Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... –...
Transcript of Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... –...
![Page 1: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes](https://reader035.fdocuments.in/reader035/viewer/2022071507/61286a950fd8987be008cb32/html5/thumbnails/1.jpg)
Prof. Fahd M. Nasr
Lebanese universityFaculty of sciences
https://yeastwonderfulworld.wordpress.com/
![Page 2: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes](https://reader035.fdocuments.in/reader035/viewer/2022071507/61286a950fd8987be008cb32/html5/thumbnails/2.jpg)
Mighty Yeasts
The yeast Saccharomyces cerevisiaeas a genetic model system
![Page 3: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes](https://reader035.fdocuments.in/reader035/viewer/2022071507/61286a950fd8987be008cb32/html5/thumbnails/3.jpg)
Yeast genetics• In 1996 Yeast genes
– 1/3 characterised by genetic analysis– 1/3 shows homology to known genes– 1/3 orphans
• 5% yeast genes with introns very few have more than one
• The intergenic space between genes is only between 200 and 1,000bp
![Page 4: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes](https://reader035.fdocuments.in/reader035/viewer/2022071507/61286a950fd8987be008cb32/html5/thumbnails/4.jpg)
Yeast genome analysis• Major goal function of every gene• Large projects and numerous approaches• Micro array analysis
– Gene expression profiles– Binding sites in the genome for all transcription factors
• A complete set of more than 6,000 deletion mutants is available for research
• Various approaches to analyse the properties of these mutants
• Tag yeast genes to GFP protein detection and microscopic localisation
• Different global protein interaction projects are ongoing
![Page 5: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes](https://reader035.fdocuments.in/reader035/viewer/2022071507/61286a950fd8987be008cb32/html5/thumbnails/5.jpg)
Yeast genes: nomenclature
![Page 6: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes](https://reader035.fdocuments.in/reader035/viewer/2022071507/61286a950fd8987be008cb32/html5/thumbnails/6.jpg)
Yeast genes: nomenclature• Many genes systematic sequencing : YDR518C,
YML016W..., where– Y stands for ”yeast”– The second letter represents the chromosome (D=IV,
M=XIII....)– L or R stand for left or right chromosome arm– The three-digit number stands for the ORF counted
from the centromere on that chromosome arm– C or W stand for ”Crick” or ”Watson” indicate the
strand or direction of the ORF• Some genes do not follow this nomenclature HO, MATa,
MATa
![Page 7: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes](https://reader035.fdocuments.in/reader035/viewer/2022071507/61286a950fd8987be008cb32/html5/thumbnails/7.jpg)
General pathway for mutational dissection of a biological process
“Forward Genetics”
![Page 8: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes](https://reader035.fdocuments.in/reader035/viewer/2022071507/61286a950fd8987be008cb32/html5/thumbnails/8.jpg)
![Page 9: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes](https://reader035.fdocuments.in/reader035/viewer/2022071507/61286a950fd8987be008cb32/html5/thumbnails/9.jpg)
Gene deletion in yeast
HIS3
CBK1X X
Chromosome XIV
DNA cassette~50nc
Chromosome XIV
HIS3
![Page 10: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes](https://reader035.fdocuments.in/reader035/viewer/2022071507/61286a950fd8987be008cb32/html5/thumbnails/10.jpg)
CBK1
DcbK1::HIS3
mmmm + histidine
+
+ -
+Transform the strain CBK1, his3 with DNA cassette
Select for transformants on mm
![Page 11: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes](https://reader035.fdocuments.in/reader035/viewer/2022071507/61286a950fd8987be008cb32/html5/thumbnails/11.jpg)
wild type(CBK1)
∆cbk1
DIC Calcofluor white
![Page 12: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes](https://reader035.fdocuments.in/reader035/viewer/2022071507/61286a950fd8987be008cb32/html5/thumbnails/12.jpg)
Yeast genetics: markers and strains
• Genetic markers for selection
• Commonly genetic markers HIS3, URA3, TRP1, LEU2, LYS2, ADE2
• The ade2 mutation cells turn red
• The first markers fermentation markers: SUC, MAL, GAL– GAL genes encode the enzymes needed to take up
galactose and convert it to glucose-6-phosphate
![Page 13: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes](https://reader035.fdocuments.in/reader035/viewer/2022071507/61286a950fd8987be008cb32/html5/thumbnails/13.jpg)
![Page 14: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes](https://reader035.fdocuments.in/reader035/viewer/2022071507/61286a950fd8987be008cb32/html5/thumbnails/14.jpg)
Purine nucleotide synthesis pathway in yeast
![Page 15: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes](https://reader035.fdocuments.in/reader035/viewer/2022071507/61286a950fd8987be008cb32/html5/thumbnails/15.jpg)
![Page 16: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes](https://reader035.fdocuments.in/reader035/viewer/2022071507/61286a950fd8987be008cb32/html5/thumbnails/16.jpg)
The art and design of genetic screens: yeast
![Page 17: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes](https://reader035.fdocuments.in/reader035/viewer/2022071507/61286a950fd8987be008cb32/html5/thumbnails/17.jpg)
Galactose metabolizing pathway of yeast
![Page 18: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes](https://reader035.fdocuments.in/reader035/viewer/2022071507/61286a950fd8987be008cb32/html5/thumbnails/18.jpg)
Galactose metabolizing pathway of yeast
![Page 19: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes](https://reader035.fdocuments.in/reader035/viewer/2022071507/61286a950fd8987be008cb32/html5/thumbnails/19.jpg)
![Page 20: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes](https://reader035.fdocuments.in/reader035/viewer/2022071507/61286a950fd8987be008cb32/html5/thumbnails/20.jpg)
• GAL genes are near each other but do not constitute an operon
• GAL4 unlinked gene repressor protein– Binds a promoter element UASG– UAS is located between GAL1 and GAL10– Transcription occurs in both directions from UASG
• Galactose absent GAL4p +GAL80p bind the UASGtranscription does not occur
• Galactose present galactose binds GAL80p and GAL4p amino acids are phosphorylated
• Galactose acts as an inducer by causing a conformation change in GAL4p/GAL80p
Transcriptional control of galactose-utilizing genes in yeast
![Page 21: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes](https://reader035.fdocuments.in/reader035/viewer/2022071507/61286a950fd8987be008cb32/html5/thumbnails/21.jpg)
Activation model of GAL genes in yeast
![Page 22: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes](https://reader035.fdocuments.in/reader035/viewer/2022071507/61286a950fd8987be008cb32/html5/thumbnails/22.jpg)
Regulation of galactose utilization in yeast
![Page 23: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes](https://reader035.fdocuments.in/reader035/viewer/2022071507/61286a950fd8987be008cb32/html5/thumbnails/23.jpg)
![Page 24: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes](https://reader035.fdocuments.in/reader035/viewer/2022071507/61286a950fd8987be008cb32/html5/thumbnails/24.jpg)
Repression of the GAL1 gene in yeast
![Page 25: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes](https://reader035.fdocuments.in/reader035/viewer/2022071507/61286a950fd8987be008cb32/html5/thumbnails/25.jpg)
![Page 26: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes](https://reader035.fdocuments.in/reader035/viewer/2022071507/61286a950fd8987be008cb32/html5/thumbnails/26.jpg)
How genes respond to environmental stimuli
![Page 27: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes](https://reader035.fdocuments.in/reader035/viewer/2022071507/61286a950fd8987be008cb32/html5/thumbnails/27.jpg)
Scer TTATATTGAATTTTCAAAAATTCTTACTTTTTTTTTGGATGGACGCAAAGAAGTTTAATAATCATATTACATGGCATTACCACCATATACASpar CTATGTTGATCTTTTCAGAATTTTT-CACTATATTAAGATGGGTGCAAAGAAGTGTGATTATTATATTACATCGCTTTCCTATCATACACASmik GTATATTGAATTTTTCAGTTTTTTTTCACTATCTTCAAGGTTATGTAAAAAA-TGTCAAGATAATATTACATTTCGTTACTATCATACACASbay TTTTTTTGATTTCTTTAGTTTTCTTTCTTTAACTTCAAAATTATAAAAGAAAGTGTAGTCACATCATGCTATCT-GTCACTATCACATATA
* * **** * * * ** ** * * ** ** ** * * * ** ** * * * ** * * *
Scer TATCCATATCTAATCTTACTTATATGTTGT-GGAAAT-GTAAAGAGCCCCATTATCTTAGCCTAAAAAAACC--TTCTCTTTGGAACTTTCAGTAATACGSpar TATCCATATCTAGTCTTACTTATATGTTGT-GAGAGT-GTTGATAACCCCAGTATCTTAACCCAAGAAAGCC--TT-TCTATGAAACTTGAACTG-TACGSmik TACCGATGTCTAGTCTTACTTATATGTTAC-GGGAATTGTTGGTAATCCCAGTCTCCCAGATCAAAAAAGGT--CTTTCTATGGAGCTTTG-CTA-TATGSbay TAGATATTTCTGATCTTTCTTATATATTATAGAGAGATGCCAATAAACGTGCTACCTCGAACAAAAGAAGGGGATTTTCTGTAGGGCTTTCCCTATTTTG
** ** *** **** ******* ** * * * * * * * ** ** * *** * *** * * *
Scer CTTAACTGCTCATTGC-----TATATTGAAGTACGGATTAGAAGCCGCCGAGCGGGCGACAGCCCTCCGACGGAAGACTCTCCTCCGTGCGTCCTCGTCTSpar CTAAACTGCTCATTGC-----AATATTGAAGTACGGATCAGAAGCCGCCGAGCGGACGACAGCCCTCCGACGGAATATTCCCCTCCGTGCGTCGCCGTCTSmik TTTAGCTGTTCAAG--------ATATTGAAATACGGATGAGAAGCCGCCGAACGGACGACAATTCCCCGACGGAACATTCTCCTCCGCGCGGCGTCCTCTSbay TCTTATTGTCCATTACTTCGCAATGTTGAAATACGGATCAGAAGCTGCCGACCGGATGACAGTACTCCGGCGGAAAACTGTCCTCCGTGCGAAGTCGTCT
** ** ** ***** ******* ****** ***** *** **** * *** ***** * * ****** *** * ***
Scer TCACCGG-TCGCGTTCCTGAAACGCAGATGTGCCTCGCGCCGCACTGCTCCGAACAATAAAGATTCTACAA-----TACTAGCTTTT--ATGGTTATGAASpar TCGTCGGGTTGTGTCCCTTAA-CATCGATGTACCTCGCGCCGCCCTGCTCCGAACAATAAGGATTCTACAAGAAA-TACTTGTTTTTTTATGGTTATGACSmik ACGTTGG-TCGCGTCCCTGAA-CATAGGTACGGCTCGCACCACCGTGGTCCGAACTATAATACTGGCATAAAGAGGTACTAATTTCT--ACGGTGATGCCSbay GTG-CGGATCACGTCCCTGAT-TACTGAAGCGTCTCGCCCCGCCATACCCCGAACAATGCAAATGCAAGAACAAA-TGCCTGTAGTG--GCAGTTATGGT
** * ** *** * * ***** ** * * ****** ** * * ** * * ** ***
Scer GAGGA-AAAATTGGCAGTAA----CCTGGCCCCACAAACCTT-CAAATTAACGAATCAAATTAACAACCATA-GGATGATAATGCGA------TTAG--TSpar AGGAACAAAATAAGCAGCCC----ACTGACCCCATATACCTTTCAAACTATTGAATCAAATTGGCCAGCATA-TGGTAATAGTACAG------TTAG--GSmik CAACGCAAAATAAACAGTCC----CCCGGCCCCACATACCTT-CAAATCGATGCGTAAAACTGGCTAGCATA-GAATTTTGGTAGCAA-AATATTAG--GSbay GAACGTGAAATGACAATTCCTTGCCCCT-CCCCAATATACTTTGTTCCGTGTACAGCACACTGGATAGAACAATGATGGGGTTGCGGTCAAGCCTACTCG
**** * * ***** *** * * * * * * * * **
Scer TTTTTAGCCTTATTTCTGGGGTAATTAATCAGCGAAGCG--ATGATTTTT-GATCTATTAACAGATATATAAATGGAAAAGCTGCATAACCAC-----TTSpar GTTTT--TCTTATTCCTGAGACAATTCATCCGCAAAAAATAATGGTTTTT-GGTCTATTAGCAAACATATAAATGCAAAAGTTGCATAGCCAC-----TTSmik TTCTCA--CCTTTCTCTGTGATAATTCATCACCGAAATG--ATGGTTTA--GGACTATTAGCAAACATATAAATGCAAAAGTCGCAGAGATCA-----ATSbay TTTTCCGTTTTACTTCTGTAGTGGCTCAT--GCAGAAAGTAATGGTTTTCTGTTCCTTTTGCAAACATATAAATATGAAAGTAAGATCGCCTCAATTGTA
* * * *** * ** * * *** *** * * ** ** * ******** **** *
Scer TAACTAATACTTTCAACATTTTCAGT--TTGTATTACTT-CTTATTCAAAT----GTCATAAAAGTATCAACA-AAAAATTGTTAATATACCTCTATACTSpar TAAATAC-ATTTGCTCCTCCAAGATT--TTTAATTTCGT-TTTGTTTTATT----GTCATGGAAATATTAACA-ACAAGTAGTTAATATACATCTATACTSmik TCATTCC-ATTCGAACCTTTGAGACTAATTATATTTAGTACTAGTTTTCTTTGGAGTTATAGAAATACCAAAA-AAAAATAGTCAGTATCTATACATACASbay TAGTTTTTCTTTATTCCGTTTGTACTTCTTAGATTTGTTATTTCCGGTTTTACTTTGTCTCCAATTATCAAAACATCAATAACAAGTATTCAACATTTGT
* * * * * * ** *** * * * * ** ** ** * * * * * *** *
Scer TTAA-CGTCAAGGA---GAAAAAACTATASpar TTAT-CGTCAAGGAAA-GAACAAACTATASmik TCGTTCATCAAGAA----AAAAAACTA..Sbay TTATCCCAAAAAAACAACAACAACATATA
* * ** * ** ** **
GAL10
GAL1
TBP
GAL4 GAL4 GAL4
GAL4
MIG1
TBPMIG1
Factor footprint
Conservation island
Conservation of Motifs
![Page 28: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes](https://reader035.fdocuments.in/reader035/viewer/2022071507/61286a950fd8987be008cb32/html5/thumbnails/28.jpg)
Yeast genetics: markers and strains
• Certain antibiotic resistance markers used in transformation kanamycin resistance = kanR
• There are many yeast strains in use in the laboratories:W303-1A, S288C, S1278b, SK1, BY4741....
![Page 29: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes](https://reader035.fdocuments.in/reader035/viewer/2022071507/61286a950fd8987be008cb32/html5/thumbnails/29.jpg)
Yeast genetics: markers and strains
• Specific properties can be quite different and are different to wild or industrial strains
• The full genotype of W303-1A strain:MATa leu2-3/112 ura3-1 trp1-1 his3-11/15 ade2-1 can1-100 GAL SUC2mal0
![Page 30: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes](https://reader035.fdocuments.in/reader035/viewer/2022071507/61286a950fd8987be008cb32/html5/thumbnails/30.jpg)
Auxotroph• Mutant organism requiring a specific growth
substance– Auxotrophy inability of an organism to synthesize a
particular organic compound required for its growth– An auxotroph is an organism that displays this
characteristic– Auxotrophic is the corresponding adjective
• Auxotrophy is the opposite of prototrophy– wild-type strain– Auxotrophic genetic markers are often used in
molecular genetics
![Page 31: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes](https://reader035.fdocuments.in/reader035/viewer/2022071507/61286a950fd8987be008cb32/html5/thumbnails/31.jpg)
Chemical structure of arginine compared to canavanine
![Page 32: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes](https://reader035.fdocuments.in/reader035/viewer/2022071507/61286a950fd8987be008cb32/html5/thumbnails/32.jpg)
Promoters on Vectors
![Page 33: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes](https://reader035.fdocuments.in/reader035/viewer/2022071507/61286a950fd8987be008cb32/html5/thumbnails/33.jpg)
Tetrad analysis for genetic analysis
![Page 34: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes](https://reader035.fdocuments.in/reader035/viewer/2022071507/61286a950fd8987be008cb32/html5/thumbnails/34.jpg)
![Page 35: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes](https://reader035.fdocuments.in/reader035/viewer/2022071507/61286a950fd8987be008cb32/html5/thumbnails/35.jpg)
![Page 36: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes](https://reader035.fdocuments.in/reader035/viewer/2022071507/61286a950fd8987be008cb32/html5/thumbnails/36.jpg)
![Page 37: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes](https://reader035.fdocuments.in/reader035/viewer/2022071507/61286a950fd8987be008cb32/html5/thumbnails/37.jpg)
![Page 38: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes](https://reader035.fdocuments.in/reader035/viewer/2022071507/61286a950fd8987be008cb32/html5/thumbnails/38.jpg)
![Page 39: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes](https://reader035.fdocuments.in/reader035/viewer/2022071507/61286a950fd8987be008cb32/html5/thumbnails/39.jpg)
![Page 40: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes](https://reader035.fdocuments.in/reader035/viewer/2022071507/61286a950fd8987be008cb32/html5/thumbnails/40.jpg)
![Page 41: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes](https://reader035.fdocuments.in/reader035/viewer/2022071507/61286a950fd8987be008cb32/html5/thumbnails/41.jpg)
Synthetic Lethal Screen
![Page 42: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes](https://reader035.fdocuments.in/reader035/viewer/2022071507/61286a950fd8987be008cb32/html5/thumbnails/42.jpg)
![Page 43: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes](https://reader035.fdocuments.in/reader035/viewer/2022071507/61286a950fd8987be008cb32/html5/thumbnails/43.jpg)
Tetrad Spore MAT leu ura his SUC NaCl
1 A a + + - - -
1 B alpha + - + - -
1 C a - - - + -
1 D alpha - + + + +
2 A a - - - - -
2 B a + + + + +
2 C alpha + - + - -
2 D alpha - + - + -
Yeast genetics: crossing strains
![Page 44: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes](https://reader035.fdocuments.in/reader035/viewer/2022071507/61286a950fd8987be008cb32/html5/thumbnails/44.jpg)
Replicate plating to isolate auxotrophic mutants: grow with His but not without His
![Page 45: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes](https://reader035.fdocuments.in/reader035/viewer/2022071507/61286a950fd8987be008cb32/html5/thumbnails/45.jpg)
![Page 46: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes](https://reader035.fdocuments.in/reader035/viewer/2022071507/61286a950fd8987be008cb32/html5/thumbnails/46.jpg)
Yeast genetics: meiosis• Yeast tetrad analysis
outcome of meiosis• 2n has two chromosomes• DNA replication two
chromosomes with two identical chromatids each
• Aligned chromosomes undergo recombination
• First meiotic division separate the chromosomes
• Second meiotic division separate the chromatids
• Each spore represents essentially one chromatid
X
![Page 47: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes](https://reader035.fdocuments.in/reader035/viewer/2022071507/61286a950fd8987be008cb32/html5/thumbnails/47.jpg)
![Page 48: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes](https://reader035.fdocuments.in/reader035/viewer/2022071507/61286a950fd8987be008cb32/html5/thumbnails/48.jpg)
Three kinds of patternsMATa TRP1URA3 x MATa trp1 ura3
![Page 49: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes](https://reader035.fdocuments.in/reader035/viewer/2022071507/61286a950fd8987be008cb32/html5/thumbnails/49.jpg)
Recombination Between Markers
RF = 1/2T +NPD If RF = 50% then genes are unlinked
![Page 50: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes](https://reader035.fdocuments.in/reader035/viewer/2022071507/61286a950fd8987be008cb32/html5/thumbnails/50.jpg)
When genes are linked, PDs exceed NPDs
![Page 51: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes](https://reader035.fdocuments.in/reader035/viewer/2022071507/61286a950fd8987be008cb32/html5/thumbnails/51.jpg)
Sulfate assimilation requires 3 different enzymes, encoded by MET3, MET14, and MET16
Met3p
SO42-
Met14p
APS PAPS
Met16p
SO32-
A mutation in any of the 3 genes will prevent sulfate assimilation required for de novo*
methionine synthesis
*de novo – no organic sulfur source is used
![Page 52: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes](https://reader035.fdocuments.in/reader035/viewer/2022071507/61286a950fd8987be008cb32/html5/thumbnails/52.jpg)
![Page 53: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes](https://reader035.fdocuments.in/reader035/viewer/2022071507/61286a950fd8987be008cb32/html5/thumbnails/53.jpg)
Ascus 1
MATa/α MET3/met3 MET14/met14
What happens when the Met+ diploid sporulates?
(We’ll ignore the MET16 and MATa loci)
Ascus 2
Each meiosis produces an ascus with 4 haploid spores
OR
1/4 spores will give rise to a Met+
haploid
![Page 54: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes](https://reader035.fdocuments.in/reader035/viewer/2022071507/61286a950fd8987be008cb32/html5/thumbnails/54.jpg)
Linkage analysis
# of tetradsGene pair PD NPD Tgal1/gal7 313 0 0gal1/gal10 59 0 0gal7/gal10 72 0 0gal1/gal4 21 23 56gal3/gal4 20 13 48
![Page 55: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes](https://reader035.fdocuments.in/reader035/viewer/2022071507/61286a950fd8987be008cb32/html5/thumbnails/55.jpg)
What does what?Enzymatic activities
Genotype Kinase Transferase Epimerasewild type 13-24 9-14 8-34gal1 0 14.9 87.2gal7 6 0 33.8gal10 2.7 2.2 0gal10/i- 13 15.5 0gal1/gal7 0 0 20.3gal1/gal10 0 6.1 0gal4 0 0 0gal4/i- 0 0 0
![Page 56: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes](https://reader035.fdocuments.in/reader035/viewer/2022071507/61286a950fd8987be008cb32/html5/thumbnails/56.jpg)
The end