Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... –...

56
Prof. Fahd M. Nasr Lebanese university Faculty of sciences [email protected] https://yeastwonderfulworld.wordpress.com/

Transcript of Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... –...

Page 1: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes

Prof. Fahd M. Nasr

Lebanese universityFaculty of sciences

[email protected]

https://yeastwonderfulworld.wordpress.com/

Page 2: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes

Mighty Yeasts

The yeast Saccharomyces cerevisiaeas a genetic model system

Page 3: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes

Yeast genetics• In 1996 Yeast genes

– 1/3 characterised by genetic analysis– 1/3 shows homology to known genes– 1/3 orphans

• 5% yeast genes with introns very few have more than one

• The intergenic space between genes is only between 200 and 1,000bp

Page 4: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes

Yeast genome analysis• Major goal function of every gene• Large projects and numerous approaches• Micro array analysis

– Gene expression profiles– Binding sites in the genome for all transcription factors

• A complete set of more than 6,000 deletion mutants is available for research

• Various approaches to analyse the properties of these mutants

• Tag yeast genes to GFP protein detection and microscopic localisation

• Different global protein interaction projects are ongoing

Page 5: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes

Yeast genes: nomenclature

Page 6: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes

Yeast genes: nomenclature• Many genes systematic sequencing : YDR518C,

YML016W..., where– Y stands for ”yeast”– The second letter represents the chromosome (D=IV,

M=XIII....)– L or R stand for left or right chromosome arm– The three-digit number stands for the ORF counted

from the centromere on that chromosome arm– C or W stand for ”Crick” or ”Watson” indicate the

strand or direction of the ORF• Some genes do not follow this nomenclature HO, MATa,

MATa

Page 7: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes

General pathway for mutational dissection of a biological process

“Forward Genetics”

Page 8: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes
Page 9: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes

Gene deletion in yeast

HIS3

CBK1X X

Chromosome XIV

DNA cassette~50nc

Chromosome XIV

HIS3

Page 10: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes

CBK1

DcbK1::HIS3

mmmm + histidine

+

+ -

+Transform the strain CBK1, his3 with DNA cassette

Select for transformants on mm

Page 11: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes

wild type(CBK1)

∆cbk1

DIC Calcofluor white

Page 12: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes

Yeast genetics: markers and strains

• Genetic markers for selection

• Commonly genetic markers HIS3, URA3, TRP1, LEU2, LYS2, ADE2

• The ade2 mutation cells turn red

• The first markers fermentation markers: SUC, MAL, GAL– GAL genes encode the enzymes needed to take up

galactose and convert it to glucose-6-phosphate

Page 13: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes
Page 14: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes

Purine nucleotide synthesis pathway in yeast

Page 15: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes
Page 16: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes

The art and design of genetic screens: yeast

Page 17: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes

Galactose metabolizing pathway of yeast

Page 18: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes

Galactose metabolizing pathway of yeast

Page 19: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes
Page 20: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes

• GAL genes are near each other but do not constitute an operon

• GAL4 unlinked gene repressor protein– Binds a promoter element UASG– UAS is located between GAL1 and GAL10– Transcription occurs in both directions from UASG

• Galactose absent GAL4p +GAL80p bind the UASGtranscription does not occur

• Galactose present galactose binds GAL80p and GAL4p amino acids are phosphorylated

• Galactose acts as an inducer by causing a conformation change in GAL4p/GAL80p

Transcriptional control of galactose-utilizing genes in yeast

Page 21: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes

Activation model of GAL genes in yeast

Page 22: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes

Regulation of galactose utilization in yeast

Page 23: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes
Page 24: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes

Repression of the GAL1 gene in yeast

Page 25: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes
Page 26: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes

How genes respond to environmental stimuli

Page 27: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes

Scer TTATATTGAATTTTCAAAAATTCTTACTTTTTTTTTGGATGGACGCAAAGAAGTTTAATAATCATATTACATGGCATTACCACCATATACASpar CTATGTTGATCTTTTCAGAATTTTT-CACTATATTAAGATGGGTGCAAAGAAGTGTGATTATTATATTACATCGCTTTCCTATCATACACASmik GTATATTGAATTTTTCAGTTTTTTTTCACTATCTTCAAGGTTATGTAAAAAA-TGTCAAGATAATATTACATTTCGTTACTATCATACACASbay TTTTTTTGATTTCTTTAGTTTTCTTTCTTTAACTTCAAAATTATAAAAGAAAGTGTAGTCACATCATGCTATCT-GTCACTATCACATATA

* * **** * * * ** ** * * ** ** ** * * * ** ** * * * ** * * *

Scer TATCCATATCTAATCTTACTTATATGTTGT-GGAAAT-GTAAAGAGCCCCATTATCTTAGCCTAAAAAAACC--TTCTCTTTGGAACTTTCAGTAATACGSpar TATCCATATCTAGTCTTACTTATATGTTGT-GAGAGT-GTTGATAACCCCAGTATCTTAACCCAAGAAAGCC--TT-TCTATGAAACTTGAACTG-TACGSmik TACCGATGTCTAGTCTTACTTATATGTTAC-GGGAATTGTTGGTAATCCCAGTCTCCCAGATCAAAAAAGGT--CTTTCTATGGAGCTTTG-CTA-TATGSbay TAGATATTTCTGATCTTTCTTATATATTATAGAGAGATGCCAATAAACGTGCTACCTCGAACAAAAGAAGGGGATTTTCTGTAGGGCTTTCCCTATTTTG

** ** *** **** ******* ** * * * * * * * ** ** * *** * *** * * *

Scer CTTAACTGCTCATTGC-----TATATTGAAGTACGGATTAGAAGCCGCCGAGCGGGCGACAGCCCTCCGACGGAAGACTCTCCTCCGTGCGTCCTCGTCTSpar CTAAACTGCTCATTGC-----AATATTGAAGTACGGATCAGAAGCCGCCGAGCGGACGACAGCCCTCCGACGGAATATTCCCCTCCGTGCGTCGCCGTCTSmik TTTAGCTGTTCAAG--------ATATTGAAATACGGATGAGAAGCCGCCGAACGGACGACAATTCCCCGACGGAACATTCTCCTCCGCGCGGCGTCCTCTSbay TCTTATTGTCCATTACTTCGCAATGTTGAAATACGGATCAGAAGCTGCCGACCGGATGACAGTACTCCGGCGGAAAACTGTCCTCCGTGCGAAGTCGTCT

** ** ** ***** ******* ****** ***** *** **** * *** ***** * * ****** *** * ***

Scer TCACCGG-TCGCGTTCCTGAAACGCAGATGTGCCTCGCGCCGCACTGCTCCGAACAATAAAGATTCTACAA-----TACTAGCTTTT--ATGGTTATGAASpar TCGTCGGGTTGTGTCCCTTAA-CATCGATGTACCTCGCGCCGCCCTGCTCCGAACAATAAGGATTCTACAAGAAA-TACTTGTTTTTTTATGGTTATGACSmik ACGTTGG-TCGCGTCCCTGAA-CATAGGTACGGCTCGCACCACCGTGGTCCGAACTATAATACTGGCATAAAGAGGTACTAATTTCT--ACGGTGATGCCSbay GTG-CGGATCACGTCCCTGAT-TACTGAAGCGTCTCGCCCCGCCATACCCCGAACAATGCAAATGCAAGAACAAA-TGCCTGTAGTG--GCAGTTATGGT

** * ** *** * * ***** ** * * ****** ** * * ** * * ** ***

Scer GAGGA-AAAATTGGCAGTAA----CCTGGCCCCACAAACCTT-CAAATTAACGAATCAAATTAACAACCATA-GGATGATAATGCGA------TTAG--TSpar AGGAACAAAATAAGCAGCCC----ACTGACCCCATATACCTTTCAAACTATTGAATCAAATTGGCCAGCATA-TGGTAATAGTACAG------TTAG--GSmik CAACGCAAAATAAACAGTCC----CCCGGCCCCACATACCTT-CAAATCGATGCGTAAAACTGGCTAGCATA-GAATTTTGGTAGCAA-AATATTAG--GSbay GAACGTGAAATGACAATTCCTTGCCCCT-CCCCAATATACTTTGTTCCGTGTACAGCACACTGGATAGAACAATGATGGGGTTGCGGTCAAGCCTACTCG

**** * * ***** *** * * * * * * * * **

Scer TTTTTAGCCTTATTTCTGGGGTAATTAATCAGCGAAGCG--ATGATTTTT-GATCTATTAACAGATATATAAATGGAAAAGCTGCATAACCAC-----TTSpar GTTTT--TCTTATTCCTGAGACAATTCATCCGCAAAAAATAATGGTTTTT-GGTCTATTAGCAAACATATAAATGCAAAAGTTGCATAGCCAC-----TTSmik TTCTCA--CCTTTCTCTGTGATAATTCATCACCGAAATG--ATGGTTTA--GGACTATTAGCAAACATATAAATGCAAAAGTCGCAGAGATCA-----ATSbay TTTTCCGTTTTACTTCTGTAGTGGCTCAT--GCAGAAAGTAATGGTTTTCTGTTCCTTTTGCAAACATATAAATATGAAAGTAAGATCGCCTCAATTGTA

* * * *** * ** * * *** *** * * ** ** * ******** **** *

Scer TAACTAATACTTTCAACATTTTCAGT--TTGTATTACTT-CTTATTCAAAT----GTCATAAAAGTATCAACA-AAAAATTGTTAATATACCTCTATACTSpar TAAATAC-ATTTGCTCCTCCAAGATT--TTTAATTTCGT-TTTGTTTTATT----GTCATGGAAATATTAACA-ACAAGTAGTTAATATACATCTATACTSmik TCATTCC-ATTCGAACCTTTGAGACTAATTATATTTAGTACTAGTTTTCTTTGGAGTTATAGAAATACCAAAA-AAAAATAGTCAGTATCTATACATACASbay TAGTTTTTCTTTATTCCGTTTGTACTTCTTAGATTTGTTATTTCCGGTTTTACTTTGTCTCCAATTATCAAAACATCAATAACAAGTATTCAACATTTGT

* * * * * * ** *** * * * * ** ** ** * * * * * *** *

Scer TTAA-CGTCAAGGA---GAAAAAACTATASpar TTAT-CGTCAAGGAAA-GAACAAACTATASmik TCGTTCATCAAGAA----AAAAAACTA..Sbay TTATCCCAAAAAAACAACAACAACATATA

* * ** * ** ** **

GAL10

GAL1

TBP

GAL4 GAL4 GAL4

GAL4

MIG1

TBPMIG1

Factor footprint

Conservation island

Conservation of Motifs

Page 28: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes

Yeast genetics: markers and strains

• Certain antibiotic resistance markers used in transformation kanamycin resistance = kanR

• There are many yeast strains in use in the laboratories:W303-1A, S288C, S1278b, SK1, BY4741....

Page 29: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes

Yeast genetics: markers and strains

• Specific properties can be quite different and are different to wild or industrial strains

• The full genotype of W303-1A strain:MATa leu2-3/112 ura3-1 trp1-1 his3-11/15 ade2-1 can1-100 GAL SUC2mal0

Page 30: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes

Auxotroph• Mutant organism requiring a specific growth

substance– Auxotrophy inability of an organism to synthesize a

particular organic compound required for its growth– An auxotroph is an organism that displays this

characteristic– Auxotrophic is the corresponding adjective

• Auxotrophy is the opposite of prototrophy– wild-type strain– Auxotrophic genetic markers are often used in

molecular genetics

Page 31: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes

Chemical structure of arginine compared to canavanine

Page 32: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes

Promoters on Vectors

Page 33: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes

Tetrad analysis for genetic analysis

Page 34: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes
Page 35: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes
Page 36: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes
Page 37: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes
Page 38: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes
Page 39: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes
Page 40: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes
Page 41: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes

Synthetic Lethal Screen

Page 42: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes
Page 43: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes

Tetrad Spore MAT leu ura his SUC NaCl

1 A a + + - - -

1 B alpha + - + - -

1 C a - - - + -

1 D alpha - + + + +

2 A a - - - - -

2 B a + + + + +

2 C alpha + - + - -

2 D alpha - + - + -

Yeast genetics: crossing strains

Page 44: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes

Replicate plating to isolate auxotrophic mutants: grow with His but not without His

Page 45: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes
Page 46: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes

Yeast genetics: meiosis• Yeast tetrad analysis

outcome of meiosis• 2n has two chromosomes• DNA replication two

chromosomes with two identical chromatids each

• Aligned chromosomes undergo recombination

• First meiotic division separate the chromosomes

• Second meiotic division separate the chromatids

• Each spore represents essentially one chromatid

X

Page 47: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes
Page 48: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes

Three kinds of patternsMATa TRP1URA3 x MATa trp1 ura3

Page 49: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes

Recombination Between Markers

RF = 1/2T +NPD If RF = 50% then genes are unlinked

Page 50: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes

When genes are linked, PDs exceed NPDs

Page 51: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes

Sulfate assimilation requires 3 different enzymes, encoded by MET3, MET14, and MET16

Met3p

SO42-

Met14p

APS PAPS

Met16p

SO32-

A mutation in any of the 3 genes will prevent sulfate assimilation required for de novo*

methionine synthesis

*de novo – no organic sulfur source is used

Page 52: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes
Page 53: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes

Ascus 1

MATa/α MET3/met3 MET14/met14

What happens when the Met+ diploid sporulates?

(We’ll ignore the MET16 and MATa loci)

Ascus 2

Each meiosis produces an ascus with 4 haploid spores

OR

1/4 spores will give rise to a Met+

haploid

Page 54: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes

Linkage analysis

# of tetradsGene pair PD NPD Tgal1/gal7 313 0 0gal1/gal10 59 0 0gal7/gal10 72 0 0gal1/gal4 21 23 56gal3/gal4 20 13 48

Page 55: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes

What does what?Enzymatic activities

Genotype Kinase Transferase Epimerasewild type 13-24 9-14 8-34gal1 0 14.9 87.2gal7 6 0 33.8gal10 2.7 2.2 0gal10/i- 13 15.5 0gal1/gal7 0 0 20.3gal1/gal10 0 6.1 0gal4 0 0 0gal4/i- 0 0 0

Page 56: Prof. Fahd M. Nasr · 2019. 3. 24. · Saccharomyces cerevisiae as a genetic model system. ... – Gene expression profiles ... Transcriptional control of galactose-utilizing genes

The end