"Promises & perils of I.T." - INSEAD class by mgirardot
-
Upload
marc-girardot -
Category
Business
-
view
267 -
download
1
description
Transcript of "Promises & perils of I.T." - INSEAD class by mgirardot
��Visiting Professor Marc Girardot | Promises & Perils of I.T. | 7/8/13 3:38 PM Slide 1
Promises and Perils of I.T.
in collaboration with
Marc Girardot Visiting Professor
��Visiting Professor Marc Girardot | Promises & Perils of I.T. | 7/8/13 3:38 PM Slide 4
��Visiting Professor Marc Girardot | Promises & Perils of I.T. | 7/8/13 3:38 PM Slide 27
Overall, the context of I.T. today is often sub-optimal, when not counter-productive
Business Side
— Limited to no knowledge in I.T. — Uncomfortable with I.T. — Fear of the unknown — Distrust of I.T. — Rarely a C-level topic — Helpdesk mentality — Viewed as relatively reliable, but not
innovative — I.T. is expensive — I.T. isn’t sexy socially
Information Technology Side
— They don’t get it! — Our budget are getting smaller to do
more and more — Don’t have the resources (…to
recruit, reward and develop top talent)
— Have little understanding of business (not ambidextrous)
— Limited capacity to communicate
��Visiting Professor Marc Girardot | Promises & Perils of I.T. | 7/8/13 3:38 PM Slide 28
What are at the possible root causes of this Divide?
Dynamics of the IT/Business Divide (Proposal)
��Visiting Professor Marc Girardot | Promises & Perils of I.T. | 7/8/13 3:38 PM Slide 30
With maturity of I.T., platforms are made possible…
— Stable — Functionality resilient — Standardization — Open technologies — Cost efficient — Quality — Standards — More inter-operability
Littlebits plaform
��Visiting Professor Marc Girardot | Promises & Perils of I.T. | 7/8/13 3:38 PM Slide 37
Source: BCG, HBR
And the Internet has already become a huge part of the economy
��Visiting Professor Marc Girardot | Promises & Perils of I.T. | 7/8/13 3:38 PM Slide 40
Promise n°1
Building the next generation company for a complex high-pace world with I.T.
Time Pressure Complexity
Time Acceleration
Technology Avalanche
Globalization Customer Demands Regulations
Structure IT Process IT People IT Tools IT
Empowerment IT
Culture IT
Industrialize IT Out-task IT
Automate IT
Simplify IT
Train IT Communicate IT Collaborate IT
Efficiency IT
��Visiting Professor Marc Girardot | Promises & Perils of I.T. | 7/8/13 3:38 PM Slide 59
Promise n°8 Information technology will try to progressively integrate with nature’s own I.T.
Integrating nature into I.T.
Integrating I.T. into nature Coding nature
11010101010 10101010101
ATGCGCTAATGC 110101010100101010101010100101010101010101001010100101011010101010010101010101010010101010101010100101010010101101010101001010101010101001010101010101010010101001010
ATGCGCTAATGCCGTAATATGCGCCGGCATTAATGCCGTAATATGCTAGCCGTAATATGCGCATGCGCTAATGCCGTAATATGCGCCGGCATTAATGCCGTAATATGCTAGCCGTAATATGCGC
=!
��Visiting Professor Marc Girardot | Promises & Perils of I.T. | 7/8/13 3:38 PM Slide 66
Peril n°5
Thinking the disruptors will forget you and that you are protected
— The Google Car or Tesla symptom
— Leveraging I.T. maturity along with leading-edge knowledge
— New ways of organizing — More focused funding — Mutualization — Specialization — I.T. money and philosophy
into Auto ventures — “Doing things differently”
Figure 1: Comparison of Top 50 Automotive and High-Tech companies
Source: “Electronics-ization of the Automobile industry”, M.Girardot, Cisco IBSG
Figure 2: Google’s self-driving car earns a driver’s license in Nevada