res
1993; 36: 701-706
Anthoni H, Zucchelli M, Matsson H, Muller-Myhsok B, Fransson I, Schumacher J, Massinen S,
Onkamo P, Warnke A, Griesemann H, Hoffmann P, Nopola-Hemmi J, Lyytinen H,
Schulte-Korne G, Kere J, Nothen MM, Peyrard-Janvid Myriam. A locus on 2p12
containing the co-regulated MRPL19 and C2ORF3 genes is associated to dyslexia. Hum
Mol Genet 2007; 16(6): 667-677
Artigas-Pallares J. Dyslexia: a disease, a disorder or something else?. Rev Neurol 2009; 27(48
supplemetary): S1097-103
Baig SM, Din MA, Hassan H, Azhar A, Baig JM, Aslam M, Anjum I, Farooq M, Hussain MS,
Rasool M, Nawaz S, Qureshi JA, Zaman T. Prevention of beta-thalassemia in a large
Pakistani family through cascade testing. Community Genet 2008;11(1):68-70
Baraiser M 1990. Microcephaly: The Genetics of Neurological Disorders. Volume. 18, 2nd
edition. Oxford Medical Publications, Oxford, pp 26-33
Bell AC, West AG, Felsenfeld G. The protein CTCF is required for the enhancer blocking
activity of vertebrate insulators. Cell 1999; 98: 387-398.
![Page 115: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/115.jpg)
Chapter 4 REFERENCES
Genetics of Learning Disabilities 85
Bennett RL, Stelnhaus KA, Uhrich SB, O’Sullivan CK, Resta RG, Lochner-Doyle D, Markel
DS, Vincent V, Hamanishi J. Recommendations for standardized human pedigree
nomenclature. Am J Hum Genet 1995; 56: 745-52
Bertolino E, Reimund B, Wildt-Perinic D, Clerc RG. A novel homeobox protein which
recognizes a TGT core and functionally interferes with a retinoid-responsive motif. J Biol
Chem 1995; 270: 31178-88
Bishop DVM. Genetic and environmental risk for specific language impairment in children.
Philos Trans R Soc Lond B Biol Sci 2001; 356: 369-380
Bittles A. Consanguinity and relevance to clinical genetics. Clin Genet 2001; 60: 89-98
Bloodstein O, Ratner NB 2008. A handbook on stuttering. 6th ed. Clifton Park, New
York
Bond J, Roberts E, Mochida GH, Hampshire DJ, Scott S, Askham JM, Springell K, Mahadevan
M, Crow YJ, Markham AF, Walsh CA, Woods CG. ASPM is a major determinant of
cerebral cortex size. Nat Genet 2002; 32: 316-320
Bond J, Scott S, Hampshire DJ, Springell K, Corry P, Abramowicz MJ, Mochida GH,
Hennekam RC, Maher ER, Fryns JP, Alswaid A, Jafri H, Rashid Y, Mubaidin A, Walsh
CA, Roberts E, Woods CG. Protein-truncating mutations in ASPM cause variable
reduction in brain size. Am J Hum Genet. 2003 Nov;73(5):1170-7
Bond J, Roberts E, Springell K, Lizarraga SB, Scott S, Higgins J. A centrosomal mechanism
involving CDK5RAP2 and CENPJ controls brain size. Nat Genet 2005; 37(4): 724-7
Bork P, Hofmann K, Bucher P, Neuwald AF, Altschul SF. Koonin EV. A super family of
conserved domains in DNA damage responsive cell cycle checkpoints proteins.
Faseb J 1997; 11(1): 68-76
Bostein D, Rich N. Discovering genotype underlying human phenotypes: past successes for
Mendelian disease, future approaches for complex disease. Nat Genet 2003; 33: Suppl,
228-37.
Brookes AJ. The essence of SNPs. Gene 1999; 234: 177-186.
Broman KW, Murray JC, Sheffield VC, White RL, Weber JL. Comprehensive human genetic
maps, individuals and sex specific variation in recombination. Am J Hum Genet 1998;
63: 861-9.
![Page 116: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/116.jpg)
Chapter 4 REFERENCES
Genetics of Learning Disabilities 86
Bressan GM, Castellani I, Colombatti A, Volpin D. Isolation and characterization of an
115,000-dalton matrix associated glycoprotein from chick aorta. J Biol Chem 1983;
258:13262-7
Bylund M, Anderson E, Novitch BG, Muhr J. Vertebrate neurogenesis is counteracted by Sox1-
3 activity. Nature Neursci 2003; 6: 1162-1168.
Carr DE, Murphy JF, Eubanks MD (2006). Heredity 96: 29–38
Campaner S, Kaldis P, Izraeli S, Kirsch IR. SIL phosphorylation in a Pin 1 binding domain
affects the duration of the spindle checkpoints. Mol Cell Biol 2005; 25(15): 6660-6672
Claverie JM, Hardelin JP, Legouis R, Levilliers J, Bougueleret L, Mattei MG, Petit C.
Characterization and chromosomal assignment of a human cDNA encoding a protein
related to the murine 102-kDa cadherin-associated protein (alpha catenin). Genomics
1993; 15: 13-20
Collington J, Sockanathan S, Hacker A, Cohen-Tannoudji M, Norris D, Rastan S, Stevanovic
M, Goodfellow PN, Lovell-badge R. A comparison of the properties of Sox-3 with SRY
and 2 related genes: Sox1 and Sox2. Development 1996; 122: 509-520
Colombatti A, Bonaldo P, Volpin D, Bressan GM. The elastin associated glycoprotein gp115.
Synthesis and secretion by chick cells in culture. J Biol Chem 1988; 263(33):17534-40
Consang.net. Background summary (updated 24 May 2005).
www.consang.net/summary.html (accessed 22 Aug 2006)
Conture EG, Kelly EM, Young stutterer’s nonspeech behaviors during stuttering. J Speech Hear
Res 1991; 34: 1041-1056
Corradi JP, Ravyn V, Robbins AK, Hagan KW, Peters MF, Bostwick R, Buono RJ, Berrettini
WH, Furlong ST. Alternative transcripts and evidence of imprinting of GNAL on
18p11.2. Mol Psychiatry 2005; 10: 1017-1025
Cox J, Jackson AP, Bond J, Woods CG. What primary microcephaly can tell us about brain
growth. Trends Mol Med 2006; 12(8):358-366
![Page 117: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/117.jpg)
Chapter 4 REFERENCES
Genetics of Learning Disabilities 87
Dathe K, Kjaer KW, Brehm A, Meinecke P, Nürnberg P, Neto JC, Brunoni D, Tommerup N,
Ott CE, Klopocki E, Seemann P, Mundlos S. Duplications involving a conserved
regulatory element downstream of BMP2 are associated with brachydactyly type A2. Am
J Hum Genet. 2009 Apr;84(4):483-92
Diamond MS, Staunton DE, Marlin SD, Springer TA. Binding of the integrin Mac-1
(CD11b/CD18) to the third immunoglobulin-like domain of ICAM-1 (CD54) and its
regulation by glycosylation. Cell 1991; 65: 961-71
Doliana R, Bot S, Mungiguerra G, Canton A, Cilli SP, Colombatti A. Isolation and
characterization of EMILIN-2, a new component of EMILINs family and a member of
the EMI domain containing superfamily. J Biol. Chem 2001; 276: 12003-12011
Donna Van Wynsberghe, Charles R. Noback, Robert C 1995. Human Anatomy and Physiology,
3rd ed. McGraw-Hill New York. pp 384-425
Do Carmo AM, Tavares A, Glover DM. Polo kinase and Asp are needed to promote the mitotic
organizing activity of centrosomes. Nat Cell Biol 2001; 3:421-424
De Kovel CGF, Hol FA, HEister JGAM, Willemen JJHT, Sandkuijl LA, Franke B, Padberg
GW. Genomewide scan identifies susceptibility locus for dyslexia on Xq27 in an
extended Dutch family. J Med Genet 2004; 41:652-657
Desir J, Cassart M, David P, Van Bogaert P, Abramowicz M. Primary microcephaly with
ASPM mutation shows simplified cortical gyration with antero-posterior gradientpre- and
post-natally. Am J Med Genet A 2008; 146A:1439-1443.
Eckert MA, Leonard CM, Richards TL, Aylward EH, Thomson J, Berninger VW. Anatomical
correlates of dyslexia: frontal and cerebellar findings. Brain 2003; 126(2): 482-494
Elaine N. Merieb, Katja Hoehn, 2007 , Human Anatomy & Physiology. Pearson Benjamen
Cumming, San Francisco, CA 94111., pp434-456
Evans PD, Anderson JR, Vallender EJ, Gilbert SL, Malcom CM, Dorus S, Lahn BT: Adaptive
evolution of ASPM, a major determinant of cerebral cortical size in humans. Hum Mol
Genet 2004, 13(5):489-494
![Page 118: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/118.jpg)
Chapter 4 REFERENCES
Genetics of Learning Disabilities 88
Fagerheim T, Raeymaekers P, Tonnessen FE, Pedersen M, Tranebjaerg L, Lubs HA. A new
gene (DYX3) for dyslexia is located on chromosome 2. Med Genet 1999; 36: 664-669
Felsenfeld G, Burgess-Beusse B, Farrell C, Gaszner M, Ghirlando R, Huang S, Jin C, Litt M,
Magdinier F, Mutskov V et al: Chromatin boundaries and chromatin domains. Cold
Spring Harb Symp Quant Biol 2004, 69:245-250
Felsenfeld S, Plomin R. Epidemiological and offspring analyses of developmental speech
disorders using data from the Colorado Adoption Project. J Speech Lang Hear Res. 1997;
40:778–791
Finlay BL, Darlington RB. Linked regularities in the development and evolution of mammalian
brains. Science 1995; 268: 1578-1584
Fish JL, Kososdo Y, Enard W, Paabo S, Huttner WB. ASPM specifically maintains symmetric
proliferative divisions of neuroepithelial cells. Proc Natl Acad Sci USA 2006; 5
:103(27):10438-10443
Fisher SE. A quantitative-trait locus on chromosome 6p influences different aspects of
developmental dyslexia. Am J Hum Genet 1999;64:146-156
Fisher SE, DeFries JC. Developmental dyslexia: genetic dissection of a complex cognitive trait.
Nat Rev Neurosci 2002; 3:767-780
Fisher SE, Francks C, Marlow AJ, MacPhie IL, Newbury DF, Cardon LR, Ishikawa-Brush Y,
Richardson AJ, Talcott JB, Gayan J, Olson RK, Pennington BF, Smith SD, DeFries JC,
Stein JF, Monaco AP. Independent genome-wide scans identify a chromosome 18
quantitative-trait locus influencing dyslexia. Nat Genet 2002; 30:86-91
Francks C, MacPhaie IL, Monaco AP. The genetic basis of dyslexia. Lancet Neurol 2002;
1:483-490
Francks C, Paracchini S, Smith SD, Richardson AJ, Scerri TS, Cardon LR, Marlow AJ,
MacPhie IL, Walter J, Pennington BF, Fisher SE, Olson RK, DeFries JC, Stein JF,
Monaco AP. A 77-kilobase region of chromosome 6p22.2 is associated with dyslexia in
families from the United Kingdom and from the United States. Am J Hum Genet 2004;
75:1046-1058
Frints SGM, Borghgraef M, Froyen G, Marynen P, Fryns JP. Clinical study and haplotype
analysis in two brothers with partington syndrome. Am J Med Genet 2002; 112: 361-368
![Page 119: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/119.jpg)
Chapter 4 REFERENCES
Genetics of Learning Disabilities 89
Galaburda AM, LoTurco J, Ramus F, Fitch RH, Rosen GD. From genes to behaviour
in developmental dyslexdia.Nat Neurosci 2006;9:1213-1217
Gayan J. Quantitative trait locus for specific language and reading defects on chromosome 6p.
Am J Hum Genet 1999; 64: 157-164
Gerard JT, Nicholas PA 1987. Principles of Anatomy and Physiology. 5th edition Harper and
Row Publishers. Washington pp 306-312
Ging-Yuek RH, Bonnie JK, Tracey LP, Shao L, Field LL. A Dyslexia susceptibility locus
(DYX7) linked to dopamine D4 receptor (DRD4) region on chromosome 11p15.5. Am J
Med Genet 2004; 125B:12-119
Graser S, Stierhof YD, Nigg EA. Cep68 and Ccp 215 (Cdk5rap2) are required for centrosome
cohesion. J Cell Sci 2007; 120:4321-31
Guernsey DL, Jiang H, Hussin J, Arnold M, Bouyakdan K, Perry S, Babineau-Sturk T, Beis J,
Dumas N, Evans SC, Ferguson M, Matsuoka M. Mutations in centrosomal proteins
CEP152 in primary microcephaly families linked to MCPH4. Am J Hum Genet 2010;
87:40-51
Gul A, Hassan MJ, Hussain S, Raza SI, Chishti MS, Ahmad W. A novel deletion mutation in
CENPJ gene in a Pakistani family with autosomal recessive primary microcephaly. J
Hum Genet. 2006a;51:760–4
Gul A, Tariq M, Khan MN, Hassan MJ, Ali G, Ahmad W. Novel protein-truncating mutations
in the ASPM gene in families with autosomal recessive primary microcephaly. J
Neurogenet. 2007;21:153–63
Hajeck M, Huonker R, Boehle C, Volz HP, Nowak H, Sauer H: Abnormalities of auditory
evoked magnetic feilds and structural changes in the left hemisphere of male
schizophrenics- a magnetoencephalographic-magnetic resonance imaging study. Bio
Pshych 1997; 42: 609-616
Hamel BCJ, Smits APT. Otten BJ, Van den Helm B, Ropers HH, Mariman ECM. Familial X-
linked mental retardation and isolated growth hormone deficiency: clinical and molecular
findings. Am J Med Genet 1996; 64:35-41
![Page 120: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/120.jpg)
Chapter 4 REFERENCES
Genetics of Learning Disabilities 90
Hasiung GYR, Kaplan BJ, Petryshen TL, Lu S, Field LL. A dyslexia susceptibility locus7
(DYX7) linked to dopamine receptor D4 (DRD4) region on chromosome 11p15.5. Am J
Med Genet B Neuropsychiatr Genet. 2004; 15;125(1):112-9
Hoffmann K, Lindner TH. easyLINKAGE-Plus--automated linkage analyses using large-scale
SNP data. Bioinformatics. 2005 ;21(17):3565-7
Howard ML, Davison EH. Cis regulatory control circuits in development. Dev Biol 2004;
271:109-118
Hung LY, Chen HL, Chang CW, Li BR, Tang TK. Identification of a novel microtubule-
destabalizing motif in CPAP that binds to tubulin heterodimers and inhibits microtubule
assembly. Mol Biol Cell 2004; 15(6): 2697-2706
Hussain MS, Bakhtiar SM, Farooq M, Anjum I, Janzen E, Toliat MR, Eiberg H, Kjaer KW,
Tommerup N, Noegel AA, Nurnberg P, Baig SM, Hansen L. Genetic heterogeneighty in
Pakistanimicrocephaly families.Clin Genet. 2013;83:446-451
Iafrat AJ, Feuk L, Rivera MN, Listewink ML, Donahoe PK, Qi Y, Schere SW, Lee C. Detection
of large scale variation in the human genome. Nat Genet 2004; 36: 949-51
Iwasaki T, Murata-Hori M, Ishitobi S, Hosoya H. Diphosphorylated MRLC is required for
organization of stress fibres in interphase cells and the contractile ring in dividing cells.
Cell Struct Func 2001; 26: 677-683
Jackson AP, Eastwood H, Bell SM, Adu J, Toomes C, Carr IM, Roberts E, Hapshire DJ, Crow
YJ, Mighell AJ, Karbani G, Jafri H, Rashid Y, Mueller RF, Markham AF, Woods CG.
Identification of microcephalin, a protein implicated in determining the size of the human
brain. Am J Hum Genet 2002; 71: 136-142
Jamieson CR, Govaerts C, Abramowics MJ. Primary Autosomal recessive Microcephaly:
homozygosity mapping of MCPH4 to chromosome 15. Am J Hum Genet 1999; 65(5):
1465-9
Kaindl AM, Passemard S, Kumar P, Kraemer N, Issa L, Zwirner A, Gerard B, Verloes A, Mani
S, Gressens P. Many roads lead to primary Autosomal recessive Microcephaly. Prog
Neurobiol 2010; 90(3):363-383
![Page 121: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/121.jpg)
Chapter 4 REFERENCES
Genetics of Learning Disabilities 91
Kang C, Riazuddin S, Mundorff J, Krasnewich D, Friedman P, Mullikin JC, Drayna D.
Mutations in the lysosomal enzyme-targeting pathway and persistent stuttering. N Engl J
Med 2010; 362:677-685
Kaminen N, Hannula-Jouppi K, Kestila M, Lahermo P, Muller K, Kaaranen M, Myllyuoma B,
Voutilainen A, Lyytinen H, Nopola-Hemmi J, Kere J. A genome scane for developmental
dyslexia confirms linkage to chromosome 2p11 and suggests a new locus on 7q32. J Med
Genet 2003; 40: 340-345
Karkera JD, IzraeliS, Roessler E. Dutra A, Kirsch I, Muenke M. The genomic structure,
chromosomal localization, and analysis of SIL as a candidate gene for
holoprosencephaly. Cytogenet Genome Res 2002; 97(1-2): 62-7
Keith LM, Arthur FD. 1999. Clinically oriented Anatomy. 4th edition. Lippincott Wlliams and
Wilkins. NewYork pp887-889
Kenneth SS. Anatomy and Physiology. 2004. 3rd edition. Mc Graw Hill. New York pp530-535
Kidd KK, Kidd JR, Records MA, The possible causes of the sex ratio in stuttering and its
implication. J of Flen Disorders 1978; 3(1): 13-23
Kim E, Naisbitt S, Hsueh YP, rao A, Rothschild A, Craig AM, Sheng M. GKAP, a novel
synaptic protein that interacts with the guanylate kinase like domain of the PSD-
95/SAP90 family of channel clustering molecules. J Cell Biol 1997; 136: 669-678 Kim
TH, Abdullaev ZK, Smith AD, Ching KA, Loukinov DI, Greem RD, Zhang MQ,
Lobanenkov VV, Ren B. Analysis of the verteberate insulator protein CTCF binding sites
in the human genome. Cell 2007;128(6): 1231-1245
Kouprina N, Pavlicek A, Collins NK, Nakano M, Noskov VN, Ohzeki JI, Mochida GH,
Risinger JI, Goldsmith P, Gunsior M, Solomon G, Gersch W, Kin JH, Barrett JC, Walsh
CA, Jurka J, Masumoto H, Larionov V. The microcephaly ASPM gene is expressed in
proliferating tissues and encodes for a mitotic spindle protein. Hum Molec Genet 2005;
14: 2155-2165
Kousar, R., Nawaz, H., Khurshid, M., Ali, G., Khan, S.U., Mir, H., Ayub, M., Wali, A., Ali, N.,
Jelani, M., et al. (2010). Mutation analysis of the ASPM gene in 18 Pakistani families
with autosomal recessive primary microcephaly. J. Child Neurol. 25, 715–720
![Page 122: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/122.jpg)
Chapter 4 REFERENCES
Genetics of Learning Disabilities 92
Kumar A, girimaji SC, Duvvari MR, Blanton SH. Mutations in STIL, encoding a pericentriolar
and centrosomal protein, cause primary Microcephaly. Am J Hum Genet 2009; 84(2):
286-290
Lander ES, Botstein D. Homozygosity mapping: a way to map human recessive traits with the
DNA of inbred children. Science 1987;236:1567-70
Lander E, Kruglyak L. Genetic dissection of complex traits: guidelines for interpreting and
reporting linkage results. Nat Genet. 1995 Nov;11(3):241-7
Lathrop GM, Lalouel JM. Easy calculations of LOD scores and genetic risks on small
computers. Am J Hum Genet 1984; 36(2):460-5
Laumonnier F, Ronce N, Hamel BCJ, Thomas P, Lespinasse J, Raynaud M, Paringaux C, van
Bokhoven H, Kalscheuer V, Fryns JP, Chelly J, Moraine C, Briault S. Transcription
factor SOX3 is involved in X-linked mental retardation with growth hormone deficeincy.
Am J Hum Genet 2002; 71:1450-1455
Lauren J, Airaksinen MS, Saarma M, Timmusk T. A novel gene family encoding leucine-rich
repeat transmembrane proteins differentially expressed in nervous system. Genomics
2003; 81:411-421
Lage K, Karlberg EO, Størling ZM, Olason PI, Pedersen AG, Rigina O, Hinsby AM, Tümer Z,
Pociot F, Tommerup N, Moreau Y, Brunak S. A human phenome-interactome network of
protein complexes implicated in genetic disorders. Nat Biotechnol, 2007; 25(3):309-16
Leal GF, Roberts E, Silvia EO, Costa SM, Hampshire DJ, Woods CG. A novel locus for
Autosomal recessive primary Microcephaly (MCPH6) maps to 13q12.2. J Med Genet
2003;40(7):540-2
Liu Y, Blackwood DH, Caesar S, de Geus EJ, Farmer A, Ferreira MA, Ferrier IN, Fraser C,
Gordon-Smith K, Green EK, Grozeva D, Gurling HM, Hamshere ML, Heutink P,
Holmans PA, Hoogendijk WJ, Hottenga JJ, Jones L, Jones IR, Kirov G, Lin D, McGuffin
P, Moskvina V, Nolen WA, Perlis RH, Posthuma D, Scolnick EM, Smit AB, Smit JH,
Smoller JW, St Clair D, van Dyck R, Verhage M, Willemsen G, Young AH, Zandbelt T,
Boomsma DI, Craddock N, O'Donovan MC, Owen MJ, Penninx BW, Purcell S, Sklar P,
Sullivan PF. Meta-analysis of genome-wide association data of bipolar disorder and
major depressive disorder. Mol Psychiatry. 2011;16(1):2-4
![Page 123: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/123.jpg)
Chapter 4 REFERENCES
Genetics of Learning Disabilities 93
Mayo P, Hartshorne T, Li K, McMunn-Gibson C, Spencer K, Schnetz-Boutaud N. CNV
analysis using Taqman copy number assays. Curr.Protoc. Hum. Genet 2010; Chapter
2:Unit2.13
McCarroll SA, Kuruvilla FG, Korn JM, Cawley S, Nemesh J, Wysoker A, Shapero MH, de
Bakker PI, Maller JB, Kirby A, Elliott A L, Parkin M, Hubbell E, Webster T, Mei R,
Veitch J, Collins P J, Handsaker R, Lincoln S, Nizzari M, Blume J,Jones K W, Rava R,
Daly MJ, Gabriel SB, Altshuler D. Integrated detection and population-genetic analysis
of SNPs and copy number variation. Nat Genet 2008; (10):1166-1174
McFarlane WB, Hanson M, Walton W, Mellon CD. Stuttering in five generations of a single
family: a preliminary report including evidence supporting a sex-modified mode of
transmission. J Fluency Disord. 1991; 16:117–123
Meng H, Smith SD, Hager K, Held M, Liu J, Olson RK, Pennington BF, DeFries JC, Gelernter
J, O’Reilly-Pol T, Somlo S, Skudlarski P, Shaywitz SE, Shaywitz BA, Marchione K,
Wang Y, Paramasivam M, LoTurco JJ, Page GP, Gruen JR. DCDC2 is associated with
reading disability and modulates neuronal development in the brain. Proc Nat Acad Sci
2005;102:17053-58
Molfese DL. Predicting dyslexia at 8 years og age using neonatal brain responses.Brain Lang
2000; 72:238-245
Muhammad F, Mahmood Baig S, Hansen L, Sajid Hussain M, Anjum Inayat I, Aslam M, Anver
Qureshi J, Toilat M, Kirst E, Wajid M, Nurnberg P, Eiberg H, Tommerup N, Kjaer KW.
Compound heterozygous ASPM mutations in Pakistani MCPH families. Am J Med
Genet A. 2009;149A:926–30
Neitzel H, Neumann LM, Schindler D, Wirges A, Tönnies H, Trimborn M, Krebsova A, Richter
R, Sperling K Premature chromosome condensation in humans associated with
microcephaly and mental retardation: a novel autosomal recessive condition. Am J Hum
Genet 2002; 70(4):1015-22
Nicholas AK, Khurshid M, Desir J, Carvalho OP, Cox JJ, Thornton G, Kausar R, Ansar M,
Ahmed W, Verloes A, Passemard S, Misson JP, Lindsay S, Gergely F, Dobyns WB,
Roberts E, Abramowics M, Woods CG. WDR62 is associated with the spindle pole and
is mutated in human microcephaly. Nat Genet 2010; 42(11):1010-4
Nobrega MA, Ovcharenko I, Afzal V, Rubin EM. scanning human gene desert for long range
enhancers. Science 2003; 302:413
![Page 124: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/124.jpg)
Chapter 4 REFERENCES
Genetics of Learning Disabilities 94
Nopola-Hemmi J, Myllyluoma B, Haltia T, Taipale M, Ollikainen V, Ahonen T, Voutilainen A,
Kere J, Widen E. A dominant gene for developmental dyslexia on chromosome 3. J Med
Genet 2001; 38:658-664
Ott JS. A comparison of two methodologies for assessing human service needs and an
assessment of the impacts of methodological choices on identified needs. J Health Hum
Resour Adm 1991; 14(2):132-59
Passemard S, Titomanlio L, Elmaleh M, Afenjar A, Alessandri JL, Andria G, Billette de
Vilemeur T, Boespflug-Tanguy O, Burglen L, Del Gundice E, Guimiot F, Hyon C, Isidor
B, Megarbane A, Moog U, Odent S, Hernandez K, Pouvreau N, Scala I, Schaer M,
Gressens P, Gerard B, Verloes A. Expanding the clinical and neuroradiologic phenotype
of primary microcephaly due to ASPM mutations. Neurology 2009; 73(12):962-969
Partington MW, Mulley JC, Sutherland GR, Hockey A, Turner G. X-linked mental retardation
with dystonic movements of the hands. Am J Med Genet 1988; 30:251-262
Partington MW, Turner G, Boyle J, Gecz J. Three new families with X-linked mental
retardation caused by the 428-451 dup (24bp) mutations in ARX. Clin.Genet 2004;
66:39-45
Pattison L, Crow YJ, Deeble VJ, Jackson AP, Jafri H, Rashid Y. A fifth locus for primary
Autosomal recessive Microcephaly maps to chromosome 1q31. Am J Hum Genet 2000;
66(2):724-7
Paulesu E, Demonet JF, Fazio F, McCroy E, Chanoine V, Brunswick N, cappa SF, Cossu G,
Habib M, Frith CD, Frith U. Dyslexia: cultural diversity and biological unity. Science
2001; 291:2165-7
Peterfy M, Phan J, XuP, Reue K. Lipodystrophy in the FLD mouse results from mutation of a
new gene encoding a nuclear protein, lipin. Nat Genet 2001; 27:121-4
Petryshen TL, Kaplan BJ, Hughes ML, Tzenova J, Feild LL. Supportive evidence for the DYX3
dyslexia susceptibility gene in Canadian families. J Med Genet 2002; 39:125-126
Petryshen TL, Kaplan BJ, Liu MF, Schmill de French N, Tobias R, Hughes ML, Field LL.
Evidence for a susceptibility locus on chromosome 6q influencing phonological coding
dyslexia. Am J Med Genet 2001; 105:507-517
![Page 125: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/125.jpg)
Chapter 4 REFERENCES
Genetics of Learning Disabilities 95
Peyrard-Janvid M, Anthoni H, Onkamo P, Lahermo P, Zucchelli M, Kaminen N, Hannula-
Jouppi K, Nopola-Hemmi J, Voutilainen A, Lyytinen K, Kere J. Fine mapping of the
2p11 dyslexia locus and exclusion of TACR1 as a candidate gene. Hum Genet 2004;
114:510-516
Przeworski M, Hudson RR, Di Rienzo A. Adjusting the focus on human variation. Trends
Genet 2000;16:296-302
Pushpa S, Ramachandara NB. Biological basis of dyslexia: A maturing perspective. Curr
Science 2006; 90: 168-175
Rabin M, Wen XL, Hepburn M, Lubs HA. Suggestive linkage of developmental dyslexia to
chromosome 1p34-p36. Lancet 1993; 34:178
Rajarethinam RP, De Quardo JR, Nalepa R, Tandon R: superior temporal gyrus in
schizophrenia: a volumetric magnetic resonance imaging study. Schizophrenia Res 2000;
41:303-312
Raza MH, Riazuddin S, Drayna D. Identification of an autosomal recessive stuttering locus on
chromosome 3q13.2-3q13.33. Hum Genet 2010; 128:461-463
Raza MH, Amjad R, Riazuddin S, Drayna D.Studies in a consanguineous family reveal a novel
locus for stittering on chromosome 16q. Hum genet 2012;131:311-313
Reue K, Xu P, Wang XP, Slavin BG. Adipose tissue deficiency, glucose intolerance, and
increased atherosclerosis result from mutation in the mouse fatty liver dystrophy (fld)
gene. J Lipid Res 2000; 41: 1067-1076
Richards T, Aylward E, Raskind W, Abbott R, Field K, Parson A, Richard A, Nagy W, Eckert
M, Leonard C, Berninger V. Converging evidence for triple word form theory in children
with dyslexia. Develop Neu-psych 2006-b; 30:547-589
Roberts E, Hampshire DJ, Springell K, Pattison L, Crow Y, Jafri H, Corry P, Kabani G,
Mannon J, Rashid Y, Keen J, Bond J, Woods CG. Autosomal recessive primary
microcephaly: an analysis of locus heterogeneity and phenotypic variation. J Med Genet
2002;39:718-721
Roberts E, Jackson AP, Carradice AC, Deeble VJ, Mannan J, Rashid Y. The second locus for
Autosomal recessive primary Microcephaly (MCPH2) maps to chromosome 19q13.1-
13.2. Eur J Hum Genet 1999;7(7):815-20
![Page 126: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/126.jpg)
Chapter 4 REFERENCES
Genetics of Learning Disabilities 96
Roongpraiwan R, Ruangdaraganon N, Visudhiphan P, Santikul K. Prevalence and clinical
characteristics of dyslexia in primary school students. J Med Assoc Thai 2002; 85 Suppl
4:S1097
Sadler TW. 2000. Langman`s medical embryology. Lippincott Williams & Wlkins. pp411
Sambrook J, Fritsch EF, Maniatis T. 1989. Molecular cloning: a laboratory manual. 2. ed., 3.
vol., Cold Spring Harbor Laboratory Press, New York
Saunders RD, Avides MC, Howard T, Gonzalez C, Glover DM. The Drosophila gene abnormal
spindle encodes a novel microtubule associated protein that associates with the polar
regions of the mitotic spindle. J Cell Biol 1997; 137:881-890
Sebat J, Lakshmi B, Troge J, Alexander J, Young J, Lundin P, Massa H, Walker M, Chi M,
Navin N, Lucito R, Healy J, Hicks J, Ye K, Reiner A, Gilliam TC, Trask B, Patterson N,
Zetterberg A, Wigler M. Large scale copy number polymorphism in the human genome.
Science 2004; 305:525-8
Shaywitz SE. Dyslexia. N Engl J Med 1998; 338:307-312
Shen J, Walsh CA. Targeted disruption of TGIF, the mouse ortholog of a human
holoprosencephaly gene, does not result in holoprosencephaly in mice. Mol Cell Biol
2005; 25: 3639-3647
Shugart YY, Mundorff J, Kilshaw J, Doheny K, Doan B, Wanyee J, Green ED, Drayna D.
Results of a genome-wide linkage scan for stuttering. Am J Med Genet 2004; 124A:133-
135
Siegel GJ, Agranaoff B, Albers RW, Fisher SK, Uhler MD 1998. Basic Neurochemistry:
Molecular, Cellular and Medical aspects: 6th Edition. Lippincott Williams & Wilkins.
Philadelphia PA
Simos PG, Fletcher JM, Foorman BR, Francis DJ, Castillo EM, Davis RN, Fitzgerald M,
Mathes PG, Denton C, Papanicolaou AC. Brain activation profiles during early stages of
reading acquisition.J Child Neurol 2002;17:159-163.
![Page 127: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/127.jpg)
Chapter 4 REFERENCES
Genetics of Learning Disabilities 97
Sitek B, Luttges J, Marcus K, Kloppel G, Schmeigel W, Meyer HE, Hahn SA, Stuhler K.
Application of fluorescence difference gel electrophoresis saturation labeling for the
analysis of microdissected precursor lesions of pancreatic ductal adenocarcinoma.
Proteomics 2005; 5(10):2665079
SLI Consortium highly significant linkage to the SLI1 locus in an expanded samle of
individuals affected by specific language impairment. Am J Hum Genet 2004; 74:1225-
1238
Smith SD, Kimberling WJ, Pennington B, Lubs HA. Specific reading disability: identification
of an inherited form through linkage analysis. Science 1983; 219:1345-1347
Solms M, Oliver T, Oliver S. 2002. The Inner World: an introduction to the neuroscience of
subjective experience. Press LLC, 307 New York
Solomon NM, Ross SA, Morgan T, Belsky JL, Hol FA, Karnes PS, Hopwood NJ, Myers SE,
Tan AS, Warne GL, Forrest SM, Thomas PQ. Array comaparative genomic hybridization
analysis of boys with X linked hypopituitarism identifies a 3.9 Mb duplicated critical
region at Xq27 containing SOX3. J Med Genet 2004; 41:669-678
Speel EJ, van der Ven PF, Albrechts JC, Ramaekers FC, Furst DO, Hopman AH. Assignment of
the human gene for the sarcomeric M- band protein myosin (MYOM1) to 18p11.31-
p11.32. Genomics 1998; 54:184-6
Stromme P, Mangelsdorf ME, Shaw MA, Lower KM, Lewis SME, Bruyere H, Lutcherath V,
Gedeon AK, Wallace RH, Scheffer IE, Turner G, Partington M, Frints SGM, Fryns JP,
Suthurland GR, Mulley JC, Gecz J. Mutations in the human ortholog of aristaless cause
X-Linked mental retardation and epilepsy. Nature Genet 2002; 30:441-445
Suresh R, Ambrose N, Roe C, Pluzhnikov A, Wittke-Thompson JK, Maggie CYN, Wu Xiaolin,
Cook EH, Lundstrom C, Garsten M, Ezrati R, Yairi E, Cox NJ. New complexities in the
Genetics of Stuttering: Significant Sex-Specific linkage Signals. Am J Hum Genet 2006;
78:554-563
Tolmie JL, McNay M, Stephenson JBP, Doyle D, Connor JM. Microcephaly: genetic
counseling and antenatal diagnosis after the birth of an affected child. Am J Med Genet
1987; 27:583-594
Trinick J. Elastic filaments and giant proteins in muscle. Curr Opin Cell Biol 1991; 3:112-9
![Page 128: prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/Syeda_Marriam_Ba… · viii TABLE OF CONTENTS Acknowledgments List of tables List of figures 1 1.1 1.2 1.3 1.4 1.5 1.6](https://reader036.fdocuments.in/reader036/viewer/2022062605/5fcb883e2168e056be14d00d/html5/thumbnails/128.jpg)
Chapter 4 REFERENCES
Genetics of Learning Disabilities 98
Tunca Y, Vurucu S, Parma J, Akin R, Desir J. Baser I. Prenatal diagnosis of primary
Microcephaly in two consanguineous families by confrontation of morphometry with
DNA data. Prenat Diagn 2006; 26(5):449-53
Ullman MT, Pierpont EI. Specific language impairment is not specific to language: the
procedural deficit hypothesis.Cortex 2005;41:399-433.
Vinkemeier U, Obermann W, Weber K, Furst DO. The globular head domain of titin extends
into the center of the sarcomeric M band: cDNA cloning, epitope mapping and
immunoelectron microscopy of two titin-associated proteins. J Cell Sci 1993; 106:319-
330
Walter J.M. Genetics advances and learning disability. Brit J Psych 2000 ;176, 12-19 Widmaier
EP, Raff H, Strang KT. Vander 2004. Sherman &Luciano’s Human Physiology: the mechanisms of body functions. 9th edition. Mc Graw Hill. NewYork. Pg. 262-264
Woods GC, Bond J, Enard W. Autosomal recessive primary microcephaly (MCPH); a review of
clinical, molecular and evolutionary findings. Am J Hum Genet 2005; 76:717-28
Wotton D, Lo RS, Swaby LA, Massague J. A Smad transcriptional co repressor. Cell 1999;
97:29-39
Yairi E, Ambrose NG. Early childhood stuttering. I. Persistence and recovery rates. J Speech
Lang Hear Res. 1999; 42:1097–1112
Yairi, E. and Ambrose, NG. (2005). Early Childhood Stuttering. Austin: Pro Ed Zhang X, Liu
D, Lv S, Wang H, Zhong X, Liu B. CDK5RAP2 is required for spindle checkpoint
function. Cell cycle 2009; 16: 8
Zhong X, Pfeifer GP, Xu X. Microcephalin encodes a centrosomal protein. Cell Cycle 2006;
14:2155-56
Zeiger A, Konig IR, Deiniel W. Developmental Dyslexia-recurrence risk estimates from a
German Bi-centric study using the single proband sib pair design. J Hum Hered 2005; 59:
136-43