Proteins and Base Mutations. Polypeptides made up of amino acids Peptides are at Least 2 amino...
-
Upload
morgan-sullivan -
Category
Documents
-
view
225 -
download
2
Transcript of Proteins and Base Mutations. Polypeptides made up of amino acids Peptides are at Least 2 amino...
Proteins and Base Mutations
Polypeptides made up of amino acids Peptides are at Least 2 amino acids bonded
together via peptide bonds Proteins ARE polypeptides, numerous amino
acids
First Recall Proteins------
**Peptide Bond between amino acids
**All AA’s look the same EXCEPT the “R” group. It’s a group of molecules. They determine which amino acid it is because each are different!
The amino acid sequence determines the protein!! Shape-specific
Example - The sequence for a specific enzyme will be totally different from that of a hormone!
Amino Acid Sequence - Polypeptide
Human Growth HormoneAmylase Enzyme
Basic Types of Proteins
Structural Proteins – forms part of cell materials
fibrous and stringy and provide support. Examples: Keratins strengthen protective coverings such as hair, quills, feathers, horns, and beaks. include keratin
Collagen, and elastin. Collagens and elastin provide support for connective tissue such as tendons and ligaments.
Structural Proteins
Hormones – Body’s chemical messengers
Functional Proteins
Hormones – Chemical Signals released by a cell or a gland in one part of the body that sends out messages that affect cells in other parts of the organism
Growth and development Metabolism - how your body gets energy from the foods you eat Sexual function Reproduction Mood
Enzymes – catalyze chemical reactions. Example – Amylase is the enzyme that breaks starches in
your mouth. Speeds up the rate of digestion.
Functional Proteins
Remember that DNA is replicated during the S phase of Interphase in both Mitosis and Meiosis (the formation of gametes)
Mutations may or may not change the function of a protein
May change phenotype, how a gene is expressed
Example: brown hair is a phenotype, sickle cell anemia is a phenotype, dwarfism is a phenotype
Mistakes Can Occur
***Errors in replication, transcription, cell division, or by external agents called mutagens (chemicals, radiation, X-rays etc.)
***Some occur randomly, some phenotypes are selected for in nature
***Although mutations can cause problems, if it weren’t for mutations we wouldn’t have new genes such as those for green eyes
Mutations-------
** Newly synthesized DNA is EXACTLY the same as the parent DNA……or is it??
Enzymes proofread as bases are paired during replication and replace those wrongly paired
Other enzymes police the replication process
But…………
“Fixing” Errors
May be random or spontaneous (influenced) When genes have an error in their DNA code,
they may not work properly, and are said to be "altered" or mutated.
DNA damage from environmental agents such as radiation (sunlight), nuclear radiation, some viruses, some chemicals, genetics, inflammation, infection
Mistakes that occur when a cell copies its DNA in preparation for cell division.
Can occur during meiosis (making of sper, and egg)
Mutations
Enzymes Speed up the rate of reaction For example, amylase breaks down
starches in your mouth
Functional Proteins
Mismatched Base Pair Can Occur – Usually Random
Spontaneous Mutions Environmental agents such as nuclear radiation can damage DNA by breaking bonds between nucleotides on either side of the DNA molecule can occur
Some mutated cells will be defeated by the body's immune system
others will undergo apoptosis, or cell suicide. occasionally a cell with mutations slips through
proofreading safeguards. When mutations accumulate, the genetic material is so
scrambled that the cell no longer acts like a normal, healthy cell.
Tumors, mass of cells that have no purpose, may form
Mutated Cells
Not malignant tumor (cancerous) Does not invade nearby tissue or spread to other parts of
the body the way cancer can. But benign tumors can be serious if they press on vital
structures such as blood vessels or nerves. Some, such as colon polyps, can become cancerous
Benign Tumors (non-cancerous)
Abnormal cells grow uncontrolled Invades surrounding tissues Usually capable of producing metastases
(spread to other organs) May recur after attempted removal May cause death of the host unless
adequately treated
Cancerous Tumor
Mutations and Reproduction**Mutations can occur during meiosis, the
making of sperm or egg by changing the nucleotide sequences within a gene and can be passed along to offspring
**Example: Achonroplasia is a type of dwarfism that can come from a mutation during sperm
formation**The mutation may produce a new trait (good OR bad) or it may result in a protein that does not work correctly.
Types of Mutations
** Point mutations, base substitution, affects a single base
**Frameshift – Addition or deletion of a base – Affects entire protein
**chromosomal mutations – affects whole chromosomes
Base Pair Substitution – AKA Point Mutation
Affects a single base and change the codon
May or may not affect the amino acid Sometimes if the third base of the codon
changes, the amino acid may stay the same!
UCU UCC UCA UCG
Point MutationsALL code for Ser
TACCAGGATTAACATGGAAGTGTAATCAUGGUCCUAAUUGUACCUUCACAUUAG
Met Val (STOP)HisSerProVal IleLeu
DNA
mRNA
Amino Acid)
NORMAL SEQUENCE
Met Val IleLeu
TACCAGGATTAAAUGGUCCUAAUU
AATGGAAGTGTAATC DNA
UUACCUUCACAUUAG mRNA
Leu (STOP)HisSerPro
What if the C was substituted with an A ?????
Addition or deletion of a base shifts the amino acids left or right affecting the whole protein. It won’t function properly
Frameshift Mutation
TACCAGGATTAACATGGAAGTGTAATC
AUGGUCCUAAUUGUACCUUCACAUUAG
(STOP)HisSerProVal
Met Val IleLeu
TACCAGGATTAAAUG GUC CUA AUU
Met Val IleLeu
ATGGAAGTGTAATC… UACCUUCACAUUAG…
Tyr His IleLeu
Example: Deletion of the C shifts the entire protein over to the left – Framshifts change ENTIRE PROTEIN –
There is NO STOP CODON!!
Ser or Arg….
Frame-Shift Mutations (Add or Delete a Base)
Sickle Cell Anemeia – red blood cells are misshaped (sickle-shaped) and cannot carry enough oxygen
Base Substitution Example
Tay-Sachs - disorder of the central nervous system.
An enzyme that is responsible for breaking down certain fatty substances in brain and nerve cells is ineffective and these substances accumulate, eventually destroying brain and nerve cells, and so the entire central nervous system.
It is an inherited trait and you can be a carrier
Example of Frameshift
Mutation Exercise
To give you a better idea of genetic mutations that effect proteins (we haven’t gotten to wntire chromsomes yet) do a little research…
Research a trait, disease/disorder that is caused by a point mutation and one that is caused by a frameshift mutation. Without getting to technical, describe where the mutation occurs, the symptoms and the prognosis
Your turn……..