"Promises & perils of I.T." - INSEAD class by mgirardot

9
Visiting Professor Marc Girardot | Promises & Perils of I.T. | 7/8/13 3:38 PM Slide 1 Promises and Perils of I.T. in collaboration with Marc Girardot Visiting Professor

description

INSEAD class by mgirardot Some sample slides from a class given at INSEAD by Marc Girardot

Transcript of "Promises & perils of I.T." - INSEAD class by mgirardot

Page 1: "Promises & perils of I.T." - INSEAD class by mgirardot

��Visiting Professor Marc Girardot | Promises & Perils of I.T. | 7/8/13 3:38 PM Slide 1

Promises and Perils of I.T.

in collaboration with

Marc Girardot Visiting Professor

Page 2: "Promises & perils of I.T." - INSEAD class by mgirardot

��Visiting Professor Marc Girardot | Promises & Perils of I.T. | 7/8/13 3:38 PM Slide 4

Page 3: "Promises & perils of I.T." - INSEAD class by mgirardot

��Visiting Professor Marc Girardot | Promises & Perils of I.T. | 7/8/13 3:38 PM Slide 27

Overall, the context of I.T. today is often sub-optimal, when not counter-productive

Business Side

—  Limited to no knowledge in I.T. —  Uncomfortable with I.T. —  Fear of the unknown —  Distrust of I.T. —  Rarely a C-level topic —  Helpdesk mentality —  Viewed as relatively reliable, but not

innovative —  I.T. is expensive —  I.T. isn’t sexy socially

Information Technology Side

—  They don’t get it! —  Our budget are getting smaller to do

more and more —  Don’t have the resources (…to

recruit, reward and develop top talent)

—  Have little understanding of business (not ambidextrous)

—  Limited capacity to communicate

Page 4: "Promises & perils of I.T." - INSEAD class by mgirardot

��Visiting Professor Marc Girardot | Promises & Perils of I.T. | 7/8/13 3:38 PM Slide 28

What are at the possible root causes of this Divide?

Dynamics of the IT/Business Divide (Proposal)

Page 5: "Promises & perils of I.T." - INSEAD class by mgirardot

��Visiting Professor Marc Girardot | Promises & Perils of I.T. | 7/8/13 3:38 PM Slide 30

With maturity of I.T., platforms are made possible…

—  Stable —  Functionality resilient —  Standardization — Open technologies — Cost efficient — Quality —  Standards — More inter-operability

Littlebits plaform

Page 6: "Promises & perils of I.T." - INSEAD class by mgirardot

��Visiting Professor Marc Girardot | Promises & Perils of I.T. | 7/8/13 3:38 PM Slide 37

Source: BCG, HBR

And the Internet has already become a huge part of the economy

Page 7: "Promises & perils of I.T." - INSEAD class by mgirardot

��Visiting Professor Marc Girardot | Promises & Perils of I.T. | 7/8/13 3:38 PM Slide 40

Promise n°1

Building the next generation company for a complex high-pace world with I.T.

Time Pressure Complexity

Time Acceleration

Technology Avalanche

Globalization Customer Demands Regulations

Structure IT Process IT People IT Tools IT

Empowerment IT

Culture IT

Industrialize IT Out-task IT

Automate IT

Simplify IT

Train IT Communicate IT Collaborate IT

Efficiency IT

Page 8: "Promises & perils of I.T." - INSEAD class by mgirardot

��Visiting Professor Marc Girardot | Promises & Perils of I.T. | 7/8/13 3:38 PM Slide 59

Promise n°8 Information technology will try to progressively integrate with nature’s own I.T.

Integrating nature into I.T.

Integrating I.T. into nature Coding nature

11010101010 10101010101

ATGCGCTAATGC 110101010100101010101010100101010101010101001010100101011010101010010101010101010010101010101010100101010010101101010101001010101010101001010101010101010010101001010

ATGCGCTAATGCCGTAATATGCGCCGGCATTAATGCCGTAATATGCTAGCCGTAATATGCGCATGCGCTAATGCCGTAATATGCGCCGGCATTAATGCCGTAATATGCTAGCCGTAATATGCGC

=!

Page 9: "Promises & perils of I.T." - INSEAD class by mgirardot

��Visiting Professor Marc Girardot | Promises & Perils of I.T. | 7/8/13 3:38 PM Slide 66

Peril n°5

Thinking the disruptors will forget you and that you are protected

—  The Google Car or Tesla symptom

—  Leveraging I.T. maturity along with leading-edge knowledge

—  New ways of organizing —  More focused funding —  Mutualization —  Specialization —  I.T. money and philosophy

into Auto ventures —  “Doing things differently”

Figure 1: Comparison of Top 50 Automotive and High-Tech companies

Source: “Electronics-ization of the Automobile industry”, M.Girardot, Cisco IBSG

Figure 2: Google’s self-driving car earns a driver’s license in Nevada