PT

AJ*†o

R

pPstiadsrrfdswpcm

g

cfmTityitBc

2

Biochemical and Biophysical Research Communications 287, 837–842 (2001)

doi:10.1006/bbrc.2001.5664, available online at http://www.idealibrary.com on

roperties of the Cysteine-less Pho84 Phosphateransporter of Saccharomyces cerevisiae

braham Berhe,*,† Renata Zvyagilskaya,‡ Jens O. Lagerstedt,*,†ames R. Pratt,*,† and Bengt L. Persson*,†,1

Department of Biochemistry and Biophysics, Wallenberg Laboratory, Stockholm University, S-106 91 Stockholm, Sweden;School of Biosciences and Process Technology, Vaxjo University, S-351 95 Vaxjo, Sweden; and ‡A. N. Bach Institutef Biochemistry, Russian Academy of Sciences, Leninsky Prospect 33, 117071 Moscow, Russia

eceived August 27, 2001

encoding the high-affinity phosphate transporter istppovaaamoccaatpmpntlgotHrbtonagttbtoa

The derepressible Pho84 high-affinity phosphateermease of Saccharomyces cerevisiae, encoded by theHO84 gene belongs to a family of phosphate:protonymporters (PHS). The protein contains 12 native cys-eine residues of which five are predicted to be locatedn putative transmembrane regions III, VI, VIII, IX,nd X, and the remaining seven in the hydrophilicomains of the protein.Here we report on the con-truction of a Pho84 transporter devoid of cysteineesidues (C-less) in which all 12 native residues wereeplaced with serines using PCR mutagenesis and theunctional consequences of this. Our results clearlyemonstrate that the C-less Pho84 variant is able toupport growth of yeast cells to the same extent as theild-type Pho84 and is stably expressed under dere-ressible conditions and is fully active in proton-oupled phosphate transport across the yeast plasmaembrane. © 2001 Academic Press

Key Words: phosphate transporter; Pho84; PHOene, plasma membrane; C-less.

The Pho84 phosphate permease of Saccharomyceserevisiae, encoded by the PHO84 gene (1), belongs to aamily of phosphate:H1 symporters (PHS) and is aember of the major facilitator superfamily (MFS) (2).his hydrophobic integral membrane protein consist-

ng of 587 amino acid residues catalyzes the coupledransport (symport) of phosphate and H1 across theeast plasma membrane, converting the energy storedn an electrochemical H1 gradient into energy forranslocation of phosphate into the cell (reviewed in 3).ecause phosphate uptake at the cell membrane is a

rucial step in phosphate acquisition, the PHO84 gene

1 To whom correspondence should be addressed. Fax: 146(8)15 304. E-mail: Bengt_P@dbb.su.se.

837

ightly regulated in response to extracellular phos-hate levels to ensure that sufficient phosphate isresent for cellular needs. In S. cerevisiae transcriptionf the PHO84 gene is activated during phosphate star-ation and repressed under conditions of phosphatedequacy (4, 5). Synthesis and activation of this high-ffinity transporter is strictly regulated and is favoredt external phosphate concentrations lower than 100M (6, 7). The Pho84 protein has been cloned (1),verexpressed and purified (8, 9), and functionally re-onstituted into proteoliposomes which catalyze a H1-oupled phosphate uptake (8, 10). Based on hydropathynalysis of the primary amino acid sequence, a second-ry structure model has been proposed (3) in which 12ransmembrane (TM) domains are connected by hydro-hilic loops and extended N- and C-termini at the sameembrane face. As in the case of several HXT trans-

orters (11, 12), the Pho84 transporter exhibits a sig-ificant number of conserved residues between each ofhe two halves of the transporter (3), separated by aarge hydrophilic loop harboring 75 amino acids, sug-esting that the protein has arisen from a duplicationf an ancestral gene. We have previously shown thatwo purified Pho84 fusion proteins with highly polaris-tagged peptides of 23 and 33 amino acid residues,

espectively, attached to the N-terminus of Pho84 cane unidirectionally reconstituted into catalytically ac-ive proteoliposomes with its N- and C-termini exposedn the exterior face of the vesicles (8, 9). The mecha-ism of protein-mediated transport of phosphatecross the membrane is not yet understood in anyreater detail. In the absence of a protein crystal struc-ure, identification of individual amino acid residueshat are in close physical contact with each other maye achieved by site-directed chemical crosslinking. Forhis, cysteine-scanning mutagenesis and crosslinkingf introduced cysteine residues followed by subsequentnalysis of disulfide bond formation have proven to be

0006-291X/01 $35.00Copyright © 2001 by Academic PressAll rights of reproduction in any form reserved.

va(wt1t(ctdrpp

MATERIALS AND METHODS

raAoPmHSCc

bPauotpate

psfC3msaCtpfpNCuy(Co

massf

LE

CC

CCCCC

C

at

Vol. 287, No. 4, 2001 BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS

aluable in the elucidation of structural and dynamicspects of membrane protein structure and function13–21). The construction of a C-less variant of Pho84ith retained structural stability and transport func-

ion is a prerequisite for such a study. Pho84 contains2 native cysteine residues of which five are predictedo be located in TM regions III, VI, VIII, IX, and XFig. 1). Here we report on the replacement the 12ysteine residues contained in Pho84 with serine andhe functional consequences of this. Our results clearlyemonstrate that the C-less variant upon homologousecombination is stably expressed in vivo under dere-ressible conditions and is fully active in H1-coupledhosphate transport across the yeast plasma membrane.

FIG. 1. Secondary structure model of the Pho84 transporter. Theodel is based on hydropathy analysis of the deduced Pho84 amino

cid sequence (1). The 12 predicted transmembrane segments arehown as boxes. The positions of the 12 cysteine residues subjected toite-directed mutagenesis are indicated by the single amino acid codeollowed by the residue number.

TAB

Cysteine Replac

Amino acid change M

145S TTATCATGATTGTCTCCACCATTCT237S/C241S/C245S TAGAACGGTACCCAACCCAATAAG

TTCAGC263S TTGGGTACCGTTCTAGGGTTGGCA335S GATTTCTCGAGACATTTTGGT399S AGTGAAGACGGATACCCAGTAACC434S AGACCATGGTCACCAAGTTTATGGT455S/C474S GACCATGGTCTGTTGGCTCTTTACG

TTGTTCCTGGTGAGTCGTTCCCA510S/C519S GGCGAAAATTTCCATGACGTGAGG

Note. Oligonucleotides used to replace cysteine residues with serinere shown in bold with the mutated bases underlined. The site of thehe N-terminus of the protein. Amino acid residues are designated b

838

Materials and strains. [32P]orthophosphate (carrier free), horse-adish peroxidase-conjugated anti-mouse-Ig-antibody (from sheep),nd enhanced chemiluminescence detection kit were obtained frommersham-Pharmacia Biotech, Sweden. Anti-myc antibodies werebtained from Invitrogen, The Netherlands. TaqPlus Long and Taq-lus Precision polymerases were from Stratagene, USA. All otheraterials of reagent grade were obtained from commercial sources.aploid, prototrophic S. cerevisiae CEN.PK113-7D (MATa MAL2-8cUC2) was kindly provided by P. Kotter, Frankfurt, Germany. TheEN.PK113-5D strain used for expression of the Pho84WT-MYC was

reated in this laboratory (22).

Construction of site-directed mutants. All mutants were preparedy oligonucleotide-directed site-specific mutagenesis of genomicHO84. Oligonucleotides were synthesized to generate the appropri-te cysteine to serine mutation and to simultaneously introducenique silent BamHI and EcoRI restriction sites at the 59 and 39 endsf the PHO84 gene, respectively. The oligonucleotides used for cys-eine mutagenesis are shown in Table 1. The two oligonucleotiderimers, 59-GAGAGAGGATCCGATGAGTTCCGTCAATAAAGAT-39,nd 59-GAGAGAGAATTCTTATGCTTCATGTTGAAGTTG-39, con-ain sequences for BamHI and EcoRI restriction sites at their 59nds, respectively.The C-less PHO84 sequence was constructed by a sequential am-

lification of the PHO84 gene from genomic DNA using the synthe-ized oligonucleotides. The C-less PCR fragments were obtained asollows: The C145S sense primer yielded together with the C237S/241S/C245S antisense primer flanked by the KpnI restriction site a89-kb fragment devoid of C145, C237, C241, and C245. This frag-ent was used as an antisense primer together with the BamHI

ense primer resulting in a 777-bp PCR product flanked by BamHInd KpnI. Next, the C335S sense primer was used together with the399S antisense primer. The obtained 239-kb PCR fragment con-

aining C335S/C399S gave together with the C434S antisenserimer a 346-kb C335S/C399S/C434S product. Use of the obtainedragment as an antisense primer together with the C263S senserimer yielded a PCR product of 580 bp flanked by KpnI and NcoI.ext, the C455S/C474S sense primer together with the C510S/519S antisense primer amplified a 254-bp fragment which whensed as a sense primer together with the antisense EcoRI primerielded a product of 431 bp. The obtained trimmed NcoI–EcoRIC455S/C474S/C510S/C519S) and the KpnI–NcoI (C263S/C335S/399S/C434S) fragments were coligated into a pUC18 plasmidpened with KpnI and EcoRI. In the second ligation step the pUC18

1

ents in Pho84

genic oligonucleotide (59 3 39)

TTCTCCACATTTGGTCAGAAGCCTTTTGAGATCTAGCATCAGA-

TTTGTATTTCAGA

GTAATGAACCAGCAGAAATCAAAATGCGAAACCGATGACAGAGAACAAATTTCGCAATTCTTCCAAAACTTCGGTCCAAACACAACCTTTA-

ACCAAGAGTTGGTTGGCTTACCGTCTCTAGCAGAGTTATG

ithin the Pho84 protein. Mutated codons within each oligonucleotidetation is shown at the left. Numbering of amino acid residues is fromheir one-letter code.

em

uta

GGA

TC

AGATTC

TA

s wmuy t

plasmid harboring the KpnI–EcoRI PHO84 construct was openedwCPdp

wrttTAieWG(Gsctsompe

coa(at

SH[ttwgeopatpar

pn

vuwrtL(iUaPc

um

R

chCCmobsbbtptcpedpipmrt

Pgg2grPpt

Vol. 287, No. 4, 2001 BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS

ith BamHI and KpnI allowing for insertion of the BamHI–KpnI145S/C237S/C241S/C245S fragment resulting in pUC18/C-lessHO84. All mutants were confirmed by DNA sequencing using theideoxy method (23). No other mutations were detected in the finalroduct flanked by BamHI and EcoRI.

Genomic PHO84 construct. The engineered C-less PHO84 geneas tagged with a stretch of DNA encoding six consecutive histidine

esidues and a tandem MYC epitope using PCR technology essen-ially as described (24). The C-less PHO84 gene was amplified fromhe pUC18/C-less PHO84 using sense (59-GAGAGAGAGACA-ATGATGAGTTCCGTCAATAAAGAT-39) and antisense (59-GAG-GAGAGAGGATCCTGCTTCATGTTGAAGTTGAGA-39) primers and

nserted into the pU6H2MYC plasmid (24) using NdeI and BamHIndonucleases yielding the construct pU6H2MYC/C-less PHO84.ith pU6H2MYC/C-less PHO84 as a template, primer 406 (59-GTATGGAACTTATT-39) was used together with antisense primer

59-GTATTATTTGTTCTAGTTTACAAGTTTTAGTGCATCTTTGAG-CTTACTATAGGGAGACCGGCAGATC-39) to PCR-amplify a cas-

ette containing the last 1.3 kb of the C-less PHO84 in an in-frameonjunction with the sequence encoding the c-myc epitope and selec-ion (kanr) marker resulting in a sequence of 3.0 kb. The cassette wasubsequently transformed into CEN.PK113-7D cells wherein homol-gous recombination occurred. After selection on YPD-geneticin (200g/ml) plates, colonies were restreaked on fresh YPD-geneticinlates and positives were verified using qualitative PCR and West-rn blot analyses.

Growth and expression of Pho84 in S. cerevisiae. S. cerevisiaeells expressing Pho84WT or Pho84C-less-MYC were precultivated aer-bically for 12 h in YPD medium at 30°C, washed twice with water,nd inoculated in high phosphate (HPi) or low phosphate (LPi) media25). Cells were grown aerobically at 30°C. Samples for phosphatessays and Western blot analyses were withdrawn at the indicatedime points.

Phosphate transport measurements. Phosphate uptake in intact. cerevisiae cells expressing Pho84WT or Pho84C-less-MYC grown inPi or LPi medium was assayed by the addition of 1 ml of

32P]orthophosphate (0.18 Ci/mmol; 1 mCi 5 37 MBq) and phosphateo a final concentration of 0.11 mM in 30 ml aliquots of cells essen-ially as described (6). Cells were resuspended at 1 mg/ml (weteight) in buffer containing 25 mM Tris-succinate, pH 5.0, and 2%lucose. To study the influence of pH on phosphate uptake, cellsxpressing Pho84WT or Pho84C-less-MYC protein were grown to an A590

f 3.0, harvested and incubated in buffers adjusted to the followingH values: 3.5, 4.5, 5.5, and 6.5 (25 mM succinate, Tris was added todjust the pH), pH 7.5, 8.5, and 9.5 (25 mM Tris, succinate was addedo adjust the pH) for the uptake assay. Where indicated the protono-hore, carbonylcyanide m-chlorophenylhydrazone (CCCP) wasdded to a final concentration of 60 mM in order to analyze theequirement of a proton gradient for phosphate uptake kinetics.

Determination of extracellular phosphate. Extracellular phos-hate concentration was determined spectrophotometrically at 850m essentially as described (26).

Western blot analysis of Pho84. Cells grown to specified A590

alues in LPi medium as described above were collected by centrif-gation at 5500g, 4°C for 10 min. Following centrifugation, proteinsere extracted and precipitated essentially as described (27). The

esolubilized protein was mixed with sample buffer prior to separa-ion by SDS–polyacrylamide gel electrophoresis using a 10%aemmli system (28). Immunoblotting was carried out on poly-

vinylidene difluoride) membranes (Immobilon-P Millipore) accord-ng to the Western blotting protocol (Amersham Pharmacia Biotech).se of anti-myc antibody and horseradish peroxidase-conjugatednti-mouse-Ig-antibody allowed for immunological detection of theho84-MYC construct. After a short incubation with chemilumines-ent substrate, the blot was exposed to film for 1–2 min. The molec-

839

lar mass of separated proteins was determined by the relativeobilities of the prestained marker proteins (Bio-Rad).

ESULTS AND DISCUSSION

Construction of C-less Pho84 and expression in S.erevisiae. The native cysteine residues of the Pho84igh-affinity phosphate transporter (C145, C237,241, C245, C263, C335, C399, C434, C455, C474,510, C519) were replaced serine residues using PCRutagenesis as described under Materials and Meth-

ds. Serine was chosen as the replacement residueecause compared to cysteine it is isosteric, displays aimilar tendency for helix formation (29) and hydrogenonding (30), and, moreover, such replacements haveeen shown to affect the function of other membraneransporters only to a minor extent (31–41). In order torobe the roles of the Cys residues in Pho84 function,he constructed PHO84C-less gene was introduced into S.erevisiae by homologous recombination. For this pur-ose, the gene was tagged with a stretch of DNA,ncoding six consecutive histidine residues and a tan-em MYC epitope, by insertion into the pU6H2MYClasmid using NdeI and BamHI endonucleases, yield-ng the construct pU6H2MYC/PHO84C-less (Fig. 2A). Re-lacement of the native PHO84 gene located on chro-osome 13 in S. cerevisiae was accomplished by

ecombination of a PCR-amplified cassette containinghe last 1.3 kb of PHO84C-less fused in frame with the

FIG. 2. Genomic construction (A) and expression (B) ofho84C-less-MYC protein. For the creation of the PHO84C-less-MYCenomic construct, a cassette (3.0 kb) containing part of the PHO84ene (1.3 kb) in an in-frame conjunction with the 1.7 kb 63His/3MYC/kanr sequence was amplified, transformed, and homolo-ously recombined into the yeast genome as described under Mate-ials and Methods. Expression of Pho84C-less-MYC (lane 1) andho84WT-MYC (lane 2) in LPi-grown cells harvested at early loghase were analyzed by SDS–PAGE followed by Western blot detec-ion of the c-myc epitope.

smcWptp

tbMdht(pcpmpcwvicaptepsAp

the wild-type Pho84, a partial uncoupling with respectteHpac4tp4t8tiat5tn

wctntadcgst

CMmp6

do(cap

Vol. 287, No. 4, 2001 BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS

equence encoding the c-myc epitope and selectionarker. Pho84C-less-MYC was expressed in LPi-grown

ells harvested at early log-phase and was verified byestern blot detection of the c-myc epitope and com-

ared to Pho84WT-MYC analyzed at identical condi-ions (Fig. 2B). Clearly, both proteins are stably ex-ressed at about the same level.

Functional characterization of the C-less Pho84ransporter. S. cerevisiae CEN.PK113-7D cells har-oring the native PHO84WT or engineered PHO84C-less-YC genes were grown in LPi media for up to 10 h

uring which cells were withdrawn and assayed forigh-affinity phosphate uptake; concomitantly the ex-ernal Pi concentration was monitored for each sampleFig. 3). Phosphate uptake activity during the laghase was typically 1.2 mmol.min21 g dry weight ofells21. In the late exponential phase derepressed phos-hate uptake activities reached their maxima of 12.5mol.min21 g dry weight of cells21 for the Pho84WT

rotein (Fig. 3A), and 12.2 mmol.min21 g dry weight ofells21 for the Pho84C-less-MYC protein (Fig. 3B), afterhich the transport activity rapidly declined, an obser-ation fully in agreement with our previous character-zation of the Pho84 protein (6, 7). The transient in-rease in extracellular phosphate observed in Figs. 3And 3B, paralleled by the activation of the Pho84 trans-orters, has been reported earlier (6). From the ob-ained results it is clear that none of the cysteines isssential for the catalytic mechanism of the trans-orter and that the Pho84C-less-MYC mutant is able toupport growth of yeast cells to about the same extent.lthough the mutant folds correctly and exhibits dere-ressive synthesis and kinetics nearly the same as for

FIG. 3. Growth, phosphate uptake, and extracellular phosphateetermination for CEN.PK113-7D cells expressing the Pho84WT (A)r Pho84C-less-MYC (B) proteins. Cells were grown in LPi (■) or HPih) medium. At specified time intervals, LPi-grown and HPi-grownells were collected and assayed for inorganic phosphate uptake (Fnd E, respectively) and the LPi supernatants were used for phos-hate determination (Œ) as described under Materials and Methods.

840

o the H1-coupled phosphate transport could not bexcluded. In order to investigate the intactness of the

1-coupled phosphate transport in the Pho84C-less-MYCrotein we analyzed transport activity in the absencend presence of the protonophore CCCP. In LPi-grownells both wild-type (Fig. 4A) and C-less construct (Fig.B) similarly revealed a 93% CCCP-mediated inhibi-ion of phosphate transport activity. Although phos-hate uptake in these cells grown in HPi media (Figs.a and 4b) exhibited a similar and high CCCP sensi-ivity, transport activity were for both proteins about0-fold lower than seen in LPi-grown cells suggestinghat the Pho84C-less-MYC protein catalyzes a derepress-ble unpertubed H1-coupled transport. Both Pho84WT

nd Pho84C-less-MYC proteins exhibited a comparableransport activity over the pH range of 3.5 to 9.5 (Fig.). Thus, none of the native cysteine residues is essen-ial for transport. Neither the affinity for phosphateor the H1-coupling of the transporter is affected.Taken together, we have shown that serine residuesithout affecting stability or function of the protein

an replace the native cysteine residues of the Pho84ransporter. This observation clearly indicates thatone of the cysteine residues plays a direct role in theransport mechanism. The unperturbed high transportctivity of the C-less variant makes it an ideal candi-ate for detailed molecular analysis by site-directedhemical modifications, such as cysteine scanning to-ether with biochemical/biophysical techniques usingite-directed sulfhydryl labeling, in order to elucidatehe proximity between residues in the functional struc-

FIG. 4. Phosphate uptake activity and uncoupler-sensitivity ofEN.PK113-7D cells harboring the PHO84WT (A, a) or PHO84C-less-YC (B, b) genes. Cells grown at pH 4.5 in LPi (A, B) or HPi (a, b)edium to an A590 of 7.5 were collected and assayed for high-affinity

hosphate uptake in the absence (F, h) and in the presence (E, Œ) of0 mM CCCP.

tl

A

itLtTSf

R

Fundamental Research and Applied Aspects (Hohmann, S., and

1

1

1

1

1

1

1

1

1

1

2

2

2

CtMm3Mh

Vol. 287, No. 4, 2001 BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS

ure of the protein. Such studies are in progress in thisaboratory.

CKNOWLEDGMENTS

Dr. Anna De Antoni, Max Planck Institute for Biophysical Chem-stry, Gottingen, Germany, is gratefully acknowledged for sharinghe plasmid pU6H2MYC. Professor H.R. Kaback at HHMI, UCLA,os Angeles, CA, is acknowledged for generously providing labora-ory room and facilities for the initiation of the work described here.his work was supported by research grants from the Human Frontiercience Organization and Magn. Bergvalls Stiftelse, and a research

ellowship to R.Z. from Stiftelsen Wenner-Grenska Samfundet.

EFERENCES

1. Bun-ya, M., Nishimura, M., Harashima, S., and Oshima, Y.(1991) The PHO84 gene of Saccharomyces cerevisiae encodes aninorganic phosphate transporter. Mol. Cell. Biol. 1, 3229–3238.

2. Pao, S. S., Paulsen, I. T., and Saier, M. H., Jr. (1998) Majorfacilitator superfamily. Microbiol. Mol. Biol. Rev. 62, 1–34.

3. Persson, B. L., Petersson, J., Fristedt, U., Weinander, R., Berhe,A., and Pattison, J. (1999) Phosphate permeases of Saccharomy-ces cerevisiae: Structure, function, and regulation. Biochim. Bio-phys. Acta 1422, 255–272.

4. Oshima, Y. (1997) The phosphatase system in Saccharomycescerevisiae. Genes Genet. Syst. 72, 323–334.

5. Lagerstedt, J. O., Kruckeberg, A. L., Berden, J. A., and Persson,B. L. (2000) The yeast phosphate transporting system. In Molec-ular Biology and Physiology of Water and Solute Transport:

FIG. 5. pH dependence of phosphate transport activity ofEN.PK113-5D cells expressing the Pho84WT or Pho84C-less-MYC pro-

eins. Phosphate transport activities of Pho84WT (F) and Pho84C-less-YC (h) proteins expressed in LPi-grown cells at A590 of 3.0 wereeasured during the first minute of uptake, over a pH range of

.5–9.5 in 25 mM assay buffer as described under Materials andethods. The phosphate uptake was normalized with the individual

ighest uptake rate set to 100%.

841

Nielsen, S., Eds.), pp. 405–414, Kluwer Academic/Plenum Pub-lishers, New York.

6. Martinez, P., Zvyagilskaya, R., Allard, P., and Persson, B. L.(1998) Physiological regulation of the derepressible phosphatetransporter in Saccharomyces cerevisiae. J. Bacteriol. 180, 2253–2256.

7. Petersson, J., Pattison, J., Kruckeberg, A. L., Berden, J. A., andPersson, B. L. (1999) Intracellular localization of an active greenfluorescent protein-tagged Pho84 phosphate permease in Sac-charomyces cerevisiae. FEBS Lett. 462, 37–42.

8. Berhe, A., Fristedt, U., and Persson, B. L. (1995) Expression andpurification of the high-affinity phosphate transporter of Saccha-romyces cerevisiae. Eur. J. Biochem. 227, 566–572.

9. Fristedt, U., Weinander, R., Martinsson, H.-S., and Persson,B. L. (1999) Characterization of purified and unidirectionallyreconstituted Pho84 phosphate permease of Saccharomyces cer-evisiae. FEBS Lett. 458, 1–5.

0. Fristedt, U., van der Rest, M., Poolman, B., Konings, W. N., andPersson, B. L. (1999) Studies of cytochrome c oxidase-drivenH1-coupled phosphate transport catalyzed by the Saccharomy-ces cerevisiae Pho84 permease in coreconstituted vesicles. Bio-chemistry 38, 16010–16015.

1. Kruckeberg, A. L. (1996) The hexose transporter family of Sac-charomyces cerevisiae. Arch. Microbiol. 166, 283–292.

2. Boles, E., and Hollenberg, C. P. (1997) The molecular genetics ofhexose transport in yeasts. FEMS Microbiol. Rev. 21, 85–111.

3. Frillingos, S., Sahin-Toth, M., Wu, J., and Kaback, H. R. (1998)Cys-scanning mutagenesis: A novel approach to structure func-tion relationships in polytopic membrane proteins. FASEB J. 12,1281–1299.

4. Lo, B., and Silverman, M. (1998) Cysteine scanning mutagenesisof the segment between putative transmembrane helices IV andV of the high affinity Na1/Glucose cotransporter SGLT1. Evi-dence that this region participates in the Na1 and voltage de-pendence of the transporter. J. Biol. Chem. 273, 29341–29351.

5. Bainbridge, G., Mobasheri, H., Armstrong, G. A., Lea, E. J., andLakey, J. H. (1998) Voltage-gating of Escherichia coli porin: Acysteine-scanning mutagenesis study of loop 3. J. Mol. Biol. 275,171–176.

6. Kubo, Y., Yoshimichi, M., and Heinemann, S. H. (1998) Probingpore topology and conformational changes of Kir2.1 potassiumchannels by cysteine scanning mutagenesis. FEBS Lett. 435,69–73.

7. Slotboom, D. J., Sobczak, I., Konings, W. N., and Lolkema, J. S.(1999) A conserved serine-rich stretch in the glutamate trans-porter family forms a substrate-sensitive reentrant loop. Proc.Natl. Acad. Sci. USA 96, 14282–14287.

8. Loo, T. W., and Clarke, D. M. (1999) Determining the structureand mechanism of the human multidrug resistance P-glyco-protein using cysteine-scanning mutagenesis and thiol-modification techniques. Biochim. Biophys. Acta 1461, 315–325.

9. Hruz, P. W., and Mueckler, M. M. (1999) Cysteine-scanningmutagenesis of transmembrane segment 7 of the GLUT1 glucosetransporter. J. Biol. Chem. 274, 36176–36180.

0. Sahin-Toth, M., Frillingos, S., Lawrence, M. C., and Kaback,H. R. (2000) The sucrose permease of Escherichia coli: Func-tional significance of cysteine residues and properties of acysteine-less transporter. Biochemistry 39, 6164–6169.

1. Tamura, N., Konishi, S., Iwaki, S., Kimura-Someya, T., Nada, S.,and Yamaguchi, A. (2001) Complete cysteine-scanning mutagen-esis and site-directed chemical modification of the Tn10-encodedmetal-tetracycline/H1 antiporter. J. Biol. Chem. 276, 20330–20339.

2. Lagerstedt, J. O., Pratt, J. R., Zvyagilskaya, R., Pattison-

Granberg, J., Kruckeberg, A. L., Berden, J. A., and Persson, B. L.

2

2

2

2

2

2

2

3

3

3

33. Arechaga, I., Raimbault, S., Pieto, S., Levi-Meyrueis, C., Zara-

3

3

3

3

3

3

4

4

Vol. 287, No. 4, 2001 BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS

(2001) Submitted.3. Sanger, F., Niklen, S., and Coulson, A. R. (1977) DNA sequenc-

ing with chain-terminating inhibitors. Proc. Natl. Acad. Sci.USA 74, 5463–5467.

4. De Antoni, A., and Gallwitz, D. (2000) A novel multi-purposecassette for repeated integrative epitope tagging of genes inSaccharomyces cerevisiae. Gene 246, 179–185.

5. Kaneko, Y., Toh-e, A., and Oshima, Y. (1982) Identification of thegenetic locus for the structural gene and a new regulatory genefor the synthesis of repressible alkaline phosphatase in Saccha-romyces cerevisiae. Mol. Cell. Biol. 2, 127–137.

6. Nyren, P., Nore, B. F., and Baltscheffsky, M. (1986) Studies ofphotosynthetic inorganic pyrophosphate formation in Rhodospi-rillum rubrum chromatofores. Biochim. Biophys. Acta 851, 276–282.

7. Horak, J., and Wolf, D. F. (2001) Glucose-induced monoubiquiti-nation of the Saccharomyces cerevisiae galactose transporter issufficient to signal its internalization. J. Bacteriol. 183, 3083–3088.

8. Laemmli, U. K. (1970) Cleavage of structural proteins during theassembly of the head of bacteriophage T4. Nature 227, 680–685.

9. Blaber, M., Zhang, X.-J., and Matthews, B. W. (1993) Structuralbasis of amino acid alpha helix propensity. Science 260, 1637–1640.

0. Richardson, J. S., and Richarson, D. C. (1989) Principles andpatterns of protein conformation. In Prediction of Protein Struc-ture and the Principles of Protein Conformation (Fasman, G. D.,Ed.), pp. 1–98, Plenum Press, New York.

1. van Ivaarden, P. R., Pastore, J. C., Konings, W. N., and Kaback,H. R. (1991) Construction of a functional lactose permease de-void of cysteine residues. Biochemistry 30, 9595–9600.

2. Yan, R.-T., and Maloney, P. C. (1993) Identification of a residuein the translocation pathway of a membrane carrier. Cell 75,37–44.

842

goza, P, Miroux, B., Ricquier, D., Bouillaud, F., and Rial, E.(1993) Cysteine residues are not essential for uncoupling proteinfunction. Biochem. J. 296, 693–700.

4. Wellner, M., Monden, I., and Keller, K. (1994) The role of cys-teine residues in glucose-transporter-GLUT1-mediated trans-port and transport inhibition. Biochem. J. 299, 813–817.

5. Due, A. D., Cook, J. A., Fletcher, S. J., Qu, Z-.C., Powers, A. C.,and May, J. M. (1995) A “cysteineless” GLUT1 glucose trans-porter has normal function when expressed in Xenopus oocytes.Biochem. Biophys. Res. Commun. 208, 590–596.

6. Schroers, A., Kramer, R., and Wohlrab, H. (1997) The reversibleantiport-uniport conversion of the phosphate carrier from yeastmitochondria depends on the presence of a single cysteine.J. Biol. Chem. 272, 10558–10564.

7. Meuller, J., Zhang, J., Hou, C., Bragg, P. D., and Rydstrom, J.(1997) Effects of metal ions on the substrate-specificity and ac-tivity of proton-pumping nicotinamide nucleotide transhydroge-nase from Escherichia coli. Biochem. J. 324, 681–687.

8. Kimura, T., Ohnuma, M., Sawai, T., and Yamaguchi, A. (1997)Membrane topology of the transposon 10-encoded metal-tetracycline/H1 antiporter as studied by site-directed chemicallabeling. J. Biol. Chem. 272, 580–587.

9. Hunke, S., and Schneider, E. (1999) A Cys-less variant of thebacterial ATP-binding cassette protein MalK is functional inmaltose transport and regulation. FEBS Lett. 448, 131–134.

0. Xu, Y., Kakhniashvili, A., Gremse, D. A., Wood, D. O., Mayor,J. A., Walters, D. E., and Kaplan, R. S. (2000) The yeast mito-chondrial citrate transport protein. Probing the roles of cys-teines, Arg(181), and Arg(189) in transporter function. J. Biol.Chem. 275, 7117–7124.

1. Hu, Y.-K., Eisses, J. F., and Kaplan, J. H. (2000) Expression ofan active Na,K-ATPase with an alpha-subunit lacking alltwenty-three native cysteine residues. J. Biol. Chem. 275,30734–30739.