Prof. Dr. ir. Peter Bossier · MGD1 mytilus galloprovincialis defensin 1 MGD2 mytilus...
Transcript of Prof. Dr. ir. Peter Bossier · MGD1 mytilus galloprovincialis defensin 1 MGD2 mytilus...
Promoters: Prof. Dr. ir. Peter Bossier
Department of Animal Production,
Faculty of Bioscience Engineering, University of Ghent
Dr. ir. Nancy Nevejan
Department of Animal Production,
Faculty of Bioscience Engineering, University of Ghent
Members of the Examination and Reading Committee:
Prof. dr. ir. Jo Dewulf (Chairman)
Department of Sustainable Organic Chemistry and Technology, Faculty of Bioscience Engineering, Ghent University, Belgium; [email protected]
Prof. dr. ir. Mieke Uyttendaele (secretary)
Department of Food safety and food quality, Faculty of Bioscience Engineering, Ghent University, Belgium; [email protected]
Prof. dr. Daisy Vanrompay
Department of Animal production, Faculty of Bioscience Engineering, Ghent University, Belgium; [email protected]
Prof. dr. Annemie Decostere
Department of Pathology, bacteriology and poultry diseases, Faculty of Veterinary
Medicine, Ghent University, Belgium; [email protected]
Em. prof. dr. Patrick Sorgeloos
Department of Animal production, Faculty of Bioscience Engineering, Ghent University, Belgium; [email protected]
Prof. dr. scient. Thorolf Magnesen
Department of Biology, Faculty of Mathematics and Natural Sciences, University of Bergen, Norway; [email protected]
Dr. Jonathan King
Marine Centre Wales, Univeristy of Bangor, UK; [email protected]
Dean: Prof. Dr. ir. Marc Van Meirvenne
Rector: Prof. Dr. Anne De Paepe
Nguyen Van Hung
The role of poly-β-hydroxybutyrate as protection against Vibrio infections in blue mussel larvae
Thesis submitted in fulfillment of the requirements for the degree of
Doctor (PhD) in Applied Biological Sciences
Dutch translation of the title: De rol van poly - β - hydroxybutyraat als bescherming tegen
Vibrio infecties bij mossel larven
Cover page: Epifluorescence microscopy of microalgae and PHB- fed two day old blue mussel
larvae stained with Nile Blue A (Laboratory of Microbial ecology and technology, Ghent
University)
To cite this work:
Hung, N.V.(2016) The role of poly-β-hydroxybutyrate as protection against Vibrio infections
in blue mussel larvae. PhD thesis, Ghent University, Belgium.
ISBN: 978-90-5989-926-1
The author and the promoters give the authorisation to consult and to copy parts of this
work for personal use only. Every other use is subject to the copyright laws. Permission to
reproduce any material contained in this work should be obtained from the author.
This study was funded by a doctoral grant of the Vietnam government, Aquaculture
Biotechnology program, and VLIR-OI project (ZEIN2011PR389).
LIST OF ABBREVIATIONS AND UNITS
i
A199 aeromonas media strain
AMPs antimicrobial peptides
ANOVA analysis of variance
AOD american oyster defensin
ARC4B5 PHB degrading isolated from blue mussel larvae
BLAST basic local alignment search tool
BRD brown ring disease
CA2 alteromonas sp.
cDNA complementary deoxyribonucleic acid
CFU colony forming units
Cg-Def1 Crassostrea gigas defensin 1
Cg-Def2 Crassostrea gigas defensin 2
CT threshold cycle
DGGE denaturing gradient gel electrophoresis
D-larvae two day old mussel larvae
DMSO dimethyl sulfoxide
DNA deoxyribo nucleic acid
DNA deoxyribo nucleic cid
ECP extracellular products
EDTA ethylenediaminetetraacetic acid
EEC european economic community
EPS exopolysaccharides
FAASW filter autoclaved artificial sea water
FAO food and agriculture organization
LIST OF ABBREVIATIONS AND UNITS
ii
FASW filter autoclaved sea water
FNSW filtered natural seawater
FOS fructooligosaccharides
FTS flow through system
GI gastrointestinal
HPS heat shock protein
HSP70 heat shock protein gene 70
HUFA high unsaturated fatty acid
ICI Imperial Chemical Industries
LB35 luria-Bertani medium (salinity 35g L-1)
L-DOPA L-3, 4- Dihydroxyphenylalanine
MB marine broth
MCF medium chain length
MGD1 mytilus galloprovincialis defensin 1
MGD2 mytilus galloprovincialis defensin 2
MOPS 3–(N–morpholino) propanesulfonic acid
n number of replicates
ND not determined
N-FMLP N-formyl-methionyl-leucyl-phenylal-anine
NMS non-metric multidimensional scaling
NS not specific
OD optical density
OsHV-1 ostreid herpesvirus 1
PCR polymerase chain reaction
LIST OF ABBREVIATIONS AND UNITS
iii
PHAs polyhydroxyalkanoates
PHB poly-β-hydroxybutyrate
PHB-A amorphous PHB
PHB-C crystalline PHB
PHB–HV poly-β hydroxybutyrate–hydroxyvalerate
PO phenoloxidase
ppA prophenoloxidase activating enzyme
ppm parts per million
proPO prophenoloxidase
PRRs pathogen recognition receptors
q-PCR quatitative polymerase chain reaction
RNA ribonucleic acid
RNS reaction nitrogen species
ROS reaction oxygen species
rRNA ribosomal RNA
SCF short chain length
SCFAs short-chain fatty acids
SEM standard error of the mean
SGR specific growth rate
SM Summer Mortality
SPSS statistical Package for the Social Sciences
TCD tissue culture dish
TOS transgalactooligosaccharides
UK United Kingdom
LIST OF ABBREVIATIONS AND UNITS
iv
USA United States of America
UV ultra-violet
v/v volume per volume
VAR Vibrio anguillarrum related strain
VLB Vibrio-like bacteria
VIED Vietnam International Education and Development
β-HB β-hydroxy butyric acid
Δt rate of change
ΔΔCT relative gene expression
% percentage
µg microgram
µl microliter
µm micrometer
0C degree Celsius
cm centimeter
g gram
h hour
kDa kilo-Daltons
L liter
mg milligram
ml milliliter
mM millimolar
rpm rotations per minute
V voltage
CONTENTS
v
CHAPTER 1: GENERAL INTRODUCTION ...................................................................................... 1
CHAPTER 2: LITERATURE REVIEW .............................................................................................. 7
2.1. The importance of aquaculture....................................................................................... 9
2.2. Bivalve mollusks in aquaculture .................................................................................... 10
2.3. Introduction to the Blue mussel Mytilus edulis ............................................................ 11
2.3.1. Taxonomy and distribution of Mytilus edulis ......................................................... 11
2.3.2. Life cycle of blue mussel ......................................................................................... 13
2.3.3. The importance of European mussel aquaculture ................................................. 16
2.3.5. Feeding behavior and digestive system of blue mussel ........................................ 18
2.4. The immune system of bivalves .................................................................................... 21
2.4.1. Cellular immune response ..................................................................................... 22
2.4.2. Humoral immune defense ..................................................................................... 25
2.4.3. Difference in the immune system between bivalve adult and larvae ................... 31
2.5. Constraints of bivalve aquaculture ............................................................................... 32
2.5.1. Bacterial diseases ................................................................................................... 32
2.5.2. Viral diseases .......................................................................................................... 35
2.6. Solutions to control diseases in bivalve larvae culture ................................................. 37
2.6.1. Water treatment .................................................................................................... 37
2.6.2. Antibiotics ............................................................................................................... 39
2.6.3. Immunostimulants ................................................................................................. 40
2.6.4. Prebiotics and probiotics ........................................................................................ 41
2.6.5. Antivirulence therapy ............................................................................................. 44
CONTENTS
vi
2.7. The use of poly–β–Hydroxybutyrate (PHB) as a tool to control disease in aquaculture
seed production ................................................................................................................... 44
2.7.1. Introduction ............................................................................................................ 44
2.7.2. The production of polyhydroxyalkanoates ............................................................ 46
2.7.3. PHB production in Ralstonia eutropha................................................................... 48
2.7.4. Mechanism of antibacterial activity of poly-β-hydroxybutyrate ........................... 49
2.7.5. The immunostimulants properties of the Poly-β-hydroxybutyrate monomer ..... 51
2.7.6. The use of poly-β-hydroxybutyrate in aquaculture ............................................... 52
CHAPTER 3: APPLICATION OF POLY-Β-HYDROXYBUTYRATE (PHB) IN MUSSEL LARVICULTURE
.................................................................................................................................................. 55
Abstract ................................................................................................................................ 57
3. 1. Introduction .................................................................................................................. 59
3. 2. Materials and methods ................................................................................................ 61
3. 2.1. Crystalline PHB and amorphous PHB .................................................................... 61
3. 2. 2. Detection of ingested PHB by fluorescence microscopy ..................................... 61
3. 2. 3. Experimental design ............................................................................................. 62
3. 2.4. Isolation, culture and identification of PHB-degrading strains ............................. 64
3. 2.5. Molecular fingerprinting of larval associated bacterial community ..................... 66
3. 2.6. Statistics................................................................................................................. 66
3. 3. Results .......................................................................................................................... 67
3. 3.1. PHB ingestion by mussel larvae ............................................................................ 67
3. 3.2. Larval survival and growth .................................................................................... 68
3. 3.3. Isolation and identification of PHB-degrading bacteria ........................................ 72
3. 3.4. Microbial community analysis ............................................................................... 73
3. 4. Discussion ..................................................................................................................... 74
CONTENTS
vii
CHAPTER 4: DOES RALSTONIA EUTROPHA, RICH IN POLY-Β HYDROXYBUTYRATE (PHB),
PROTECT BLUE MUSSEL LARVAE AGAINST PATHOGENIC VIBRIOS? ........................................ 79
Abstract ................................................................................................................................ 81
4.1. Introduction ................................................................................................................... 83
4. 2. Materials and Methods ................................................................................................ 84
4. 2.1. Bacterial strains and growth conditions................................................................ 84
4. 2.2. Amorphous PHB (PHB-A) ....................................................................................... 85
4. 2.3. Experimental mussel larvae .................................................................................. 85
4. 2.4. Blue mussel larvae challenge tests ........................................................................ 85
4. 2.5. Effect of β-HB on growth of V. coralliilyticus and V. splendidus ........................... 87
4. 2.6. Effect of β-HB on virulence factors of V. coralliilyticus and V. splendidus ............ 88
4. 2.7. Data analysis and statistics .................................................................................... 89
4. 3. Results .......................................................................................................................... 89
4. 3.1. Survival of mussel larvae in challenge tests .......................................................... 89
4. 3.2. Effect of β-HB on growth of V. coralliilyticus and V. splendidus ........................... 90
4. 3.3. Effect of β-HB on virulence factors ....................................................................... 93
4. 4. Discussion ..................................................................................................................... 99
CHAPTER 5: RALSTONIA EUTROPHA, CONTAINING HIGH POLY-β-HYDROXYBUTYRATE LEVELS
(PHB-A), REGULATES THE IMMUNE RESPONSE IN MUSSEL LARVAE CHALLENGED WITH
VIBRIO CORALLIILYTICUS ........................................................................................................ 105
Abstract .............................................................................................................................. 107
5.1. Introduction ................................................................................................................. 109
5. 2. Materials and methods .............................................................................................. 111
5.2.1. Bacterial strains and growth conditions .............................................................. 111
5.2.2. Spawning procedure and larvae handling ............................................................ 111
CONTENTS
viii
5.2.3. Challenge tests ..................................................................................................... 111
5.2.4. Standardization of quantitative real-time qRT-PCR for mussel larvae ................ 113
5.2.5. Real-time qPCR standardization of primer concentrations ................................. 115
5.2.6. Total RNA extraction and Reverse Transcription ................................................. 115
5.2.7. Real-time PCR ....................................................................................................... 116
5.2.8. Real-time PCR analysis (2-ΔΔCT Method) ................................................................ 116
5.2.9.Phenoloxidase activity .......................................................................................... 117
5.2.10. Statistics and analysis ......................................................................................... 118
5.3. Results ......................................................................................................................... 118
5.3.1. Survival ................................................................................................................. 118
5.3.2. Design of immune gene primers for blue mussel larvae ..................................... 119
5.3.3. Impact PHB-A and/or pathogen on the expression of the antimicrobial peptides
(Experiment 2). ............................................................................................................... 121
5.3.4. Phenoloxidase activity (Experiment 3) ................................................................. 122
5.3.5. Time window of gene expression of AMPs (Experiment 4) ................................. 123
5.4. Discussion .................................................................................................................... 124
CHAPTER 6: GENERAL DISCUSSION ........................................................................................ 131
6.1. Introduction ................................................................................................................. 133
6.2. The effect of PHB on bivalve larvae and spat performance ....................................... 134
6.3. The effect of poly-β-hydroxybutyrate on the microbial composition in the digestive
tract of blue mussel larvae ................................................................................................. 137
6.4. Effect of poly-β-hydroxybutyrate on disease resistance of bivalve larvae ................. 138
6.5. Antimicrobial peptides (AMPs) immune response in bivalve mollusks ...................... 139
6.6. Induction of phenoloxidase enzyme activity in the early life stage of bivalve larvae by
PHB. .................................................................................................................................... 142
CONTENTS
ix
6.7. The proposed model for future application of amorphous PHB in bivalve larvae
culture. ............................................................................................................................... 143
6.8. General discussions ..................................................................................................... 143
6.9. Further perspectives ................................................................................................... 144
x
LIST OF TABLES
xi
Table 2. 1: Life stages and characteristics of the blue mussel ................................................ 15
Table 2. 2: Classification of the hemocytes for different bivalve............................................. 23
Table 2. 3: Antimicrobial peptides of two closely related mussel species and their classes .. 28
Table 2. 4: Summary of defense mechanism recorded in blue mussel (Mytilus edulis) ......... 32
Table 2. 5: Experimental infection of bivalve larvae, juvenile and adults with pathogenic
Vibrio spp. ................................................................................................................................. 35
Table 2. 6: The evaluation of various PHB production systems reported for wild-type PHB
producing strains ...................................................................................................................... 49
Table 3. 1: Overview of the experiments ................................................................................. 61
Table 3. 2: Survival (%) and shell height (µm) of mussel larvae subjected to different PHB
treatments in experiment 1 and 3 (Day 14 post-hatching and Day 18 post-hatching) and in
experiment 2 (Day 10 post-hatching and Day 14 post-hatching) ............................................ 69
Table 3. 3: Settlement success (%) and shell height (µm) of mussel spat subjected to different
PHB treatments in experiment 1, 2 and 3 ................................................................................ 70
Table 3. 4: The final yield of mussel spat under different experimental conditions ............... 72
Table 4. 1: Overview of the different blue mussel larvae challenge tests ............................... 87
Table 4. 2: Swimming motility zone of V. splendidus and V.coralliilyticus after 24h incubation
on soft agar at pH7 and pH8 with different β-HB concentrations. .......................................... 93
Table 4. 3: The activity of different lytic enzymes (caseinase, gelatinase, lipase, hemolysin,
and phospholipase) of V. splendidus and V. coralliilyticus upon supplementation of varying
concentrations of β-hydroxybutyrate at various pH levels ..................................................... 95
Table 4. 4: Summary of the effects of β-HB on selected virulence factors of mussel larvae
Vibrio pathogens .................................................................................................................... 103
LIST OF TABLES
xii
Table 5. 1: Summary of the challenge tests with V. coralliilyticus (105CFU mL-1) in the
presence of PHB-A (1 mg L-1) added 6 h before the pathogen .............................................. 113
Table 5. 2: Characteristics of the primers used for expression analysis with RT-qPCR ......... 120
Table 5. 3: RT-qPCR amplification efficiencies for all immune genes .................................... 120
Table 5. 4:The outcome of independent t-test between challenged and un-challenged mussel
larvae ...................................................................................................................................... 124
LIST OF FIGURES
xiii
Figure 2. 1: World capture fisheries and aquaculture production .......................................... 10
Figure 2. 2: Global bivalve mollusk production by species ...................................................... 11
Figure 2. 3: Blue mussel Mytilus edulis .................................................................................... 12
Figure 2. 4: Worldwide distribution of bivalves. Mytilus edulis lives in the Arctic regions and
European waters ..................................................................................................................... 13
Figure 2. 5. Blue mussel larvae development .......................................................................... 14
Figure 2. 6: Schematic illustration of reproduction cycle ....................................................... 15
Figure 2. 7: Production of the blue mussel, Mytilus edulis in the world and in Europe ......... 16
Figure 2. 8: Production cycle of Mytilus edulis ........................................................................ 17
Figure 2. 9. Digestive system of M. edulis: Illustration of the stomach and digestive gland .. 19
Figure 2. 10: Schematic illustration of filter feeding process ................................................. 19
Figure 2. 11: Comparative sizes of suspension-feeding bivalves and their potential food
(seston). .................................................................................................................................... 20
Figure 2. 12: Mechanisms involved in the bactericidal activity of bivalve hemolymph .......... 22
Figure 2. 13: Schematic illustration of phagocytosis ............................................................. 25
Figure 2. 14: Diagram of the major reaction cascades from the initial pathogen contact
through oxidative killing. ........................................................................................................ 30
Figure 2. 15: Pseudomonas putida cells accumulating PHB inclusion under electron
microscopy ............................................................................................................................... 45
Figure 2. 16: General structural formula of poly–β–hydroxybutyrate .................................... 45
Figure 2. 17: A schematic representation of the biosynthesis of PHA in bacteria ................. 47
Figure 2. 18: Metabolic pathway for microbial production of (R)-3-hydroxybutyric acid ....... 48
Figure 3. 1: Light (A and B) and epifluorescence microscopy (C and D) images of starved
larvae (A and C) and larvae fed with Nile Blue A stained PHB for 2 hours (B and D) .............. 67
LIST OF FIGURES
xiv
Figure 3. 2: Size class distribution of mussel larvae on day 14, subjected to different feeding
regimes in experiment 2 .......................................................................................................... 71
Figure 3. 3: NMS ordination based on Bray Curtis similarities for the bacterial communities
associated with the larvae subjected to different feeding regimes in experiment 1. ............. 73
Figure 3. 4: NMS ordination based on Bray Curtis similarities for the bacterial communities
associated with the larvae subjected to different PHB concentrations in experiment 2. ....... 74
Figure 4. 1: Blue mussel larvae after Lugol staining (x 400). Living larvae (A) are completely
dark while partly (B) or entirely (C) empty shells are counted as dead larvae. ....................... 87
Figure 4. 2: Survival of blue mussel larvae challenged with V. coralliilyticus or V. splendidus at
105 CFU mL-1 under different experimental conditions. .......................................................... 92
Figure 4. 3: Growth curves of V. splendidus and V. coralliilyticus (OD600) in LB35 at pH7 and
pH8 with different concentrations of 0, 1, 5, 25, and 125 mM β-HB. ..................................... 92
Figure 4. 4: Biofilm formation (a & b) and exopolysaccharide production (c & d) of V.
splendidus and V.coralliilyticus. ............................................................................................... 99
Figure 5. 1: Experiment 1. Survival (%) of mussel larvae after 48h exposure to V. coralliilyticus
(105 CFU mL-1) in the presence or not of PHB-A ................................................................... 119
Figure 5. 2: Experiment 2. Expression of immune genes (A) mytimycin, (B) mytilinB (C)
lysozyme, and (D) defensin .................................................................................................... 122
Figure 5. 3: Phenoloxidase activity (PO) in the mussel larvae collected after 48 h exposure to
the different treatments ........................................................................................................ 122
Figure 5. 4: Expression of immune genes (A) mytimicin, (B) mytilinB, (C) lysozyme and (D)
defensin in challenged mussel larvae with V. coralliilyticus at 105 CFU mL-1 ....................... 123
Figure 6. 1: Schematic overview of the study on the mode of action of PHB in mussel larvae
culture. ................................................................................................................................... 134
1
General introduction
CHAPTER 1: GENERAL INTRODUCTION
2
Chapter 1 General introduction
3
Aquaculture production is expected to play a crucial role in meeting the growing demand for
aquatic products, especially since capture fisheries have markedly stagnated with little
likelihood of increased production in the foreseeable future. Currently, aquaculture is the
fastest growing sector in the food production industry with an average yearly growth rate of
more than eight percent over the past two decades (FAO, 2014a). In 2011, total global
aquaculture production of mollusks reached 14.4 million tonnes, accounting for 22.9% of
total aquaculture production of 62.7 million tonnes (FAO, 2013).
Bivalve mollusks are an important global food commodity (Sauve, 2013). Natural populations
cannot meet the increasing demand for seed due to overexploitation, which has led to the
development of aquaculture techniques (seed capture, hatchery practices) (Avendaño and
Riquelme, 1999). Hatcheries have several advantages, such as the possibility to satisfy seed
requirements out of the natural growing season, the supply of genetic strains with improved
biological characteristics or the supply of new bivalve (exotic) species. Nevertheless, the
culture of bivalves in hatcheries is frequently affected by severe disease outbreaks, mainly
caused by bacterial infections of members of the genus Vibrio, resulting in the loss of
complete batches and compromising the regular production and the economic viability of
the industry. There are many descriptive studies detailing these outbreaks, but only a few
focus on the control of microbiota. The unique characteristics of bivalve aquaculture must
be considered in the design of improved hatchery systems. The classical treatment is
directed towards the complete removal of bacteria from the culture seawater. However, this
objective is on the one hand unfeasible, because the cultures are not axenic, and on the
other hand undesirable since some bacteria enhance larval development (Prado et al.,
2010). Larvae and bacteria, including both beneficial and potentially pathogenic ones, share
a common environment. The filter feeding behavior of larvae increases the strong influence
of these bacterial populations on the hosts.
The particularities of bivalve aquaculture in hatcheries must be considered to design
methods of control. A number of methods have already been developed to control the
proliferation of pathogens and to maintain a healthy microbial environment in aquaculture
Chapter 1 General introduction
4
systems. Classically, the water is subjected to treatments with the aim to reduce the
associated bacterial population. Decantation and subsequent filtration of natural seawater
are common practices, while additional procedures such as ultraviolet radiation or chemical
treatment have also been employed to attain the complete elimination of harmful
microbiota from the culture water. However, this objective is not practical as bacterial
populations, or, at least, part of them, have a beneficial effect on the larval development
(Hidu and Tubiash, 1963).
While vaccination has been a major success in fish culture (Romalde et al., 2002, Herrera and
Toranzo, 2005), vaccination procedures cannot be applied successfully to mollusks because
they have only an innate immune system and lack an adaptive immune system. However, a
number of alternative strategies have been tested to enhance larval cultures performance of
bivalves by modifying the microbiota or by interfering with the innate immune system.
Among these are the use of probiotics (Douillet and Langdon, 1994), immunostimulants
(Bachère, 2003), and antimicrobial peptides (Defer et al., 2009). However, the
implementation of these alternative techniques should be based on the understanding of
the mechanisms involved and their putative consequences (Marques et al., 2005). Therefore,
new solutions need to be developed and validated for the control of bacterial diseases in
larval cultures of bivalves in hatcheries.
Poly-β-hydroxybutyrate (PHB), the simplest and most common member of the
polyhydroxyalkanoates (PHAs), a class of linear polyesters produced in nature by bacteria
out of sugar or lipids, is considered to have a high potential in human medicine as a
degradable implant material because of its non- toxic nature. (Freier et al., 2002). Several
studies have demonstrated that PHB might constitute an ecologically and economically
sustainable alternative strategy to fight infections in aquaculture (Defoirdt et al., 2006b), It
has been suggested that, PHB can be degraded into β-hydroxy short-chain fatty acids
(SCFAs). SCFAs specifically downregulate virulence factor expression and positively influence
the gastrointestinal microflora of the host (Defoirdt et al., 2009). Currently, there is
considerable interest in SCFAs as bio-control agents in animal production. Therefore, PHB
could be a potential candidate for the biological control of bacterial infection in bivalve
larvae culture as it could be a source of SCFAs after depolymerization of particulate PHB,
provided the latter can be easily accumulated by the filter-feeding mollusk larvae.
Chapter 1 General introduction
5
In this study, the blue mussel Mytilus edulis was selected as a model species because it is an
important aquaculture bivalve species in Europe with high production (Lobel et al., 1990)
and because of the relative easiness of handing larvae of this species under lab condition.
The overall objective of the present thesis is to investigate whether the application of PHB in
larval cultures of the blue mussel, M. edulis, can increase survival. It has been suggested that
PHB can boost survival in aquaculture species by acting as a bacteriostatic compound and/or
by stimulating the immune system. Yet up to now it has not been verified where PHB is also
instrumental in sustaining a high survival in mollusk larviculture (chapter 3), neither had it
been verified what the mode of action of this compound could be. Possible mode of action
could be a direct inhibition of pathogens (chapter 4), an impact on the diversity of the
microbial composition in the intestinal tract of the larvae reducing negative host microbial
interactions (chapter 3) but also a potential stimulation of the innate immunity of the
mussel larvae by (chapter 5).
As a general introduction to the results chapters the production of bivalve mollusks in
aquaculture is reviewed. The advantages and constraints of larval production are described,
jointly with an overview of the most common diseases in hatchery-reared bivalve larvae and
common strategies to control pathogenic bacterial infection (Chapter 2).
- In the results chapters, the beneficial effect of PHB is investigated together with a
verification of some putative mode of action.
- In order to do so the effect of PHB on blue mussel larvae was identified (Chapter 3). This
was achieved through the subsequent 3 experimental approaches:
By evaluating the blue mussel larvae’s ability to ingest PHB using fluorescent
microscopy of the gut. Different forms of PHB (crystalline PHB vs. amorphous
PHB Ralstonia eutropha containing 75% DW of PHB) were supplemented in
the culture water.
By determining the optimal PHB dosage for mussel larvae culture in a large-
scale experiment where three dosages were tested. Larvae survival, and
growth and settlement were the monitored parameters.
Chapter 1 General introduction
6
By verification of the effect of PHB on the diversity of the microbial
community composition in the digestive tract of mussel larvae using DGGE
(denaturing gel gradation electrophoresis) on amplified 16S rDNA fragments.
- In addition the antimicrobial activity and the protection offered by PHB-containing
bacteria against different pathogenic Vibrio strains was verified using in vivo
challenge tests with mussel larvae in a nearly-gnotobiotic system. Furthermore, to
document a potential mode of interaction between PHB and a particular Vibrio
strain, the effect of hydroxybutyric acid on the growth and virulence factor of Vibrio
pathogenic bacteria at two pH levels (pH7 and 8) was studied by in vitro experiments
(Chapter 4).
- Finally, to monitor the immune reaction in mussel larvae in attempt to understand
why PHB enhances their survival of mussel. The innate immune gene expression and
phenoloxidase enzyme activity of mussel larvae challenged with Vibrio coralliilyticus
was analyzed. In addition the production of selected antimicrobial peptides during
specific bacterial infections was monitored (Chapter 5).
- Finally an overall discussion is presented, the main conclusions are drawn and
perspectives for further research are elaborated in Chapter 6.
7
Literature review
CHAPTER 2: LITERATURE REVIEW
8
Chapter 2 Literature review
9
2.1. The importance of aquaculture
Aquaculture comprises all forms of culture of aquatic animals and plants in fresh, brackish
and marine environments (Pillay and Kutty, 2005). The role of aquaculture in ensuring a
consistent supply of aquatic species for human consumption cannot be overstated. Seafood
production, especially fish, is important for future global food security. Fish, as well as other
aquaculture products such as mollusks and crustaceans are nutritionally very important to
humans, as it provides all essential amino acids and is an excellent source of proteins, trace
elements and polyunsaturated fatty acids (Kris-Etherton et al., 2002). Currently, we face an
increase in global population that is expected to grow by another 2 billion to reach 9.6 billion
people by 2050 with a concentration in coastal urban areas (Glenn, 2014). The world fish
consumption per capita apparently increased from an average of 9.9 kg in the 1960s to 17.0
kg in the 2000s and 18.9 kg in 2010, with preliminary estimates for 2012 pointing towards
further growth to 19.2 kg (Belton and Thilsted, 2014). Fish consumption is not equally
distributed geographically. For example, in 2014 fish consumption in Africa (Congo, Liberia)
was 9.7 kg/person/year while fish consumption in Vietnam amounted to 38.3 kg/person/
year. The driving force behind the impressive surge has been a combination of population
growth, rising incomes, and urbanization (resulting in better distribution channels)
interlinked to the high expansion of fish production.
According to the available statistics collected globally by FAO, world aquaculture production
attained another all-time high of 90.4 million tonnes (live weight equivalent) in 2012
(US$144.4 billion) (Figure 2.1), including 66.6 million tonnes of food fish (US$137.7 billion)
and 23.8 million tonnes of aquatic algae (mostly seaweeds, US$6.4 billion) (FAO, 2014b). Not
only is aquaculture important for future global food security but it is also the most
sustainable form of animal production. With growing global population and declining natural
resources aquaculture is increasingly being viewed as the most environmentally sustainable
form of animal production. The food conversion rate (FCR) of fish production (between 1
and 2 in aquaculture setting) is less than all other production animals, including cattle (FCR
>6), swine (FCR < 3.5), poultry (FCR < 2), while bivalves being primary consumers, are even
more efficient (FAO, 2012). For bivalve spat a FCR of 0.4 is generally accepted in hatcheries
(pers.comm).
Chapter 2 Literature review
10
Figure 2. 1: World capture fisheries and aquaculture production (FAO, 2014b)
The global food sector is facing various challenges related to the recovering economy and
demographic issues, including growing urbanization. In particular, urbanization will bring
with it changes in lifestyles and consumption patterns. In combination with income growth,
it may accelerate the ongoing diversification of diets in developing countries (Garrett and
Ruel, 2000). Therefore, demand for fish products is expected to continue to rise in the
coming decades. However, future increases in per capita fish consumption will depend on
the availability of fishery products. With capture fisheries production stagnating, significant
increases in food fish production are forecasted to come from aquaculture.
2.2. Bivalve mollusks in aquaculture
Bivalve mollusks (oysters, mussels, clams, and scallops) form a significant part of the world’s
fisheries production. Bivalve mollusks represented almost 10 % of the total world fishery
production, but 26 % of volume and 14 % in value of the total world aquaculture production.
World bivalve production has increased substantially in the last 50 years, going from nearly 1
million tons in 1950 to about 13.9 million tons in 2010 (FAO, 2014b).
China is by far the leading producer of bivalve mollusks, with 10.35 million tons in 2010,
representing 70.8 % of the global molluscan shellfish production and 80 % of the global
bivalve mollusk aquaculture production. All Chinese bivalve production is cultured. The other
main bivalve producers in 2010 were Japan (819,131 tons), the USA (676,755 tons), the
Republic of Korea (418,608 tons), Thailand (285,625 tons), France (216,811 tons), Spain
Chapter 2 Literature review
11
(206,003 tons) and Chile (300,000 tons). By species, the bivalve mollusk production from
aquaculture in 2013 consisted of 37 % (clams, cockles, arkshells), 36 % ( oysters), 13 %
(mussels) and 14 % (scallops, pectens) with an impressive growth in the production of
oysters, clams, cockles and ark shells since the early 1990s (Figure 2.2) (FAO, 2015)
Figure 2. 2: Global bivalve mollusk production by species (FAO, 2015)
2.3. Introduction to the Blue mussel Mytilus edulis
2.3.1. Taxonomy and distribution of Mytilus edulis
Mytilus edulis is a taxon belonging to a group of three closely related taxa of blue mussels
known as the M. edulis complex (de Meeiis and Renaud, 1997). This group comprises of M.
edulis, M. galloprovincialis and M. trossulus. The taxonomy of these species is based on their
morphological and genetic differences, and they can hybridize when present in the same
locality (Gosling, 1984, McDonald et al., 1991). Linnaeus, 1758, described the scientific
classification of Mytilus edulis (Figure 2.3) as:
Kingdom: Animalia
Phylum: Mollusca
Class: Bivalvia
Scallops, pectens
14%
Mussels13%
Clams, cockles, arkshells
37%
Oysters36%
Chapter 2 Literature review
12
Order: Mytiloida
Family: Mytilidae
Genus: Mytilus
Species: Mytilus edulis Linnaeus,
English name: Blue mussel
Figure 2. 3: Blue mussel Mytilus edulis
Mytilus edulis has a wide distribution pattern, extending from the Artic towards the mild
subtropical regions. In European waters, blue mussels are distributed from the White Sea in
the North (Russia), over the North Sea (The Netherlands and Belgium) and the Atlantic
Ocean (the United Kingdom and Ireland) to the Atlantic coast in the South (Southern France)
(see the red circle in Figure 2.4) (Gosling, 2003, Beaumont et al., 2007, FAO, 2016). They
occur most abundantly in the tidal and sub-tidal zones, ranging from the poly-haline to
mesohaline estuarine environments. They tend to proliferate on the rocky shores of the
coastlines, bays, and river mouths which usually show high levels of nutrient loads (coming
from the land), a necessary condition for phytoplankton blooms (Newell and Moran, 1989).
Salinity has relatively little effect on growth and survival of both larvae and adult in contrast
to other exogenous factors such as temperature or food availability (Widdows, 1991).
Adult mussels have been reported to survive to harsh winter periods even when the sea is
covered by a thick ice layer (Hatcher et al., 1997). Low temperatures however, significantly
influence the growth and the development of larvae, particularly temperatures lower than
160C. The strongest growth of larvae is obtained at temperatures between 16 -220C but this
range varies among larvae originating from different geographic regions (Widdows, 1991).
Brenko and Calabrese (1969) also recorded optimum larval growth at 200C within a salinity
Chapter 2 Literature review
13
range of 25 to 30 g L-1. Decreases in growth rate were experienced at both 100C and 250C,
especially at low (20 g L-1) and high (40 g L-1) salinities.
Figure 2. 4: Worldwide distribution of bivalves. Mytilus edulis lives in the Arctic regions and European waters
(red circle) (Gosling, 2003).
2.3.2. Life cycle of blue mussel
The common blue mussel (Mytilus edulis) has several stages in its life cycle (Figure 2.6). The
first stage occurs when two adult mussels produce and release a large amount of sperm and
eggs into the water where the fertilization takes place. The sperm is released before the
eggs, in fact sperm triggers the release the eggs (Gosling, 2003). Females can produce up to
8 million eggs per individual and for each egg there are about 10 000 spermatozoa released
by males (Zaidi et al., 2003). The spawning season depends on different factors such as the
environmental water temperature, food availability, salinity and occurs from early spring
(April) till the end of summer (September) (Gabbott, 1976). Hatching usually occurs on
average 24 hours after fertilization, forming a ciliated embryo (trochophore larva). The
ciliated velum serves both to propel the larva and filter food particles. These embryos
continue to undergo a series of different veliger stages as explained below. After 2 days of
hatching, trochophore larvae have developed the first larval shell called prodissoconch I
Chapter 2 Literature review
14
secreted by the shell gland and the mantle epithelium. Based on the shape, larvae at this
stage are also known as “D-larvae” or “straight hinged” larvae. As the veligers continue to
develop, the second shell called prodissoconch II is secreted by the mantle. Larvae at this
stage are called a veliconcha and distinguished themselves from the D-larva by the
development of umbo on the top of larval shell (Figure 2.5).
Figure 2. 5. Blue mussel larvae development
This larval stage can last for a week depending on environmental conditions. During that
time it grows in size and develops a pair of photosensitive pigmented eye spots and an
elongated foot with a byssal gland, and is termed the pediveliger. Once entering the
pediveliver stage it starts searching sites and substrates for settlement. Once settled by
secreting the byssal thread to attach to the suitable substrate, the larvae lose or reabsorb
the velum and undergo metamorphosis stage to develop into spat which resemble the
adults in shape (Newell and Moran, 1989). The life stages and characteristics are presented
in Table 2.1.
Chapter 2 Literature review
15
Table 2. 1 Life stages and characteristics of the blue mussel (Newell and Moran, 1989)
Stage Size Age and characteristic
Fertilized egg 68-70 (µm) 0 – 5 h non motile
Trochophore 70 -110 (µm) 5 – 24 h ciliated and motile
Veliger larva Up to 35 days; start feeding using velum
- Prodissoconch I 110 (µm) Straight – hinged shell
- Prodissoconch II 260 (µm) Occurring umbo
- Eyed larvae 220 – 260 (µm) Development of eye spots
- Pediveliger 260 (µm) Development of food
Spat 0.26 – 1.5 mm Up to 6 months, temporarily attached to
filamentous substrates
Juvenile Up to 2 years Up to 2 years, sexually immature
Figure 2. 6: Schematic illustration of reproduction cycle (Waikato, 2013)
Chapter 2 Literature review
16
2.3.3. The importance of European mussel aquaculture
There were reports in France in the 13th century of cultivation on wooden stakes (Garen et
al., 2004). Blue mussels are also among the top 5 economically important species that
contribute to the worldwide production of bivalves. In 2013 global production of blue mussel
M. edulis was 197.831 metric tonnes (mt) of which 184.873 mt (93.45%) was produced in
Europe (FAO, 2014b).
Over the last 50 years, the major producers of blue mussel M. edulis have been Denmark,
France, Ireland, the Netherlands, United Kingdom, Sweden and Norway (Lee et al., 2012)
(Figure 2.7) while M. galloprovincialis (Mediterranean mussel) has mainly been produced in
Spain and Italy (Smaal, 2002)
Figure 2. 7: Production of the blue mussel, Mytilus edulis in the world and in Europe (Lee et
al., 2012, FAO, 2014b)
The majority of seed production sources from natural populations although increasingly,
stocks are approaching or have exceeded maximum sustainable yields. Stock enhancement
through the capture of larvae while still relying on natural seed in both extensive and
Chapter 2 Literature review
17
intensive forms of culture is a common practice worldwide. However the reliability of
natural recruitment can never be guaranteed, and conflicts over the use of the coastal zone
are becoming ever more pressing. One solution for meeting the growing demand for seed by
the mussel industry is seed production in hatcheries. However, production costs are still too
high in Europe compared to the wild-caught seed to turn it into a profitable business.
Hatchery production of spat could provide a back-up when natural spat fall fails, reduce the
pressure on the natural populations and eventually would allow for selection.
Mussels are farmed using long lines, rafts or a mixture of long lines and poles installed in
shallow intertidal areas. Aypa (1990) describes three main categories of culture methods for
mussel cultivation, bottom culture growing mussels directly on the bottom, intertidal and
shallow water culture in the intertidal zone, and deep water culture (Figure 2.8).
Figure 2. 8: Production cycle of Mytilus edulis (FAO, 2014b)
Chapter 2 Literature review
18
The largest bivalve markets in the European Union (EU) are France, Italy, and Spain. France is
the largest EU importer of mussels (FAO, 2015). Meanwhile, smaller sized markets include
the Netherlands, Italy, Belgium and Denmark. Ireland and France provide the market with
oysters, while Denmark, Ireland, The Netherlands, and Spain provide mussels. The trade is
mainly intraregional between the EU Member States with a smaller contribution from third
countries. Only a few third countries, such as Chile and New Zealand, can penetrate the EU
markets with their mussel species.
2.3.5. Feeding behavior and digestive system of blue mussel
The blue mussel is a filter feeder, a feeding process that is well conserved amongst most
bivalve species. Food particles are taken up from the incoming water current, followed by
selection, transport, ingestion and finally digestion as described below (Jorgensen, 1990,
Gosling, 2003).
The water, with suspended organic particles such as unicellular phytoplankton, enters the
mussel through the inhalant opening. With the help of cilia, located on the gills, particles of
interest are trapped in mucus and transported along the labial palps towards the mouth. The
food particles are then, again assisted by cilia, transported through the esophagus and
directed towards the stomach. The stomach is surrounded by a dark digestive gland. Due to
mechanical and enzymatic processes, the food particles are digested extracellularly. These
digested end-products are then absorbed in the hemolymph (Figure 2.9).
Via the hemolymph this transport of nutrients could, for example, end up in the mantle
tissue where it is stored as the metabolic reserve glycogen. The waste materials and rejected
products are converted to faeces in the intestine and excreted through the anus. They find
their way back into the seawater through the exhalant opening (Jorgensen, 1990, Gosling,
2003). The selection of particles of interest is a selective process. The unwanted particles are
rejected and exit the mussel, as pseudofaeces, together with the waste water through the
inhalant opening (Jorgensen, 1996).
Chapter 2 Literature review
19
Figure 2. 9. Digestive system of M. edulis: Illustration of the stomach and digestive gland
(Gosling, 2003)
Figure 2. 10: Schematic illustration of filter feeding process (Aquascope, 2000).
Bayne and Widdows (1978) determined the filtration rate of M. edulis to be 1.34-2.59 L h-1.
Winter (1973) found that filtration rate in mussels increases with body size. On average,
mussels with shell lengths of 8.5 mm filtered algal cells out of water at a rate of
approximately 20 ml h-1 whereas mussels with shell lengths of 56.5 mm filtered at a rate of
Chapter 2 Literature review
20
about 1300 ml h-1. Winter (1973) also found that halving the algal concentration
approximately doubled the filtration rates. This large filter capacity allows the mussel to
ingest unselectively not only food particles and organic matter but also bacteria, toxic
substances, parasite larvae and even chemical pollutants. Because of this, the blue mussel
can concentrate several contaminants at high levels in its tissue and is thereby an ideal
biological marker for monitoring aquatic environments (Widdows et al., 2002, Brenner et al.,
2014). This characteristic also requires that mussels are produced in “clean” environments
and/or that they are regularly monitored for contaminants, including amongst others faecal
coliforms and marine toxin (depuration is often applied depending on the status of the
production area).
The life of marine bivalve mollusks is complex and includes a planktonic larval stage. Both
larvae and many adult bivalves feed by capturing microscopic particulates, inclusive detritus,
bacteria, microalgae and small animals (seston). Sestonic particles captured by bivalve
suspension feeders typically have diameters in the order of 1 to 100 μm: bacteria to
microplankton (Figure 2.11) and occur in seasonally variable amounts in seawater. The size
of particle captured depends on the different stage of life cycle of these species (Raby et al.,
1997)
Figure 2. 11: Comparative sizes of suspension-feeding bivalves and their potential food (seston). Adapted from Wildish and Kristmanson (1993).
Chapter 2 Literature review
21
2.4. The immune system of bivalves
In common with most invertebrates, bivalve mollusks are characterized by an innate, non-
specific immune system. This means that they react towards foreign components without
any memory regarding previous contacts and they do not use antibodies, the latter being
elements of the adaptive immune system (Roch, 1999, Gosling, 2003). The innate immune
system in bivalves comprises both cellular and humoral components, which play a vital role
in protecting the animals against foreign invaders namely bacterial, fungal, and viral
pathogens (Canesi et al., 2002b, Iwanaga and Lee, 2005)
The cellular response of the innate immune system is based on the activity of the
hemocytes, which resemble the monocytes and macrophages of vertebrates in both
structure and function. The hemocytes, circulating in the hemolymph, are responsible for
different cell-mediated reactions such as phagocytosis and subsequent cytotoxic reactions
(Lee, 2005). Phagocytosis generally starts with the recognition of the foreign particle such as
a bacterium. This particle, engulfed by the phagosome, is further processed. Hemocytes
granules fuse with phagosome. This allows effector molecules to come into contact with the
foreign particles helping to destroy them. This effectors include the production of reactive
species of oxygen (ROS) through the NADPH oxidase complex and/or defense molecules
(antimicrobials, hydrolytic enzymes) (Bachère et al., 2015). These cellular components of the
immune system are also involved in other important physiological functions such as
digestion and nutrient transport, wound healing and shell excretion (Lee, 2005, Bettencourt
et al., 2009).
The humoral component immune system of bivalves consists of the blood cells, the
hemocytes, and of soluble Hemolymph factors, that operate in a co-ordinated way to
provide protection from invading micro-organisms (Canesi et al., 2006). Hemolymph serum
contains humoral defense factors, such as soluble lectins, hydrolytic enzymes and
antimicrobial peptides (Canesi et al., 2002a, Pruzzo et al., 2005, Bachère et al., 2015) (Figure
2.12). Bivalve hemocytes are extremely heterogeneous; classifications proposed for different
bivalve species are reported elsewhere (Fryer and Bayne, 1996, Ottaviani and Franceschi,
1998, Hine, 1999).
Chapter 2 Literature review
22
Figure 2. 12: Mechanisms involved in the bactericidal activity of bivalve hemolymph (Canesi
et al., 2006)
2.4.1. Cellular immune response
Cellular response is carried out by hemocytes and in Mytilus edulis, they can be subdivided
into two categories, namely granulocytes and hyalinocytes or agranulocytes. Granulocytes
are the most abundant hemocytes in bivalve and have a large variability in number, type of
granules and degree of phagocytic activity. For example in Mytilus campechiensis, the
percentage of granulocytes and agranulocytes is 58.4 and 41.6, respectively (Huffman and
Tripp, 1982). The latter group, agranulocytes, has few or no granules and are less phagocytic
then granulocytes (Gosling, 2003, Song et al., 2010). The classification of hemocytes for
different bivalve mollusk species summarized in Table 2.2.
Chapter 2 Literature review
23
Table 2. 2 Classification of the hemocytes for different bivalve
Bivalves species Hemocytes Reference
Clam Tapes philippinarum -Granulocytes (80.1%)
-Hyalinocytes (32.2%)
-Hemoblast (18.9%)
-Serous cells (0.8%)
Cima et al. (2000)
Giant Clam Tridacna crocea -Eosinophilic granular
-Hemocytes
-Agranular cells
-Morula-like cells
Nakayama et al. (1997)
Meretrix meretrix -Agranular hemocytes
-Lymphoid hemocytes
-Large granular hemocytes
-Small granular hemocytes
Yanyan et al. (2006)
Anodont (Anodonta cygnea) -Granulocytes (eosinophilic and
basophilic granulocytes and an
intermix)
-Agranulocytes (hyalinocytes and
blast-like cells, vesicular cells)
Salimi et al. (2009)
There are different types of cellular defense mechanisms in bivalves, namely hemocytosis,
phagocytosis and encapsulation.
Hemocytosis, or hemocyte proliferation, is the first response to an infection or presence of a
non-self-particle. This involves an increase of circulating hemocytes, which move towards
the infected of injured tissue (Gosling, 2003). This movement of the cells is activated by
chemo-attractant substances, such as opsonines (for example, the extrapallial protein in
Mytilus galloprovincialis (MgEP)), to which the hemocytes are sensitive to. (basically
opsonization of microorganisms has been shown to occur through plasma proteins like Cg-
EcSOD, which promotes b-integrin-mediated phagocytosis (Duperthuy et al., 2011)). This
movement is implemented by two motile responses, namely chemotaxis and chemokinesis.
Chapter 2 Literature review
24
Chemotaxis is a directional movement and in M. edulis for example, is triggered by the
presence of lipopolysaccharides from Escherichia coli and Serratia marcescens. Chemokinesis
is a random, indirectional migration of the hemocytes and for example stimulated by N-
formyl-methionyl-leucyl-phenylal-anine (N-FMLP) in the blue mussel (Canesi et al., 2002b,
Song et al., 2010).
Myticin class C of mussel Mytilus galloprovincialis (Myt C) is known as an antimicrobial
peptide, and it is the most abundantly expressed gene in cDNA after immune stimulation of
Mytilus galloprovincialis (Costa et al., 2009). Recently, Balseiro et al. (2011) showed that this
AMP (Myt C) could be acting as immune system modulator molecule because its over-
expression was able to alter the expression of mussel immune-related genes such as Myticin
B, Mytilin B, and lysozyme. Moreover, the in vitro results indicate that Myt C-peptides have
antimicrobial and chemotactic properties. The result of this study suggested that Myt C
should be considered not only as an AMP but also as the first chemokine/cytokine-like
molecule identified in bivalves.
After this movement, non-self-recognition and attachment of the hemocyte to the targeted
particle occurs and, the particle is enclosed in a vesicle in the cell by endocytosis. This vesicle
is also called a primary phagosome and fuses together with a lysosome to form a
phagolysosome. In this structure, the engulfed particle is destroyed by lysosomal enzymes,
reactive oxygen intermediates, nitric oxide and antimicrobial factors (Gosling, 2003, Song et
al., 2010). Antimicrobial factors including cytoskeleton modification, internalization, and
destruction of the engulfed target within phagosomes (Song et al., 2010). This mechanism is
called phagocytosis and is illustrated in Figure 2.13.
Nodulation is one of cellular defense mechanisms against bacterial, fungal and viral infection
in insect (Drosophila) and other invertebrates. Nodulation is mediated by hemocytes
aggregate formation around bacteria and fungi (Lavine and Strand, 2002). Encapsulation is
similar to nodulation and refers to hemocyte aggregation around larger pathogens like
parasitoids and nematodes (Gandhe et al., 2007). The nodulation mechanism has been
exited in bivalve Eastern oyster Crassostrea virginica. However, the study of nodule
formation in bivalves is very rare.
Chapter 2 Literature review
25
Figure 2. 13: Schematic illustration of phagocytosis (Anonymous, 2016).
Encapsulation is the cellular immune response to foreign particles that are too large to be
phagocytosed. In this mechanism the foreign particle is encapsulated with hemocytes and
cytotoxic products, such as degradative enzymes and free radicals, are released to destroy
the particles (Song et al., 2010).
2.4.2. Humoral immune defense
Humoral response is carried out by humoral defense factors that are present in the
Hemolymph, as mentioned above. These factors can cause a direct cytotoxic effect on
pathogens and a lot of soluble molecules in the hemolymph can be categorized as humoral
defense factors. It should be noted that some of these factors are present in hemocytes and
are thereby also involved in the cellular defense. The most abundant humoral defense
factors in Mytilus species are (soluble) lectins, hydrolytic and lysosomal enzymes such as
phosphatase and lysozyme and antimicrobial peptides (Canesi et al., 2002b, Pruzzo et al.,
2005).
Chapter 2 Literature review
26
2.4.2.1. Lectins
Lectins are sugar-binding proteins that can interact specifically and reversibly with
membrane glycoproteins or glycolipids of bacteria or other invaders (Renwrantz, 1990).
Thereby, lectins are involved in several immune functions, such as self/non-self recognition
and associated effector mechanisms (Song et al., 2010).
Lectins can have a direct or indirect role in the phagocytosis process. Lectins can cause
agglutination and thereby potentiate the phagocytosis process by immobilization of
bacteria. On the other hand, lectins can also act as bridge molecules between bacteria and
hemocytes and thereby act as opsonization for phagocytosis (Pruzzo et al., 2005). There exist
many lectins, and they can be distinguished from each other by differences in molecular size,
subunit structure, agglutination properties, and sugar-binding specificity (Canesi et al.,
2002b). There are some important lectins such as MytiLec which is a α-Gal-binding lactic that
was isolated from the Mediterranean mussel Mytilus galloprovincialis (family Mytilidae)
(Hasan et al., 2015) and C-type GalNAc-specific lectins recovered from the sea cucumber
Cucumaria echinata which interact with target membranes and exhibit strong hemolytic
activity and cytotoxicity through pore formation (Hatakeyama et al., 1996).
2.4.2.2. Lysozymes
Lysozyme is a widely distributed anti-bacterial molecule (basically mostly a family of
molecules) present in numerous animals including bivalves. It is a hydrolytic protein that can
break the glycosidic union of the peptidoglycans of the bacteria cell wall. It is present in the
Hemolymph and the cells, and its release is associated with physiological changes, age,
stress, (Lopez et al., 1997, Cronin et al., 2001) and bacterial infections (Li et al., 2008).
Several studies have shown that lysozymes are able to kill Gram-negative bacteria, but some
have a wider activity. It was demonstrated for example that: an antibacterial lysozyme-like
protein from Icelandic scallops could inhibit the growth of all Gram-positive and Gram-
negative bacteria. Moreover, purified oyster plasma lysozyme inhibited the growth of Gram-
positive bacteria (e.g., Lactococcus garvieae, Enterococcus sp.) and Gram-negative bacteria
(e.g., Escherichia coli, Vibrio vulnificus)(Yue et al., 2011).
Chapter 2 Literature review
27
Lysozyme expression has been detected and localized in cells of digestive tubules, gill and
mantle (Bachère et al., 2015). Although lysozyme activity was first reported in mollusks over
30 years ago, complete sequences were published only recently, including those from M.
edulis, M. galloprovincialis, and two different forms in Crassostrea virginica, C. gigas, Ostrea
edulis and Chlamys farreri (Bachali et al., 2002, Itoh and Takahashi, 2007, Li et al., 2008).
Several types of lysozymes have been purified, from the best-known chicken-type (c-type)
and goose-type (g-type) to the more recently identified invertebrate-type (i-type)(Nilsen and
Myrnes, 2001). Such i-type lysozymes have been identified in several bivalve mollusk,
including the Icelandic scallop, Chlamys islandica (Nilsen and Myrnes, 2001) and the blue
mussel, Mytilus edulis. In the Mediterranean mussel, M. galloprovincialis, lysozyme has been
found localized within granular hemocytes. Higher levels of activity have been detected in
hemocytes compared with plasma in both M. edulis and the carpet shell clam, Ruditapes
decussatus (Li et al., 2008).
2.4.2.3. Antimicrobial peptides (AMPs):
AMPs are a major component of the innate immune defense system of bivalves. AMPs are
molecules with a mass less than 10 kDa which shows antimicrobial and antifungal properties
(Tincu and Taylor, 2004). Currently, ca. 10 different types of AMPs have been identified in
the mussel. They can be categorized into four different groups according to their
antimicrobial and antifungal action and to their primary structure (hydrophobic, cationic or
amphipathic). These four groups with their associated classes are called defensins, mytilins,
myticins and mytimycins (Canesi et al., 2002b, Tincu and Taylor, 2004, Song et al., 2010).
Many antimicrobial peptides are located in epithelia (Schröder, 1999) where they prevent
invasion by pathogens while others may be especially abundant in circulating cells.
In bivalves, AMPs were first purified from the blue mussel (M. edulis) hemocyte granules
(Charlet et al., 1996) and classified into three families: defensins, related to arthropod
defensins, mytilins and mytimycin. These three AMPs are present in different quantities
(Gestal et al., 2008). Moreover, the genes are differentially regulated according to the
challenging bacteria (Cellura et al., 2007). In M. galloprovincialis, all of the peptides possess
eight cysteine’s arranged in particular conserved arrays (Mitta et al., 2000a, Mitta et al.,
2000d). The typical structure of these peptides is shared by the new myticin class, myticin C,
Chapter 2 Literature review
28
recently described in M. galloprovincialis (Pallavicini et al., 2008). The genes encoding these
proteins showed a high polymorphic variability (Padhi and Verghese, 2008), which has been
suggested to account for the high resistance of the Mediterranean mussel to disease (Costa
et al., 2008). This variability was also observed in clam and mussel mytilins (Gestal et al.,
2007, Parisi et al., 2009). In the oyster C. gigas, a molecular biological approach revealed the
presence of two isoforms of a defensin-like protein (Gueguen et al., 2006, Gonzalez et al.,
2007). In contrast to the one from the mussel, the oyster defensin was not altered after a
bacterial challenge (Gueguen et al., 2006).
Table 2. 3: Antimicrobial peptides of two closely related mussel species and their classes
(Tincu and Taylor, 2004)
Species Peptide Class
Mytilus edulis Defensins A and B
Mytilin A and B
Mytimycin
β-3
β-4
β-6
Mytilus galloprovinciallis Myticin A and B
Defensins 1 and 2
MytilinB, C, D and G1
β-4
β-4
β-4
2.4.2.4. Phenoloxidase (PO)
Phenoloxidase is a critical component of the immune system of mollusks (Asokan et al.,
1997, Lopez et al., 1997). As the product of a complex cascade of reactions, PO is generated
from prophenoloxidase (proPO) through a limited proteolysis by a proPO activating enzyme
(ppA) (Coles and Pipe, 1994). In vivo ppA is activated in the presence of microbial
polysaccharides, such as lipopolysaccharides, peptidoglycans and 1,3-β-glucans. Upon
binding of these type of molecules to specific pattern-recognition receptors ppA is activated,
and as a consequence, active ppA converts proPO to PO (Aspan et al., 1995, Ballarin et al.,
1998). Finally, PO is involved in melanization, encapsulation, wound healing, phagocytosis,
and pathogen extermination (Bai et al., 1997, Newton et al., 2004, Munoz et al., 2006). In
Chapter 2 Literature review
29
bivalve mollusks, PO is mainly found in the Hemolymph (Asokan et al., 1997, Munoz et al.,
2006), and exits both in the soluble or cellular form: the soluble form is always involved in
humoral immunity, while the cellular PO, which binds to the surface of hemocytes is more
associated with cell-mediated immunity (Ling and Yu, 2005, Hellio et al., 2007), although
there is other PO-like activity (Rizzi et al., 1994). Significant differences in phenoloxidase
activity have been observed in bivalves exposed to environmental stressors or pollution
(Kuchel et al., 2010, Luna-Acosta et al., 2010). Phenoloxidase enzymes can be detected in all
life stages of M. edulis (Coles and Pipe, 1994, Dyrynda et al., 1995, Luna-Acosta et al., 2011)
and Pacific oyster C. gigas (Thomas-Guyon et al., 2009). PO enzymes are most commonly
found in adult hemocytes (Luna-González et al., 2003) but embryonic cells, which possess
some phagocytic capacity, possess a restricted level of PO activity as well (Dyrynda et al.,
1995, Luna-González et al., 2003) and it has been suggested that it plays an important
function in non-self-recognition and host immune reactions in the early life stages of bivalve
(Thomas-Guyon et al., 2009).
2.4.2.5. Production of reactive oxygen species (ROS)
Reactive oxygen (ROS) and nitrogen species (RNS) are naturally produced in all cells and
organisms. ROS generation may result in oxidative stress (Donaghy et al., 2015). In
mammals, all the blood phagocytes contain granules rich in lysosomal enzyme, which
degranule during phagocytosis to bring about the killing an degradation of endocytosis
pathogens (Pipe, 1992). In bivalve mollusks, ROS is produced in hemocytes as part of their
basal metabolism as well as in response to endogenous and exogenous stimuli (Donaghy et
al., 2015). The major reaction cascades from the initial pathogen contact through oxidative
killing are summarized in Figure 2.14.
Chapter 2 Literature review
30
Figure 2. 14: Diagram of the major reaction cascades from the initial pathogen contact
through oxidative killing. Adapted from Roch (1999).
2.4.2.6. Cytotoxic enzymes activity
In many invertebrate species, several kinds of immune-related humoral activities have been
reported. Bivalves possess various types of non-specific humoral defense molecules
including agglutinins, opsonizing lectins, bactericidins, lysozymes and serine proteases. In the
blue mussel, M. edulis, a modification of the in vitro plaque assay has been employed to
demonstrate the presence of cytolytic molecules (another name is cytotoxic hemocytes
(Wittke and Renwrantz, 1984, Leippe and Renwrantz, 1988). Also, the plasma of the
Mediterranean mussel, M. galloprovincialis, contains cytotoxic activity against both
vertebrate (erythrocytes and mouse tumor) and protozoan cells. The prokaryotic bacteria,
Escherichia coli and Vibrio alginolyticus, were not sensitive to this cytotoxicity (Hubert et al.,
1996). Injection of erythrocytes stimulated the cytotoxic activity of the plasma with a
maximum 2 days post-injection, suggesting that cytotoxic molecules are involved in immune
defense (Hubert et al., 1997). The activity was still present in dialyzed samples but was
destroyed by heating at 45°C. Purification by anion exchange chromatography followed by
gel filtration revealed a 320-kDa cytotoxic polymeric protein (Roch et al., 1996). Composed
of three different proteins (25 – 320 kDa), the complex acts through a hetero-polymerization
process after binding to target cell membranes as revealed by ultrastructural observation
(Hubert et al., 1997).
Chapter 2 Literature review
31
2.4.3. Difference in the immune system between bivalve adult and larvae
Very little is known about the immune system of bivalve mollusk larvae although some
studies reported that larvae of certain groups of mollusks may have a stronger innate
internal defense than others, or perhaps there are differences in the maturation rate of the
immune system during the early development (Luna-Gonzalez et al., 2002).
Dyrynda et al. (1995) found that larvae have non-specific defense barriers to bacterial
invasion as well as specific immune functions. Non-specific immune defense includes
external and mucosal barriers and some adaptive components that are transferred from the
mother, such as agglutinins, precipitins, lysins and immunoglobins on the egg membrane
surface (Mulero et al., 2007). External and mucosal barriers are the first line of defense since
infection usually requires intimate association with larvae surfaces (Olafsen, 2001, Gomez-
Leon et al., 2008).
In a study of the immune system of larvae of blue mussel M. edulis Dyrynda et al. (1995)
demonstrated some immune defense functions including production of degradative
enzymes phenoloxidase and arylsulphatase, phagocytosis of E. coli cells and generation of
reactive oxygen metabolites. Immunity attributes were compared to those of adults in Table
2.4 (Dyrynda et al., 1995), which indicates that some elements of the immune system in
adults bivalves also appear in the trochophore and veliger larvae.
Recently, Song et al. (2016) reported that the newly hatched, trochophore stages of the
Pacific oyster are not only critical for oyster development in general, but also critical for the
ontogenesis of the immune system. Phagocytosis was firstly observed in the early D-veliger
larvae, 17 hour after fertilization
The adult bivalve immune system does not appear to operate autonomously in regulation
and action as previously thought, but rather may interact with the nervous and endocrine
systems (Koller, 1990). These links may increase the complexity of the immune response and
potentially make it more sensitive to environmental stressors (Parry and Pipe, 2004).
Chapter 2 Literature review
32
Table 2. 4: Summary of defense mechanism recorded in blue mussel (Mytilus edulis)
Activity Adults Larvae Reference
Degradative enzyme + + (Pipe, 1990)
Phagocytosis + + (Noël et al., 1994)
Cytotoxic reaction + ND* (Leippe and Renwrantz, 1988)
Reaction oxygen metabolites generation + ND (Pipe, 1992)
Nitric oxide generation + ND (Ottaviani et al., 1990)
(*)ND: not determined
2.5. Constraints of bivalve aquaculture
One of the main problems in the aquaculture of bivalve mollusks is occurring mortality,
which severely reduces production. These outbreaks of disease affect larval, and postlarvae
in the hatchery, as well as juvenile and adults, cultured in the natural environment. Research
has been conducted to determine the aetiology, epidemiology and control measures for
these epizootics (Renault, 1996). Bacteria, viruses, fungi, and protozoan parasites have
caused major epizootics in bivalve mollusks. This is probably facilitated by considerable
(commercial) movement of life animals, explaining the appearance and the spread of some
infectious diseases in several countries around the world (Renault, 1996). In this chapter, we
will focus on bacteria and viral diseases of bivalve mollusks that have been reported so far,
and their economic impact on the bivalve mollusk aquaculture.
2.5.1. Bacterial diseases
For the main microbial diseases affecting cultured marine bivalves the aetiologic agents have
been characterized, and their pathogenesis and pathogenicity have been studied. Several
recent bivalve-interaction models have been studied for the brown ring disease, juvenile
oyster disease, Pacific oyster nocardiosis and summer mortalities of oysters (Paillard et al.,
2004). In addition, the taxonomy and phylogeny of new potential bivalve pathogens and
Chapter 2 Literature review
33
their virulence factors have been established. Facing the difficulty of identifying bacterial
strains associated with molluscan diseases (mainly vibriosis), polyphasic approaches have
been developed to correlate the phenotype and genotype of potential pathogens (Paillard et
al., 2004).
So far, in bivalve mollusk hatcheries, massive mortalities can result in the complete loss of
the production stock, with serious economic consequences. In most cases, the studies have
demonstrated that the problems are caused by bacterial pathogens, the primary etiological
agents being members of genus Vibrio, Pseudomonas, Aeromonas, and Vibrio–like bacteria
(VLB) (Tubiash et al., 1965, Tubiash et al., 1970, Sugumar, 1998, Beaz‐Hidalgo et al., 2010).
Although all life larval stages are vulnerable, the larvae are particularly exposed to a high
concentration of potentially pathogenic bacteria associated with tank surface, moribund
larvae, or organic detritus (moribund larvae or organic debris) during the temporary fixation
of the larvae on the bottom of the tank (Sutton and Garrick, 1993).
Vibrio alginolyticus has been reported as one of the most pathogenic bacteria for molluscan
larvae (Tubiash and Otto, 1986, Luna-Gonzalez et al., 2002). For example, survival rates of
Mytilus galloprovincialis larvae exposed to Vibrio alginolyticus were found to be between 64-
95% 48 h post challenge for the different bacterial concentrations. Minimum survival (64%)
was found in 3 × 104 CFU ml–1 and the maximum in the control treatment (95%) (Anguiano-
Beltrán et al., 2004).
Together with the species V. alginolyticus, both V. tubiashii, and V. anguillarum were
recognized as the primary causal agents of the “bacillary necrosis” (Tubiash et al., 1970,
Tubiash and Otto, 1986). The disease is characterized by bacterial colonization of the mantle,
velum disruption, abnormal swimming, visceral atrophy, and lesions in the organs among
other signs. Another characteristic sign of larval vibriosis in hatcheries is the appearance of
the phenomenon called “spotting,” defined as an accumulation of moribund larvae
agglutinated at the bottom of the tanks (DiSalvo et al., 1978). Table 2.5 provides a summary
of the most recent studies on bivalve larvae vibriosis.
Vibriosis is not only the main cause of massive mortalities in larval stages but also effects
juveniles and adults (Paillard et al., 2004). A total of 90 samples of adults blue mussels grown
in Germany were analyzed. The analysis revealed the presence of Escherichia coli and
Chapter 2 Literature review
34
Salmonella spp. but also may Vibrio spp. Vibrio spp. was detected in 74.4% of the samples
analyzed in this study. Among Vibrio isolates, Vibrio alginolyticus was the species most
frequently detected (51.2%), followed by Vibrio parahaemolyticus (39.5%) and Vibrio
vulnificus (3.5%). V. parahaemolyticus and V. vulnificus were not found in samples collected
at low water temperatures (Lhafi and Kuhne, 2007).
In France, classical Vibrio infections are associated with the phenomenon known as Summer
Mortality (SM) in juvenile Pacific oysters (Crassostrea gigas). SM affects juvenile oyster
populations during the warmer months when the water temperature is ≥ 18 0C and
reproduction takes place (Berthelin et al., 2000). This phenomenon has been associated with
stress situations, low dissolved oxygen or presence of toxic substances in the sediment
(Cheyney et al., 2000). Lipp et al. (1976) were the first to observe that the oyster
Hemolymph had high levels of Vibrios that were causing death and later studies identified V.
splendidus as the causal agent of SM (Lacoste et al., 2001, Gay et al., 2004). More recently,
Allain et al. (2009) suggested the possible role of V. harveyi as the aetiological agent of SM,
since it was detected in most samples of affected oysters during the 2008 warm season and
was able to produce mortality in experimental challenges. The most accepted theory today
is that the oyster SM cannot be attributed to one bacterial pathogen or to the Oyster
Herpesvirus alone, but to a complex interaction between the physiological and/or
genetic state of the host, environmental factors and the presence of various opportunistic
infectious Vibrio species (Paillard et al., 2004, Pruzzo et al., 2005, Labreuche et al., 2006).
Another serious mollusk disease is the Brown Ring Disease (BRD), caused by V. tapetis
(Borrego et al., 1996). It has been widely studied since it is the primary disease with bacterial
etiology in adult clams (Ruditapes semidecussatus and Ruditapes decussatus) (Paillard et al.,
2004). Susceptibility to V. tapetis infections is species specific, causing greater physiological
disturbances and mortality in R. semidecussatus than in other species of clams (R.
decussatus and Mercenaria mercenaria) or in the oyster C. Virginia (Allam et al., 2001, Allam
et al., 2006). Environmental factors (i.e. temperature and salinity) play a role in the
development of BRD, which tends to be more frequent in the spring and winter as the
optimum growth temperature for V. tapetis is 15 °C (Paillard et al., 1994, Paillard et al.,
2004).
Chapter 2 Literature review
35
Table 2. 5: Experimental infection of bivalve larvae, juvenile and adults with pathogenic Vibrio spp. Adapted from Romalde and Barja (2010).
Pathogenic species Bivalve species* Life stage Reference
V. alginolyticus M.galloprovincialis Larvae Anguiano-Beltrán et al. (2004)
R. decussates Larvae Gómez-León et al. (2005)
V. splendidus biovar II
R. decussates Larvae Gómez-León et al. (2005)
C. gigas Juveniles Waechter et al. (2002)
V. splendidus –like
P. maxima Larvae Sandlund et al. (2006)
C. gigas Adults Gay et al. (2004)
V. aestuarianus C. gigas Adults Garnier et al. (2008)
V. tubiashii C. gigas Larvae Hasegawa et al. (2008)
V. parahaemolyticus
V. vulnificus
V. alginolyticus
Mytilus edulis Adults Lhafi and Kuhne (2007)
Vibrio sp.
C.gigas; O. edulis Larvae Estes et al. (2004)
C. virginica Larvae Gomez-Leon et al. (2008)
C. gigas; C. virginica Juveniles Gay et al. (2004); Gomez-Leon et al. (2008)
*Abbreviations: C = Crassostrea, M = Mytilus, O = Ostrea, P= Pecten, R = Ruditapes.
2.5.2. Viral diseases
In general, viruses can be significant infectious agents in bivalve species. Particularly in early
life stages of bivalves, there appears to be mortality associated with Herpes-like and irido-
like viruses (Elston, 1997). The herpes-like virus affects bivalve populations in many countries
including Australia, Asian countries and especially in France where infected hatchery-reared
larval Pacific oysters showed cumulative infection rates of 60-100% at 7-11 days post
fertilization (Hine et al., 1992). Larval hatchery-reared Pacific oysters in France experienced
Chapter 2 Literature review
36
abnormal mortality and morbidity associated with a herpes-like viral infection (Nicolas et al.,
1992) and mass mortality of 80-90% observed during the summer. Le Deuff et al. (1994)
reported experimental transmission of the infection from a population of infected oyster
larvae to larvae obtained from a pathogen-free broodstock but maintained by axenic
methods. Within 48 h of inoculating a virus suspension into the cultures of axenic larvae, the
animals exhibited a high rate of morbidity, and virus-like particles were observed in
connective tissue cells around the velum. Le Deuff et al. (1994) later showed that the viral
infection would produce complete viral particles and 80-90% mortality in oyster larvae
reared at 25-26 °C but not in larvae reared at 22-23 °C. At the lower temperature, the
authors reported nuclear alterations but no viral particles were found. This could be
interpreted as latent infections. Elston (1997) also found viral infections developing in larvae
from three out of four broodstock batches obtained from different areas in Atlantic France.
Larval hatchery-reared Pacific oysters in France experienced unusually high mortality and
morbidity rates associated with a herpes-like viral infection (Nicolas et al., 1992). The
infection was associated with cellular changes in oyster seed, collected from survivors of
populations that had undergone 80-90% mortality during the summer for at least 20 years
(Renault et al., 1994, Goulletquer et al., 1998, Soletchnik et al., 2007). This syndrome has
been reported in most Pacific oyster producing countries, such as Japan, USA and Australia.
The first description of this phenomenon was made in the 1940s in Japan, where C. gigas is
endemic. Herpes virus also causes mortality in different bivalve aquaculture species. For
example, abnormal summer mortalities associated with the detection of ostreid herpesvirus
1 (OsHV-1) have been reported among larvae and spat of the Pacific oyster C. gigas in France
(Schikorski et al., 2011), as well as in farmed seed and adult green-lipped mussels (Perna
canaliculus) from New Zealand. Cumulative mortality of 50-100% associated with apparent
virus infection was reported in green lipped mussel seed during the summer and autumn,
while mortality in adults was only 2-5% (Jones et al. (1996). In addition, summer mortality
occurred in different mollusks species and regions such as the blue mussel (M. edulis) in
Denmark (Rasmussen, 1986), abalone (Haliotic spp.) farm in Australia (Hooper et al., 2007,
Tan et al., 2008, Corbeil et al., 2012).
Chapter 2 Literature review
37
Among 1200 specimens of M. edulis examined from three localities in Denmark, a total of 34
mussels with virus-associated granulocytomas were discovered. Confirmation that the virus
was related to Picornaviridae was based on the following five observations. The virion was
non-enveloped, the capsid was apparently icosahedral and measured approximately 27 nm,
the virus was found only in the cytoplasm, and no viral DNA was seen (for the latter the
Feulgen reaction was used for viral DNA detection. However, result of the Feulgen reaction
was negative) (Rasmussen et al., 1985).
2.6. Solutions to control diseases in bivalve larvae culture
2.6.1. Water treatment
The influence of the environment on hatchery cultures is paramount. The bivalve larvae live
in the water, sharing the environment with both beneficial bacteria and potential pathogens.
The bacterial loads in bivalve larvae tanks and reported to vary between 105- 106 bacteria
ml-1 (Nevejan et al., 2016). As bivalves release their young at an early ontogenic stage, these
early life-history stages are especially sensitive to possible infections. In part, this is due to
their filter-feeding behavior and the subsequent flow of sea water through the organism
(Prado et al., 2010). Some methodologies and technologies are currently used to remove the
excess of organic matters and nutrients in aquatic systems. Different water treatments, such
as filtration, pasteurization, Ozone, Ultraviolet (UV) radiation have been employed in
mollusk hatcheries (Vasconcelos and Lee, 1972, Murchelano et al., 1975, Lodeiros et al.,
1987). A recent alternative approach is the integration of a biological filter in recirculating
systems (Marinho-Soriano et al., 2011) The core mechanism of such strategies is the
utilization of living bacteria and algae to convert the toxic pollutants into the less toxic form
or microbial biomass that can be fed to the culture animals.
Once most of the solid particles are eliminated from the seawater through decantation, the
water is filtered. Filtration is an expensive treatment, with incremental costs with increased
volume and the filtration range established. An advisable practice is to reduce the content
of bacterial load and results show that this is better than using alternative systems like
pasteurization, as demonstrated by Lewis et al. (1988) in a Pacific oyster hatchery. The main
disadvantage of pasteurization is the risk of subsequent contaminations due to the necessity
Chapter 2 Literature review
38
of transporting the treated water through long pipes and the prolonged period of high
temperature to cool down (Prado et al., 2010).
To overcome those problems, disinfection with chlorine has been employed too, but it
comes with many problems, like the interference with the larval mechanism of pumping, as
described by Vasconcelos and Lee (1972) for cultures of C. gigas, and by Asokan et al. (2013)
for a mussel hatchery. Some studies suggested that the reactions between chlorine and
organic nitrogen in the water could produce residues toxic to marine organisms (Jorquera et
al., 2002). Another alternative is ozonization, but its application to disinfect aquaculture
systems can be complex and costly (Summerfelt, 2003). One of the most common
treatments is the radiation of seawater with ultraviolet (UV) light, with unquestionable lethal
effects on bacteria and viruses. However, there are disagreements about the actual effects
when the water treatment is used in hatcheries. Vasconcelos and Lee (1972) found
advantages in its use, as different bacterial populations, including bivalve pathogens,
decreased. In larval cultures of Ostrea edulis, the population of Vibrios decreased with UV
treatment (Lodeiros et al., 1987, Sainz-Hernandez and Maeda-Martinez, 2005).
Nevertheless, Brown (1981) found that the same treatment with UV tested against two
pathogenic Vibrio spp. was effective against one of them, while the other strain was able to
grow after an initial inhibition. Therefore, the effects of UV-radiation are not homogenous
against all the bacterial populations, and more variability is added with factors like the dose,
the water flow and the individual efficiency of the radiation unit (Prado et al., 2010). In
general, those treatments can reduce number of bacteria in water. For example the addition
of ozone reduced the numbers of heterotrophic bacteria by 3log10 units (Suantika et al.,
2001). A reduction in bacterial numbers can only have advantages in terms of the hygienic
quality of aquatic animal; however, attention should also be paid to the changes in bacterial
communities imposed by the disinfection.
Moreover, it is known that the efficiency of the treatment is affected by the organic content
of water and the presence of small particles to which bacteria are attached (Liltved and
Cripps, 1999). In summary, these significant differences in the effectivity can lead to the
selection of undesirable populations, including those resistant to the treatment, which
would find an ecological niche favorable to their growth.
Chapter 2 Literature review
39
Currently many bivalve mollusk hatcheries are using a flow through system (FTS) for growing
larvae. There are some important advantages larval handling is reduce and the water
parameters are less fluctuating because the feeding with algae happens also continuously.
These stress-reducing conditions make the larvae less susceptible for disease. Besides a
better disease control, larval tanks can hold a much higher larval density in comparison to
batch culture and labor cost are reduced (Magnesen and Jacobsen, 2012). However, one
should take into account that it is impossible to create a stable bacteria community in the
tanks under these conditions and the development of bivalve- specific recirculating systems
offers a window of opportunities.
2.6.2. Antibiotics
Antibiotics have been extensively used as therapeutic treatments to disease in bivalve
hatcheries since Davis and Chanley (1956) showed their ability to reduce larval mortalities in
hard clam Mercenaria mercenaria. However, in parallel with studies confirming the
beneficial effects, other works described toxic effects, as well as a lack of effectiveness or
consistency in the results obtained. Jeffries (1982) observed that the treatment with
chloramphenicol achieved a slight recovery in a larval culture of C. gigas, but at the same
time the larvae ceased swimming and therefore feeding. Uriarte et al. (2001) reported that
chloramphenicol added to the food two times per day resulted in better survival and growth
rates in Chilean scallops (Argopecten purpuratus) between the early larvae and pediveliger
stages cultured in a closed system. Similar benefits were reported for larval stages of the
great scallop (Pecten maximus) (Torkildsen et al., 2005). In experiments with the blue
mussel, M. edulis, the treatment with chloramphenicol resulted in good survival but slow
development, showing an opposite effect to the combination of ampicillin and streptomycin,
with excellent development but low survival (Prado et al., 2010).
However, the massive use of antibiotics has led to the development of multiple drug
resistant bacteria (Karunasagar et al., 1994, Tendencia and de la Peña, 2001) and even the
risk of transmission of resistant plasmids among aquatic-associated pathogens to human
pathogens, with the subsequent risk for the hatchery workers (Jeffries, 1982, McPhearson et
Chapter 2 Literature review
40
al., 1991, Spanggaard et al., 1993). Also, the water exchange between the hatchery and the
environment may spread resistant bacteria (McPhearson et al., 1991, Kemper, 2008).
As a result of the growing awareness that antibiotics should be used with more care, more
strict regulations on antibiotic usage in aquaculture and on the acceptable residue levels of
various agents in the aquatic product have been set (Bachère, 2003, Defoirdt et al., 2011).
For instant, nowadays, chloramphenicol is prohibited in any veterinary applications to avoid
the health hazards to humans by food consumption at least within the EU (Annex IV of
Directive 2377/90/EEC), due to its potential toxic effects in humans as well as to the
difficulty in determining security levels of its residues (Prado et al., 2010).
The final objective of all the methods cited above is to obtain a substantial reduction of
number bacteria within the hatcheries, but this goal does not seem reasonable, since the
bacteria population, or, at least, part of it, may have a beneficial effect on larval
development. In addition, a lack of microbiota can favor the colonization of the system by
non-desirable microorganisms, due to a lack of natural competitors, in an environment with
a regular input of organic matter and optimal conditions (Romalde and Barja, 2010).
2.6.3. Immunostimulants
A set of different substances such as beta-glucans, bacterial products, and plant constituents
may directly activate the innate defense mechanisms by acting on receptors. This may
trigger the production of anti-microbial molecules. These immunostimulants are often
obtained from bacterial sources, brown or red algae. Terrestrial fungi are also exploited as a
source of novel potential substances. The use of immunostimulants, as dietary supplements,
can improve the innate defense of animals providing resistance to pathogens during periods
of high stress (Bricknell and Dalmo, 2005).
Heat Shock Protein (HSP) was considered as an immunostimulant in different bivalve mollusk
species, including the mud clam Mya arenaria (Abele et al., 2002) and Pacific oyster C.gigas
(Lang et al., 2009). These studies found that transcription after heat shock increased for
genes putatively encoding heat shock proteins and genes for proteins that synthesize lipids,
whereas transcription decreased for genes of proteins that mobilize lipids and detoxify
reactive oxygen species. Hong et al. (2006) reported that the genomic DNA of Escherichia
Chapter 2 Literature review
41
coli, which contains the un-methylated CpG motif, was used to evaluate the
immunostimulating effect of bacterial DNA on innate immune responses in the bivalve
mussel Hyriopsis cumingii Lea. These results showed that the bactericidal activity of the
hemocytes was significantly increased when the cells were incubated with 50 or 100 μg ml-1
bacterial DNA for 12 and 24 h. Antibacterial activity, lysozyme activity, and prophenoloxidase
(proPO) production of hemolymph were also increased, when the bivalve mollusk was
injected with 50 or 100 μg ml-1 of bacterial DNA for 12 and 24 h. These activities returned to
the control level after 48 h. In summary, bacterial DNA with unmethylated CpG motif
(Unmethylated CpG motifs are prevalent in bacterial but not vertebrate genomic DNAs)
could activate some parameters of the immune system of bivalve mollusk both in vivo and in
vitro.
In conclusion, immunostimulants can reduce the losses caused by disease in aquaculture;
however, they may not be effective against all diseases. For the efficient use of
immunostimulants, the timing, dosages, method of administration and the physiological
condition of aquatic animal, including bivalve mollusks, need to be taken into consideration.
2.6.4. Prebiotics and probiotics
Since the concept of prebiotics was introduced, it has attracted scientific and commercial
interest. The main characteristic of prebiotics is the selective stimulation of intestinal
bacteria growth, contributing to the hosts' health and welfare. This requires prebiotics to be
non-digestible and resistant to gastric acidity, bile salts, and hydrolysis by the host's enzymes
(Glenn and Roberfroid, 1995, Roberfroid, 2007). Symbiotics, products that contain both
probiotics and specific prebiotics that promote the growth of the probiotic strains, are
considered a good solution in many cases (Apajalahti et al., 2004, Cheng et al., 2005, Bomba
et al., 2006). Recently, the use of prebiotics has become popular for a number of
aquaculture species, both fish and shrimp (Yousefian and Amiri, 2009). Some of the more
commonly used prebiotics in animal aquaculture feeds include inulin, fructooligosaccharides
(FOS) and transgalactooligosaccharides (TOS) (Vulevic et al., 2004), which function to
increase feed intake, growth rate and food digestibility of aquatic animals (RingØ et al.,
Chapter 2 Literature review
42
2010). In bivalve mollusk species, the use of prebiotics for larval stages has not been as
widely used compared to probiotics.
Verschuere et al. (2000) gave a definition of probiotics, appropriated to be used within the
field of aquaculture, taking into account the close interaction of the animal with the
environment. According to these authors a probiotic would be a live microbial additive with
a beneficial effect on the host, modifying the microbiota associated with the host or
the environment, ensuring an optimal use of the feed or improving its nutritional value,
improving the host response to the disease, or getting a better quality of its environment.
To date, the use of probiotics in aquaculture has focused mainly on fish and crustacean
production, with scarce literature considering their application in bivalve mollusk
aquaculture. Lodeiros et al. (1989) published the first work on the effect of antibiotic-
producing marine bacteria on the larval survival of scallop Pecten ziczac and the best results
were achieved using a live bacterial culture.
Douillet and Langdon (1993) conducted a set of experiments with axenic oyster larvae (C.
gigas), fed with a mono-algal axenic diet and inoculated with different marine bacteria. Most
of the isolates assayed had negative or neutral variable effects, and only the strain CA2
(Alteromonas sp.) showed a beneficial impact on the growth and survival of oyster larvae. In
non-axenic larval cultures, Douillet and Langdon (1994) found that the effect of strain CA2
depended on its concentration, being detrimental to larval growth and survival when
administered at 107 CFU ml-1 whereas at 10 to 106 CFU ml-1 larval survival was not affected
and growth was enhanced. The optimal concentration, 105 CFU ml-1, was within the constant
values for bacterial populations in bivalve cultures obtained by plate counting, between 104
and 106 CFU ml-1 (Jeanthon et al., 1988). They pointed out the beneficial effects in terms of
the percentage of larvae that metamorphosed to spat and spat size after 30 days; a possible
indirect beneficial effect was improved growth and development during the larval phase.
The group of Riquelme (Riquelme et al., 1996, Riquelme et al., 1997, Riquelme et al., 2001),
performed the most comprehensive assessment on the benefits of probiotic bacteria in
bivalve cultures. Their results demonstrated that a strain of Pseudoalteromonas haloplanktis
was effective against different bacterial species, including members of genus Vibrio. Further,
they found that strain 11 (Pseudomonas sp) (one strain among 506 isolates) was effective in
Chapter 2 Literature review
43
the larval cultures of Argopecten purpuratus against pathogenic Vibrio anguillarum-related
(VAR) strain.
The term ‘probiotic’ was also used by Gibson et al. (1998) in a study on the protection of C.
gigas larvae by the strain A199 (Aeromonas media), against the infection by Vibrio tubiashii.
The strain A199 showed a broad spectrum of in vitro inhibition, including members of genus
Vibrio and Aeromonas. The conditioning of larvae with the probiotic strain (104 CFU ml-1)
allowed the survival of larval cultures inoculated with the pathogen (102,103 and 105 CFU ml-
1).
Nakamura et al. (1999) reported the beneficial effects of strain S21, isolated from seawater,
against pathogenic Vibrios, as demonstrated by the protection offered to Pacific oyster C.
gigas larvae against V. alginolyticus. These results demonstrated that the inoculation of
probiotic at 104 or 105 CFU ml-1 immediately after the pathogenic strain (105 CFU ml-1)
reduced the larval mortality from 91.6% to 53.1 and 78.0%, respectively. In any case, the
potential probiotic maintained their numbers in the medium, avoiding the risk of a
dangerous proliferation.
Kesarcodi-Watson et al. (2009) first screened probiotics for effective use with green shell
mussel larvae (Perna canaliculus), and has demonstrated the benefit of including test
animals in the initial screening stages. It should also be considered that when screening for
effective probiotics, it is best to use bacteria associated with or existing in the natural
environment of the host. Effective application in flow-through hatchery production
conditions is achieved by switching off the water flow for just 2 h with daily probiotic
addition. A later study of Kesarcodi-Watson et al. (2010) demonstrated that both strains of
Alteromonas macleodii 0444 and Neptunomonas sp. 0536, were two novel probiotics for
effective use on hatchery-reared Green shell mussel larvae, Perna canaliculus.
In general, the positive effect of probiotic bacteria in bivalve mollusk species was
demonstrated in those studies. However, there are some limitations to the use of probiotics
in aquaculture. Because, the most important limitation to the use of probiotics is that in
many cases they are not able to maintain themselves in sufficient numbers in the standing
microbial communities, and so they need to be added regularly and at high concentrations
making this technique less cost effective (Defoirdt et al., 2007b). Probiotics that were mostly
Chapter 2 Literature review
44
selected in vitro based on the production of inhibitory compounds might fail to produce
these compounds in vivo. Also, food safety issues and difficulties regarding incorporation of
viable cells in feed, maintaining them stable during storage have put a constraint on the full-
scale application of probiotics (Merrifield et al., 2010).
2.6.5. Antivirulence therapy
Antivirulence therapy is a promising alternative approach to treating bacterial diseases.
Because bacteria use virulence factors to cause infection, preventing pathogens from
producing and using such factors is a promising strategy for disease control. This therapy is
thus based on a thorough understanding of the mechanisms that pathogenic bacteria use to
cause diseases (Defoirdt, 2014). The major advantage of antivirulence therapy is that there
will be less or no interference with non-target organisms, such as the commensal
microbiota. This is because antivirulence therapy specifically targets virulence gene
expression and regulation (Defoirdt, 2013, Defoirdt, 2014). Antivirulence therapy consists on
one hand of specifically inhibiting one or more virulence factors. On the another hand,
antivirulence therapy can interfere with the mechanisms that control the expression of
virulence factors. These mechanisms are for instance cell-to-cell communication (or quorum
sensing) and host-pathogen signaling. So for example, quorum sensing disrupting agents can
prevent bacteria from attaching to the host and are in this way effective in disease control
(Defoirdt, 2014).
2.7. The use of poly–β–Hydroxybutyrate (PHB) as a tool to control disease in aquaculture
seed production
2.7.1. Introduction
Polyhydroxyalkanoates (PHAs) are polyesters of hydroxyalkanoates that accumulate
intracellularly as carbon and energy storage materials in numerous microorganisms, usually
when grown under limitations of oxygen, nitrogen, phosphate, sulphur, or magnesium and in
the presence of excess carbon (Anderson and Dawes, 1990, Valappil et al., 2007). PHA is
typically produced as a polymer of 103 to 104 monomers (Suriyamongkol et al., 2007) which
exists as discrete granules, with about 5 to 13 granules per cell and with diameters of 0.2 to
Chapter 2 Literature review
45
0.5 μm (Figure 2.15) (Lee, 1996a, Sudesh et al., 2000). The properties of PHAs are similar to
those of conventional petrochemical-based synthetic thermoplastics and can hence
potentially replace them. Furthermore, they become completely degraded to carbon dioxide
and water under aerobic conditions, and to methane and carbon dioxide under anaerobic
conditions by microorganisms in the environment (Anderson and Dawes, 1990, Lee, 1996b).
Figure 2. 15: Pseudomonas putida cells accumulating PHB inclusion under electron
microscopy (Luengo et al., 2003).
PHAs can be classified as either short-chain-length (SCF) PHAs with C3-C5 hydroxyacids as
monomers or medium-chain-length (MCF) PHAs with C6-C16 hydroxyacids as monomers. The
SCF-PHAs have properties close to the conventional plastics (stiff and brittle) while MCF
PHAs are flexible, present low crystallinities, tensile strengths and melting points. Certain
bacteria can synthesize PHAs containing both SCF and MSF monomer units (Philip et al.,
2007). The molecular weight of PHAs varies between 2 × 105 and 3 × 106 Daltons (Figure
2.16). The composition and molecular weight of the synthesized polymer are governed by
two factors: the microbial strains and the provided substrate (mainly the carbon source)
(Valappil et al., 2007). The best-known member of the PHAs is poly-β-hydroxybutyrate
(PHB), containing repeat units of (R)-3 hydroxybutyrate (Lee, 1996b).
Figure 2. 16: General structural formula of poly–β–hydroxybutyrate
Chapter 2 Literature review
46
2.7.2. The production of polyhydroxyalkanoates
Previous studies have shown that several bacteria can accumulate high levels of PHA per dry
cell weight (Kim et al., 1994, Wang and Lee, 1997). They can be divided into two groups, of
which the first includes Ralstonia eutropha, Protomonas extorquens, and Pseudomonas
oleovorans. These bacteria require limitations of essential nutrients (such as nitrogen,
magnesium, phosphorous or sulphur) while those of the second group, i.e., Alcaligenes latus
and Azotobacter vinelandii, require no such nutrient limitations (Lee, 1996b). Nonetheless,
the PHA content can be increased if a nutrient limitation is applied (Wang and Lee, 1997).
The production of PHAs can be performed from a wide variety of renewable resources,
including pure sugars (glucose, xylose, sucrose) (Quillaguamán et al., 2006, Quillaguamán et
al., 2007), biomacro-molecules (starch, cellulose) (Keenan et al., 2006, Halami, 2008), and
by-products (molasses, whey, wheat bran, corn steep liquor) (Ahn et al., 2000, Vijayendra et
al., 2007), as well as fossil resources (methane, mineral oil, lignite, hard coal) (Reddy et al.,
2003, Mothes et al., 2008), chemicals (acetate, propionic acid, butyric acid) (Shi et al., 1997)
and carbon dioxide (Ishizaki et al., 2001). The metabolic pathway of PHA synthesis in
bacteria from different carbon sources is summarized in Figure 2.17. The carbon source is
first transferred from the extracellular environment into the cells by a specific transport
system or diffusion. The carbon source is then converted into an (R)-hydroxyacyl-CoA
thioester (a substrate of the PHA synthase) by anabolic or catabolic reactions or both.
Finally, PHA synthases, which are the key enzyme of PHA synthesis, use (R)-hydroxyacyl-CoA
thioesters as the substrate and catalyzes the formation of PHA inclusions with a concomitant
release of coenzyme A (Steinbüchel and Valentin, 1995).
Chapter 2 Literature review
47
Figure 2. 17: A schematic representation of the biosynthesis of PHA in bacteria (adapted from Steinbüchel and Valentin (1995))
Metabolic pathways and possible options for production of (R)-3-HB are described in Figure
2.18. For the production of (R)-3-HB, pathways leading to PHB production and degradation
have to be exploited. Recently, a metabolic pathway for the production of PHB and in vivo
hydrolysis to release (R)-3-HB in the culture supernatant was investigated (Shiraki et al.,
2006). Culture conditions would affect the metabolic shift of the PHB pathway; thereby
enhancing the extracellular production of (R)-3-HB in the culture supernatant. Furthermore,
it may be possible to introduce PHB knock-out in the PHB metabolic pathway of R. eutropha.
This process would involve the conversion of acetoacetyl-CoA to acetoacetate (in the
presence of acetoacetyl-CoA synthetase), which finally could be converted to (R)-3-HB.
Chapter 2 Literature review
48
Figure 2. 18: Metabolic pathway for microbial production of (R)-3-hydroxybutyric acid (Tokiwa and Ugwu, 2007).
2.7.3. PHB production in Ralstonia eutropha
Ralstonia eutropha (formerly named Alcaligen eutrophus) has been studied most extensively
due to its ability to accumulate a large amount of PHB from pure carbon sources, for
example, glucose, fructose and acetic acid. Imperial Chemical Industries (ICI, UK) has been
producing PHB on a large scale from glucose, and poly3-hydroxybutyrate-co-3-
hydroxyvalerate (P(3HB-co-3HV)) from a mixture of glucose and propionic acid by the fed-
batch culture of R. eutropha. Initially, the cells are grown in a glucose-salts medium
containing calculated amounts of phosphate to support the desired amount of cell growth.
Cells encounter phosphate limitation after about 60 h and accumulate PHB during the next
40–60 h from supplied glucose. By controlling the glucose concentration at 10–20 g l-1 during
fed-batch culture the final cell mass, PHB concentration and PHB content of 164, 121 g l-1,
and 76%, respectively, is obtained for 50 h, resulting in a high productivity of 2.42 g (l-1 h-1)
(Kim and Chang, 1995). Several carbon sources other than glucose have also been used as
the substrate for PHB production by Ralstonia eutropha (Table 2.6).
Chapter 2 Literature review
49
Table 2. 6: The evaluation of various PHB production systems reported for wild-type PHB
producing strains (Tokiwa and Ugwu, 2007).
Strain Carbon
substrate
PHB
analysis
Cultur
e time
(h)
Culture
mode
PHB
con.
(gl-1 )
PHB prod.
(gl-1h-1 )
PHB
conte
nt (%)
Reference
A. latus (DSM 1123) Sucrose GC 20 Feb-batch 98.7 4.94 88 Wang and Lee
(1997)
A. eutrophus
(NCIMB 11599)
Glucose GC 50 Feb-batch 121 2.42 76 Kim et al. (1994)
R.eutropha H16 Soybean
oil
GC 96 Feb-batch 95.8 1.00 76 Kahar et al.
(2004)
Azotobacter
chrococcum
Starch GC - Continuous 30.1 0.87 75 Du et al. (2001)
A. latus (DSM 1123) Sucrose GV 93 Feb-batch 4.9 0.05 63 Grothe et al.
(1999)
R. eutropha WSH3 Tapioca GC 59 Feb-batch 61.5 1.04 58 Kim and Chang
(1995)
A. latus (DSM 1123) Sucrose GC 18 Feb-batch 71.4 3.97 50 Yamane et al.
(1996)
CDW=cell dry weight; conc.= concentration; GC= gas chromatography; GV= gravimetric; prod.= productivity.
2.7.4. Mechanism of antibacterial activity of poly-β-hydroxybutyrate
Poly-β hydroxybutyrate (PHB) is a short chain fatty acid polymer of biological origin, which is
insoluble in water. PHB is degraded into water-soluble monomers or oligomers by the action
of PHB depolymerase enzymes secreted in the gastrointestinal passage of many aquatic
animals (Liu et al., 2010). PHB is produced by a wide variety of microorganisms as an
intracellular energy and carbon storage compound (Anderson and Dawes, 1990, Madison
and Huisman, 1999). PHB is deposited intracellularly in the form of inclusion bodies in the
fluid, amorphous state (Amor et al., 1991). After death and cell lysis, the polymer is released
Chapter 2 Literature review
50
in a partially crystalline state (Doi et al., 1995). The ability to degrade extracellular PHB
depends on the secretion of extracellular PHB depolymerase enzymes and is widely
distributed in bacteria and fungi (Jendrossek, 1998, Jendrossek and Handrick, 2002). The
extracellular PHB depolymerase of Comamonas testosterone is well characterized; the
enzymes were found to hydrolyse PHB into β-hydroxybutyrate monomers (Mukai et al.,
1993, Kasuya et al., 1994).
PHB has been shown to effectively exhibit some antimicrobial, insecticidal and antiviral
activities (Tokiwa and Ugwu, 2007). Philip et al. (2007) mentions for example the commercial
product Nodax which is a copolymer containing mainly 3(HB) and small quantities of MCL
monomers. It can degrade anaerobically and hence can be applied as a coating for urea
fertilizers. It is used in rice fields as herbicide and insecticide. As such, it may also be applied
as a means to control infectious disease in aquaculture systems (Defoirdt et al., 2009). The
antimicrobial activity of β-hydroxybutyrate acid is thought to be comparable to that of other
short-chain fatty acids (SCFAs) (Defoirdt et al., 2007b). The main bacteriostatic and/or
bactericidal mechanism of SCFAs (and organic in general) is believed to be caused by the
undissociated form of the acid (Ricke, 2003). In the undissociated form, the short-chain fatty
acids can pass the cell membrane of bacteria and dissociate in the more alkaline cytoplasm,
thereby increasing the intracellular concentration of protons (Kashket, 1987, Cherrington et
al., 1991). Consequently, the cells have to spend energy in order to maintain the intracellular
pH at the optimal level. This energy cannot be used for other metabolic processes and
therefore, the growth of the cells is inhibited (Defoirdt et al., 2007b).
In fact, it has been suggested that short-chain fatty acids (SCFAs) could be useful as
biocontrol agents to control bacterial diseases in animal production and more specifically
aquaculture (Defoirdt et al., 2009). Several studies have demonstrated that SCFAs inhibit the
growth of enterobacteria like Salmonella Typhimurium, and Shigella flexneri (Cherrington et
al., 1991). In another report, the well-known bacterial storage compound PHB, a polymer of
the SCFA ß-hydroxybutyrate, was also shown to protect Artemia larvae from the virulent V.
campbellii strain. The degraded product can exert its beneficial effects like other SCFA do
(Defoirdt et al., 2007b). In several experiments with A. fransiscana, this approach increased
Chapter 2 Literature review
51
the survival of the animals by up to 73% following a challenge with the pathogen V.
campbellii (Halet et al., 2007, Defoirdt et al., 2007b).
2.7.5. The immunostimulants properties of the Poly-β-hydroxybutyrate monomer
In addition to its antimicrobial function, SCFA butyrate also induces heat shock protein (Hsp)
25 in rat intestinal epithelial cells and protects the latter against oxidant injury (Ren et al.,
2001). HSPs are a group of highly conserved proteins of which expression is constitutive or
inducible under different conditions. Hsps, particularly Hsp70, have strong cytoprotective
effects and behave as molecular chaperones for maintaining proper protein folding,
disaggregating, and refolding misfolded protein as well as targeting damaged proteins for
degradation (Hishiya and Takayama, 2008, Tutar and Tutar, 2010). Besides these, Hsp70 also
generates protective immunity against many diseases as demonstrated in a wide variety of
animal models (Johnson and Fleshner, 2006). Baruah et al. (2015) suggested that PHB
conferred protection to Artemia host against V. campbellii by a mechanism of inducing heat
shock protein (Hsp) 70. Additionally, further findings also showed that this salutary effect of
PHB was associated with the generation of protective innate immune responses, especially
the pro-phenoloxidase and transglutaminase immune systems – phenomena possibly
mediated by PHB-induced Hsp70. From overall results, it can be concluded that PHB induces
Hsp70 production which might contribute in part to the protection of Artemia against
pathogenic V. campbellii (Baruah et al., 2015).
Yik Sung et al. (2007) and Baruah et al. (2013) demonstrated a correction between the
amount of induced Hsp70 and the degree of protective immune responses against diseases
in animals. Baruah et al. (2015) determined that PHB not only regulates the expression of
innate immune related genes in Artemia but also increases the activity of phenoloxidase in
Artemia treated with PHB and simultaneously challenged with V. campbellii. Further, Suguna
et al. (2014) recently reported the immunostimulatory efficacy of poly-β hydroxybutyrate–
hydroxyvalerate (PHB–HV) extracted from Bacillus thuringiensis B.t.A102 in another
aquaculture species, the tilapia Oreochromis mossambicu. These results revealed that all the
doses of PHB–HV supplementation in feed were effective in stimulating nonspecific immune
mechanisms.
Chapter 2 Literature review
52
As a conclusion from the research mentioned above, it can be stated that SCFAs and β-
hydroxybutyrate acid showed good potential as antimicrobial and immunostimulant
compounds to fight infections in aquaculture. However, the mode of action of PHB in
aquaculture species needs to be further studied e.g. in relation to its capacity to regulate the
immune response.
2.7.6. The use of poly-β-hydroxybutyrate in aquaculture
Bacterial disease outbreaks are considered a significant constraint to the development of the
aquaculture sector, as well terrestrial animal production. The ban on the use of antibiotics to
control diseases in these production sectors has challenged researchers throughout the
world to look for alternative biocontrol strategies (Nicolas et al., 2007, Sapkota et al., 2008).
As PHB has been shown to effectively exhibit some antimicrobial, insecticidal and antiviral
activities (Tokiwa and Ugwu, 2007) it is increasingly being tested as an antimicrobial
compound to control bacterial infection in aquaculture research, especially in larval rearing.
Recently, a high number of trials with PHB aquatic animals have been done, demonstrating
positive effects on survival, growth rate and disease resistance. It also seems to act as an
antimicrobial agent and specially enhances “positive” shifts in the microbial community
composition in the digestive tract of aquaculture animals.
Defoirdt et al. (2007b) started to investigate whether poly-β-hydroxybutyrate (PHB) could be
used as an elegant method to deliver SCFAs to the brine shrimp gut. The addition of 1000 mg
L-1 commercial PHB particles (average diameter 30 μm) to the culture water offered a
complete protection (no significant mortality when compared with uninfected nauplii) from
the pathogenic V campbellii (Defoirdt et al., 2007b). In a follow-up study, it was shown that
the addition of 107 CFU ml-1 of PHB-containing Brachymonas bacteria (corresponding to
∼10 mg L-1 PHB) also completely protected the shrimp from the Vibrios (Halet et al., 2007).
Based on these results it was hypothesized that the PHB polymer is (at least partially)
degraded to β-hydroxybutyrate in the Artemia gut and that the release of this SCFA protects
the shrimp from the pathogen (Defoirdt et al., 2007a). Recently, a number of studies have
found a positive effect of PHB treatment on the survival of either the larval or juvenile stage
of a number of aquaculture species. For example, Nhan et al. (2010) reported the increased
Chapter 2 Literature review
53
survival and growth in the larvae of the giant fresh water prawn, following PHB enrichment
at 5 g L-1 in combination with/or highly unsaturated fatty acids (HUFA). Similar beneficial
effects have been reported in another study (Ludevese-Pascual personal communication,
Ugent) in which survival rates of tiger shrimp Penaeus monodon postlarvae increased via
PHB incorporated in Artemia nauplii. Laranja et al. (2014) reported that PHB is accumulated
in Bacillus spp, improving the survival, growth and robustness of Penaeus monodon
(Fabricius, 1798) postlarvae. In other crustacean aquaculture species, enhanced growth,
survival and protection from Vibrio anguillarum was found in the zoea larvae of the Chinese
mitten crab (Eriocheir sinensis) (Sui et al., 2012). Beneficial effects of PHB have also been
reported in fish culture systems. For example, (Situmorang et al., 2016) reported that PHB
also acted as a protecting agent for Nile tilapia larvae, resulting in a 20% increase in larval
survival following a gnotobiotic challenge test with the pathogen Edwardsiella ictaluri
gly09R.
Further investigations are required to verify the effect of PHB in the different animal species,
with focus on using PHB supplementations in fish diets. De Schryver et al. (2010) replaced
the sea bass (Dicentrachus labrax) diet partially with 2%, 5%, and 10% of the dry feed weight
with PHB. They documented that PHB could serve as an energy source in sea bass juveniles
(as in a diet with 100% PHB, survival was considerably higher than with starved animals) and
significantly increased growth rate and decreased FCR when present at 2% and 5% in the
diets. In addition, a reduction of the gut pH from 7.7 to 7.2 was observed, suggesting that
PHB can be degraded in the intestine, leading to an increased production of short-chain fatty
acids. Based on molecular analysis, higher dietary PHB levels induced larger changes in the
bacteria community composition and the highest bacteria range-weighted richness in the
fish intestine was observed in PHB treatments.
In the later experiment, Najdegerami et al. (2012) confirmed the positive effect of PHB on
growth performance of Siberian sturgeon (Acipenser baerii) fingerlings and microbial
community in its gastrointestinal tract. The results indicated that a 2% replacement in the
diet with PHB improved weight gain, specific growth rate (SGR) and survival in the sturgeon
fingerlings during the 10-week experimental period. Juveniles fed with 2% PHB enriched diet
Chapter 2 Literature review
54
exhibited the highest intestinal microbial species richness. The development of bacteria
belonging to the genera Bacillus and Ruminococcaceae was promoted.
Based on current results, the use of PHB looks promising for aquaculture, especially in
improving growth and survival in larval culture systems. However, in terms of effectiveness,
the use of bacteria cells that contain PHB-A (amorphous PHB particles) can be considered as
an effective alternative for PHB-C (crystalline) particles (Halet et al., 2007). It is reported that
the extraction of PHB from the cells amount to about 30% of the total production cost of the
pure/ crystalline PHB-C (Mudliar et al., 2008). Consequently, the absence for the need of
PHB extraction in the application of amorphous PHB will considerably decrease the
application costs of PHB. It was estimated that the price of PHB contained within bacterial
cells will be about 40% lower than that of pure extracted crystalline PHB (De Schryver et al.,
2010). Overall, more research is needed on PHB degradation, metabolism and immune
response, in different aquaculture species in order to effectively and efficiently apply PHB as
immunostimulants/additives in aquaculture production.
55
Application of poly-β-hydroxybutyrate (PHB) in
mussel larviculture
Nguyen Van Hung1,2, Peter De Schryver1, Tran Thanh Tam1, Linsey Garcia-Gonzalez3, Peter Bossier1 and Nancy Nevejan1
1Laboratory of Aquaculture & Artemia Reference Center, Ghent University, Rozier 44, B-9000 Gent, Belgium
2 Research Institute for Aquaculture no.3, 33 Dangtat, Nhatrang, Vietnam
3 Flemish Institute for Technological Research (VITO), Boeretang 200, 2400 Mol, Belgium
Published in Journal of Aquaculture (2015) 446, 318 - 324
CHAPTER 3: APPLICATION OF POLY-Β-HYDROXYBUTYRATE (PHB) IN MUSSEL LARVICULTURE
56
Chapter 3 Application of PHB in mussel larviculture
57
Abstract
In this study, the effect of poly-β-hydroxybutyrate (PHB) delivery on the performance
(survival, growth and metamorphosis) of blue mussel (Mytilus edulis) larvae was studied for
the first time. Upon addition of PHB in either crystalline (i.e. extracted from the bacterial
cell) or amorphous (i.e. still contained in the bacterial cell) form to a standard algal diet at
concentrations of 0.1 mg L-1, 1.0 mg L-1 and 10.0 mg L-1, no significant improvement in
growth performance or metamorphosis was observed. However, a concentration of 1.0 mg
L-1 amorphous PHB almost doubled the survival of the larvae in three independent
experiments. A total of 22 PHB-degrading bacterial strains could be isolated from the PHB
treated mussel larvae of which 16 could be characterized to belong to the genus
Pseudoalteromonas. The application of these in combination with PHB however, did not
further increase the culture performance of the mussel larvae. Where previous studies
suggested that the PHB effect could be related to a change in the intestinal microbial
community of the treated animals, molecular fingerprinting analysis of the mussel larvae
associated microbiota did not show a relationship between changes in the microbiota
composition and the improved survival following PHB treatment. Overall, this study showed
for the first time that PHB can be applied in blue mussel larviculture to increase the survival
of the cultured animals.
Keywords: Mussel larvae, crystalline PHB, amorphous PHB, PHB-degrading bacteria, Mytilus
edulis
58
Chapter 3 Application of PHB in mussel larviculture
59
3. 1. Introduction
Mass mortalities of bivalve larvae caused by bacterial infections are reported regularly
(Nicolas et al., 1996, Romalde et al., 2013). For example, mass mortality of early stage oyster
larvae has been attributed to Vibrio tubiashii infections in 2006 and 2007, resulting in 59%
loss in hatchery production (Elston et al., 2008). To eliminate pathogenic bacteria, many
bivalve hatcheries use different water treatments such as filtration, pasteurization,
ozonation and UV radiation (Verschuere et al., 2000). The use of chemotherapeutic agents is
widespread in mollusk hatcheries, although showing inconsistent results (Prado et al., 2010).
In addition, many hatcheries use antibiotics to culture the larval phases (Nicolas et al., 1996,
Sugumar, 1998, Uriarte et al., 2001, Cabello, 2006). However, due to rising concerns about
public health and environmental safety issues, the use of antibiotics are being discouraged
worldwide (Schneider, 2003). Attempts have been made to enhance the culture of larval
bivalves by controlling the microbiota in the culture water to mitigate the effects of
pathogens in bivalve hatcheries. Of these methods, prebiotics and probiotics have gained a
lot of interest recently (Gibson et al., 1998, Ruiz-Ponte et al., 1999, Riquelme et al., 2000,
Kesarcodi-Watson et al., 2008, Kesarcodi-Watson et al., 2010, Prado et al., 2010). For
example, the addition of the probiotic Alteromonas sp. (CA2 strain) resulted in an enhanced
survival and growth rate of Pacific oyster larvae (Douillet and Langdon, 1993) while Riquelme
and colleagues (Riquelme et al., 1997, Riquelme et al., 2000, Riquelme et al., 2001) used
three strains of probiotic bacteria - Vibrio sp. C33, Pseudomonas sp. 11 and Bacillus sp. B2 –
to enhance the survival of scallop (Argopecten purpuratus) larvae. As illustrated by these
examples, the search for novel sustainable alternatives for maintaining healthy bivalve
larvae has become increasingly important.
The bacterial storage compound poly-β-hydroxybutyrate (PHB) has been applied as a
prebiotic and proved to act beneficially for a variety of aquatic animals (De Schryver et al.,
2010). PHB is a natural polymer that is accumulated by a wide variety of microorganisms
that produce this polymer of the fatty acid β-hydroxybutyrate as an intracellular energy and
carbon storage compound (Anderson and Dawes, 1990). Within a bacterial cell, PHB is
present in a non-crystalline amorphous state whereas upon lysis of the cell the PHB becomes
(partially) crystalline (Jendrossek and Handrick, 2002). The use of PHB for aquaculture
Chapter 3 Application of PHB in mussel larviculture
60
purposes was introduced in 2007 when Defoirdt et al. (2007b) and Halet et al. (2007)
described the effectiveness of the compound to protect Artemia franciscana larvae against
Vibrio infection. It was suggested that this was due to the gastrointestinal production of the
monomer β-hydroxybutyrate (β-HB) that had an anti-pathogenic activity. Since then, the
application of PHB has been successfully tested on a variety of aquaculture species: PHB
significantly increased the growth rate of larvae of giant freshwater prawn (Macrobrachium
rosenbergii) when supplied through live food (Nhan et al., 2010) and of juvenile European
seabass (Dicentrarchus labrax) when included in the diet at 2 and 5% (w/w) (De Schryver et
al., 2010). Survival and growth rate of Siberian sturgeon (Acipenser baerii) fingerlings was
improved when included in the diet at 2% (w/w) (Najdegerami et al., 2012). It also protected
zoea larvae of the Chinese mitten crab (Eriocheir sinensis) against V. anguillarum (Sui et al.,
2012) and larvae of giant freshwater prawn against V. harveyi BB120 infection (Thai et al.,
2014).
The ability to produce extracellular PHB depolymerase enzymes is widely distributed among
bacteria and fungi (Jendrossek and Handrick, 2002). Liu et al. (2010) isolated PHB-degrading
bacteria from the gastrointestinal tract of juvenile European sea bass, juvenile Siberian
sturgeon and giant freshwater prawn larvae. They evaluated their efficiency to increase the
beneficial effect of PHB in a synergetic approach and the results provided perspectives to
improve the gastrointestinal health of aquatic animals.
In this study, the impact of PHB on the culture performance of blue mussel larvae was
investigated for the first time. PHB was supplied in crystalline and amorphous form at
different concentrations to the culture water of blue mussel larvae (Mytilus edulis) and the
survival, growth and metamorphosis success of the larvae was assessed. PHB-degrading
bacteria associated with the larvae were isolated and supplemented, and changes in the
intestinal microbial community composition of the larvae were investigated. The table below
gives an overview of the experiments. Experiment 1 lasted for 18 days (22 March – 9 April,
2013); experiment 2 lasted for 14 days (8 May – 22 May, 2013) and experiment 3 for 18 day
(22 June – 10 July, 2013).
Chapter 3 Application of PHB in mussel larviculture
61
Table 3. 1 Overview of the experiments
Experiment (Exp.)
Treatment
Periods of experiment Evaluation
Larvae spat
Exp. 1
(n=3)
Effect of different
PHB form
Control
PHB-C 0.1 mg L-1
PHB-C 1.0 mg L-1
PHB-A 0.1 mg L-1
PHB-A 1.0 mg L-1
18 day
Sample for
MC analysis
15 day
- Larvae performance
- Spat performance
- Microbial community
(MC)
Exp. 2
(n=5)
Optimization of
PHB-A
concentration in
larvae culture
Control
PHB-A 1.0 mg L-1
PHB-A 10.0 mg L-1 14 day
Sample for
MC analysis
15 day
- Larvae performance
- Spat performance
- MC
Exp.3
(n=4)
Impact of PHB
degrader bacteria
in larvae culture
Control
PHB-A 1.0 mg L-1
PHB-A 1.0 mg L-1
+
PHB degrader
PHB degrader
18 day 15 day
- Larvae performance
- Spat performance
3. 2. Materials and methods
3. 2.1. Crystalline PHB and amorphous PHB
Two forms of PHB were used in this study. Crystalline PHB particles (PHB-C) were obtained
from Goodfellow (Huntingdon, England) and amorphous PHB (PHB-A) consisting of a freeze-
dried Ralstonia eutropha culture containing 75% cell dry weight of PHB was obtained from
VITO (Mol, Belgium). Both of them were ground and sieved through a 30 µm mesh before
addition into the culture water to make sure that the particles could be filtered out of the
water by the larvae.
3. 2. 2. Detection of ingested PHB by fluorescence microscopy
Before performing the experiments, fluorescence microscopy was used to verify the ability
of mussel larvae to ingest PHB. For that purpose crystalline PHB was stained with Nile blue.
500 µl Nile blue A (NBA) was added to 500 mg sonicated PHB in 30 ml of deionized water for
Chapter 3 Application of PHB in mussel larviculture
62
20 minutes. It was consequently centrifuged at 5000 rpm for 10 minutes. The solution was
resuspended to wash 3 times with deionized water. Four day post-hatching D-larvae were
starved for 24 h to eliminate all algae present in the intestines. Then, the larvae were
supplied with 30 µm sieved and Nile Blue A stained PHB (Ostle and Holt, 1982) at a
concentration of 1 g L-1 in 0.2 µm filtered natural seawater (FNSW). After two hours, the
larvae were collected on a 60 µm sieve, rinsed with seawater to remove all PHB particles
from the outer surface of the larvae and examined under a fluorescence microscope
(Axioskop II, Zeiss, Jena, Germany) operating at 488 nm wavelength and using a total
magnification of 630 X. The microscope was equipped with a Peltier-cooled single-chip
digital camera (Orca Illm; Hamamatsu, Massay, France) connected to a PC. Larvae that were
not supplied PHB served as control.
3. 2. 3. Experimental design
3. 2.3.1. Mussel larvae source and experimental conditions
Broodstock animals were supplied by the commercial mussel producer Roem van Yerseke in
The Netherlands. Upon arrival in the laboratory, they were rinsed with FNSW. Spawning was
induced by thermal shocks, by emerging the animals alternately in water baths of 15°C and
25 °C every 15 minutes. Individual matured males and females were identified at the time of
gamete release and isolated into individual beakers. Eggs and sperm of individual females
and males, respectively, were pooled before fertilization was carried out. Fertilized eggs
were regularly stirred with a plunger during 30 min before being rinsed with FNSW and put
in a 20 L incubator rectangular tank. Two days after fertilization, hatched D-larvae were
concentrated on a sieve (60 µm), rinsed with FNSW and counted before stocking in 8L Züger
bottles (Urbányi et al., 2008). The larvae from all treatments were fed every 2 days with an
algae diet consisting of Isochrysis galbana and Chaetoceros calcitrans (1:1, based on cell
numbers) for the first 4 days. From day 4 onwards Tetraselmis suecica was added as well
(1:1:1, based on cell numbers). The total concentrations gradually increased from 3 x 104 CFU
mL-1 at the start of the experiment to 1 x 105 CFU mL-1 at the end of the experiment in steps
of 1 x 104 CFU mL-1 per 2 days.
Chapter 3 Application of PHB in mussel larviculture
63
Water was changed completely every two days. At that occasion, feed was administered and
samples were taken for larval survival and height measurements. During the experiments,
gentle bottom aeration was provided to supply oxygen and enhance larvae suspension. The
water temperature of the larvae culture was on average 17 ± 0.5 °C during experiment 1 and
3 and 19 ± 0.5 °C during experiment 2.
Three different experiments were performed:
- In experiment 1, the effects of PHB-C and PHB-A were compared. The larvae were stocked
in the Züger bottles at a density of 5 larvae mL-1. The following 5 treatments were conducted
in triplicate for 18 days: (1) Control, consisting of the algae diet only, (2) PHB-C 0.1,
consisting of adding crystalline PHB at 0.1 mg L-1 to the algae diet, (3) PHB-C 1.0, consisting of
adding crystalline PHB at 1.0 mg L-1 to the algae diet, (4) PHB-A 0.1, consisting of adding
amorphous PHB at 0.1 mg L-1 to the algae diet, and (5) PHB-A 1.0, consisting of adding
amorphous PHB at 1.0 mg L-1 to the algae diet. The parameters as described under 3.2.3.2
were assessed on Day 14 and on Day 18 post-hatching. At the end of experiment 1, PHB-
degrading bacteria were isolated from the mussel larvae (see 3.2.4).
- In experiment 2, the optimal concentration of PHB-A for the mussel larvae was determined
as PHB-A showed better effects than PHB-C in experiment 1. The larvae were stocked at a
density of 10 larvae mL-1 in the Züger bottles and the following 3 treatments were conducted
in quintuplicate for 14 days: (1) Control, consisting of the algae diet only, (2) PHB-A 1.0,
consisting of adding amorphous PHB at 1.0 mg L-1 to the algae diet and (3) PHB-A 10 mg L-1,
consisting of adding amorphous PHB at 10 mg L-1 to the algae diet. The parameters as
described under 3. 2.3.2 were assessed on Day 10 and on Day 14 post-hatching.
- In experiment 3, the optimal dose of PHB-A from experiment 2 was combined with the
strongest bacterial PHB degrader (isolate ARC4B5 obtained from experiment 1, see 3.2.4) to
examine whether the effects of amorphous PHB could be further enhanced. Larvae were
stocked at a density of 10 larvae mL-1 in the Züger bottles and the following 4 treatments
were conducted in quadruplicate for 18 days: (1) Control, consisting of the algae diet only,
(2) PHB-A 1.0, consisting of adding amorphous PHB at 1.0 mg L-1 to the algae diet, (3) PHB-A
1.0 + PHB degrader, consisting of adding amorphous PHB at 1.0 mg L-1 and 106 colony
forming units (CFU) mL-1 of ARC4B5 to the algae diet and (4) PHB-degrader, consisting of
Chapter 3 Application of PHB in mussel larviculture
64
adding 106 CFU mL-1 of ARC4B5 to the algae diet. The parameters as described under 3.2.3.2
were assessed on Day 14 and on Day 18 post-hatching.
3. 2.3.2. Larval survival, height measurement, and settlement
The survival and growth of the larvae in experiments were determined as follows. For
sampling, all larvae were collected on a 60 to 90 µm sieve depending on the average larval
size, and concentrated in 1.5 L of FNSW. A plunger was used to distribute larvae
homogenously in the beaker before taking a subsample of 2 mL in four replicates. Dead and
living larvae were distinguished under a light microscope (Euromex, Holland) using Lugol’s
solution (Sullivan and Gifford, 2009). Deterioration of organ structure and empty shells
denoted moribund or dead individuals. The growth was determined by measuring the shell
height of fifty larvae that were randomly sampled from a 2 mL subsample. The shell height,
being the largest distance from the ventral side to the straight-hinge, was measured using
the automated image analysis software Clemex Vision PE version 3.6.002 based on images
obtained with a light microscope at a magnification of 400x, equipped with a MicroPublisher
3.3 camera (QImaging, China) directly connected to the computer with the software.
At the end of each experiment, all larvae from each Züger bottle were harvested on a 150
µm sieve. After re-suspension, 1000 larvae from each replicate were stocked in a
downweller, consisting of a PVC cylinder (Ø 12cm, H 14cm) provided with a bottom sieve of
150 µm. The downwellers were placed in a rectangular tank (water bath) containing 60 L of
FNSW of 17 ± 0.5 °C, making sure that each tank contained 1 replicate of each treatment.
The larvae were fed a combination of the three microalgae species that were administered
during the larval stage at a concentration of 1 x 105 CFU mL-1 without any addition of PHB
particle or amorphous PHB. The water was changed completely every 2 days and after 15
days, settlers (young spat) were counted and the shell height of fifty settlers from each
replicate was measured.
3. 2.4. Isolation, culture and identification of PHB-degrading strains
At the end of experiment 1, larvae from each PHB treatment were collected to isolate PHB-
degrading bacteria from the intestinal tract. About ten thousand larvae from each replicate
were collected on a sterile 100 µm sieve and rinsed twice with 0.2 µm filtered autoclaved
Chapter 3 Application of PHB in mussel larviculture
65
artificial sea water (FAASW) (35 g L-1 Instant Ocean®, Aquarium Systems Inc., Sarrebourg,
France). The larvae were transferred to a sterile plastic bag containing 2 ml of FAASW and
homogenized with a stomacher blender (400SN, Seward Medical, London, UK) for 5 min. A
70 µL aliquot of the homogenate was added either to 10 mL marine broth (MB - DifcoTM
Marine Broth 2216) to boost bacterial growth prior to PHB degrader selection or to 10 mL
PHB minimal medium (FAASW containing 0.2 g L-1 NH4Cl and 1.0 g L-1 crystalline PHB
particles, average diameter 30 µm) to directly select for PHB degraders. The cultures were
incubated at 28°C on an orbital shaker (130 rpm) for 1 and 3 days, respectively. Both cultures
were sub-cultured twice by transferring 1 ml of culture medium into 100 mL fresh PHB
minimal medium (which was incubated at 28°C on an orbital shaker (130 rpm) for 3 days)
before being plated on marine agar where single colonies could be picked. Morphologically
different colonies were incubated in PHB minimal medium for 72h and subsequently purified
by streak plating on marine agar resulting in 22 isolates. Extracellular PHB depolymerase
production was assessed qualitatively by spotting the isolates on PHB agar (being PHB
minimal medium supplemented with 15 g L-1 agar) or PHB agar supplemented with 10% LB
medium as the carbon sources (Defoirdt et al., 2007b, Liu et al., 2010). The plates were
incubated at 28°C and examined daily for the presence of clearing zones around the
colonies. PHB-degrading bacteria were stored in 20% glycerol at -80 °C until further use.
A 1465 base pair fragment of the 16S rRNA gene of the 22 isolated PHB-degrading strains
was amplified using the universal primers 27F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 1492R
(5’-CGGTTACCTTGTTACGACTT-3’) (Jiang et al., 2006). PCR was performed using a GeneAmps
PCR system 2700 thermal cycler using the following program: 95°C for 5 minutes, 30 cycles
of 95°C for 1 minute, 50°C for 1 minute, 72°C for 2 minutes and finally an extension period of
72 °C for 10 minutes. The resulting PCR product was purified using a Wizard® SV Gel and PCR
Clean-Up System (Promega, The Netherlands) and sequenced at the Center for Medical
Genetics (Ghent University Hospital, Belgium) using the PCR primers. The nucleotide
sequences were analyzed using the VECTOR NTI ADVANCE program, version 11.5 and
homology searches were completed with the BLAST server of the National Centre for
Biotechnology Information using the BLAST algorithm (Altschul et al., 1997) for comparison
of the nucleotide query sequence against a nucleotide sequence database (BLASTN).
Chapter 3 Application of PHB in mussel larviculture
66
3. 2.5. Molecular fingerprinting of larval associated bacterial community
3. 2.5.1. DNA extraction and PCR amplification
From each replicate, about five thousand mussel larvae were collected on a 100 μm sieve at
the end of the experiments 1 and 2 and rinsed three times with FAASW. The larvae were
transferred to a sterile 2 ml tube and stored at -20°C until further processing. The extraction
of DNA from the samples was carried out with a DNeasy Blood and Tissue Kit (Qiagen, The
Netherlands) according to the manufacturer’s instruction. PCR amplification targeting the V3
region of the 16S rRNA gene was conducted as described by Boon et al. (2002) using
bacterial primer 338f (5′-ACTCCTACGGGAGGCAGCAG-3′) with a 40-base GC clamp attached
to its 5′ end and universal primer 518r (5′-ATTACCGCGGCTGCTGG-3′).
3. 2.5.2. Denaturing gradient gel electrophoresis (DGGE)
A Bio-Rad D Gene system (Bio-Rad, Hercules, CA, USA) was used to perform DGGE analysis
(Boon et al., 2002). The denaturing gradient of the gel ranged between 45% and 60%.
Electrophoresis was performed with a constant voltage of 38 V at 60°C for 16 h. Bands were
visualized using a UV transilluminator after staining the gel for 20 minutes in a 1% gel-red
solution.
3. 2.5.3. Processing DGGE images and statistical analysis
The DGGE patterns were processed with BIONUMERICS software version 5.0 (Applied Maths,
Sint-Martens-Latem, Belgium) and analyzed as described by Bakke et al. (2013). A 1% band
position tolerance limit was maintained for considering bands as being identical. As DGGE
analysis of the DNA of the algae used as feed also resulted in bands, the peak areas in each
sample pattern located at the position of the algal bands were deleted prior to analysis of
the gels.
3. 2.6. Statistics
The survival data of larvae and spat were arcsine transformed to satisfy the homogeneity of
variance requirement. The survival, height and the settlement success of the mussel larvae
in the different treatments were compared by one-way ANOVA analysis using SPSS (version
Chapter 3 Application of PHB in mussel larviculture
67
16.0). A Duncan post-hoc test was used for identification of significant differences between
the means (p ≤ 0.05). For analysis of the DGGE patterns from experiment 1 and 2, a matrix of
Bray – Curtis similarities (Bray and Curtis, 1957) between the samples from each experiment
(all loaded on a single DGGE gel) was constructed using the software Primer6 (Bakke et al.,
2013). A non-metric multidimensional scaling (NMS) plot was constructed using the software
SPSS (version 20.0). To identify significant differences between the microbial communities in
the different treatment, an ANOSIM analysis of the Bray-Curtis similarity values was
performed (Clarke, 1993) using Primer6. The ranked similarity R was determined by
performing 999 permutations.
3. 3. Results
3. 3.1. PHB ingestion by mussel larvae
Epifluorescence images of larvae showed that larvae fed with Nile Blue A stained PHB-
particles were brightly fluorescent in the stomach area (Figure 1). Fluorescence was already
visible 1 hour after supplementation of PHB but maximum intensity was reached after 2
hours. Fluorescence of the stained PHB lasted for 5 hours.
Figure 3. 1: Light (A and B) and epifluorescence microscopy (C and D) images of starved larvae (A and C) and larvae fed with Nile Blue A stained PHB for 2 hours (B and D)
Chapter 3 Application of PHB in mussel larviculture
68
3. 3.2. Larval survival and growth
In experiment 1, the larvae fed the PHB-A 1.0 mg L-1 diet survived significantly better than
the larvae from the control treatment at day 14 and day 18 (Table 3. 2). The larvae from the
PHB-C 0.1, PHB-C 1.0 and the PHB-A 0.1 treatment tended to survive better than the larvae
from the control treatment, but the differences were not significant anymore on day 18. At
the onset of the experiment, the larvae had an average shell height of 70 µm. At 14 days and
18 days post hatching, the larvae supplied with PHB in either crystalline or amorphous form
were not bigger than the control larvae.
There were no significant positive effects of PHB on the settlement success of the mussel
spat (Table 3. 3). There was also no significant difference in spat size between the
treatments, although the spat of the control treatment had a tendency to be larger than the
spat from the PHB treatments.
Chapter 3 Application of PHB in mussel larviculture
69
Table 3. 2: Survival (%) and shell height (µm) of mussel larvae subjected to different PHB treatments in experiment 1 and 3 (Day 14 post-hatching and Day 18 post-hatching) and in experiment 2 (Day 10 post-hatching and Day 14 post-hatching)
Treatment Survival Shell height Survival Shell height
Experiment 1 (n = 3) Day 14 post-hatching Day 18 post-hatching
Control 33.9 ± 6.1a 157.5 ± 3.1a 25.9 ± 8.9 a 185.5 ± 1.9a
PHB-C 0.1 mg L-1 56.2 ± 5.6b 146.2 ± 0.8a 35.4 ± 6.4ab 187.3 ± 0.2a
PHB-C 1.0 mg L-1 50.4 ± 4.1ab 148.2 ± 7.0a 32.3 ± 2.2ab 183.5 ± 8.4a
PHB-A 0.1 mg L-1 56.0 ± 4.0 b 145.1 ± 2.8a 39.7 ± 7.1ab 197.4 ± 1.3a
PHB-A 1.0 mg L-1 58.3 ± 6.9b 142.6 ± 2.4a 50.2 ± 6.2b 180.8 ± 4.5a
Experiment 2 (n = 5) Day 10 post-hatching Day 14 post-hatching
Control 42.9 ± 3.0a 160.5± 2.3b 26.5 ± 1.9a 177.1 ± 1.0b
PHB-A 1.0 mg L-1 53.8 ±1.2b 159.4 ± 2.0b 40.3 ± 2.4b 177.9 ± 3.4b
PHB-A 10.0 mg L-1 39.4 ± 2.5a 99.3 ± 0.9a 23.0 ± 0.8a 113.9 ± 5.7a
Experiment 3 (n = 4) Day 14 post-hatching Day 18 post-hatching
Control 49.0 ± 2.5a 138.7 ± 1.0a 33.5 ± 3.0a 189.8 ± 4.4a
PHB-A 1.0 mg L-1 56.5 ± 5.2ab 159.8 ± 4.9b 47.7 ± 4.0b 186.8 ± 3.5a
PHB-A 1.0 mg L-1 +
PHB degrader 59.3 ± 4.5ab 122.2 ± 3.0c 31.6 ± 6.0a 149.1 ± 0.5b
PHB degrader 68.8 ± 4.8b 122.8 ± 3.0c 32.9 ±3 5.5a 141.5 ± 3.0b
Values represent means ± standard error. Data in the same column and within an experiment that are labelled with a different superscript letter are significantly different (p≤0.05)
Chapter 3 Application of PHB in mussel larviculture
70
Table 3. 3: Settlement success (%) and shell height (µm) of mussel spat subjected to different PHB treatments in experiment 1, 2 and 3
Treatment Settlement success Shell height
(µm)
Experiment 1 (n = 5)
Control 41.4 ± 10.8a 388.2 ± 5.3a
PHB-C 0.1 mg L-1 43.3 ± 2.7a 347.2 ± 18.1a
PHB-C 1.0 mg L-1 27.7 ± 4.2a 352.9 ± 15.7a
PHB-A 0.1 mg L-1 43.0 ± 9.6a 365.5 ± 3.4a
PHB-A 1.0 mg L-1 51.2 ± 5.1a 352.1 ± 13.8a
Experiment 2 (n=5)
Control 35.5 ± 2.1a 433.8 ± 11.3a
PHB-A 1.0 mg L-1 30.5 ± 4.9a 428.9 ± 9.0a
PHB-A 10.0 mg L-1 24.1 ± 3.4a 418.9 ± 14.6a
Experiment 3 (n = 4)
Control 20.4 ± 7.3ab 375.6 ± 13.2a
PHB-A 1.0 mg L-1 34.3 ± 4.0b 333.6 ± 5.2ab
PHB-A 1.0 mg L-1 + PHB degrader 15.9 ± 3.9a 314.0 ± 4.5bc
PHB degrader 13.4 ± 1.4a 279.3 ± 16.9c
Values represent means ± standard error. Data in the same column and within an
experiment that are labelled with a different superscript letter are significantly different
(p≤0.05)
Chapter 3 Application of PHB in mussel larviculture
71
Figure 3. 2: Size class distribution of mussel larvae on day 14, subjected to different feeding regimes in experiment 2 (n =5)
Similar to experiment 1, the PHB-A 1.0 mg L-1 treatment in experiment 2 showed a
significantly higher survival as compared to the control treatment while the growth was not
significantly different (Table 3.2). The addition of 10 mg L-1 PHB-A to the rearing water
induced no difference in survival of the mussel larvae as compared to the control, but
significantly suppressed the growth. A total of 92% of the larvae in this treatment were
smaller than 180 µm while this was only 45% and 46% in the control treatment and the PHB-
A 1.0 mg L-1 treatment, respectively (Figure 3. 2). There were no significant effects of PHB-A
on the settlement success and the growth of the mussel spat (Table 3. 3).
The addition of the PHB-degrading isolate ARC4B5 in experiment 3 did not enhance the
positive effect of PHA-A 1.0 mg L-1 on the larval survival (Table 3. 2). On the contrary, the
presence of the PHB-degrader significantly decreased the growth of the larvae and the
settlement success. The resulting spat were also smaller (Table 3. 3).
Based on the results of Table 3.2 and Table 3.3, the total yield of mussel spat under
difference experimental conditions was calculated Table 3.4
0
20
40
60
80
100
Per
cen
tage
(%
)
Treatment
>=220
>=200- 220
>=180 - 200
<180
Chapter 3 Application of PHB in mussel larviculture
72
Table 3. 4. The final yield of mussel spat under different experimental conditions
Treatment Yield
(from egg to spat, %)
Experiment 1 (n = 5)
Control 10.7
PHB-C 0.1 mg L-1 15.3
PHB-C 1.0 mg L-1 8.9
PHB-A 0.1 mg L-1 17.0
PHB-A 1.0 mg L-1 25.7
Experiment 2 (n=5)
Control 9.4
PHB-A 1.0 mg L-1 12.3
PHB-A 10.0 mg L-1 5.5
Experiment 3 (n = 4)
Control 6.8
PHB-A 1.0 mg L-1 16.3
PHB-A 1.0 mg L-1 + PHB degrader 5.0
PHB degrader 4.4
3. 3.3. Isolation and identification of PHB-degrading bacteria
A total of 16 different isolates were obtained from the mussel larvae fed with either
crystalline PHB or amorphous PHB. A homology search revealed that all isolates belonged to
the genus Pseudoalteromonas. Isolate ARC4B5 was most closely related to the marine
bacterium Pseudoalteromonas species Strain X153 (GenBank accession number AJ581533)
and showed the highest PHB-degrading capacity according to a PHB depolymerase agar
assay (data not shown). Therefore it was selected for use in experiment 3.
Chapter 3 Application of PHB in mussel larviculture
73
The nucleotide sequences of the isolates were deposited in the GenBank database
(http://www.ncbi.nlm.nih.gov/Genbank) with the accession numbers KJ775741, KJ775742,
KJ775743, KJ775744, KJ775745, KJ775746, KJ775747, KJ775748, KJ775749, KJ775750,
KJ775751, KJ775752, KJ775753, KJ775754, KJ775755, KJ775756.
3. 3.4. Microbial community analysis
In experiment 1, NMS ordination based on Bray-Curtis similarities revealed that the
microbiota associated with the mussel larvae seemed to group together according to
treatment (amorphous or crystalline) (Figure 3. 3). The analysis of similarities indeed showed
a significant global R value of 0.751 (p-value of 0.001) suggesting that similarity between
samples within a treatment is higher than the similarity between samples of different
treatments. Upon pairwise comparisons of treatments, however, no significant differences
could be determined due to the low number of replicates per treatment.
Figure 3. 3: NMS ordination based on Bray Curtis similarities for the bacterial communities associated with the larvae subjected to different feeding regimes in experiment 1. One replicate sample from treatment PHB-C 0.1 mg L-1 was left out of the analysis because it showed an abnormal low number of bands on the DGGE pattern
Chapter 3 Application of PHB in mussel larviculture
74
The NMS plot from experiment 2 suggests a considerable overlap in the composition of the
microbial communities associated with the larvae from the different treatments (Figure 3.
4). The non-significant differences between the microbial communities were confirmed by
the global R-value of only 0.027 and the p-value of 0.346.
Figure 3. 4: NMS ordination based on Bray Curtis similarities for the bacterial communities associated with the larvae subjected to different PHB concentrations in experiment 2.
3. 4. Discussion
Many studies focus on the development of sustainable strategies to improve the culture
performance and disease resistance of aquatically cultured animals. In this study, it was
shown for the first time that the supplementation of PHB can improve the survival of bivalve
larvae.
Even though mussel larvae are known filter feeders, a prerequisite for the experiments was
to determine whether PHB particles are taken up from the rearing water when offered to
the larvae. Defoirdt et al. (2007b) described the use of fluorescent labeling to visualize the
Chapter 3 Application of PHB in mussel larviculture
75
ingestion of PHB by Artemia franciscana larvae and it proved to be effective to demonstrate
the ingestion of PHB by mussel larvae within a time frame of two hours. The
supplementation of crystalline PHB to the culture water of the mussel larvae did not
significantly improve the survival, except for a temporary effect at the lowest concentration
until 14 days post hatching. This observation does not correspond with the results of
previous studies. A beneficial effect of PHB on survival was reported for Artemia franciscana
larvae (Defoirdt et al., 2007b), giant fresh water prawn larvae (Nhan et al., 2010, Thai et al.,
2014), and Chinese mitten crab larvae (Sui et al., 2012). The application method of PHB in
these studies (with the exception of the study on Artemia franciscana), however, was
different as PHB was administered either by addition to formulated feeds or by the
enrichment of live feed. This may partly explain the differences in observed effects. It is also
possible that the absence of improved survival is due to the mussel larvae not being able to
metabolize the crystalline PHB, despite their proven ability to ingest it, as D-stage mussel
larvae have an immature digestive system (Seafood-Industry-training-Organisation, 2006)
that may prevent them from efficiently metabolizing the crystalline PHB. In contrast, the
supplementation of amorphous PHB at a concentration of 1.0 mg L-1 did have a positive
effect on the larval survival. This may be due to the amorphous PHB being more
biodegradable than the crystalline PHB. Halet et al. (2007) made similar observations in case
of Artemia franciscana and ascribed this to the smaller size of the amorphous PHB and the
lower degradability of PHB in a crystalline structure. The crystalline particles in this study
have an average diameter of 30 µm, whereas the PHB containing bacteria are on average 1
µm in size. It cannot be overlooked, however, that the PHB is delivered to the mussel larvae
encapsulated within microbial biomass. This biomass may also have unintentionally
influenced the survival (for example by uncharacterized immunological stimulation). This
aspect needs to be further investigated.
The supplementation of PHB to the culture water of the mussel larvae did not result in a
faster growth nor in an improvement of the settlement success, not even for the PHB-A 1.0
mg.L-1 treatment that induced an increase in survival. De Schryver et al. (2010) in contrast
found that supplementing the diets of European sea bass with 2% or 5% crystalline PHB led
to a significant increase in fish weight gain as compared to the normal feed treatment (0%
PHB). Nhan et al. (2010) and Thai et al. (2014) demonstrated that the development of giant
Chapter 3 Application of PHB in mussel larviculture
76
freshwater prawn larvae fed with Artemia nauplii enriched with PHB in crystalline and
amorphous form, respectively, was significantly faster. Similarly, Sui et al. (2012) showed a
growth promoting effect of crystalline PHB on Chinese mitten crab larvae. As it was
previously suggested that PHB and/or its degradation products may be used as a fuel for
development and growth (Thai et al., 2014), this does not seem to be the case for mussel
larvae. Maybe the monomer of PHB, 3-hydroxybutyrate, is not used as a ketone body by
bivalves whereas this is the case for vertebrates and shrimp (Weltzien et al., 1999).
At this stage the exact mechanism by which the PHB polymer is broken down inside the
intestinal tract of animals is not known, i.e. whether it is mainly driven by physicochemical
processes or by biological activity of the host and/or microorganisms present in the gut
(Nhan et al., 2010). Defoirdt et al. (2007b) and (Liu et al., 2010) suggest that the metabolism
of PHB in brine shrimp larvae occurs at least partially by enzymatic activity of the host while
microbial activity may also play a role. This was based on the observation that the disease
resistance against the pathogen V. campbellii LMG21363 increased by the addition of PHB-
degrading bacteria, compared to the PHB treatment alone. To maximize the chance that
PHB-degrading isolates can persist and function in the specific ecological niche of the host
gastrointestinal tract, it is advisable to isolate them from this specific environment (Reid et
al., 2003). In the current study, all 16 (out of 22) PHB-degrading isolates seemed to belong to
the genus Pseudoalteromonas; isolate ARC4B5 showed the strongest PHB-degrading activity
and was thus selected for experiment 3. Its application, however, did not result in an
increase in survival and even seemed to lower the growth performance of the larvae. These
observations partly are in correspondence with the findings of Arlette et al. (2004), who
found a Pseudoalteromonas isolate that improved the survival of infected scallop (Pecten
maximus) larvae but also decreased their growth. Sandaa et al. (2008) describe a strain of
Pseudoalteromonas spp. as an opportunistic pathogen of P. maximus larvae. In our study, no
significant difference in survival between the control treatment and the Pseudoalteromonas
sp. treatment was observed.
It was earlier suggested that the beneficial effects associated with PHB may result from a
change in the gastrointestinal microbial community composition (De Schryver et al., 2011).
The differences in survival rates of mussel larvae in the different treatments could, however,
not be explained by differences in their respective microbial communities based on the
Chapter 3 Application of PHB in mussel larviculture
77
molecular analyses of the larvae associated microbial communities that were performed in
this study.
In conclusion, our results revealed that amorphous PHB, encapsulated in Ralstonia microbial
biomass, at a concentration of 1 mg L-1 had a positive effect on the survival of blue mussel
larvae. The total yield from egg to settled spat of 2 weeks old was 1.3 (experiment 2) to 2.4
(experiment 1 and 3) times higher than in the control treatment. Further research needs to
be performed to establish why amorphous PHB beneficially influences larval survival and not
larval growth. In addition, it is advised to determine if PHB may be used as an antimicrobial
compound to control pathogenic disease in blue mussel larvae like it does for other aquatic
species.
Acknowledgements
The Vietnam International Education Development (VIED) and Vlir-OI project (“Ensuring
bivalve seed supply in Central-Vietnam”, 2011-068) supported this work though a doctoral
grant to Nguyen Van Hung. Peter DS is supported as a post-doctoral research fellow by the
Research Foundation - Flanders (FWO, Belgium).
78
79
Does Ralstonia eutropha, rich in poly-β
hydroxybutyrate (PHB), protect blue mussel
larvae against pathogenic vibrios?
Nguyen Van Hung1,2, Peter Bossier1, Nguyen Thi Xuan Hong1, Christine Ludeseve1, Linsey Garcia-Gonzalez3, Nancy Nevejan1, Peter De Schryver1
1 Laboratory of Aquaculture & Artemia Reference Center, Ghent University, Rozier 44, B-9000 Gent, Belgium
2 Research Institute for Aquaculture no.3, 33 Dangtat, Nhatrang, Viet Nam
3 Vlaamse Instelling voor Technologisch Onderzoek (VITO), Boeretang 200, 2400 Mol, Belgium
CHAPTER 4: DOES RALSTONIA EUTROPHA, RICH IN POLY-Β HYDROXYBUTYRATE (PHB),
PROTECT BLUE MUSSEL LARVAE AGAINST PATHOGENIC VIBRIOS?
80
Chapter 4 Ralstonia eutropha, rich PHB, protect blue mussel larvae
81
Abstract
Disease outbreaks during larval rearing of commercial bivalve species are an important
impediment to the development of the mollusk aquaculture sector. Current research focuses
on finding alternatives to antibiotics and in this study the use of the natural polymer poly-β-
hydroxybutyrate (PHB) as a biological agent to control bacterial pathogens of blue mussel
(Mytilus edulis) larvae was investigated.
Blue mussel larvae were supplied with amorphous PHB (PHB-A: lyophilized Ralstonia
eutropha containing 75% PHB) at a concentration of 1 mg L-1 or 10 mg L-1 for 6 or 24 hours,
after which they were exposed to either the rifampicin resistant pathogen Vibrio splendidus
or Vibrio coralliilyticus at a concentration of 105 CFU mL-1 in well-plates containing 2 ml of
filtered-sterilized seawater enriched with 0.1% (v/v) of Luria-Bertani medium (salinity 35 g L-
1) and 10 mg L-1 rifampicin. Unchallenged larvae (with and without PHB-A) were used as
negative controls. LB35 (0.1%) medium was added to the water culture to stimulate the
growth of (only) the rifampicin-resistant pathogens. The survival of the larvae that were
PHB-A pretreated (1 mg L-1) for 6 h before the challenge was higher than when the pre-
treatment started 24 h before challenge. After 96h of pathogen exposure, the survival of
PHB-A treated mussel larvae was 1.41 and 1.76 fold higher than the survival of larvae not
treated with PHB-A when challenged with V. splendidus and V. coralliilyticus respectively. An
increase in PHB-A concentration from 1 to 10 mg L-1 significantly increased larval survival
Chapter 4 Ralstonia eutropha, rich PHB, protect blue mussel larvae
82
after 72 h and 48 h of a challenge with V. splendidus in the groups pretreated with PHB-A
for 6 h and 24 h respectively. The increased PHB-A concentration, however, did not lead to a
significant difference in the protection of mussel larvae against V. coralliilyticus A possible
mode of action includes the depolymerization of PHB by enzymatic or microbial activity into
the water-soluble short-chain fatty acid monomer, β-hydroxybutyrate (β-HB) that acts as a
microbial control agent. Therefore, growth inhibition of four concentrations of β-HB (1, 5, 25
and 125 mM) on the two pathogens was tested in vitro in LB35 medium, buffered at two
different pH values (pH7 and pH8). The highest concentration of 125 mM significantly
inhibited the pathogen growth in comparison to the lower levels. The effect of β-HB on the
virulence of the tested pathogenic Vibrios revealed a variable pattern of responses. The
highest β-HB concentration inhibited some virulence factors such as the production of the
lytic enzymes hemolysis, phospholipase but also stimulated the production of caseinase in V.
splendidus at pH7 and in V. coralliilyticus at pH8. β-HB had no effect on the production of
gelatinase and lipase or biofilm formation.
Chapter 4 Ralstonia eutropha, rich PHB, protect blue mussel larvae
83
4.1. Introduction
The production of many bivalve mollusk species depends on hatchery production of seed,
yet the intensive production of bivalve larvae is characterized by mass mortalities caused by
bacterial pathogens (Hada et al., 1984, Prado et al., 2010) In many cases, bacteria of the
genus Vibrio have been found to be the principle causative agents, with mortality often
exceeding 90% (Takahashi et al., 2000). Therefore, Vibriosis is considered a significant
disease threat for hatchery-reared larvae. To prevent infection by pathogenic Vibrio strains
many hatcheries adopt the use of antibiotics during larval culture (Nicolas et al., 1996,
Uriarte et al., 2001) although this is known to lead to the development of drug resistance in
pathogenic strains (Nicolas et al., 1996, Cabello, 2006, Fernandes Cardoso de Oliveira et al.,
2010). For this reason, the focus has shifted towards applying alternative biocontrol
techniques in bivalve rearing systems to prevent disease outbreaks. Probiotics, for example,
are considered a possible solution for controlling bacterial infections in bivalve larvae
(Douillet and Langdon, 1993, Kesarcodi-Watson et al., 2012). Alternatively, Defoirdt et al.
(2009) suggested that the polymer of the short-chain fatty acid (SCFA) β-hydroxybutyrate (ß-
HB), the well-known bacterial storage compound poly-β-hydroxybutyrate (PHB), could be
used to protect aquatic animals from pathogenic bacteria. Polyhydroxybutyric acid is an
important member of the family of polyhydroxyalkanoates (PHAs), and it can be degraded by
bacteria into the monomer β-HB (Kato et al., 1992, Patnaik, 2005). β-hydroxybutyrate acid is
known to have some antimicrobial, insecticidal and antiviral activities (Tokiwa and Ugwu,
2007). In addition, β-hydroxybutyrate is a known ketone body (Jendrossek and Handrick,
2002) that serves an important role in the energy metabolism of a large number of animals
(Nehlig, 2004). PHB can be supplied in either the crystalline (i.e. extracted from the bacterial
cell) or amorphous form (i.e. still contained within the bacterial cell) which after ingestion, is
thought to be depolymerized.Positive effects of PHB on growth and survival were shown for
a number of aquaculture species such as juvenile European sea bass (De Schryver et al.,
2010), juvenile Siberian sturgeon (Najdegerami et al., 2012), larval giant freshwater prawn
(Nhan et al., 2010, Thai et al., 2014), larval giant tiger prawn (Laranja et al., 2014), larval Nile
tilapia (Situmorang et al., 2016) and larval Chinese mitten crab (Sui et al., 2012). .
Chapter 4 Ralstonia eutropha, rich PHB, protect blue mussel larvae
84
Most recently, Hung et al. (2015) observed a 50 % increase in blue mussel larvae survival
when amorphous PHB (PHB-A) was supplied to the culture water at a concentration of 1 mg
L-1. However, no effect on larval growth or survival after metamorphosis was observed. It
was suggested that the increase in larval survival may have resulted from the antimicrobial
activity of the compound against opportunistic bacteria that were naturally present in the
water although that assumption was not verified.
This study investigated the effect of amorphous PHB in blue mussel larvae cultures in vivo
when challenged with the pathogenic bacteria Vibrio splendidus and Vibrio coralliilyticus.
Furthermore, the impact of βHB on the growth and some virulence factors of V. splendidus
or V. coralliilyticus was examined in vitro. The in vitro trials were carried out at pH7 and
pH8. Normal acidity of seawater is pH 8, but previous research demonstrated that β-HB was
more efficient as antimicrobial agent at a lower pH of 7 (Defoirdt et al., 2007b). In addition,
Defoirdt et al. (2009) hypothesized that a possible effect of PHB supplementation, is the
lowering of the pH value in the intestines of the host.
4. 2. Materials and Methods
4. 2.1. Bacterial strains and growth conditions
The pathogenic bacteria used in this study were V. coralliilyticus DO1 (Genbank accession
number EU358784) and V. splendidus 0529 (Genbank accession number EU358783) since
there are no pathogens described specifically for Mytilus edulis larvae to our knowledge. The
chosen pathogens were earlier reported to be pathogenic towards green shell mussel (Perna
canaliculus) larvae (Kesarcodi-Watson et al., 2009) and were kindly provided by Dr.
Kesarcodi-Watson (Cawthron Institue, New Zealand) for the current study.
Before use, the strains were made rifampicin resistant. Firstly, each bacterial strain stocked
in 40 % glycerol at - 80 °C was grown overnight at 18 °C in Luria-Bertani broth supplemented
with 35 g L-1 Instant Ocean sea salt (Aquarium Systems, Sarrebourg, France) (LB35). Further, a
volume of 500 µL was transferred into 5 mL of fresh LB35 containing rifampicin (which was
dissolved in DMSO) at a final concentration of 50 mg L-1. It took a few days before the
medium showed signs of growth. Afterward, 50 µl of this medium was plated on LB35 plates
Chapter 4 Ralstonia eutropha, rich PHB, protect blue mussel larvae
85
containing 50 mg L-1 rifampicin. A single colony was picked up from the plate, and the whole
procedure was repeated. The resistant strains were finally stored in 40 % glycerol at – 80 °C.
For use in the experiments, the rifampicin resistant bacteria were grown overnight in LB35
under constant agitation (130 rpm) at 18 °C, the temperature at which the challenges were
carried out. Cell densities were measured spectrophotometrically at 600 nm with an OD of 1
corresponding to about 1.2 x 109 colony forming units (CFU) mL-1. The final concentration of
pathogenic bacteria used in all challenge experiments was 105 CFU mL-1.
4. 2.2. Amorphous PHB (PHB-A)
The amorphous PHB consisted of lyophilized Ralstonia eutropha containing 75% PHB on cell
dry weight and was produced as described by Thai et al. (2014). The PHB-A was suspended
at 50 mg L-1 in FASW and sonicated for homogenization using an ultrasonic machine
(Branson 1200, USA). A final concentration of 1 mg L-1 and 10 mg L-1 PHB was utilized in the
challenge experiments.
4. 2.3. Experimental mussel larvae
Mature adult mussels were obtained from Roem van Yerseke (Yerseke, The Netherlands) the
day before spawning. The spawning and fertilization protocol were followed as described by
Hung et al. (2015). After fertilization, the development of the fertilized eggs was regularly
monitored. When the morula stage was reached in the majority of the embryos, they were
rinsed with filter autoclaved sea water (FASW) on a 30 μm sieve to wash away remaining
sperm. Next, the embryos were transferred to a glass bottle containing 2L of FASW at 18 °C
and a mixture of the antibiotics rifampicin, kanamycin, and ampicillin (10 mg L-1 each). After
48 hr, D-veliger larvae were obtained and washed at least five times with FASW to remove
the antibiotics. The larvae were re-suspended in fresh FASW, and the density was
determined. All manipulations were performed under laminar flow.
4. 2.4. Blue mussel larvae challenge tests
The protective effect of PHB-A against bacterial infection in blue mussel larvae was
evaluated in a number of challenge tests. The basis of each challenge test consisted of
Chapter 4 Ralstonia eutropha, rich PHB, protect blue mussel larvae
86
adding 100 mussel larvae into 24 inner wells (to avoid plate edge effects) of a sterile 48
well-plate (Tissue Culture Dish, Thermo Scientific). Each well contained 1 ml of FASW
supplemented with LB35 (0.1% v/v) and rifampicin (10 mg L-1). These 24 wells were divided
into 6 treatments with 4 replicate wells per treatment. This set-up was also applied in 24
well-plates for challenge tests. The plates were incubated at 18°C under a light regime 12D:
12L for all experiments. During the challenge test, the suspension in all wells was pipetted
very gently twice a day to re-suspend the PHB-A in the water column. Each challenge test
was repeated at least once. Only one sample experiment is shown here, since the results
were very consistent. Other results can be found in Appendix-C (see page on 189.)
Each challenge test consisted of following six treatments:
1) Non-treated larvae (“control”)
2) Larvae supplied with PHB-A immediately after stocking in the plates (“PHB-A”)
3) Larvae challenged with V. coralliilyticus at 6 or 24 h after stocking in the plates
(“V. coralliilyticus”)
4) Larvae challenged with V. splendidus at 6 or 24 h after stocking in the plates (“V.
splendidus”)
5) Larvae supplied with PHB-A immediately after stocking in the plates and
challenged 6 or 24 h later with V. coralliilyticus (“PHB-A + V. coralliilyticus”)
6) Larvae supplied with PHB-A immediately after stocking in the plates and
challenged 6 or 24 h later with V. splendidus (“PHB-A + V. splendidus”)
In each challenge test, the survival of the larvae was verified at 24h, 48h, 72h, and 96h after
introduction of the pathogens (except for control). At each of these time points, the larvae
of 3 well-plates were killed and stained with Lugol’s solution. Under the microscope, survival
was determined based on the presence of lugol coloured internal structures that included
the vellum, cilia, and stomach. Deterioration of organ structures and empty shells were
denoted as moribund or dead individuals (Figure 4.1). The conditions of the different
challenge tests are as explained in Table 4.1.
Chapter 4 Ralstonia eutropha, rich PHB, protect blue mussel larvae
87
Table 4. 1: Overview of the different blue mussel larvae challenge tests
Pathogens PHB concentration Period of PHB treatment
before challenge
Challenge test 1 V. coralliilyticus
V. splendidus
1 mg L-1 6 h
Challenge test 2 V. coralliilyticus
V. splendidus
1 mg L-1 24 h
Challenge test 3 V. coralliilyticus
V. splendidus
10 mg L-1 6 h
Challenge test 4 V. coralliilyticus
V. splendidus
10 mg L-1 24 h
Figure 4. 1: Blue mussel larvae after Lugol staining (x 400). Living larvae (A) are completely dark while partly (B) or entirely (C) empty shells are counted as dead larvae.
4. 2.5. Effect of β-HB on growth of V. coralliilyticus and V. splendidus
V. coralliilyticus and V. splendidus were grown overnight as described above and set at an
OD600 value of 1.0 in fresh LB35. The bacterial suspensions were inoculated (2% v/v) in 200 μl
LB35 containing different concentrations (0 mM, 1.0 mM, 5.0 mM, 25 mM and 125 mM) of β-
Chapter 4 Ralstonia eutropha, rich PHB, protect blue mussel larvae
88
HB (sodium β-hydroxybutyrate, Sigma-Aldrich, Germany) in a 96-well plate (n = 4 for each
pathogen-concentration combination). The assay was performed at pH 7 and pH 8 in the
presence of a 1M MOPS buffer. The plates were incubated in a spectrophotometer (Tecan I-
Control, Belgium) and the optical density of each well at 600 nm was measured every hour
for 24 h.
4. 2.6. Effect of β-HB on virulence factors of V. coralliilyticus and V. splendidus
For all virulence factors considered, filtered sterilized β-HB was added to the medium at
concentrations of 0 mM, 1 mM, 5 mM, 25 mM, or 125 mM. The pH of the medium was
consequently adjusted at 7 or 8 by the addition of 0.1 N HCl or 0.1 N NaOH.
All assays were performed in triplicate in at least two independent experiments with
consistent results.
4. 2.6.1. Swimming motility
A swimming motility assay was performed using LB35 plates with 2% agar ( Yang and Defoirdt
(2015)). The pathogens were spotted at the center of the plates, and the diameter of the
motility zones was measured after 24 h of incubation at 18 °C.
4. 2.6.2. Lytic enzyme production: caseinase, gelatinase, hemolysin, lipase and phospholipase
All assays were performed according to Natrah et al. (2011). The caseinase assay plates were
prepared by mixing equal volumes of autoclaved double strength LB35 agar and a 4%
skimmed milk powder suspension (Oxoid, UK), sterilized separately at 121 °C for 5 min.
Colony diameters and clearing zones were measured after 3 days of incubation at 28 °C.
Gelatinase assay plates were prepared by mixing 0.5% gelatin (Sigma-Aldrich) into LB35. After
incubation for 7 days, saturated ammonium sulfate (80%) in distilled water was poured over
the plates and after 2 min, the diameters of the clearing zones around the colonies were
measured.
Hemolytic assay plates were prepared by supplementing autoclaved LB35 agar with 5%
defibrinated sheep blood (Oxoid, Basingstoke, and Hampshire, UK). Colony diameters and
clearing zones were measured after 2 days of incubation at 18 °C.
Chapter 4 Ralstonia eutropha, rich PHB, protect blue mussel larvae
89
For the lipase and phospholipase assays, LB35 agar plates were supplemented with 1%
Tween 80 (Sigma-Aldrich) and 1% egg yolk emulsion (Sigma-Aldrich), respectively.The
diameter of the opalescent zones was measured after 3 days of incubation at 18 °C.
4. 2.6.3. Biofilm formation and exopolysaccharide production
A biofilm formation assay was conducted in 96 well plates as described by Li et al. (2014)
using LB35 broth. The exopolysaccharide (EPS) production assay was performed in a similar
way. For the quantification of exopolysaccharides, calcofluor white staining (Sigma-Aldrich)
was used as described by Brackman et al. (2008)
4. 2.7. Data analysis and statistics
Larval survival data in challenge tests were subjected to a logistic regression analysis using
GenStat (VSN International) version 16. The effects of varying concentrations of β-HB on the
virulence factors of the pathogenic bacteria were determined by first checking the
assumptions associated with ANOVA and in case any of the assumptions was violated, non-
parametric equivalents were considered. In effect, since the mean response was expected to
vary with a concentration level of β-HB, we were interested in testing trends in response to
increasing levels. Therefore, the Jonckheere Terpstra test for ordered alternatives was
applied. In situations where this test failed to indicate the presence of trends, the Kruskal-
Wallis test was used. All tests between the different concentrations of β-HB were tested at
the 5% significance level with the ANOVA Dunn-Bonferroni posthoc analysis to account for
multiplicity. All analyses were carried out using Statistical Package for the Social Sciences
version 23 (SPSS. Inc., Chicago. IL, USA) and R version 3.2.2 software packages.
4. 3. Results
4. 3.1. Survival of mussel larvae in challenge tests
The supplementation 6h before the introduction of the pathogens V. splendidus and
V.coralliilyticus of PHB-A at a concentration of 1 mg L-1, significantly increased larval survival
measured 96 h after the challenge (Figure 4.2, challenge 1). For all other larval
pretreatments in combination with V. coralliilyticus, no significant difference in survival with
the challenged control was observed.
Chapter 4 Ralstonia eutropha, rich PHB, protect blue mussel larvae
90
There was a significantly increased protection of mussel larvae against V. splendidus for 48 h
in the 24h pretreated PHB-A group in comparison to the non-pretreated challenged group.
(Figure 4.2, challenge 2). Compared to the challenged larvae that did not receive PHB-A, the
increase in PHB-A concentration from 1 to 10 mg L-1 significantly increased larval survival
after 72 h and 48 h of a challenge with V. splendidus in the groups pretreated with PHB-A for
6h and 24 h respectively. The increased PHB-A concentration, however, did not lead to a
significant difference in the protection of mussel larvae against V. coralliilyticus (Figure 4.2,
challenge 3 &4).
4. 3.2. Effect of β-HB on growth of V. coralliilyticus and V. splendidus
The impact of β-HB on the growth of the pathogens was species and pH dependent. The
growth of the two bacterial strains in LB35 was significantly inhibited at the highest β-HB
concentration of 125 mM at pH7 and pH8 except for the combination V.coralliilyticus at pH7
and pH8 (Figure 4.3).
Chapter 4 Ralstonia eutropha, rich PHB, protect blue mussel larvae
91
_ ................................................................................................................................................................................................................................................................................................................ !
i i~~·· re~ i 1
: • ''>+----i--,,, : I,
::::. 40 '+- · - · - · -~ ::::. 40 ' · ',, b
~ ~ 0 24 .. :2 .: ~ 2~ 0 24 .. - ~2- - -~ I Post exposure (h) Post exposure (h) I
·····+ ··· Control - · • · - V.splendidus ··· +···· Control - · • · - V.coralliilyticus
- PHB --•--V.splendidus + PHB - PHB - .... --V.coralliilyticus+ PHB ! Ch:~:nge test 2. 1 mg PHB L-
1; 24h
100
a I
'#. 80 ,,~~~>:~!, : : a '#. 80 '\ \, ~ a : : I ~ 60 f '':-',, b 1 60 ',I ~' 1,,
i!: 40 ' .: ... _ i!: 40 i'- ._ ....
~ 20 'a. >--- b b ~ 20 •• bb i 0 c -· b-:::~:~=~-=-lb 0 ·-...-~-=-~= ~= ~Q ____ b~b ' !
=::rr: :: .. ..:~_::~:::; .. "" :::rr~ o :,~:~:::::~ •• ". 1
;:~···~ ~ 1: \ : : : !,,!
i!: 40 r- ---- ..,~>--~ ~ 40 \
~ 20 c c --- : ~ 20 \ b. ! 0 0 -:..!?_ __ ~--..!>JL.
0
.. ....... Control
-PHB
24 48 72 96 Postexposure(h)
- .. - V.splendidus
- .... -- V.splendidus + PHB
Challenge test 4. 10 mg PHB L-1 ; 24h
100 ~: a a a • • • \ : ... a 80 ,_, a a a '#. \~ , b "iii 60 ~,, ' e. .::: '\, ........ b i!: 40 11.. '
~ ... ,, .. , ..... ..... ::::. c ""' ....... , .. ... ...... b "' 20 c ------- ~b bb .... ~:: .. -::-~::.~
0
0 24 48 72 96
Post exposure (h)
····•··· Cont rol ·-• -- V.s plendidus
- PHB - •- V.splendidus + PHB
0 24 48 72 96 Post exposure (h)
····•··· Cont rol -----V. coralliilyticus
-PHB --+- V. co ralliilyticus + PHB
100 ~: a a a • • • --~-' •a a a a
'#. 80 ---..t:> b \ '
"iii 60 ··.' .::: \' ',,, i!: 40 ' ' ::::. ',,_, b "' 20 ',, .. _- b
b ... _____ ::- .b ~
0 --- "'"-=----._--_.. 0 24 48 72 96
Post exposure (h) ·· ··• ··· Control --•-· V.coralliilyticus
- PHB - •- V.coralliilyticus + PHB I i "'·-··············································-····- ··········-·-···········-·················-···········-····················································-···········- -···········-·················-···········-···········-·····-·············································-1
Chapter 4 Ralstonia eutropha, rich PHB, protect blue mussel larvae
92
Figure 4. 2: Survival of blue mussel larvae challenged with V. coralliilyticus or V. splendidus at 105 CFU mL-1 under different experimental conditions. In challenge test 1 and 2, PHB was supplemented at a concentration of 1 mg L-1 6 h and 24 h respectively before the challenge, in challenge test 3 and 4, PHB was supplemented at a concentration of 10 mg L-1 6 h and 24h respectively before the challenge. Values are presented as means ± standard error (SE) of 3 replicate plates. The survival in both the control treatment (larvae only) and the PHB-A treatment without challenge was similar and therefore cannot be distinguished in the graphs. Values at the one-time point (just 24 h) that are marked with a different letter are significantly different (P < 0.05).
Figure 4. 3: Growth curves of V. splendidus and V. coralliilyticus (OD600) in LB35 at pH7 and pH8 with different concentrations of 0, 1, 5, 25, and 125 mM β-HB. Data are expressed as mean ± Standard Error (SE) of four replicates. An asterisk denotes a significant difference between the highest concentration of β-HB and the other concentrations. Error bars presented in the graph are often too small to be visible.
Chapter 4 Ralstonia eutropha, rich PHB, protect blue mussel larvae
93
4. 3.3. Effect of β-HB on virulence factors
4. 3.3.1. Swimming motility
Both Vibrio spp. used in this study exhibited swimming motility although patterns appeared
to differ between the two species (Table 4.2). The swimming motility of V. splendidus was
significantly higher with 25 mM β-HB at neutral pH, whereas no significant differences were
found between the different β-HB concentrations at pH8. The swimming motility of V.
coralliilyticus was only significantly affected at the highest concentration of 125 mM β-HB at
pH 7. At pH 8, no significant effects as compared to the control could be observed.
Table 4. 2: Swimming motility zone of V. splendidus and V.coralliilyticus after 24h incubation
on soft agar at pH7 and pH8 with different β-HB concentrations.
V. splendidus V. coralliilyticus
β-HB
(mM)
pH7 pH8 pH7 pH8
Motility zone (mm) Motility zone (mm) Motility zone (mm) Motility zone (mm)
0 40.0 ± 0.7a 33.5 ± 0.5a 45.3 ± 0.3b 47.5 ± 1.0ab
1 38.0 ± 2.0a 30.0 ± 0.7a 44.8 ± 0.3ab 45.0 ± 0.0a
5 46.8 ± 1.0ab 32.5 ± 1.0a 46.0 ± 0.7b 45.8 ± 0.8ab
25 57.3 ± 3.5b 31.8 ± 2.3a 41.3 ± 0.5ab 49.8 ± 0.9b
125 43.8 ± 0.9ab 30.8 ± 1.7a 35.3 ± 1.0a 46.0 ± 0.7ab
Data are expressed as mean ± Standard Error (SE) of four replicates. Values in the same column with different letters indicate significant differences in motility zones between β-hydroxybutyrate concentrations (p<0.05). All pairwise comparisons were done using the Dunn-Bonferroni method.
4. 3.3.2. Lytic enzymes activity
The activity of different lytic enzymes (caseinase, gelatinase, lipase, hemolysin, and
phospholipase) of V. splendidus and V. coralliilyticus upon supplementation of varying
Chapter 4 Ralstonia eutropha, rich PHB, protect blue mussel larvae
94
concentrations of β-hydroxybutyrate at different pH levels is shown both Vibrio strains
tested positive for all virulence factors in the absence of β-HB. Overall, the colonies and
clearing zones on the caseinase assay plates were noticeably smaller at the highest
concentration of β-HB. The ratio between the clearing zone and colony diameter was
significantly higher at 125 mM β-HB as compared to 0 mM (except for V. splendidus at pH8).
A significantly stronger gelatinase activity was observed at 5 mM β-HB for V. coralliilyticus at
pH8. For the other concentrations of β-HB, there were no significant differences in the
control treatment of 0 mM β-HB for both pathogens at both pH values (Table 4. 2).
There was no significant effect of β-HB on lipase at any of the β-HB concentrations for both
pathogens. The ratio in V. splendidus was bigger than in V. coralliilyticus, whereas the
colonies in V. splendidus were smaller than in V. coralliilyticus.
On the contrary, an effect of β-HB on the hemolytic activity was observed in both pathogens
and both pH levels. The highest level of β-HB always showed a significant difference as
compared to the control treatment (0 mM βHB), being higher for V. splendidus at pH 7 and
lower in all other cases.
While phospholipase activity was significantly decreased at 125 mM for V. splendidus at both
pH7 and pH8, there was no significant effect for V. coralliilyticus.
Chapter 4 Ralstonia eutropha, rich PHB, protect blue mussel larvae
95
Table 4. 3: The activity of different lytic enzymes (caseinase, gelatinase, lipase, hemolysin,
and phospholipase) of V. splendidus and V. coralliilyticus upon supplementation of varying
concentrations of β-hydroxybutyrate at various pH levels
β-HB
(mM)
pH7 pH8
Colony
diameter
(mm)
Clearing
zone
(mm)
Ratio Colony
diameter
(mm)
Clearing
zone
(mm)
Ratio
Caseinase/ V.splendidus
0 18.0 ± 0.0 22.0 ± 0.0 1.2 ± 0.0a 25.5 ± 1.0 29.5 ± 1.7 1.2 ± 0.0ab
1 20.0 ± 0.7 24.5 ± 1.2 1.2 ± 0.0a 26.0 ± 1.1 31.3 ± 1.8 1.2 ± 0.0ab
5 20.0 ± 0.4 23.5 ± 0.6 1.2 ± 0.0a 25.5 ± 0.5 29.3 ± 0.8 1.1 ± 0.0a
25 17.3 ± 0.9 21.3 ± 1.3 1.2 ± 0.0a 19.0 ± 0.0 24.0 ± 0.0 1.3 ± 0.0b
125 5.0 ± 0.0 10.0 ± 0.0 2.0 ± 0.0b 18.5 ± 0.3 21.8 ± 0.3 1.2 ± 0.0ab
Caseinase / V.coralliilyticus
0 19.0 ± 0.6 24.3 ± 0.3 1.3 ± 0.0a 24.5 ± 0.3 29.3 ± 0.5 1.2 ± 0.0a
1 21.8 ± 0.3 26.0 ± 0.4 1.2 ± 0.0a 26.0 ± 0.0 30.0 ± 0.0 1.2 ± 0.0a
5 18.5 ± 0.9 21.0 ± 1.0 1.1 ± 0.0a 25.3 ± 0.3 28.8 ± 0.8 1.1 ± 0.0a
25 17.0 ± 0.4 20.8 ± 0.3 1.2 ± 0.0a 22.8 ± 0.9 24.8 ± 0.3 1.1 ± 0.0a
125 5.0 ± 0.0 10.0 ± 0.0 2.0 ± 0.0b 17.0 ± 0.0 23.0 ± 0.0 1.4 ± 0.0b
Gelatinase/V.splendidus
0 18.5 ± 1.6 34.3 ± 0.5 1.9 ± 0.1ab 19.0 ± 0.6 35.3 ± 0.3 1.9 ± 0.1ab
1 15.3 ± 0.5 30.5 ± 1.0 2.0 ± 0.0b 15.0 ± 1.3 32.5 ± 1.0 2.2 ± 0.1b
Chapter 4 Ralstonia eutropha, rich PHB, protect blue mussel larvae
96
5 25.3 ± 1.9 35.0 ± 3.1 1.4 ± 0.1a 20.0 ± 0.0 35.0 ± 0.0 1.8 ± 0.0ab
25 22.8 ± 1.0 34.0 ± 0.7 1.5 ± 0.0ab 22.3 ± 1.0 35.5 ± 0.5 1.6 ± 0.1a
125 14.5 ± 1.2 26.0 ± 0.8 1.8 ± 0.1ab 16.0 ± 0.0 30.0 ± 0.0 1.9 ± 0.0ab
Gelatinase/ V.coralliilyticus
0 21.5 ± 1.2 33.5 ± 0.5 1.6 ± 0.1ab 19.5 ± 0.3 33.0 ± 0.6 1.7 ± 0.0a
1 13.8 ± 1.3 29.0 ± 0.6 2.1 ± 0.2b 16.0 ± 0.7 33.0 ± 0.6 2.1 ± 0.1ab
5 19.8 ± 1.3 32.8 ± 1.1 1.7 ± 0.1ab 14.0 ± 0.0 33.3 ± 0.5 2.4 ± 0.0b
25 27.8 ± 3.0 38.0 ± 0.0 1.4 ± 0.2a 16.0 ± 2.0 33.3 ± 0.8 2.1 ± 0.3ab
125 15.3 ± 0.9 27.3 ± 0.5 1.8 ± 0.1ab 15.8 ± 0.5 32.0 ± 0.0 2.0 ± 0.1ab
Lipase/ V.splendidus
0 7.6 ± 0.2 16.5 ± 0.3 2.2 ± 0.1a 7.5 ± 0.3 14.5 ± 0.3 1.9 ± 0.0ab
1 6.8 ± 0.6 13.5 ± 0.6 2.0 ± 0.1a 7.5 ± 0.5 12.5 ± 0.6 1.7 ± 0.1a
5 7.8 ± 0.3 15.8 ± 0.5 2.0 ± 0.1a 8.1 ± 0.1 16.3 ± 0.3 2.0 ± 0.0b
25 8.3 ± 0.3 16.3 ± 0.5 2.0 ± 0.1a 8.0 ± 0.4 16.0 ± 0.8 2.0 ± 0.0b
125 8.3 ± 0.1 15.5 ± 0.3 1.9 ± 0.0a 7.8 ± 0.3 14.5 ± 0.3 1.9 ± 0.1ab
Lipase/ V.coralliilyticus
0 15.5 ± 0.9 19.5 ± 0.5 1.4 ± 0.1a 14.8 ± 0.3 19.8 ± 0.3 1.3 ± 0.0a
1 14.0 ± 0.6 18.5 ± 0.6 1.3 ± 0.0a 15.0 ± 0.4 19.0 ± 0.4 1.3 ± 0.0a
5 13.8 ± 1.3 18.8 ± 0.9 1.4 ± 0.1a 12.8 ± 0.5 20.3 ± 0.9 1.6 ± 0.1a
25 17.3 ± 0.8 21.3 ± 0.6 1.2 ± 0.0a 14.5 ± 0.5 19.3 ± 0.8 1.3 ± 0.0a
125 13.8 ± 0.5 18.5 ± 0.3 1.3 ± 0.0a 13.8 ± 0.5 18.3 ± 0.6 1.3 ± 0.0a
Chapter 4 Ralstonia eutropha, rich PHB, protect blue mussel larvae
97
Hemolytic/ V.splendidus
0 18.8 ± 0.6 15.5 ± 0.6 0.8 ± 0.1a 11.3 ± 1.1 19.5 ± 1.0 1.8 ± 0.1a
1 9.3 ± 0.1 12.3 ± 0.1 1.3 ± 0.0ab 10.5 ± 0.3 12.5 ± 0.3 1.2 ± 0.0bc
5 18.3 ± 1.1 16.0 ± 0.3 0.9 ± 0.2ab 14.8 ± 2.0 13.5 ± 0.9 0.9 ± 0.1c
25 11.5 ± 0.7 13.8 ± 0.4 1.2 ± 0.1ab 9.0 ± 0.4 12.5 ± 0.3 1.4 ± 0.1b
125 7.0 ± 0.0 10.5 ± 0.1 1.5 ± 0.0b 9.0 ± 0.0 12.3 ± 0.3 1.4 ± 0.0b
Hemolytic/ V.coralliilyticus
0 9.0 ± 0.0 15.5 ± 0.3 1.7 ± 0.0a 9.0 ± 0.0 18.0 ± 0.0 2.0 ± 0.0a
1 9.5 ± 0.3 11.8 ± 0.3 1.2 ± 0.0ab 9.0 ± 0.0 12.0 ± 0.0 1.3 ± 0.0ab
5 10.0 ± 0.0 12.0 ± 0.0 1.2 ± 0.0ab 9.0 ± 0.0 12.0 ± 0.0 1.3 ± 0.0ab
25 10.0 ± 0.4 11.8 ± 0.3 1.2 ± 0.0ab 9.5 ± 0.3 12.0 ± 0.0 1.3 ± 0.0ab
125 10.8 ± 0.3 13.0 ± 0.0 1.2 ± 0.0b 11.5 ± 0.5 13.3 ± 0.5 1.2 ± 0.0b
Phospholipase/ V.splendidus
0 10.0 ± 0.0 14.5 ± 0.3 1.5 ± 0.0a 11.0 ± 0.6 14.3 ± 0.3 1.3 ± 0.1a
1 12.0 ± 0.0 15.8 ± 0.3 1.3 ± 0.0ab 13.5 ± 0.5 15.5 ± 0.5 1.1 ± 0.0ab
5 10.0 ± 0.3 13.0 ± 0.0 1.3 ± 0.0ab 12.8 ± 0.5 15.8 ± 0.5 1.2 ± 0.0a
25 11.8 ± 0.3 15.8 ± 0.3 1.3 ± 0.0ab 13.0 ± 0.0 15.3 ± 0.3 1.2 ± 0.0a
125 11.0 ± 0.3 13.5 ± 0.3 1.2 ± 0.0b 10.5 ± 0.3 11.5 ± 0.3 1.1 ± 0.0b
Phospholipase/ V.coralliilyticus
0 13.8 ± 0.3 18.8 ± 0.8 1.4 0.1ab 15.3 ± 0.5 18.5 ± 0.5 1.2 0.0ab
1 14.5 ± 0.3 21.0 ± 0.0 1.4 0.0ab 13.0 ± 0.0 16.3 ± 0.3 1.3 0.0a
Chapter 4 Ralstonia eutropha, rich PHB, protect blue mussel larvae
98
5 12.5 ± 0.5 17.0 ± 0.0 1.4 0.1ab 12.0 ± 0.0 16.0 ± 0.0 1.3 0.0a
25 13.0 ± 0.0 15.0 ± 0.0 1.2 0.0b 12.0 ± 0.0 14.0 ± 0.0 1.2 0.0ab
125 13.3 ± 0.3 15.5 ± 0.3 1.2 0.0b 12.0 ± 0.0 13.3 ± 0.5 1.1 0.0b
Data are expressed as mean ± standard error (SE) of four replicates. Ratio values for each virulence factor-species combination in the same column indicated with a different letter are significantly different (P < 0.05). All pair wise comparisons were done using Dunn-Bonferroni method. The ratio of colony diameter and clearing zone data were transformed (normality and homogeneity) to satisfy assumptions of ANOVA.
There was no significant effect of β-HB on biofilm formation for both pathogens at both pH
values compared to the control treatment (Figure 4. 4 a & b). The exopolysaccharide
production more or less reflected the tendencies observed for the biofilm formation (Figure
4. 4 c & d). A significant increase was found though at 5 mM and pH8 in the case of V.
splendidus (Figure 4. 4 c).
Chapter 4 Ralstonia eutropha, rich PHB, protect blue mussel larvae
99
Figure 4. 4: Biofilm formation (a & b) and exopolysaccharide production (c & d) of V. splendidus and V.coralliilyticus after 4 days incubation at 18°C in different ß-HB concentrations at pH7 and pH8 (average ± standard error of four replicates). Different letters indicate significant differences between β-HB levels (a,b for comparison at pH7; x,y for comparison at pH8). All pairwise comparisons were done using Dunn-Bonferroni method.
4. 4. Discussion
The results obtained in the present work demonstrated that the administration of PHB-A
had a positive effect in vivo on the survival of blue mussel larvae when it was administered 6
h before the challenge with V. splendidus or V. coralliilyticus. To our knowledge, this is the
first time that PHB-A has been tested as a protective compound for blue mussel larvae in
controlled challenge tests. It was also confirmed that the two tested vibrios are also virulent
for blue mussel larvae.
Currently, the exact mode of action by which PHB induces its protective effects is still not
clear. In general, it is assumed that the compound is bio-converted to its monomer β-HB
upon ingestion and that this compound then acts as an antimicrobial agent (Defoirdt et al.,
Chapter 4 Ralstonia eutropha, rich PHB, protect blue mussel larvae
100
2009), provides direct energy to the host (Fernández, 2001) or acts as an immunostimulant
(Baruah et al., 2015). In previous studies, PHB-A has been shown to significantly increase the
survival of Artemia when challenged with V. campbellii under both gnotobiotic and
conventional conditions (Halet et al., 2007, Defoirdt et al., 2007b). Consistent with a
previous report on Artemia (Defoirdt et al., 2007b), our results provided evidence that the
addition of amorphous PHB to the mussel larvae culture water significantly improves the
protection of larvae against both pathogens V. splendidus and V. coralliilyticus, although
there were major differences in the effective PHB-A dose between the two studies. In the
Defoirdt et al. (2007b) study, maximum and complete protection against V. campbellii was
obtained at a PHB-A concentration of 1000 mg L-1 while the lower PHB-A concentration of
100 mg L-1 still provided significant protection. In contrast, in the present study, an increase
in PHB-A concentration from 1 mg to 10 mg PHB-A mL-1 did not improve the larval survival.
This result supports our previous in vivo study (Hung et al., 2015) where the beneficial
effects of PHB-A in the culture of blue mussel larvae were optimal at 1 mg L-1, with inferior
results obtained at the higher concentration of 10 mg L-1.
Another interesting observation that was noted in this study was that the time window
between treatment and challenge influenced the outcome of the challenge. When the
pretreatment with PHB-A was administered 24h before the challenge, no positive effect on
survival was observed. In this case, it is possible that the PHB-A had been rapidly degraded
by the natural enzymes or resident PHB-degraders in the digestive system of the larvae.
Therefore, PHB-A treated mussel larvae failed to accumulate enough PHB concentration
when pretreated 24h before the challenge (in contrast to the 6 h pre-treatment).
In order to determine the effect of the monomer β-HB on the pathogens in this study, an
effort was made to measure the concentration of β-HB in the mussel larvae themselves.
However, due to the small dimensions of the mussel larvae, values remained below the
detection limit. In another study, however, it was found that the β-HB concentration in
Artemia nauplii supplied with PHB ranged between 1 and 8 mM (De Schryver et al.,
unpublished data). Based on these values, it was decided to determine the effect of β-HB on
the growth and virulence factor activity of the pathogens at concentrations of 1 and 5 mM,
this being a realistic estimation of the PHB concentration in the gut of blue mussel larvae
treated with PHB. In addition, higher PHB concentrations of 25 and 125 mM were also
Chapter 4 Ralstonia eutropha, rich PHB, protect blue mussel larvae
101
included to provide a better insight on the effect of β-HB. The effect of these concentrations
were verified at two pH values. Indeed, pH of the environment is a very important factor
since the growth-inhibitory effect of β-HB was earlier shown to decrease with increasing pH.
At pH 5, the growth of V. campbellii was completely inhibited; at pH 6, growth was delayed
and at pH 7, no inhibition could be observed (Defoirdt et al., 2006b). The pH-dependency
can be explained by the fact that fatty acids can pass the cell membrane only in their
undissociated form, which will be more pronounced at lower pH (see the Henderson-
Hasselbach equation (Sun et al., 1998)).
From the in vitro assays, it became clear that the pathogens’ growth was not inhibited at the
lower concentrations of β-HB. Only a concentration of 125 mM β-HB significantly inhibited
the growth of both pathogens V. splendidus and V. coralliilyticus at neutral pH (except for V.
coralliilyticus at alkaline pH). This indicates that the beneficial effect of PHB on larval survival
was unlikely the consequence of β-HB reducing the growth of the pathogens as it is exactly
these lower concentrations that can be expected in the gastrointestinal environment of the
blue mussel larvae. For this reason, it was determined if there could have been an effect of
β-HB on the virulence factors of the pathogens.
A proper evaluation of the in vitro test requires a better understanding of the general and
specific stress response capabilities of pathogens. The degree of pathogenicity, also termed
virulence depends on the expression of virulence factors, i.e. gene products that enable the
pathogen to infect and damage the host, including proteins involved in motility and
adhesion of the pathogen to the host, protection from host defence mechanism and host
tissue degradation, iron acquisition and toxins (Chen et al., 2005, Defoirdt, 2014).
Bacterial motility is now considered as an important virulence factor for many pathogens. It
is essential for pathogenic bacteria during the initial phases of infection as it helps them to
overcome repulsive forces between the bacterial cell and the host tissues and hence,
facilitates attachment to the host (McCarter, 2001). Our results indicated that the effect of
β-HB on the swimming motility of pathogens depended both on the species and
concentration. V. splendidus’ swimming activity significantly increased at 25 mM of β-HB
while V. coralliilyticus’ motility was significantly decreased at 125 mM (pH7).
Chapter 4 Ralstonia eutropha, rich PHB, protect blue mussel larvae
102
Biofilm formation is an ancient and integral component of the prokaryotic life cycle and is a
critical factor for survival in diverse environments (Hall-Stoodley et al., 2004). This process in
Vibrios depends on specific genes (flagella, pili, and exopolysaccharide biosynthesis) and
regulatory processes (Yildiz and Visick, 2009). In the present study, β-HB did not exert any
influence on the biofilm formation of the two Vibrio spp. investigated. Irrespective of the
presence or absence of β-HB, biofilm formation seemed to be very low in both Vibrio spp.
For Vibrio fischeri, Chavez-Dozal and Nishiguchi (2011) found biofilm formation at an OD562
to be 0.83 and 1.10 at 20 and 25°C, respectively, whereas our results showed minimum-
maximum values of 0.04-0.10 and 0.04-0.15 in V. splendidus and V. coralliilyticus,
respectively. The small biofilm formation observed in the present study could be related to
the sub-optimal incubation temperature used (18 °C). This context applies in particular for V.
coralliilyticus. Several studies have identified V. coralliilyticus as a mesophilic bacterium with
its virulence factors upregulated at elevated temperatures (Kimes et al., 2012, Frydenborg et
al., 2014). This is not applicable however for V. splendidus that grows at low temperatures,
being psychrotroph (Pujalte et al., 1999).
Extracellular proteases have been identified to play a significant role in virulence and
pathogenicity of many bacteria (Cai et al., 2007). Defoirdt (2014) found that lytic enzymes
produced by aquaculture pathogens include hemolysins and proteases. Haemolysin is one of
the virulence factors of pathogens described for shrimp, fish (Liu et al., 1996, Sun et al.,
2007) and bivalve mollusks (Nottage and Birkbeck, 1990). Secreted phospholipases are
thought to function in phosphate acquisition, carbon source acquisition, and in some cases
as virulence factors for pathogenic species (Schmiel and Miller, 1999). The results of the
assays indicated that β-HB significantly affected the virulence factors only in a limited
number of cases (Table 4. 4).
Chapter 4 Ralstonia eutropha, rich PHB, protect blue mussel larvae
103
Table 4. 4: Summary of the effects of β-HB on selected virulence factors of mussel larvae
Vibrio pathogens
V. splendidus V. coralliilyticus
pH 7 pH 8 pH 7 pH 8
Caseinase 125 mM No effect No effect 125 mM
Gelatinase No effect No effect No effect No effect
Lipase No effect No effect No effect No effect
Hemolysin 125 mM 1, 5, 25 ,125 mM 125 mM 125 mM
Phospholipase 125 mM 125 mM No effect No effect
Swimming motility 25 mM No effect 125 mM No effect
Biofilm formation No effect No effect No effect No effect
Exopolysaccharide No effect 5 mM No effect No effect
Focusing on the concentrations that can be considered to be relevant to the gastrointestinal
environment of blue mussel larvae (range 1- 25mM), only one beneficial effect of β-HB for
the host can be reported: at a β-HB concentration of 1, 5 and 25mM, the hemolytic enzyme
activity in V. splendidus is inhibited at pH8. The hypothesis is that PHB may affect the
virulence factor activity of the pathogens under investigation and as such protect the blue
mussel larvae from infection, is here with rejected. It is likely that the protective effect of
PHB on blue mussel larvae involves other mechanisms such as immunostimulation (Baruah
et al., 2015) or the direct provision of energy (De Schryver et al., 2010).
In conclusion, the present study indicated that PHB-A can partly protect mussel larvae
against specific pathogenic bacteria and that the effect of PHB-A on larval survival in the
challenge experiments depended on both PHB-A concentration and exposure time. In
general, pretreatment of mussel larvae with PHB-A at a concentration of 1 mg L-1 resulted in
better larval survival when administered 6h before the challenge, compared to
Chapter 4 Ralstonia eutropha, rich PHB, protect blue mussel larvae
104
administration of PHB-A 24h before the challenge. Larvae with the 6h pretreatment showed
a 55% and 25% increase in survival after exposure to the pathogens V. splendidus and V.
coralliilyticus, respectively, as compared to challenged larvae that were not treated with
PHB-A. Increasing the pretreatment from 1 to 10 mg PHB-A L-1 did not improve the
protection of mussel larvae against the challenge unless treatment was suspended PHB-A at
6h challenged with V. splendidus. This result is in accordance with the previous mussel larvae
experiments confirming that PHB-A of 1 mg L-1 is an optimal concentration in mussel larvae
culture (Hung et al., 2015).
The in vitro experiments suggested that β-HB affected the virulence factor activity of the
pathogens rather than growth, although the responses didn’t follow a clear pattern. The
highest β-HB concentration of 125 mM inhibited some virulence factors of the pathogenic
bacteria such as hemolysis, phospholipase, but also stimulated caseinase production. The
lowest β-HB concentrations inhibited a hemolytic enzyme (1 mM) in contrast, EPS was
stimulated at (5mM) β-HB in V. splendidus at pH8. There was no effect on the production of
the lytic enzymes gelatinase and lipase and the formation of biofilm were not affected by the
presence of β-HB at any concentration. The in vitro and in vivo tests of this study confirmed
that both Vibrio coralliilyticus and V. splendidus are also virulent for blue mussel larvae.
Acknowledgements
The Vietnamese International Education Development Agency (VIED), the Vlir-OI project
(“Ensuring bivalve seed supply in Central-Vietnam” no2011-068) supported this work
through a doctoral grant to the first author. The Research Foundation - Flanders (FWO,
Belgium), supported Peter DS as a post-doctoral research fellow. This research was also
financed by Ghent University through the Special Research Fund “Host-microbial
interactions in aquatic production” project (BOF12/GOA/022). We wish to thank Dr.
Kesarcodi-Watson (Cawthron Institue, New Zealand) kindly provided the bacterial strain for
this research and Dr. Abatih Emmanuel (FIRE, University of Ghent) for statistical guidance.
105
Ralstonia eutropha, containing high poly-β-
hydroxybutyrate levels (PHB-A), regulates the
immune response in mussel larvae challenged with
Vibrio coralliilyticus
Nguyen Van Hung1,2, Nancy Nevejan1, Peter De Schryver1, Nguyen Viet Dung1 and Peter Bossier1
1Laboratory of Aquaculture & Artemia Reference Center, Ghent University, Rozier 44, B-9000 Gent, Belgium
2Research Institute for Aquaculture no.3, 33 Dangtat, Nhatrang, Viet Nam
CHAPTER 5: RALSTONIA EUTROPHA, CONTAINING HIGH POLY-Β-HYDROXYBUTYRATE LEVELS
(PHB-A), REGULATES THE IMMUNE RESPONSE IN MUSSEL LARVAE CHALLENGED WITH
VIBRIO CORALLIILYTICUS
106
Chapter 5 PHB-A regulates immune response in challenged mussel larvae
107
Abstract
Marine invertebrates rely solely on innate immune mechanisms that include both humoral
and cellular responses. Antimicrobial peptides (AMPs), lysozyme and phenoloxidase activity,
are important components of the innate immune defense system in marine invertebrates.
They provide an immediate and rapid response to invading microorganisms. The impact of
amorphous poly-β-hydroxybutyrate (PHB-A) (1mg PHB-A L-1) on gene expression of the
AMPs mytimycin, mytilinB, defensin and the hydrolytic enzyme lysozyme in infected blue
mussel larvae was investigated during “in vivo” challenge tests with Vibrio coralliilyticus (105
CFU mL-1). RNAs were isolated from mussel larvae tissue, and AMPs were quantified by q-
PCR using the 18SrRNA gene as a housekeeping gene. Our data demonstrated that AMPs
genes had a tendency to be upregulated in challenged mussel larvae, and the strongest
expression was observed from 24h post-exposure onwards. The presence of both PHB-A and
the pathogen stimulated the APMs gene expression however; no significant differences were
noticed between treatments and exposure time. Looking at the phenoloxidase activity in the
infected mussels, it was observed that the addition of PHB-A induced increased activity.
108
Chapter 5 PHB-A regulates immune response in challenged mussel larvae
109
5.1. Introduction
In common with other invertebrates, bivalves rely solely on innate immunity, which by
definition lacks adaptive characteristics, to combat against invading pathogens.
Antimicrobial peptides appear to be one of the actors in innate immunity that have been
conserved during evolution, although their involvement in anti-infectious processes is
different according to species, cell type, and tissue (Mitta et al., 2000b). Many antimicrobial
peptides are located in epithelia (Schröder, 1999) where they prevent invasion by pathogens
while others may be especially abundant in circulating cells. They are recognized to be a
major component of the innate immune defense system in bivalve mollusks as well (Cellura
et al., 2007).
The innate immunity in mollusks is not well understood. Nevertheless, pathogen recognition
receptors (PRRs) have been identified in some species (Araya et al., 2010). Once the
presence of microbes is detected, these intruders are phagocytosed and destroyed by toxic
radicals, lysozyme and antimicrobial peptides, which are involved in bacterial killing by
destabilizing their membrane permeability (Hancock and Rozek, 2002). Jenssen et al. (2006)
described in detail the interaction process between the peptide and target cell. It is thought
to occur through electrostatic bonding between the cationic peptide and the negatively
charged components present on the bacterial outer envelope, such as phosphate groups
within the lipopolysaccharides of Gram-negative bacteria or lipoteichoic acids present on the
surface of Gram-positive bacteria.
In mussels, four AMPs (defensin, mytilin, myticin and mytimycin) which play a key role in the
immune defense were identified and characterized (Mitta et al., 2000b). Different mussel
species have various AMPs genes, e.g., myticin appears in Mytilus galloprovincialis only,
whereas mytimycin occurs in M. edulis only (Tincu and Taylor, 2004). Some of them have a
wide spectrum of action while others are target-specific. For instance, mytimycin is
described as being strictly anti-fungal, mytilin acts extracellularly, whereas myticin can act
either intracellularly (during phagocytosis) or extracellularly (Mitta et al., 2000b). Mitta et al.
(2000b) also reported that defensin producing granulocytes are concentrated in the
intestinal epithelia, whereas mytilin and myticin expressing granulocytes are well
represented in gills suggesting that the type of AMP may dictate granulocyte allocation in
Chapter 5 PHB-A regulates immune response in challenged mussel larvae
110
different organs in mussels. M. galloprovincialis defensin 1 (MGD1) is an original member of
the arthropod defensin family due to the presence of 2 extra-cysteines and one modified
amino acid (Mitta et al., 1999b). Defensin, mytilin and myticin were determined in vitro to
have antimicrobial activity. Differences in expression of these AMPs genes were recorded
when mussel M. galloprovincialis adults were challenged with various factors such as
bacterial infections or by heat shock (Cellura et al., 2007). To our knowledge, nothing is
known about the genes that code for these antimicrobial peptides in blue mussel M. edulis
larvae or about the regulation of their expression. Besides the AMP gene expression,
another critical component of the immune system of bivalves namely phenoloxidase activity
(PO) was examined. As the product of a complex cascade of reactions, PO is generated from
proPO through a limited proteolysis by a proPO activating enzyme (Asokan et al., 1997), and
is involved in melanization, encapsulation, wound healing, phagocytosis, and pathogen
extermination (Bai et al., 1997, Munoz et al., 2006). The soluble form of PO is always
involved in humoral immunity while the cellular PO that binds to the surface of hemocytes,
is more associated with cell-mediated immunity (Hellio et al., 2007). Bacterial infection can
cause a significant increase in PO in the hemolymph of the bivalves Crassostrea madrasensis
and Chlamys farrization (Cong et al., 2008).
The compound poly-ß-hydroxybutyrate (PHB), a polymer of the short-chain-fatty acid ß-
hydroxybutyrate, was proven to protect experimental animals against a variety of bacterial
diseases, including vibriosis in farmed aquatic animals, albeit through undefined mechanisms
(Baruah et al., 2015). Recent research demonstrated that amorphous PHB-A, namely
Ralstonia cells containing more than 75% PHB on dry weight basis, in particular increases the
survival of mussel larvae (M. edulis) (Hung et al., 2015) and protects them during in vivo
challenge tests with V. coralliilyticus and V. splendidus in the previous study (chapter 4).
This study focuses on the detection and regulation of the three AMPs mytimycin, mytilinB,
defensin and the hydrolytic lysozyme in M. edulis larvae. On a second level the impact of
PHB-A on the expression of these genes and on PO activity regulation was investigated
during challenge tests with the pathogen V.coralliilyticus.
Chapter 5 PHB-A regulates immune response in challenged mussel larvae
111
5. 2. Materials and methods
5.2.1. Bacterial strains and growth conditions
Vibrio coralliilyticus is a Gram-negative marine bacterium isolated at the Glen Haven
Aquaculture Centre (New Zealand) during 2004 and 2005. This selected strain was reported
as a pathogenic Vibrio for bivalve larvae culture (Kesarcodi-Watson et al., 2009b). V.
coralliilyticus used in the experiments was mutated to a rifampicin resistant strain (in
previous study - chapter 4). Before use, 10 µl of the stored cultures (in 40% glycerol at -80
°C) were plated on Luria- Bertani plates to which 35g L-1 of Instant Ocean® (LB35 agar) was
added and incubated for 24 h at 17 °C. Single colonies were picked from the plates and
cultured overnight in fresh LB35 at 17 °C under constant agitation (150 min-1) before each
experiment.
5.2.2. Spawning procedure and larvae handling
Mature blue mussels (Mytilus edulis) were transported from the mussel producer Roem van
Yerseke, in The Netherlands to the Laboratory of Aquaculture and Artemia Reference
Center, Ghent University, Belgium, under cooled conditions. The protocol for mussel
spawning and fertilization was followed as described in Hung et al. (2015). The development
of the fertilized eggs was regularly monitored. When the morula stage was reached in the
majority of the embryos, the embryo solution was sieved through a 30 μm sieve. The
remaining sperm was washed away with 0.22 μm filtered and autoclaved seawater (FASW).
After this washing step, the embryos were transferred to a 2L glass bottle containing fresh
FASW at 18 °C and a mixture of antibiotics (10 mg l-1) to minimize bacterial interference (in
previous study-chapter 4). After 48h, the straight-hinged D-larvae were washed at least five
times with FASW to remove every trace of antibiotics and then re-suspended in fresh FASW.
All manipulations were performed under a laminar flow hood to avoid contamination before
the start of the challenge tests.
5.2.3. Challenge tests
The first experiment was carried out in 48-well tissue culture dishes (TCD), and the second,
third and fourth experiment in 1L bottles. Survival was only measured in the small-scale test
Chapter 5 PHB-A regulates immune response in challenged mussel larvae
112
while the larvae in the bottle experiment were also used for tissue collection. Samples from
the second and third experiment were used to measure AMPs gene expression and PO
activity, respectively. The fourth experiment was carried out to evaluate a wider time
window of gene expression for the different AMPs (till 48 h, based on the results of second
experiment, in which the signal of expression was low).
Each treatment was performed in triplicate, each experiment in TCD test was repeated at
least once, and only one result is presented in this study. Plate sterility of the control
treatments was checked at the end of the challenge by plating 100 µl of the culture water on
LB35 plates and incubating at 17 °C. If the control was contaminated, the results were not
considered, and the experiment was repeated.
5.2.3.1. Experiment 1
A completely randomized experimental design was followed to evaluate the effect of PHB-A
on V. coralliilyticus exposure in mussel larvae. The challenge test was performed in 48-well
TCDs. Each well contained approximately 100 two-day-old D-larvae. The rearing water
contained LB35 (0.1% v/v) and rifampicin (10 mg L-1) to suppress growth of ambient bacteria.
In treatment 1 (control), larvae were neither PHB-A treated nor challenged, in treatment 2
the mussel larvae were challenged after 6 h with the rifampicin resistant strain
V.coralliilyticus at a concentration of 105 CFU mL-1 while in treatment 3 the larvae were
supplemented with PHB-A at a concentration of 1 mg L-1. PHB-A consists of a freeze-dried
Ralstonia eutropha culture containing 75% PHB on cell dry weight (VITO, Mol, Belgium). In
treatment 4, the larvae were supplemented with PHB-A 6 h before being challenged with
V.coralliilyticus. During the challenge test, larvae were pipetted twice a day to ensure that
PHB-A particles were suspended in the water column and available for uptake by the larvae.
The survival of the larvae was determined 24h and 48h after the addition of the pathogen.
5.2.3.2. Experiment 2, 3 and 4
The larvae were submitted to the same treatments as in Experiment 1, control PHB-A unfed
larvae were compared with PHB-A fed larvae challenged with 105 CFU mL-1 of V.
coralliilyticus. Three replicate glass bottles of 1L, containing 50,000 D-larvae each, were
sacrificed at each sampling point. Room temperature was 17°C. All the larvae of the three
replicate bottles were collected separately on a 60 µm sieve. For experiment 2, mussel
Chapter 5 PHB-A regulates immune response in challenged mussel larvae
113
larvae were pretreated with PHB-A for 6h before exposure to the pathogen and samples
were collected at the sampling points 3h, 6h, and 12h (counted just after adding the
pathogen), and no sampling was done at 24h and 48h. For experiment 3, larvae were
collected at 48h after the addition of the pathogen and PO was measured in challenged
larvae at 12h, 24h, 36h and 48h while for experiment 4, the larvae were collected at 0h, 3h,
6h, 9h, 18h, 24h and 48h. The larvae were washed with AFSW and transferred to 2 ml
centrifuge tubes, weighed, flash-frozen in liquid nitrogen and stored at -80°C for PO
measurement and RNA extraction respectively. Procedure of four experiment was
summarized in the Table below:
Table 5. 1: Summary of the challenge tests with V. coralliilyticus (105CFU mL-1) in the
presence of PHB-A (1 mg L-1) added 6 h before the pathogen
Challenge
experiment
(Exp.)
Vessel Sampling point Evaluation
Exp.1 Tissue culture
Dishes (TCD)
48h Survival of larvae
Exp.2 Glass bottle of 1 L 0, 3, 6, 9, 12, 24, 48, 72
and 96 h
Time window
Exp.3 Glass bottle of 1 L 0, 3, 6 and 12 h AMPs gene expression
Exp.4 Glass bottle of 1 L 12,24,26 and 48h Phenoloxidase activity
5.2.4. Standardization of quantitative real-time qRT-PCR for mussel larvae
5.2.4.1. Design of gene-specific primers
The sequences of mytimycin, mytilinB, defensin, and lysozyme from two blue mussel species
M. gallloprovincialis and M. edulis were selected from the GenBank
(http://www.ncbi.nlm.nih.gov). Specific primers for 18srRNA, mytimycin, mytilinB, lysozyme
and defensin genes were designed using the Primer3.0 software
Chapter 5 PHB-A regulates immune response in challenged mussel larvae
114
(http://biotools.umassmed.edu/bioapps/primer3). In this study, the 18srRNA gene was
retained as the housekeeping gene.
5.2.4.2. Gradient PCR
The stock and working solutions of the primers were made at concentrations of 100 µl and
20 µM respectively. The gradient PCR was performed with Bio-Rad My CyclerTM thermocycler
at temperatures varying between 52 and 66°C. Pure species of PCR products were obtained
by electrophoretic separation. The PCR products were run on a 2% agarose gel in 0.5X TBE
(Tris-borate-EDTA) buffer for 75 minutes at 400 volts.
5.2.4.3. Bulk PCR and Band elution of PCR product
To have sufficient amounts of PCR product for cloning and sequencing a total of 50 µl of the
reaction at each particular temperature was loaded and ran on a 1.5% agarose gel in 1X TBE
(Tris-borate-EDTA) buffer stained with Gel Red. The specific bands of interest were cut and
purified from gel slices, following the instructions of the manufacturer (Wizard SV Gel and
PCR Clean –up System, Promega, USA).
5.2.4.4. Cloning
Ten ligation mixes were prepared in advance, containing 5 µl ligation buffer, 1 µl vector, 3 µl
insert, and 1 µl T4 enzyme. 50 µl of thawed TOP10 competent E.coli was supplemented with
2 µl of a ligation mixture and incubated on ice for 20 minutes. Further, a heat shock of 42°C
was applied for 70 seconds after which the E.coli were immediately placed back in the ice.
950 µl of SOC medium (Tryptone 2%, Yeast Extract 0.5%, NaCl 0.05%, KCl 0.02%) was added
and the pH adjusted to at 7. Next, 1.8 ml of filtered glucose 20% and 0.5 ml filtered MgCl2
(2M) was added, and the mixture incubated at 37°C at 210 rpm for 1hour. Afterward, a
sample of 30, 150, 300 µl was spread on LB supplemented ampicillin (100 mg ml-1) plates
and grown in an incubator at 37°C for 16 hours. A single colony was picked up, and colony
PCR was performed to see only for positive clones. These clones were picked and grown
overnight in LB broth containing ampicillin.
5.2.4.5. Plasmid extraction and sequencing
The protocol for plasmid extraction is described by the manufacturer of the kit (Wizard Plus
Minipreps DNA purification system, Omega). NanoDrop 2000 (Thermo Scientific) measured
Chapter 5 PHB-A regulates immune response in challenged mussel larvae
115
the concentration of that plasmid. The number of plasmid copies was calculated according
to the formula of Whelan et al. (2003) and used to build the standard curve for each gene.
The concentration of the primers was between approximately 10 and 20 ƞg µl-1 and the final
volume was 10 µl. Primers T7 and SP6 were used as reverse and forward sequencing
primers, respectively. The genomic sequencing company LGC (Germany) conducted the
sequencing. The software Vector NTI version 15.0 was used to edit the sequence database.
The selected primer sequences were blasted on NCBI to verify their specificity for the
respective AMPs genes.
5.2.5. Real-time qPCR standardization of primer concentrations
The concentration of genes was optimized based on the manufacturer’s instructions
(Thermo Scientific Maxima SYBR Green/ROX qPCR Master Mix (2X)). Each primer was
prepared at different concentrations varying from 0.1 to 0.35 µM to select the optimal level
for defining the standard curve. A standard curve was drawn by plotting the natural log of
the threshold cycle (CT) against the natural of the number of molecules. The plasmids were
serially diluted from 102 to 106 plasmid copy µl-1. The standard curve was run in triplicate per
sample in the StepOneTM Real-Time PCR System thermal cycler (Applied Biosystems,
Belgium). The concentration of the primer that gave an optimal efficiency of 90 – 110 % with
a slope between -3.1 and -3.6 was selected to determine the standard curve for CT value
calculations.
5.2.6. Total RNA extraction and Reverse Transcription
Before the RNA extraction, the larvae were homogenized using the stomacher homogenizer
machine (Minibeabbeater, Biospec products, Branson 1200 Model B1200E-1, USA). Tissue
debris of the larvae was removed using the Qiashredder apparatus (Qiagen, Hilden,
Germany) to avoid clogging of the RNA extraction columns. Total RNA was extracted using
the SV Total RNA Isolation System kit (Promega, USA) following the manufacturer’s
instructions. Extracts were subsequently treated with DNase I (Fermentas, Germany) to
remove the remaining DNA. The RNA concentration was checked with the NanoDrop 2000
(Thermo Scientific) and adjusted to 500 ng µl-1 in all samples. The complete DNA degradation
within the RNA samples was confirmed by running the DNase-treated RNA sample in the
Chapter 5 PHB-A regulates immune response in challenged mussel larvae
116
PCR. After confirmation of the RNA quality by electrophoresis, it was stored at – 80oC for
subsequent use.
Reverse transcription was performed with a RevertAidTM H minus First strand cDNA
synthesis kit (Fermentas GmbH, Baden-Württemberg, Germany) following the
manufacturer’s instructions with some modifications (Ruwandeepika et al., 2011). Briefly, a
mixture of 1 μg RNA and 1 μl random hexamer primer solution was prepared. Then, 8 μl of
the reaction mixture containing 4 μl of 5x reaction buffer (0.25 mol−1 Tris-HCl pH 8.3, 0.25
mol−1 KCl, 0.02 mol−1 MgCl2, 0.05 mol −1 DTT), 2 μl of 0.01 mol−1 dNTP mix, 20 units of
ribonuclease inhibitor, 200 units of RevertAidTM H minus M-MuLV Reverse Transcriptase
was added. The reaction mixture was incubated for 5 min at 250C followed by 60 min at
420C. The reaction was terminated by heating at 700C for 5 min and then cooled to 40C.
cDNA samples were checked by PCR and stored at −200C for further use.
5.2.7. Real-time PCR
Real-time PCR was used to quantify the level of expression of the selected antimicrobial
peptide genes. This procedure was performed using Maxima® SYBR Green/ROX qPCR Master
Mix (Fermentas, Fisher Scientific, Erembodegem, Belgium) as described previously by Yang
et al. (2014) with some modifications. Briefly, the reaction was performed in a StepOneTM
Real-Time PCR System thermal cycler (Applied Biosystems, Belgium) in a total volume of 25
μl, containing 12.5 μl of 2 × SYBR Green master mix, 300 nM of forward and reverse primers
and 2 μl of template cDNA. The thermal cycle parameters used for the real-time
amplification were an initial activation at 500C for 2 minutes, initial denaturation at 950C for
10 min followed by 40 cycles of denaturation at 950C for 15 s and primer annealing at 600C
(gene 18srRNA), 630C (genes mytimycin, and mytilinB) , and 58oC (genes lysozyme and
defensin) and elongation at 60oC for 1 min. Dissociation curve analysis in the real-time PCR
was performed to check for the amplification of untargeted fragments. Data acquisition was
carried out with the StepOneTM Software.
5.2.8. Real-time PCR analysis (2-ΔΔCT Method)
The real-time PCR was validated by amplifying serial dilutions of cDNA synthesized from 0.5
μg of RNA isolated from mussel larvae samples. Serial dilutions of cDNA were amplified by
Chapter 5 PHB-A regulates immune response in challenged mussel larvae
117
real-time PCR using gene specific primers. ΔCT (average CT value of target – average CT value
of 18srRNA) was calculated for the different dilutions and plotted against the cDNA
concentration. The slope of the graph was almost equal to 0 for all four target genes.
Therefore, the amplification efficiency of reference and the target genes was considered to
be equal. Based on this precondition, real-time PCR data were analyzed using the 2-ΔΔCT
method (Schmittgen and Livak, 2008).
The relative expression was calculated as Relative expression = 2-ΔΔCT.
With ∆ΔCT = ∆CT,target – ∆CT, control
∆CT,target = CT, target, time x – CT, 18srRNA, time x
∆CT, control = CT, control, time 3 – CT, 18srRNA, time 3
RNA extracts from unchallenged mussels taken at 3h were used as a reference: expression in
this sample was set at 1 and all other data were normalized accordingly. The 18SrRNA gene
was used as a reference gene.
5.2.9.Phenoloxidase activity
The protocol as reported for Artemia Baruah et al. (2011) was slightly modified for use in
mussel larvae (De Rijcke et al., 2015). Briefly, based on sufficient cellular material (> 0.1 g),
the enzymatic transformation of L-3, 4-dihydroxyphenylalanine (L-DOPA) to dopachrome can
be used to determine the phenoloxidase (PO) activity of tissues. Before the actual PO
analysis, the homogenizing buffer (pH 7.5) was made (0.43% NaCl, 1.25 mM EDTA, 0.5%
Triton-X, 5 mM CaCl2). With this buffer, a 0.5 mM stock solution of L-DOPA was prepared (all
chemicals purchased from Sigma-Aldrich, Germany). Then, larvae (10% w:w) were
homogenized in the buffer using a pestle and stored overnight at 40C. Tube filters (0.22 µm)
removed cellular debris the following day through centrifuging (10,000 g, 20 min). Triplicate
20 µl aliquots of the resulting larval protein extracts were placed in a 96-well tissue culture
plate, and 200 µl of the L-DOPA solution was added to each well. Blank homogenizing buffer
samples were included for determining the non-enzymatic dopachrome production. The
tissue culture plates were dark-incubated at 300C, and absorbance (λ = 490 nm) was
measured twice a day for the next 48 hours using the Tecan spectrophotometer (Tecan I-
Chapter 5 PHB-A regulates immune response in challenged mussel larvae
118
Control). For all treatments, differences in average optical densities at time t and 0 were
calculated.
5.2.10. Statistics and analysis
Data analysis was carried out using the Statistical Package for the Social Sciences (SPSS
version 23). Statistical significance of differences in survival between treatment groups was
assessed using a one-way analysis of variance (ANOVA) followed by Tukey's post hoc test.
To study the effect of the treatments on expression levels (∆CT) of the different genes and on
PO a repeated measures ANOVA taking account of the replicate measurements was
performed, with treatment and time as factors. The significance of the interaction between
treatment and time was tested. In case the interaction effect was significant, a one-way
ANOVA or t-test was performed for each time point followed by post-hoc tests with
Bonferroni correction. For all statistical analysis a 5% significant level was used. The changes
in expression between a 0.5 and 2- fold threshold are often not considered as biologically
relevant (Figure 5.2, Figure 5.4, and Table 5.3).
5.3. Results
5.3.1. Survival
Survival of mussel larvae in Experiment 1 at 6h, 12h, and 24h was 100% for all treatments
(data not shown). However, significant differences were observed between the treatments
48h post-exposure, whereby the addition of PHB-A lowered the mortality for the larvae
challenged with V. coralliitycus (L+VC+PHB-A) compared to challenged larvae without PHB-A
treatment (L+VC). The survival was highest for non-challenged larvae L (CT) and L+PHB-A
(Figure 5.1).
Chapter 5 PHB-A regulates immune response in challenged mussel larvae
119
Figure 5. 1: Experiment 1. Survival (%) of mussel larvae after 48h exposure to V. coralliilyticus (105 CFU mL-1) in the presence or not of PHB-A (1 mg L-1). Data are expressed as mean ± Standard Error (SE) of three replicates. Different letters indicate significant differences (p < 0.05).
5.3.2. Design of immune gene primers for blue mussel larvae
Table 5.2 gives an overview of the primers that were designed to evaluate the gene
expression of the 4 selected antimicrobial peptides in mussel larvae by qPCR, using 18srRNA
as a housekeeping gene. A standard curve based on the amplification efficiency for each
gene was established (Table 5.3).
Chapter 5 PHB-A regulates immune response in challenged mussel larvae
120
Table 5. 2: Characteristics of the primers used for expression analysis with RT-qPCR
No Gene GenBank
accession no.
Primer Amplicon
length (bp)
Annealing
temperature
1 18srRNA L33448.1 F: TTAAGAGGGACTGACGGGGG 93 60 °C
R: TTGGCAAATGCTTTCGCAGT
2 Mytimicin JN825739.1 F: CCATTGTTGGGACTGCACTG 123 63 °C
R: CGGTCCCCACGTTCATAACA
3 MytilinB AF177540.1 F: CAGAGGCAAGTTGTGCTTCC 125 63 °C
R: GGAATGCTCACTGGAACAACG
4 Lysozyme AF334662.1 F: CCAACGACTATTCATGTGCCT 122 58 °C
R: TCCCCTTGGACCTCCATTGT
5 Defensin JN935271.1 F: CCCAGCACCGATTCTAGGAC 140 58 °C
R: AAGCGCCATATGCTGCTACT
Table 5. 3: RT-qPCR amplification efficiencies for all immune genes
No. Gene Funtion Slope R2 Amplification efficiency (%)
1 18SrRNA Housekeeping gene -3.5 0.99 93
2 Mytimycin Target gene -3.2 0.99 103
3 MytilinB Target gene -3.1 0.98 109
4 Lysozyme Target gene -3.3 0.98 100
5 Defensin Target gene -3.3 0.98 102
Chapter 5 PHB-A regulates immune response in challenged mussel larvae
121
5.3.3. Impact PHB-A and/or pathogen on the expression of the antimicrobial peptides
(Experiment 2).
The addition of the pathogen (L+VC) led to a significant down regulation of mytimycin after
12 h in comparison to the control treatment. Remarkably none of the genes was upregulated
upon Vibrio challenge neither at 6 nor 12 h. The addition of PHB-A on the other hand led to a
significant up-regulation of mytimycin and defensin after 6 h relative to the control. This
effect disappeared after 12h (Figure 5.2A & D). After 6 h, in the presence of Vibrio, PHB-A
down regulates mytimycin and lysozyme. After 12 h this is only the case of lysozyme. The
levels of defensin gene expression were equal for all treatments and time points except for
treatment L+PHB-A+VC at 6h post-exposure (Figure 5.2D). The overall expression pattern,
across treatments and time points, is rather similar for mytimycin and defensin. Both Vibrio
challenge and PHB-A seem to down regulate lysozyme expression at both time points.
Chapter 5 PHB-A regulates immune response in challenged mussel larvae
122
Figure 5. 2: Experiment 2. Expression of immune genes (A) mytimycin, (B) mytilinB (C) lysozyme, and (D) defensin in unchallenged (L) and challenged (L+VC) mussel larvae with V.coralliilyticus at 105 CFU mL-1 (n=3, mean ± standard error). PHB-A (1 mg L-1) was added to the mussel larvae culture water 6 h before the pathogen. The expression of AMP genes in the control treatment (CT) was regarded as 1.0. Different small and capital letters indicate significant differences between the treatments for the sampling points 6 h and 12 h post challenge respectively. Asterisks denote a significant difference between sampling point 6 h and 12 h post challenge for a particular treatment (T-test, P < 0.05).
5.3.4. Phenoloxidase activity (Experiment 3)
PHB-A significantly increased the phenoloxidase activity during the 48h of the assay (Figure
5.3). However, not only PHB-A but also V.coralliilyticus triggered a significant increase in
larval phenoloxidase activity (p < 0.05) as compared to the negative control (unchallenged).
Especially, PO activity was significantly increased in the double treatment where the
presence both of PHB-A and pathogen resulted in a higher PO activity relative to the control
but also to the single treatments.
Figure 5. 3: Phenoloxidase activity (PO) in the mussel larvae collected after 48 h exposure to the different treatments (mean ∆OD±SE, n=3). Data represent the increase in dopachrome over a 48 hours time frame in which PO activity in the 4 samples was measured. Data are expressed as mean ± Standard Error (SE) of three replicates. Different letters indicate significant differences for a given time point (P < 0.05).
Chapter 5 PHB-A regulates immune response in challenged mussel larvae
123
5.3.5. Time window of gene expression of AMPs (Experiment 4)
Overall, the expression of the AMPs genes in exposed mussel larvae appeared to be up-
regulated during the challenge test with V.coralliilyticus and to rapidly increase from 24h
onwards following exposure (Figure 5.4 A, B, and D). At 48 hrs, mytimycin, defensin, and
mytilinB are expressed 53, 35.7 and 8.3-fold higher respectively, in comparison to the
expression at time point 3h. During the 48h challenge test, the expression levels of the
lysozyme are down-regulated (Figure 5.4C) except at sampling point 6h, when an up-
regulation was noticed (Table 5.4). Differences between treatments because of a challenge
at subsequent sampling point are shown Table 5.3.
Figure 5. 4: Expression of immune genes (A) mytimicin, (B) mytilinB, (C) lysozyme and (D) defensin in challenged mussel larvae with V. coralliilyticus at 105 CFU mL-1 (n=3, mean ± standard error). The expression of AMPs gene in the negative control was regarded as 1.0 at 3h.
Chapter 5 PHB-A regulates immune response in challenged mussel larvae
124
Table 5. 4:The outcome of independent t-test between challenged and un-challenged mussel
larvae
Gene Post exposure (h)
6 9 12 18 24
Mytimycin *↑ *↑
MytilinB *↓ *↓ *↑
Lysozyme *↑ *↓ *↓
Defensin *↑ *↓ *↑
Asterisks denote a significant difference between challenged and un-challenged larvae at a particular sampling point relative to time point 3 h after exposure (t-test, p < 0.05). Symbols represent an up-regulation (↑), or down-regulation (↓). The sample of unchallenged treatment at 48h was not analyzed. The changes in expression between a 0.5 and 2- fold threshold are often not considered as biologically relevant, and are hence not included in the table. Difference in AMP expression in samples of challenged and unchallenged mussel larvae are verified by t-test at P < 0.05.
5.4. Discussion
The pathogenicity of this V. corallilyticus strain was again established in this study,
confirming the validity of the strain as a pathogen using the described challenge protocol.
Knowledge on the immune system in bivalve larvae is scare. In order to develop a tool box
for studying the immune response in bivalve mollusk, several studies concentrated on
designing specific primers for AMPs genes. Adults and larvae of M. galloprovincialis have
been studied quite extensively: primers for mytilin, myticin, defensin, heat shock protein
gene 70 (HSP70), mytilinB, lysozyme and for the house-keeping genes 18srRNA and 28srRNA
have been reported (Mitta et al., 1999a, Mitta et al., 1999b, Mitta et al., 2000a, Mitta et al.,
2000b, Cellura et al., 2007, Li et al., 2008).
The primers developed for M. galloprovincialis were tested at several occasions during this
research and did not work well for the blue mussel M. edulis larvae, challenged with V.
coralliilyticus. In addition, the time window of gene expression of AMPs in the larval phase of
Chapter 5 PHB-A regulates immune response in challenged mussel larvae
125
M. edulis is not determined yet. In fact, there is no information on the gene expression of
mytimycin in this species although it is abundantly present in the hemolymph of M. edulis.
Therefore it was necessary to first develop the primers for the 3 antimicrobial peptides that
were reported to be present in M. edulis adults (Charlet et al., 1996) as well as for the
hydrolytic enzyme lysozyme.
The selection of the housekeeping gene 18srRNA for mussel larvae appeared to be the right
choice, based on its expression in both untreated and treated mussel larvae and its stability
in expression, independently from the treatment (data not shown). This allowed us to
establish the kinetics of expression of the AMPs genes and lysozyme gene in blue mussel
larvae in response to a V.coralliilyticus challenge.
Phenoloxidase activity is commonly found in invertebrates (Smith and Söderhäll, 1991) and
is present in hemocytes of the adult mussel and larvae as well (Coles and Pipe, 1994,
Dyrynda et al., 1995). PO activity have been detected in all the disaggregated larval cells
from M. edulis, showing a stronger reaction in the veligers (Dyrynda et al., 1995) and also
previously observed in cells from the inner mantle fold of the pediveliger of O. edulis,
(Cranfield, 1974). Larval M. edulis cells are described to be capable of phagocytosis (Dyrynda
et al., 1995). Bacterial infection can cause a significant increase in PO activity in the whole
hemolymph of adult bivalves Crassostrea madrasensis and Chlamys farreri (Cong et al., 2008,
Gijo Ittoop et al., 2010). Recently De Rijcke et al. (2015) determined a significant increase in
PO activity in blue mussel larvae challenged with the toxin of harmful microalgae. The
implications of an elevated larval PO activity are, however, largely unknown as the
immunological role of PO is still poorly understood.
In this study, PO activity was detected in homogenates of M. edulis larvae and results show
that PO enzyme activity was elicited in non-infected mussel larvae in response to larvae fed
PHB-A. These findings are consistent with previous studies in other aquaculture species such
as Artemia (Baruah et al., 2011) and may at least partly explain why mussel larval survival
increased when PHB-A was added to the rearing water in this study (Figure 1), also observed
in previous experiments (Hung et al., 2015).
For a long time, mollusk hemocytes have been reported to be responsible for bactericidal
activities mediated against numerous toxic compounds (Li et al., 2008), such as
Chapter 5 PHB-A regulates immune response in challenged mussel larvae
126
antimicrobial peptides (Charlet et al., 1996) and lysozyme (McHenery et al., 1979), and by
phenoloxidase activity (Coles and Pipe, 1994). During the last decade, knowledge of immune
processes in adult bivalves have been significantly improved by the development of genomic
tools (Fleury et al., 2009, De Lorgeril et al., 2011, Fleury and Huvet, 2012). However, the
immune characteristics of larvae remain under-investigated, notably due to the difficulty to
isolate hemocytes from larvae. Elston (1980) observed phagocytes (described as
coelomocytes) containing bacterial fragments in the visceral cavity of C. virginica veliger
larvae. Dyrynda et al. (1995) have confirmed that some elements of the immune system in
adult M. edulis are also present in the trochophore and veliger larvae of this species.
Recently, several studies reported that hemocytes appear during the gastrular –
trochophore developmental stages. At these stages, haemocyte generation/proliferation
and induction of immune related genes are concomitant (Tirapé et al., 2007). In the mussel
Mytilus galloprovincialis, the antimicrobial peptides mytilin and defensin have been found
during and after larval metamorphosis (Mitta et al., 2000a). Furthermore, lysozyme-like and
hydrolysis enzyme activities are present in C. gigas larvae. Bivalve hemocytes seem to
respond to bacteria stimulation with a burst of respiratory activity similarly to the
respiratory burst of mammalian phagocytes, resulting in the generation of various free
radicals or reactive oxygen species (ROS) that eliminate the phagocytized material
(Labreuche et al., 2006, Lambert et al., 2007). ROS production are controlled by antioxidant
defense systems to limit tissue peroxidation (Genard et al., 2013). The generation of ROS
metabolites has been recorded in both trochophore and D-larvae cells of M. edulis (Dyrynda
et al., 1995).
Genard et al. (2013) reported that bacterial infections can have serious consequences for the
survival of bivalve larvae. When a pathogen infects a host, multiple reactions occur, initiated
both by the pathogen in an attempt to survive and multiply, and by the host in an attempt to
eliminate the pathogen. For the host, changes induced by infection can be seen at several
levels such as molecular, physiological and biochemical processes. First, infection induces
the activation of both cellular and humoral immune responses that act together to kill and
eliminate the infecting bacteria. In bivalves, immunity is constituted of innate processes
including various serologically active molecules including antimicrobial factors and of the
Chapter 5 PHB-A regulates immune response in challenged mussel larvae
127
phagocytosis accompanied by production of oxygen metabolites and the release of
lysosomal enzymes.
After engulfment of microorganism, the phagosome undergoes maturation with acidification
and sequential fusion with endosomal and lysosomal compartments including granules,
which contain diverse families of antimicrobial peptides/proteins (Gueguen et al., 2009,
Schmitt et al., 2012). The release into the phagosome of microcidal compounds leads to the
rapid neutralization/degradation of the engulfed microorganisms. Among the hydrolytic
enzymes that are released into the maturing phagosome, lysozymes are known play an
important role in microbial destruction due to their lytic properties on the peptidoglycan of
the bacteria cell wall (Hancock and Scott, 2000). It is likely that AMPs and lysozymes stored
in hemocyte cytoplasmic granules are delivered to the phagosome to kill phagocytosed
bacteria (Bachère et al., 2015).
The existence and diversity of AMP has been revealed both in M. edulis (Charlet et al., 1996)
and M. galloprovincialis (Hubert et al., 1996). Cellura et al. (2007) described how AMPs
respond specifically to the challenges, confirming that at least some of the innate immune
mechanisms are specifically orientated. Mytimycin is linked to fungal infection (Charlet et al.,
1996, Sonthi et al., 2011) and also shows very low expression in the velum of M.
galloprovincialis larvae, when challenged with Vibrio anguillarum (Balseiro et al., 2013). This
is in contradiction to the earlier findings of Mitta et al. (2000a) who found that both mytilinB
and defensin genes in M. galloprovincialis are constitutively expressed and not inducible
following Vibrio alginolyticus (DSMZ 2171) bacterial challenge (possibly the host response is
strain dependent). In addition, the expression of both genes mytilinB and defensin are
recorded to be developmentally regulated, and neither gene is expressed in mussels until
after larval settlement and metamorphosis according to Mitta et al. (2000a). This study,
therefore, focused on immune gene expression in D-larvae both by PHB-A and Vibrio
coralliilyticus at two specific time points namely 6 and 12 h after challenge. Overall the
results seem to indicate that in general in this short time frame, neither PHB-A nor challenge
seem to upregulate the measured immune genes (apart from some upregulation after 6h by
PHB-A) This might indicate that the infection process had not started yet (in which case the
fluctuations are stochastic) or that this particular species is able to control the host response
Chapter 5 PHB-A regulates immune response in challenged mussel larvae
128
at the transcriptional level (assuming that infection had started). The PHB-A treatment did
not have a major positive effect either and hence does not seem to contribute to the
capacity of the host to maintain expression of the tested genes (in this time frame). In view
of these observations immune genes expression was monitored over a longer time frame.
An experiment running over 48h demonstrated that mussel larvae (2-day old D-larvae)
regulate the tested genes from 24h post-exposure onwards. Mytimycin is the AMPs gene
with the highest expression in M. edulis larvae in response to the exposure to the pathogenic
bacterium V. coralliilyticus, followed by defensin and mytilinB. This result indicates that D-
larvae is either responding very late to the invading pathogen or that the pathogen is only
invading the host after 24 h exposure when an increased expression of the tested genes
becomes apparent. This is also in agreement with the results of the first experiment of this
study where mortality only occurs after 48 h. The former explanation would be in
accordance to the report of Balseiro et al. (2013) who stated that bivalve larvae are not
entirely immune-competent to combat infections by pathogens.
However the PO activity measurement, in larvae 48 hours after exposure, seems to point in
the other direction. Here PHB-A stimulates PO, possibly contributing to the capacity of the
larvae to handle a Vibrio challenge, in which case PHB-A acts as an immunostimulant. PO
activity is also increased upon Vibrio exposure, but that level of PO activity is insufficient for
protection against Vibrio. A double exposure, PHB-A, and Vibrio, increased PO activity even
further. These data seem to suggest that some immunological capacity is available in this
developmental stages and that it can be steered, such as by the addition of PHB-A.
Taken together it is apparent that the immunological response in larvae as monitored by
gene expression can only be interpreted at its best if simultaneously the infection process is
visualized (by e.g. immunohistochemistry). Such data would allow a better understanding of
the dynamics of the immune response.
In conclusion, this study reports the successful development of 5 primers (3 AMPs, 1
hydrolytic enzyme, 1 house-keeping gene) to monitor the immune response of blue mussel
(M. edulis) larvae. PHB-A regulated immune gene expression was found in challenged mussel
larvae, as revealed by PO activity in unchallenged and challenged (48h after exposure)
Chapter 5 PHB-A regulates immune response in challenged mussel larvae
129
larvae. This may at least partly explain why larval survival increases in the presence of PHB-
A.
It was demonstrated that 2 day-old blue mussel larvae activate the expression of the three
AMPs, mytimycin, mytilinB and defensin upon invasion by the pathogen V. coralliilyticus. The
level of expression is up- and down-regulated in the first 12hours after exposure in an
unclear pattern, but rapidly increases from 24 to 48 h post-exposure. The expression of
lysozyme, however, remains very low and stable during the first 48 h after challenge.
Mytimycin gene is one of the genes with the strongest expression in blue mussel larvae.
Acknowledgments
The Vietnam International Education Development (VIED) and Vlir-OI project (“Ensuring
bivalve seed supply in Central of Vietnam”, 2011-068) financial supported this work through
a doctoral grant to Nguyen Van Hung. The Research Foundation - Flanders (FWO, Belgium),
supports Peter DS as a post-doctoral research fellow. The guidance and assistance of the
staff of the Artemia Reference Center (Ghent University, Belgium) are highly appreciated.
We wish to thank Dr. Linsey Garcia-Gonzalez (VITO, Belgium) for providing the PHB-A. Dr.
Kesarcodi-Watson (Cawthron Institue, New Zealand) kindly provided the bacterial strain V.
corallilyticus. We wish to thank Dr. Abatih Emmanuel (FIRE, University of Ghent) for
statistical guidance.
130
131
GENERAL DISCUSSION
CHAPTER 6: GENERAL DISCUSSION
132
Chapter 6 General discussion
133
6.1. Introduction
In bivalve aquaculture species, susceptibility to viral and bacterial infections is higher in
larvae than adults (Lane and Birkbeck, 2000, Arzul et al., 2001). Major knowledge gaps still
exist in our understanding of the internal defense mechanisms in the early life-history of
bivalves. To date, most immunological studies in bivalves have been performed on adults,
probably because it is not possible to obtain blood samples from larvae and young juveniles
needed to study the hemocytes responsible for the internal defense (Luna-González et al.,
2003). Several studies reported though that hemocyte appears during the gastrular –
trochophore developmental stages and that, hemocyte generation/proliferation and
induction of immune related genes are concomitant at these stages (Tirapé et al., 2007).
Therefore, this study accepted the challenge and concentrated on the gene expression of
immune defense effectors in blue mussel (Mytilus edulis) larvae. Advances in
characterization of these effectors in larvae may lead to a better understanding of the
immune defense mechanisms and give new insights into health management and diseases
control in the larval culture of bivalves.
Polyhydroxybutyrate (PHB) is a typical storage compound of carbon and energy that occurs
widely in prokaryotes. This polymer can be accumulated up to 90% of the cellular dry weight
of some bacteria (Uchino et al., 2008). PHB can be degraded extracellularly by many types of
bacteria that secrete specific extracellular PHB depolymerases into the environment or by
intracellular mobilization of PHB in the accumulating strain itself. Originally, the interest for
PHB was based on its medical and industrial application possibilities (Anderson and Dawes,
1990, Chen and Wu, 2005), and it was not until recently that PHB was identified as a
potential bio-control agent for aquaculture (Defoirdt et al., 2007b). The use of crystalline
PHB (i.e. extracted from the bacterial cells, PHB-C) as a bio-control agent has been tested
and was found promising to control vibriosis in different aquaculture species (Nhan et al.,
2010, Sui et al., 2012). However, the efficiency of PHB was shown to be considerably higher
when supplied in the amorphous state (i.e. still contained in bacteria cell, PHB-A) (Halet et
al., 2007). Indeed, the impact of both forms of PHB on aquatic species is different due to a
number of confounding factors such as the particular shape, size, digestibility, and others (cf
134
infra). In this study, PHB was applied as a pre-biotic compound in the larval culture of a
model bivalve species, the blue mussel Mytilus edulis (Figure 6.1). The effects of crystalline
and amorphous PHB were evaluated (1) based on the growth performance and survival of
mussel larvae and early-set spat under normal rearing conditions, (2) based on the
interference with virulence factors of mussel pathogens in vitro and the results of larval
challenge tests in vivo, and (3) based on the larval innate immune response. In this chapter,
our results are confronted with the existing literature and discussed in the light of research
needs and application opportunities in hatcheries.
Figure 6. 1: Schematic overview of the study on the mode of action of PHB in mussel larvae
culture.
6.2. The effect of PHB on bivalve larvae and spat performance
The successful application of PHB in aquaculture systems has been explored in different
species and at different life stages. Based on these results, it can be stated that the
beneficial effects of PHB, including acting as an antimicrobial agent and changing the
microbial composition in the digestive tract of the cultured animal, depend on several
Mussel larvae
PHB
Antimicrobal
activity/protection
Innate immune
response
Survival & growth
performance
Conclusion
Chapter 6 General discussion
135
factors such as application method, a form of PHB, concentration and aquaculture species.
Depending on the feeding behaviour of the target species, PHB-C can be administered either
directly to the culture water (giant freshwater prawn larvae (Nhan et al., 2010)), as a
compound of formulated feeds (European seabass (De Schryver et al., 2010), Siberian
sturgeon (Najdegerami et al., 2012)) or as enrichment of live feed (giant freshwater prawn
larvae (Thai et al., 2014), Chinese mitten crab (Sui et al., 2014). Blue mussel larvae are active
filter feeders, so the direct application of both forms of PHB in the culture water proved to
be successful (Chapter 3).
The supplementation of PHB-A into the rearing water of blue mussel larvae led to better
performances than the supplementation of PHB-C. Indeed, this result may be due to their
inability to efficiently metabolize PHB-C (Chapter 3), despite their proven ability to ingest it.
In contrast, the addition of PHB-A at a concentration of 1.0 mg L−1 did have a positive effect
on the larval survival. This may be attributed to the fact that PHB-A is better biodegradable
and has a smaller size than PHB-C (Halet et al., 2007). At this stage the exact mechanism by
which the PHB polymer is broken down inside the intestinal tract of animals is not known,
i.e. whether it is mainly driven by physicochemical processes or by biological activity of the
host and/or microorganisms present in the gut (Nhan et al., 2010). Defoirdt et al. (2007b)
and Liu et al. (2010) suggested that the metabolism of PHB in brine shrimp nauplii occurs at
least partially by the enzymatic activity of the host. Based on the results of our study, it can
be hypothesized that PHB-degrading enzymes that would enable mussel larvae to digest the
compound are lacking since D-stage mussel larvae have an immature digestive system.
Supplementing the strongest PHB-degrading bacterium ARC4B5, isolated from PHB-treated
mussel larvae, to the larval cultures that received PHB-A, did not result in an increase in
survival, on the contrary, seemed to lower the growth performance of the larvae. This is in
contrast to the findings of Liu et al. (2010) who reported that the application of PHB-
degraders as pre/probiotic in combination with PHB was better than PHB alone. As a
consequence, it would seem that enzymes play a more important role in PHB-digestion than
microbial activity. However, it is not clear whether the immature digestive system of D-stage
larvae possess depolymerases.
Chapter 6 General discussion
136
It should also be kept in mind that PHB-A does not contain solely PHB, as is the case of PHB-
C, but also dead bacterial cell walls. The latter may also trigger an increased immune
response (Nathalie, 2001) and ultimately lead to less mortality. More and more evidence is
being obtained in other species for this alternative explanation of the observed beneficial
effect, basically indicating that PHB effects are multifactorial
The supplementation of PHB to the culture water of the mussel larvae did not result in faster
growth nor in an improvement of spat performance in terms of growth or survival regardless
form and concentration. In contrast, De Schryver et al. (2010) found that supplementing the
diets of European sea bass with 2% or 5% crystalline PHB led to a significant increase in fish
weight compared to fish fed the control feed (0% PHB). Nhan et al. (2010) and Thai et al.
(2014) demonstrated the faster development of giant freshwater prawn larvae fed with
Artemia nauplii enriched with crystalline or amorphous PHB respectively. Similarly, Sui et al.
(2012) showed a growth- promoting effect of crystalline PHB on Chinese mitten crab larvae.
The positive effect of PHB on fish growth can be explained by the fact that the monomer β-
hydroxybutyrate (β-HB) resulting from degradation (enzymatic or microbial) is known to be
used as carbon and energy source for fish (Kato et al., 1992, Patnaik, 2005, De Schryver et
al., 2010). Mussel larvae, however, do not seem to use PHB and/or its degradation products
as fuel for development and growth. I hypothesize therefore that either the mussel larvae
are not capable of degrading PHB or that the monomer β-HB is not used as a ketone body by
this marine bivalve in contrast to vertebrates and crustaceans (Weltzien et al., 1999). The
latter is supported by the findings of Stuart and Ballantyne (1996) who did not detect any
activity of the enzyme β-hydroxybutyrate dehydrogenase in the gills or digestive gland of
adult Mytilus edulis, which indicates that the mussels are not capable of producing nor using
β-HB. Besides, the lack of this enzyme seems to be general in marine mollusk. In other
words, whilst PHB seems to stimulate the immune system of blue mussel larvae resulting in
a positive effect on the survival this phenomenon has an energetic cost which affects
growth, and the production of ketones does not seem to compensate for that since marine
bivalves mollusks are not able to use β-HB ketones. All this requires further verification.
Chapter 6 General discussion
137
6.3. The effect of poly-β-hydroxybutyrate on the microbial composition in the digestive
tract of blue mussel larvae
Establishing and maintaining beneficial interactions between the host and its associated
microbiota are critical requirements for host health. Although the gut microbiota has
previously been studied in the context of inflammatory diseases, it has recently become
clear that this microbial community has a beneficial role during normal homeostasis,
modulating the host’s immune system (Sommer and Backhed, 2013). Concerted research
efforts have concentrated on optimizing livestock production (both terrestrial and aquatic)
with eco-friendly alternatives to the therapeutic use of antimicrobials. In several previous
studies, PHB was used as a prebiotic in aquaculture species, offering some benefits to the
host primarily via the direct or indirect modulation of the gut microbiota. PHB interacts with
the microbiota inhabiting the gut and induces modifications at the microbial community
level and consequently affects the host level. In fact, the presence of PHB in the gut of the
animal has been demonstrated to induce a steering effect on the gut microbial community in
juvenile European sea bass (De Schryver et al., 2010), and in Siberian sturgeon fingerlings
(Najdegerami et al., 2012) where the gut pH decreased from 7.7 to 7.2 suggesting that the
presence of PHB in the gut led to the increased production of short-chain fatty acids (De
Schryver et al., 2010). Nhan et al. (2010) reported that supplementation of PHB in the
culture water resulted in a decreased number of Vibrio spp. in the intestinal tract of
freshwater prawn larvae.
In our research (Chapter 3), it was shown for the first time that PHB tends to alter the gut
microbiota in mussel larvae regarding relative abundance, dynamics, and genetic diversity.
Bacteria that are enhanced by PHB may represent niche populations able to metabolize PHB
during the gastrointestinal passage. The capacity to produce extracellular PHB depolymerase
is a widespread phenomenon amongst bacteria and was demonstrated under aerobic,
anaerobic and thermophilic conditions (Tokiwa and Ugwu, 2007). A total of 22 strains of PHB
degraders were isolated from the digestive system of mussel larvae and their degrading
properties demonstrated. Of these 22 strains, 16 PHB-degrading isolates seemed to belong
to the genus Pseudoalteromonas, of which isolate ARC4B5 showed the strongest PHB-
degrading activity.
Chapter 6 General discussion
138
Our study showed that the microbial community of mussel larvae fed PHB tended to be
more diverse than the control treatment, although not significantly. As a consequence, no
close link could be defined between survival and growth performance on the one hand and
the intestinal microbiota community structure, richness and diversity in the mussel larvae on
the other hand. This is in contrast to the findings of De Schryver et al. (2010) and
Najdegerami et al. (2012) who observed significant differences. A possible explanation
suggests that PHB degradation does not occur in the immature digestive tract of mussel
larvae because the transit time of the food particles is too short (Bayne et al., 1987). Mussel
larvae clear their gut in less than 2 hours which may prevent degradation of PHB both
enzymatically and microbially.
6.4. Effect of poly-β-hydroxybutyrate on disease resistance of bivalve larvae
Poly-β-hydroxyalkanoate polymers can be degraded into β-hydroxy short-chain fatty acids of
which β-hydroxybutyrate (β-HB) exhibits some antimicrobial, insecticidal, and antiviral
activities. The antimicrobial activity of β-HB is thought to be comparable to that of other
short chain fatty acids although the antibacterial mechanism(s) of these compounds are not
completely understood (Ricke, 2003, Tokiwa and Ugwu, 2007). The antimicrobial effect of β-
HB towards aquaculture pathogens Vibrio campbellii and Vibrio harveyi has previously been
investigated by Defoirdt et al. (2007b), who demonstrated that the growth-inhibitory effect
of β-HB was sensitive to the environmental pH. At pH 5, growth was completely inhibited, at
pH 6, growth was delayed and at pH 7, no inhibition could be observed (Defoirdt et al.,
2006b). It is probable that this pH-dependency can be explained by the fact that fatty acids
can pass the cell membrane only in their undissociated form, which is more prominent at
lower pH (Sun et al., 1998). In this study (Chapter 4), the effect of β-HB on the growth and
virulence of the bivalve pathogens was assessed in in vitro experiments at pH 7 and 8. It was
observed that β-HB affected the virulence factors’ activity of the bivalve pathogens rather
than the growth. The effect of β-HB on the virulence factors depended on the pathogenic
strain, the environmental pH and did not allow for a clear pattern to be distinguished. The
highest β-HB concentration (125 µM) inhibited some virulence factors of the pathogenic
bacteria such as hemolysis, phospholipase, but also stimulated caseinase in V. splendidus at
Chapter 6 General discussion
139
pH7 and V. coralliilyticus at pH8. In addition, β-HB had no effect on gelatinase, lipase, and
biofilm formation. The concentration of 125 µM is biologically speaking irrelevant for mussel
larvae and hence the results should be put in the right perspective.
The effect of PHB-A on larval survival during challenge experiments depended on various
factors: the pathogen, PHB-A concentration and exposure time. In general, survival of mussel
larvae that received PHB-A at a concentration of 1 mg L-1 PHB-A 6h before the challenge test
was higher compared to the survival of the larvae that received the PHB-A pre-treatment
24h before the challenge test. Larvae that received PHB-A 6h before the challenge showed a
55% and 25% increase in survival measured 96h after exposure to the pathogens V.
splendidus and V. coralliilyticus respectively, as compared to the controls. Increasing the
pretreatment from 1 to 10 mg PHB-A L-1 did not further improve the results.
These results validate V. coralliilyticus and V. splendidus as being pathogenic for M. edulis
larvae. Furthermore, it was demonstrated that PHB-A as a pre-treatment (6h) offers
protection to the mussel larvae and increases survival significantly during challenge tests.
6.5. Antimicrobial peptides (AMPs) immune response in bivalve mollusks
Bivalves lack an adaptive immune system and, therefore, do not possess immune memory.
Alternatively, they have developed an innate immune system involving cell-mediated and
humoral components used to recognize and eliminate pathogens (Gestal et al., 2007).
Antimicrobial peptides (AMPs) are essential elements of the innate host response to
microbial invasion (Gestal et al., 2007). The study of antimicrobial peptides is important to
increase our basic knowledge on shellfish immunity, but also to evaluate the potential of
these peptides as disease management tools in aquaculture.
They are usually characterized by their small size, heat-stability and a broad range of
antimicrobial activity (Licheng et al., 2009). Antibacterial activity was first reported in
mollusks in the ‘80s (Kubota et al., 1985) whereas the isolation and characterization of true
AMPs from the mussels Mytilus galloprovincialis (Hubert et al., 1996) and M. edulis (Charlet
et al., 1996) date back to 1996. Taking into account the features of their primary structure
and their consensus cysteine array, these peptides were classified into four groups: i)
mytilins, with five isoforms (A, B, C, D and G1) (Mitta et al., 2000a, Mitta et al., 2000c), ii)
Chapter 6 General discussion
140
myticins, with three isoforms A, B (Mitta et al., 1999a, Mitta et al., 1999b), and C (Pallavicini
et al., 2008) iii) defensins, found in both mussel and oysters, with two isoforms (MGD1 and
MGD2) in M. galloprovincialis; defensin A and B in M. edulis, two isoforms in the Pacific
oyster, Crassostrea gigas (Cg-Def1 and Cg-Def2), and AOD (American oyster defensin) in C.
virginica (Charlet et al., 1996, Mitta et al., 2000a, Seo et al., 2005, Gonzalez et al., 2007)
and iv) mytimicin, partially characterized from M. edulis plasma (Charlet et al., 1996).
In a first research line (Chapter 5), three genes coding for the AMPs mytimycin, mytilin B,
defensin and one gene coding for the hydrolytic enzyme (lysozyme) were selected to study
the immune gene expression in blue mussel larvae when exposed to the pathogen V.
coralliilyticus. The mytimicin gene is one of the AMPs only present in M. edulis, but not in M.
galloprovincialis whereas mytilinB, and defensin exists in both Mytilus species (Tincu and
Taylor, 2004). A first challenge was to develop the primers for AMPs that work specifically
for blue mussel (M. edulis) larvae.
Next, these home-designed primers were used to optimize the Real-time PCR protocol for
blue mussel larvae and to investigate the immune gene response of the mussel larvae when
challenged with V. coralliilyticus, as opposed to the traditional approach where functional
assays and histological studies determine the lesions and the interactions between host
immune system and pathogens (Figueras and Novoa, 2004). To date, most of the
information on mussel larval immunity is based on phagocytosis assays (García-García et al.,
2008) chemo-illuminescence production and nitric oxide release (Costa et al., 2009).
Information on gene expression of the immune response in mussel larvae tissue
homogenates is scarce. Mitta et al. (2000a) analyzed the expression of the genes encoding
for the AMPs mytimicin, mytilin B, defensin, and lysozyme in the hemocytes of adult animals
subjected to various stress factors, as well as in tissue homogenates during larval
development.
Overall the results seem to indicate that in a short time frame (up to 12 h), neither PHB-A
nor challenge seem to up-regulate the measured immune genes (apart from some up-
regulation after 6h by PHB-A). This might indicate that the infection process had not started
yet (in which case the fluctuations are stochastic) or that this particular pathogenic strain is
Chapter 6 General discussion
141
able to control the host response at the transcriptional level (assuming that infection had
started). The PHB-A treatment did not have a major positive affect either and hence does
not seem to contribute to the capacity of the host to maintain expression of the tested
genes (in this time frame). In view of these observations immune genes expression was
monitored over a longer time frame.
When considering a time frame of 48 h, the response of exposed mussel larvae appeared
soon after 3 hours, but a drastic increase in expression of mytimycin 48 h after exposure to
the pathogen as well as induced up-regulation of defensin and mytilinB from 24h post-
exposure onwards was observed. The latter is interesting since the expression of both genes
mytilinB and defensin are reported to be developmentally regulated, and not being
expressed in mussels until after larval settlement and metamorphosis (Mitta et al., 2000a).
These results are in agreement with the results of Gestal et al. (2007) who found that the
expression levels in carpet shells (Ruditapes decussates) increased from 24 to 48h after
exposure to a mixture of both dead and alive Vibrio anguillarum. When comparing the gene
expression of the 3 AMPs in infected mussel larvae, mytimicin was found to be highly
expressed, suggesting that the production of this AMP is quite important as a protection
mechanism in mussel larvae against invasive pathogenic bacteria.
This result indicates that D-larvae are either responding very late to the invading pathogen
or that the pathogen is only invading the host after 24 h exposure when an increased
expression of the tested genes becomes apparent. This is also in agreement with the results
of the first experiment where mortality only occurs after 48 h. The main clinical signs
observed in challenged scallop larvae for 24 h were bacterial swarms on the margins of the
larvae, extension and disruption of the velum, detachment of velum cilia cells and digestive
tissue necrosis (Beaz‐Hidalgo et al., 2010) and very high mortality (98 -100%) in challenged
oyster larvae less than 48 h (Rojas et al., 2015).
In addition, AMPs are found to be abundant in hemocytes which are an important barrier
defense in the mussel. Conversely, during pathogen exposure, the expression of the
lysozyme gene was stable and seemed not to be induced when the mussel larvae were
exposed to the pathogen V. coralliilyticus. This seems logical since lysozyme can be in both
Chapter 6 General discussion
142
the gut and the digestive system of the mussel. However, lysozyme were able to
differentiate amongst bacteria species, even between two vibrio species. The expression of
lysozyme was downregulate to V. coralliilyticus whereas may be strongly modulate to
another stressors (Li et al., 2010). Further studies must address the behavior of the other
known immune molecules in order to obtain a complete overview of the innate response.
The main goal of the present research was to study the gene immune reactions produced
after stimulation with pathogenic Vibrio bacteria and PHB-A. This new information will
contribute to increased knowledge about the defense mechanisms in this species, which is
of major interest to the aquaculture sector.
6.6. Induction of phenoloxidase enzyme activity in the early life stage of bivalve larvae by
PHB.
Phenoloxidase (PO) activity is considered a constituent of the immune system and is
probably responsible, at least in part, for the defense mechanism upon non-self recognition
in crustaceans, insects (Hernández-López et al., 1996) and bivalve mollusks (Coles and Pipe,
1994, Dyrynda et al., 1995). PO is present in hemocytes of the adult mussel and also
detected in disaggregated larval cells from M. edulis, showing a strong reaction in the
veligers (Dyrynda et al., 1995). PO activities always had a strong relationship with pathogen
levels: f.ex. bacterial infection caused a significant increase in PO activity in the whole
hemolymph of the bivalves Crassostrea madrasensis and Chlamys farreri (Cong et al., 2008,
Gijo Ittoop et al., 2010). Recently De Rijcke et al. (2015) recorded a significant increase in PO
activity in challenged blue mussel larvae with toxic harmful microalgae.
The presence of PO in the hemolymph of bivalve mollusks, and its stimulation by bacterial
and fungal cell wall components in the adult mussel Perna viridis confirm that PO plays a role
in the internal defense mechanism (Deaton et al., 1999). The implications of an elevated
larval PO activity are, however, largely unknown as the immunological role of PO is still
poorly understood. The current study (Chapter 5) indicated that the addition of PHB-A
increased PO enzyme activity in the early life stages of blue mussel larvae. The combination
of V. coralliilyticus and PHB-A stimulated the PO activity in mussel larvae, indicating that
PHB-A treatment might facilitate a PO response to a pathogen.
Chapter 6 General discussion
143
6.7. The proposed model for future application of amorphous PHB in bivalve larvae
culture.
Recently, under lab conditions, PHB has been successfully applied to some aquaculture
species, resulting in an increase in survival, grow performance and disease resistance. In this
thesis work, we demonstrated that the use of amorphous PHB-A was more advantageous
than crystalline PHB, leading to higher larval survival both under challenged and
unchallenged conditions. Possibly, the addition of the bacterial cell walls plays a role as well
as an immune-stimulating agent. This research indicated that the application of PHB as a
biological control against bacterial infection in bivalve mollusk aquaculture would be a valid
option, and certainly has potential benefits for the bivalve hatchery industry. It was
demonstrated that PHB-A acts mainly as an immune-stimulating compound, enabling the
blue mussel larvae to protect themselves at least partly against the invasion of pathogens.
The concentrations of PHB used in this study were significantly lower than those used for
other aquaculture organisms which make it even more attractive as a disease control tool.
The fact that PHB-A seems to have a positive role also opened the possibility to apply
microbial biomass rich in PHB rather than PHB-C. PHB-C needs to be chemically extracted
from PHB-rich microbial biomass, increasing the price of its production. A thorough
validation of the benefits of PHB-A at a commercial hatchery level might provide the
necessary data to verify the economic feasibility of PHB-A application.
6.8. General discussions
The survival of the mussel larvae almost doubled following the application of 1 mg L-1 PHB-A
to the culture water of blue mussel larvae. This research demonstrated that amorphous PHB
was more effective than crystalline PHB in mussel larvae culture. Both forms of PHB did not
improve larval growth or metamorphosis and appeared not to be used as an energy source
in mussel larvae. PHB-A can partly protect mussel larvae against the specific pathogenic
bacteria V. splendidus and V. coralliilyticus, but the effect depended on both PHB-A
concentration and exposure time. The beneficial effect of PHB-A could also be attributed to
the presence of the dead bacterial cell walls, but this needs further investigation.
Chapter 6 General discussion
144
In general, pretreatment of mussel larvae with PHB-A at a concentration of 1 mg L-1 resulted
in better larval survival when pretreated 6h before the challenge test compared to being
treated 24h before the challenge test. Β-HB had some impact on selected virulence factors
of the pathogenic bacteria but there was no clear pattern, and the effects were only
observed at concentrations that were not biologically relevant. Interestingly, the
supplementation of PHB-A regulates gene expression in challenged mussel larvae but also
triggers increased PO activity. The AMP gene expression in mussel larvae challenged with V.
coralliilyticus was strongest from 24 h after challenge onwards. The expression of defensin is
for the first time described in blue mussel larvae. Based on these results we can make a
strong assumption that PHB-A has an effect on the immune system of the blue mussel larvae
rather than having an anti-bacterial activity against the pathogens.
6.9. Further perspectives
1. By linking the changes in AMP gen-expression with the actual production of the AMP
through Western blot (for which antibodies would be needed), one would gain a better
insight in the biological meaning of the registered up- and downregulation of the responsible
genes.
2. The expression of the AMP-genes has been described to depend on the nature of the
stressor. It would be very interesting to monitor gene expression and the effect of PHB when
comparing different stressors such as temperature shock and physical stress caused by
handlings common in hatcheries (sieving f.ex.). It would give a better insight in the diversity
of responses of the innate immune system of the mussel.
3. The regulation of AMP expression is species dependent. It would be interesting to run the
experiments of Chapter 5 with Japanese oyster larvae Crassostrea gigas, the most important
bivalve in terms of aquaculture production or with bivalve species that are renowned for
their stress-sensitivity such as scallops. The genome of C. gigas is almost completely known
and extensive literature is available on the genetic regulation of its innate immune system.
As a result, changes in AMP production caused by PHB could be linked to the responsible
genes.
Chapter 6 General discussion
145
4. The importance of the incubation time with PHB before exposure to the pathogen was
obvious in our study. Best results were obtained with an incubation period of 6 h. Therefore
application of PHB-A as a pre-treatment at different time slots (e.g. 18 h) could be
interesting and should be related to a better understanding of the infection model of the
pathogen under investigation. Mode of infection can be followed visually and histologically
by fixating mussel larvae in parafilm at different time intervals. By labelling the pathogen
with a green fluorescent protein (f.ex. (GFP-HI-610) (Rekecki et al., 2012), one can localize
the pathogen in function of time (eventually immunohistochemistry techniques could be
used as well, provided antibodies could be raised against the pathogens. Tissue damage
could be visualized with standard staining methods (hematoxylin and eosin).
5. PHB-A contains not only PHB but also the bacterial cell wall. In addition, Ralstonia
eutropha is a gram-negative bacterium possibly containing endotoxins in the cell wall which
may also have an effect on mussel larvae when PHB-A is supplemented. Lee et al. (1999)
produced poly (3-hydroxybutyrate) by cultivating several gram-negative bacteria, including
Ralstonia eutropha, Alcaligenes latus, and recombinant Escherichia coli. When PHB was
recovered by the chloroform extraction method, the endotoxin level was less than 10
endotoxin units (EU) per g of PHB irrespective of the bacterial strains employed and the PHB
content in the cell. Therefore the endotoxins in the PHB-A used in our study is most probably
negligible. Nevertheless, it would be interesting to separate the effect of the bacterial cell
wall from PHB as such. It might not be easy to obtain PHB-A in a pure form. A density
gradient centrifugation protocol has been described to isolate PHB, obtaining amorphous
PHB with high purity (Nickerson, 1982). So it would be worthwhile to follow this possibility. It
amorphous PHB could be obtained in this way with no contamination of other cellular
polymers, such amorphous PHB could be of great help in unraveling the mode of action of
PHB. Alternatively, we can evaluate the (interfering) effect of the cell wall by using Ralstonia
eutropha with different PHB concentrations. This is only an approximation since the cell wall
composition is most probably also affected by the different culture conditions that lead to
different PHB cell concentrations.
6. The mode of action of poly-β-hydroxybutyrate in bivalve mollusk should be further
investigated. This research should focus on its regulating effect on the microbial community
Chapter 6 General discussion
146
composition in the gastrointestinal tract of the animal, using different PHB-A concentrations.
Microbial community analysis could be done on 16S rDNA by DGGE or by high throughput
sequencing technology.. The latter technology has the advantage of generating a much more
detailed picture of the microbial community composition, depending on the “sequencing
depth”. However, the downside of this method is the price of the analysis (although falling)
and the overload of data that needs to processed and interpreted by specialists.
7. A combination of various immune-stimulating compounds (such as beta glucan) could
further enhance the pre-biotic effect of PHB on bivalve larvae.
8. The application of PHB can be considered in bivalve hatcheries industry. It is anticipated
that the necessary microbial biomass does not need to be added alive and rather small
amounts need to be dosed. This makes the application of PHB in hatcheries economically
feasible provided positive effects can be obtained.Research would still need to be done on
e.g. dose, frequency of application and strains.
9. In an attempt to link virulence factor production with the observed in vivo mortality,
challenged tests could be designed that compare the effect of the “wild type” pathogen with
mutant pathogen that lack certain putative virulence factors and eventually such mutant
that contain this virulence gene on a single copy plasmid (provided such strains can be
engineered for the pathogenic strains that have been used in this study. This experimental
approach could yet a much better insight into the importance of certain virulence factors in
the pathogenesis.
147
REFERENCES/A
SUMMARY/SAMENVATTING/B
EXTRA-EXPERIMENT/C
ACKNOWLEDGMENTS/D
CURRICULUM VITAE/E
148
APPENDIX-A References
149
REFERENCES
Abele, D., Heise, K., Pörtner, H.-O. & Puntarulo, S. (2002) Temperature-dependence of
mitochondrial function and production of reactive oxygen species in the intertidal mud
clam Mya arenaria. Journal of Experimental Biology, 205, 1831-1841.
Ahn, W.S., Park, S.J. & Lee, S.Y. (2000) Production of Poly (3-Hydroxybutyrate) by Fed-
Batch Culture of Recombinant Escherichia coli with a Highly Concentrated Whey
Solution. Applied and Environmental Microbiology, 66, 3624-3627.
Allain, G., Arzul, I., Chollet, B., Cobret, L., De Decker, S., Faury, N., Ferrand, S., François,
C., Garcia, C. & Haffner, P. (2009) Summer mortality outbreaks of French Pacific
oysters, Crassostrea gigas, in 2008: research and detection of pathogens. In: Proc.
14th EAFP International Conference, Diseases of Fish and Shellfish (ed. by.
Allam, B., Ashton-Alcox, K.A. & Ford, S.E. (2001) Haemocyte parameters associated with
resistance to brown ring disease in Ruditapes spp. clams. Developmental &
Comparative Immunology, 25, 365-375.
Allam, B., Paillard, C., Auffret, M. & Ford, S.E. (2006) Effects of the pathogenic Vibrio
tapetis on defence factors of susceptible and non-susceptible bivalve species: II.
Cellular and biochemical changes following invivo challenge. Fish & Shellfish
Immunology, 20, 384-397.
Altschul, S., Madden, T., Schaffer, A., Zhang, J., Zhang, Z. & Miller, W. (1997) Gapped
BLAST and PSI-BLAST: a new generation of protein database search programs.
Nucleic Acids Res, 25, 3389 - 3402.
Amor, S.R., Rayment, T. & Sanders, J.K. (1991) Poly (hydroxybutyrate) in vivo: NMR and x-
ray characterization of the elastomeric state. Macromolecules, 24, 4583-4588.
Anderson, A.J. & Dawes, E.A. (1990) Occurrence, metabolism, metabolic role, and industrial
uses of bacterial polyhydroxyalkanoates. Microbiological reviews, 54, 450-472.
Anguiano-Beltrán, C., Lizarrga-Partida, M.L. & Searcy-Bernal, R. (2004) Effect of Vibrio
alginolyticus on larval survival of the blue mussel Mytilus galloprovincialis. Diseases
of Aquatic Organisms, 59, 119-123.
Anonymous (2016) Nonspecific Defenses of the Host [Online] Accessed March, 2016, at:
http://classes.midlandstech.edu/carterp/courses/bio225/chap16/lecture3.htm.
Apajalahti, J., Kettunen, A. & Graham, H. (2004) Characteristics of the gastrointestinal
microbial communities, with special reference to the chicken. World's Poultry Science
Journal, 60, 223-232.
Aquascope (2000) [On line] Accessed March, 2016, At:
http://www.vattenkikaren.gu.se/fakta/arter/mollusca/bivalvia/mytiedul/mytifile.html
Araya, M.T., Markham, F., Mateo, D.R., Mckenna, P., Johnson, G.R., Berthe, F.C.J. & Siah,
A. (2010) Identification and expression of immune-related genes in hemocytes of soft-
APPENDIX –A References
150
shell clams, Mya arenaria, challenged with Vibrio splendidus. Fish & Shellfish
Immunology, 29, 557-564.
Arlette, L., Peduzzi, J., Barthelemy, M., Corre, S., Nicolas, J.-L. & Guyot, M. (2004)
Purification and partial identification of novel antimicrobial protein from marine
bacterium Pseudoalteromonas species strain X153. Marine Biotechnology, 6, 633-
641.
Arzul, I., Renault, T., Lipart, C. & Davison, A.J. (2001) Evidence for interspecies
transmission of oyster herpes virus in marine bivalves. Journal of General Virology,
82, 865-870.
Asokan, P., Mohamed, K. & Sasikumar, G. (2013) Mussel farming and hatchery. P.B. No.
1603, Ernakulam North P.O., Cochin-682018, Kerala, India.
Asokan, R., Arumugam, M. & Mullainadhan, P. (1997) Activation of prophenoloxidase in the
plasma and haemocytes of the marine mussel Perna viridis Linnaeus. Developmental
& Comparative Immunology, 21, 1-12.
Aspan, A., Huang, T., Cerenius, L. & Söderhall, K. (1995) cDNA cloning of
prophenoloxidase from the freshwater crayfish Pacifastacus leniusculus and its
activation. Proc Natl Acad Sci U S A, 92, 939- 943.
Avendaño, R.E. & Riquelme, C.E. (1999) Establishment of mixed-culture probiotics and
microalgae as food for bivalve larvae. Aquaculture Research, 30, 893-900.
Aypa, S.M. (1990) Mussel culture. agris.fao.org.
Bachali, S., Jager, M., Hassanin, A., Schoentgen, F., Jollès, P., Fiala-Medioni, A. & Deutsch,
J.S. (2002) Phylogenetic Analysis of Invertebrate Lysozymes and the Evolution of
Lysozyme Function. Journal of Molecular Evolution, 54, 652-664.
Bachère, E. (2003) Anti-infectious immune effectors in marine invertebrates: potential tools
for disease control in larviculture. Aquaculture, 227, 427-438.
Bachère, E., Rosa, R.D., Schmitt, P., Poirier, A.C., Merou, N., Charrière, G.M. &
Destoumieux-Garzón, D. (2015) The new insights into the oyster antimicrobial
defense: Cellular, molecular and genetic view. Fish & Shellfish Immunology, 46, 50-
64.
Bai, G., Brown, J.F., Watson, C. & Yoshino, T.P. (1997) Isolation and Characterization of
Phenoloxidase from Egg Masses of the Gastropod Mollusk, Biomphalaria glabrata.
Comparative Biochemistry and Physiology Part B: Biochemistry and Molecular
Biology, 118, 463-469.
Bakke, I., Skjermo, J., Vo, T.A. & Vadstein, O. (2013) Live feed is not a major determinant
of the microbiota associated with cod larvae (Gadus morhua). Environmental
Microbiology Reports, 5, 537-548.
Ballarin, L., Cima, F. & Sabbadin, A. (1998) Phenoloxidase and cytotoxicity in the compound
ascidian Botryllus schlosseri. Developmental & Comparative Immunology, 22, 479-
492.
Balseiro, P., Falco, A., Romero, A., Dios, S., Martinez-Lopez, A., Figueras, A., Estepa, A. &
Novoa, B. (2011) Mytilus galloprovincialis myticin C: a chemotactic molecule with
antiviral activity and immunoregulatory properties. PLoS One, 6, e23140.
APPENDIX –A References
151
Balseiro, P., Moreira, R., Chamorro, R., Figueras, A. & Novoa, B. (2013) Immune responses
during the larval stages of Mytilus galloprovincialis: Metamorphosis alters
immunocompetence, body shape and behavior. Fish & Shellfish Immunology, 35, 438-
447.
Baruah, K., Huy, T.T., Norouzitallab, P., Niu, Y., Gupta, S.K., De Schryver, P. & Bossier, P.
(2015) Probing the protective mechanism of poly-ß-hydroxybutyrate against vibriosis
by using gnotobiotic Artemia franciscana and Vibrio campbellii as host-pathogen
model. Scientific Reports, 5, 9427.
Baruah, K., Norouzitallab, P., Shihao, L., Sorgeloos, P. & Bossier, P. (2013) Feeding
truncated heat shock protein 70s protect Artemia franciscana against virulent Vibrio
campbellii challenge. Fish & Shellfish Immunology, 34, 183-191.
Baruah, K., Ranjan, J., Sorgeloos, P., Macrae, T.H. & Bossier, P. (2011) Priming the
prophenoloxidase system of Artemia franciscana by heat shock proteins protects
against Vibrio campbellii challenge. Fish & Shellfish Immunology, 31, 134-141.
Bayne, B. & Widdows, J. (1978) The physiological ecology of two populations of Mytilus
edulis L. Oecologia, 37, 137-162.
Bayne, B.L., Hawkins, A.J.S. & Navarro, E. (1987) Feeding and digestion by the mussel
Mytilus edulis L. (Bivalvia: Mollusca) in mixtures of silt and algal cells at low
concentrations. Journal of Experimental Marine Biology and Ecology, 111, 1-22.
Beaumont, A., Gjedrem, T. & Moran, P. (2007) Blue mussel Mytilus edulis, Mediterranean
mussel M. galloprovincialis. Genetic impact of aquaculture activities in native
populations. Genimpact Final Scientific Report, 62-69.
Beaz‐Hidalgo, R., Balboa, S., Romalde, J.L. & Figueras, M.J. (2010) Diversity and
pathogenecity of Vibrio species in cultured bivalve mollusk. Environmental
Microbiology Reports, 2, 34-43.
Belton, B. & Thilsted, S.H. (2014) Fisheries in transition: Food and nutrition security
implications for the global South. Global Food Security, 3, 59-66.
Berthelin, C., Kellner, K. & Mathieu, M. (2000) Storage metabolism in the Pacific oyster
(Crassostrea gigas) in relation to summer mortalities and reproductive cycle (West
Coast of France). Comparative Biochemistry and Physiology Part B: Biochemistry
and Molecular Biology, 125, 359-369.
Bettencourt, R., Dando, P., Collins, P., Costa, V., Allam, B. & Serrão Santos, R. (2009)
Innate immunity in the deep sea hydrothermal vent mussel Bathymodiolus azoricus.
Comparative Biochemistry and Physiology Part A: Molecular & Integrative
Physiology, 152, 278-289.
Bomba, A., Jonecová, Z., Koščová, J., Nemcová, R., Gancarčíková, S., Mudroňová, D.,
Buleca, V., Lazar, G., Pošivák, J. & Kaštel, R. (2006) The improvement of probiotics
efficacy by synergistically acting components of natural origin: a review. Biologia, 61,
729-734.
Boon, N., De Windt, W., Verstraete, W. & Top, E.M. (2002) Evaluation of nested PCR–
DGGE (denaturing gradient gel electrophoresis) with group-specific 16S rRNA
primers for the analysis of bacterial communities from different wastewater treatment
plants. FEMS Microbiology Ecology, 39, 101-112.
APPENDIX –A References
152
Borrego, J.J., Castro, D., Luque, A., Paillard, C., Maes, P., Garcia, M.T. & Ventosa, A. (1996)
Vibrio tapetis sp. nov., the causative agent of the brown ring disease affecting cultured
clams. International Journal of Systematic and Evolutionary Microbiology, 46, 480-
484.
Brackman, G., Defoirdt, T., Miyamoto, C., Bossier, P., Van Calenbergh, S., Nelis, H. &
Coenye, T. (2008) Cinnamaldehyde and cinnamaldehyde derivatives reduce virulence
in Vibrio spp. by decreasing the DNA-binding activity of the quorum sensing response
regulator LuxR. BioMed Central Microbiology, 8, 149.
Bray, J.R. & Curtis, J.T. (1957) An ordination of the upland forest communities of southern
Wisconsin. Ecological monographs, 27, 325-349.
Brenko, M.H. & Calabrese, A. (1969) The combined effects of salinity and temperature on
larvae of the mussel Mytilus edulis. Marine Biology, 4, 224-226.
Brenner, M., Broeg, K., Frickenhaus, S., Buck, B.H. & Koehler, A. (2014) Multi-biomarker
approach using the blue mussel (Mytilus edulis L.) to assess the quality of marine
environments: Season and habitat-related impacts. Marine Environmental research,
95, 13-27.
Bricknell, I. & Dalmo, R.A. (2005) The use of immunostimulants in fish larval aquaculture.
Fish & Shellfish Immunology, 19, 457-472.
Brown, C. (1981) A study of two shellfish-pathogenic Vibrio strains isolated from a Long
Island hatchery during a recent outbreak of disease [New York]. Journal of Shellfish
Research.
Cabello, F.C. (2006) Heavy use of prophylactic antibiotics in aquaculture: a growing problem
for human and animal health and for the environment. Environmental Microbiology, 8,
1137-1144.
Cai, Q.-Y., Mo, C.-H., Li, Y.-H., Zeng, Q.-Y., Katsoyiannis, A., Wu, Q.-T. & Férard, J.-F.
(2007) Occurrence and assessment of polycyclic aromatic hydrocarbons in soils from
vegetable fields of the Pearl River Delta, South China. Chemosphere, 68, 159-168.
Canesi, L., Betti, M., Ciacci, C., Lorusso, L., Pruzzo, C. & Gallo, G. (2006) Cell signalling in
the immune response of mussel hemocytes. Invertebrate Survival Journal, 3, 40-49.
Canesi, L., Betti, M., Ciacci, C., Scarpato, A., Citterio, B., Pruzzo, C. & Gallo, G. (2002b)
Signaling pathways involved in the physiological response of mussel hemocytes to
bacterial challenge: the role of stress-activated p38 MAP kinases. Developmental &
Comparative Immunology, 26, 325-334.
Canesi, L., Gallo, G., Gavioli, M. & Pruzzo, C. (2002a) Bacteria–hemocyte interactions and
phagocytosis in marine bivalves. Microscopy Research and Technique, 57, 469-476.
Cellura, C., Toubiana, M., Parrinello, N. & Roch, P. (2007) Specific expression of
antimicrobial peptide and HSP70 genes in response to heat-shock and several bacterial
challenges in mussels. Fish & Shellfish Immunology, 22, 340-350.
Charlet, M., Chernysh, S., Philippe, H., Hetru, C., Hoffmann, J.A. & Bulet, P. (1996) Innate
Immunity: isolation of several cystein-rich antimicrobial peptides from the blood of
mollusk, mytilus edulis. Journal of Biological Chemistry, 271, 21808-21813.
APPENDIX –A References
153
Chavez-Dozal, A. & Nishiguchi, M.K. (2011) Variation in biofilm formation among
symbiotic and free-living strains of Vibrio fischeri. Journal of basic microbiology, 51,
10.
Chen, G.-Q. & Wu, Q. (2005) The application of polyhydroxyalkanoates as tissue engineering
materials. Biomaterials, 26, 6565-6578.
Chen, L., Yang, J., Yu, J., Yao, Z., Sun, L., Shen, Y. & Jin, Q. (2005) VFDB: a reference
database for bacterial virulence factors. Nucleic Acids Research, 33, 325-328.
Cheng, I.-C., Shang, H.-F., Lin, T.-F., Wang, T.-H., Lin, H.-S. & Lin, S.-H. (2005) Effect of
fermented soy milk on the intestinal bacterial ecosystem. World journal of
gastroenterology: WJG, 11, 1225-1227.
Cherrington, C.A., Hinton, M., Pearson, G. & Chopra, I. (1991) Short‐chain organic acids at
pH 5.0 kill Escherichia coli and Salmonella spp. without causing membrane
perturbation. Journal of Applied Bacteriology, 70, 161-165.
Cheyney, D., Macdonald, B. & Elston, R. (2000) Summer mortality of Pacific oysters,
Crassostrea gigas (Thunberg): initial findings on multiple environmental stressors in
Puget Sound, Washington. Journal of Shellfish Research, 19, 353-359.
Cima, F., Matozzo, V., Marin, M.G. & Ballarin, L. (2000) Haemocytes of the clam Tapes
philippinarum (Adams & Reeve, 1850): morphofunctional characterisation. Fish &
Shellfish Immunology, 10, 677-693.
Clarke, K.R. (1993) Non‐parametric multivariate analyses of changes in community structure.
Australian Journal of Ecology, 18, 117-143.
Coles, J.A. & Pipe, R.K. (1994) Phenoloxidase activity in the haemolymph and hemocytes of
the marine mussel Mytilus edulis. Fish & Shellfish Immunology, 4, 337-352.
Cong, M., Song, L., Wang, L., Zhao, J., Qiu, L., Li, L. & Zhang, H. (2008) The enhanced
immune protection of Zhikong scallop Chlamys farreri on the secondary encounter
with Listonella anguillarum. Biochemistry and Molecular Biology of Comparative
Biochemistry and Physiology 151, 191-196.
Corbeil, S., Mccoll, K.A., Williams, L.M., Mohammad, I., Hyatt, A.D., Crameri, S.G., Fegan,
M. & Crane, M.S.J. (2012) Abalone viral ganglioneuritis: Establishment and use of an
experimental immersion challenge system for the study of abalone herpes virus
infections in Australian abalone. Virus Research, 165, 207-213.
Costa, M., Dios, S., Alonso-Gutierrez, J., Romero, A., Novoa, B. & Figueras, A. (2008)
Myticin C variability in mussel: ancient defence mechanism or self/nonself-
discrimination. Developmental & Comparative Immunology, 32, 213-226.
Costa, M., Dios, S., Alonso-Gutierrez, J., Romero, A., Novoa, B. & Figueras, A. (2009)
Evidence of high individual diversity on myticin C in mussel (Mytilus
galloprovincialis). Developmental & Comparative Immunology, 33, 162-170.
Costa, M.M., Prado-Alvarez, M., Gestal, C., Li, H., Roch, P., Novoa, B. & Figueras, A.
(2009) Functional and molecular immune response of Mediterranean mussel (Mytilus
galloprovincialis) hemocytes against pathogen-associated molecular patterns and
bacteria. Fish & Shellfish Immunology, 26, 515-523.
APPENDIX –A References
154
Cranfield, H.J. (1974) Observations on the morphology of the mantle folds of the pediveliger
of Ostrea edulis L. and their function during settlement. Journal of the Marine
Biological Association of the United Kingdom, 54, 1-12.
Cronin, M., Culloty, S. & Mulcahy, M. (2001) Lysozyme activity and protein concentration in
the haemolymph of the flat oyster Ostrea edulis (L.). Fish & Shellfish Immunology,
11, 611-622.
Davis, H.C. & Chanley, P.E. (1956) Effects of some dissolved substances on bivalve larvae.
In: Proceedings of the National Shellfisheries Association (ed. by, pp. 59-74.
De Lorgeril, J., Zenagui, R., Rosa, R.D., Piquemal, D. & Bachère, E. (2011) Whole
transcriptome profiling of successful immune response to Vibrio infections in the
oyster Crassostrea gigas by digital gene expression analysis. PLoS One, 6, e23142.
De Meeiis, T. & Renaud, F. (1997) Heterozygote deficiency in the mussel Mytilus edulis
species complex revisited. Marine Ecology Progress Series, 156, 225-237.
De Rijcke, M., Vandegehuchte, M.B., Bussche, J.V., Nevejan, N., Vanhaecke, L., De
Schamphelaere, K.a.C. & Janssen, C.R. (2015) Common European Harmful Algal
Blooms affect the viability and innate immune responses of Mytilus edulis larvae. Fish
& Shellfish Immunology, 47, 175-181.
De Schryver, P., Dierckens, K., Thi, Q.Q., Amalia, R., Marzorati, M., Bossier, P., Boon, N. &
Verstraete, W. (2011) Convergent dynamics of the juvenile European sea bass gut
microbiota induced by poly-beta-hydroxybutyrate. Environmental Microbiology, 13,
1042-1051.
De Schryver, P., Sinha, A.K., Kunwar, P.S., Baruah, K., Verstraete, W., Boon, N., De Boeck,
G. & Bossier, P. (2010) Poly-beta-hydroxybutyrate (PHB) increases growth
performance and intestinal bacterial range-weighted richness in juvenile European sea
bass, Dicentrarchus labrax. Applied Microbiology and Biotechnology, 86, 1535-1541.
Deaton, L.E., P.J Jordan & Dankert, J.R. (1999) Phenoloxidase activity in the hemolymph of
bivalve mollusks. Journal of Shellfish Research, 18, 223-226.
Defer, D., Bourgougnon, N. & Fleury, Y. (2009) Screening for antibacterial and antiviral
activities in three bivalve and two gastropod marine mollusk. Aquaculture, 293, 1-7.
Defoirdt, T. (2013) Antivirulence therapy for animal production: filling an arsenal with novel
weapons for sustainable disease control. PLoS Pathog, 9, e1003603.
Defoirdt, T. (2014) Virulence mechanisms of bacterial aquaculture pathogens and
antivirulence therapy for aquaculture. Reviews in Aquaculture, 6, 100-114.
Defoirdt, T., Boon, N., Sorgeloos, P., Verstraete, W. & Bossier, P. (2007a) Alternatives to
antibiotics to control bacterial infections: luminescent vibriosis in aquaculture as an
example. Trends Biotechnology, 25, 472-479.
Defoirdt, T., Boon, N., Sorgeloos, P., Verstraete, W. & Bossier, P. (2009) Short-chain fatty
acids and poly-β-hydroxyalkanoates: (New) Biocontrol agents for a sustainable animal
production. Biotechnology Advances, 27, 680-685.
Defoirdt, T., Halet, D., Sorgeloos, P., Bossier, P. & Verstraete, W. (2006b) Short-chain fatty
acids protect gnotobiotic Artemia franciscana from pathogenic Vibrio campbellii.
Aquaculture, 261, 804-808.
APPENDIX –A References
155
Defoirdt, T., Halet, D., Vervaeren, H., Boon, N., Van De Wiele, T., Sorgeloos, P., Bossier, P.
& Verstraete, W. (2007b) The bacterial storage compound poly-β-hydroxybutyrate
protects Artemia franciscana from pathogenic Vibrio campbellii. Environmental
Microbiology, 9, 445-452.
Defoirdt, T., Sorgeloos, P. & Bossier, P. (2011) Alternatives to antibiotics for the control of
bacterial disease in aquaculture. Current Opinion in Microbiology, 14, 251-258.
Disalvo, L., Blecka, J. & Zebal, R. (1978) Vibrio anguillarum and larval mortality in a
California coastal shellfish hatchery. Applied and Environmental Microbiology, 35,
219-221.
Doi, Y., Kitamura, S. & Abe, H. (1995) Microbial synthesis and characterization of poly (3-
hydroxybutyrate-co-3-hydroxyhexanoate). Macromolecules, 28, 4822-4828.
Donaghy, L., Hong, H.-K., Jauzein, C. & Choi, K.-S. (2015) The known and unknown
sources of reactive oxygen and nitrogen species in hemocytes of marine bivalve
mollusk. Fish & Shellfish Immunology, 42, 91-97.
Douillet, P. & Langdon, C.J. (1993) Effects of Marine Bacteria on the Culture of Axenic
Oyster Crassostrea gigas (Thunberg) Larvae. The Biological Bulletin, 184, 36-51.
Douillet, P.A. & Langdon, C.J. (1994) Use of a probiotic for the culture of larvae of the
Pacific oyster (Crassostrea gigas Thunberg). Aquaculture, 119, 25-40.
Du, G., Chen, J., Yu, J. & Lun, S. (2001) Continuous production of poly-3-hydroxybutyrate
by Ralstonia eutropha in a two-stage culture system. Journal of Biotechnology, 88,
59-65.
Duperthuy, M., Schmitt, P., Garzón, E., Caro, A., Rosa, R.D., Le Roux, F., Lautrédou-
Audouy, N., Got, P., Romestand, B., De Lorgeril, J., Kieffer-Jaquinod, S., Bachère, E.
& Destoumieux-Garzón, D. (2011) Use of OmpU porins for attachment and invasion
of Crassostrea gigas immune cells by the oyster pathogen Vibrio splendidus.
Proceedings of the National Academy of Sciences, 108, 2993-2998.
Dyrynda, E.A., Pipe, R.K. & Ratcliffe, N.A. (1995) Host defence mechanisms in marine
invertebrate larvae. Fish & Shellfish Immunology, 5, 569-580.
Elston, R. (1980) Functional anatomy, histology and ultrastructure of the soft tissues of the
larval American oyster, Crassostrea virginica. Proceedings of the National
Shellfisheries Association, 70, 65-93.
Elston, R. (1997) Bivalve mollusk viruses. World Journal of Microbiology and
Biotechnology, 13, 393-403.
Elston, R.A., Hasegawa, H., Humphrey, K.L., Polyak, I.K. & Häse, C.C. (2008) Re-
emergence of Vibrio tubiashii in bivalve shellfish aquaculture: severity, environmental
drivers, geographic extent and management. Diseases of Aquatic Organisms, 82, 119-
134.
Estes, R.M., Friedman, C.S., Elston, R.A. & Herwig, R.P. (2004) Pathogenicity testing of
shellfish hatchery bacterial isolates on Pacific oyster Crassostrea gigas larvae.
Diseases of Aquatic Organisms, 58, 223-230.
Fao (2012) The State of world fisheries and aquaculture. Rome [Online] at
http://www.fao.org/3/a-i2727e.pdf.
APPENDIX –A References
156
Fao (2013) Fishery and Aquaculture Statistics. Food and Agriculture Organization (FAO),
Rome [Online]: at http://www.fao.org/docrep/019/i3507t/i3507t.pdf, 105 pp.
Fao (2014a) The State of World Fisheries and Aquaculture, Opportunities and challenges.
Food and agriculture organization of the united nations. Rome [Online] at:
http://www.fao.org/3/a-i3720e.pdf, 243 pp.
Fao (2014b) The State of World Fisheries and Aquaculture. Rome [Online] at:
http://www.fao.org/3/a-i3720e/i3720e04.pdf, 223 pp.
Fao (2015) Globefish. Food and agriculture organization of the united nations. [Online] at:
http://www.fao.org/in-action/globefish/market-reports/resource-detail/en/c/337216/.
Fao (2016) Fisheries and aquaculture resources. [Online] at:
http://www.fao.org/fishery/culturedspecies/Mytilus_edulis/en.
Fernandes Cardoso De Oliveira, A., Ranzani De França, P. & Pinto, A. (2010) Antimicrobial
resistance of heterotrophic marine bacteria isolated from seawater and sands of
recreational beaches with different organic pollution levels in southeastern Brazil:
evidences of resistance dissemination. Environmental Monitoring and Assessment,
169, 375-384.
Fernández, R.G. (2001) Artemia bioencapsulation I. Effect of particle sizes on the filtering
behavior of Artemia franciscana. Journal of Crustacean Biology, 21, 435-442.
Figueras, A. & Novoa, B. (2004) What has been going on in Europe in bivalve pathology?
Bulletin of the European Association of Fish Pathologists, 24, 16-21.
Fleury, E. & Huvet, A. (2012) Microarray analysis highlights immune response of Pacific
oysters as a determinant of resistance to summer mortality. Marine Biotechnology, 14,
203-217.
Fleury, E., Huvet, A., Lelong, C., De Lorgeril, J., Boulo, V., Gueguen, Y., Bachere, E.,
Tanguy, A., Moraga, D., Fabioux, C., Lindeque, P., Shaw, J., Reinhardt, R., Prunet, P.,
Davey, G., Lapegue, S., Sauvage, C., Corporeau, C., Moal, J., Gavory, F., Wincker,
P., Moreews, F., Klopp, C., Mathieu, M., Boudry, P. & Favrel, P. (2009) Generation
and analysis of a 29,745 unique Expressed Sequence Tags from the Pacific oyster
(Crassostrea gigas) assembled into a publicly accessible database: the GigasDatabase.
BMC Genomics, 10, 341.
Freier, T., Kunze, C., Nischan, C., Kramer, S., Sternberg, K., Saß, M., Hopt, U.T. & Schmitz,
K.-P. (2002) In vitro and in vivo degradation studies for development of a
biodegradable patch based on poly(3-hydroxybutyrate). Biomaterials, 23, 2649-2657.
Frydenborg, B., Krediet, C., Teplitski, M. & Ritchie, K. (2014) Temperature-Dependent
Inhibition of Opportunistic Vibrio Pathogens by Native Coral Commensal Bacteria.
Microbial Ecology, 67, 392-401.
Fryer, S.E. & Bayne, C.J. (1996) Phagocytosis of latex beads by Biomphalaria glabrata
hemocytes is modulated in a strain-specific manner by adsorbed plasma components.
Developmental & Comparative Immunology, 20, 23-37.
Gabbott, P.A. (1976) Energy metabolism. In: Marine mussels, their ecology and physiology. .
BAYNE, B.L. (Ed). Cambridge University Press, Great Brittan, 293-355. (ISBN 290
521 21058 21055).
APPENDIX –A References
157
Gandhe, A.S., John, S.H. & Nagaraju, J. (2007) Noduler, a novel immune up-regulated
protein mediates nodulation response in insects. The Journal of Immunology, 179,
6943-6951.
García-García, E., Prado-Álvarez, M., Novoa, B., Figueras, A. & Rosales, C. (2008) Immune
responses of mussel hemocyte subpopulations are differentially regulated by enzymes
of the PI 3-K, PKC, and ERK kinase families. Developmental & Comparative
Immunology, 32, 637-653.
Garen, P., Robert, S. & Bougrier, S. (2004) Comparison of growth of mussel, Mytilus edulis,
on longline, pole and bottom culture sites in the Pertuis Breton, France. Aquaculture,
232, 511-524.
Garnier, M., Labreuche, Y. & Nicolas, J.-L. (2008) Molecular and phenotypic
characterization of Vibrio aestuarianus subsp. francensis subsp. nov., a pathogen of
the oyster Crassostrea gigas. Syst Appl Microbiol, 31, 358-365.
Garrett, J.L. & Ruel, M.T. (2000) Achieving urban food and nutrition security in the
developing world. A 2020 vision for food , agriculture, and the environment, 3, 1-10.
Gay, M., Berthe, F.C. & Le Roux, F. (2004) Screening of Vibrio isolates to develop an
experimental infection model in the Pacific oyster Crassostrea gigas. Diseases of
Aquatic Organisms, 59, 49.
Genard, B., Miner, P., Nicolas, J.-L., Moraga, D., Boudry, P., Pernet, F. & Tremblay, R.
(2013) Integrative Study of Physiological Changes Associated with Bacterial Infection
in Pacific Oyster Larvae. PLoS One, 8, e64534.
Gestal, C., Costa, M., Figueras, A. & Novoa, B. (2007) Analysis of differentially expressed
genes in response to bacterial stimulation in hemocytes of the carpet-shell clam
Ruditapes decussatus: Identification of new antimicrobial peptides. Gene, 406, 134-
143.
Gestal, C., Roch, P., Renault, T., Pallavicini, A., Paillard, C., Novoa, B., Oubella, R., Venier,
P. & Figueras, A. (2008) Study of Diseases and the Immune System of Bivalves Using
Molecular Biology and Genomics. Reviews in Fisheries Science, 16, 133-156.
Gibson, L., Woodworth, J. & George, A. (1998) Probiotic activity of Aeromonas media on
the Pacific oyster, Crassostrea gigas, when challenged with Vibrio tubiashii.
Aquaculture, 169, 111-120.
Gijo Ittoop, K.C. George, George, R.M., K. S. Sobhana & Nisha, N.K.S.a.P.C. (2010)
Modulation of selected hemolymph factors in the Indian edible oyster Crassostrea
madrasensis (Preston) upon challenge by Vibrio alginolyticus. Indian Journal Fish,
57, 55-60.
Glenn, G. & Roberfroid, M. (1995) Dietary modulation of the human colonic microbiota:
introducing the concept of prebiotics. Journal of Nutrition, 125, 1401-1412.
Glenn, J.C. (2014) Our Global Situation and Prospects for the Future. The Futurist, 48, 15.
Gómez-León, J., Villamil, L., Lemos, M.L., Novoa, B. & Figueras, A. (2005) Isolation of
Vibrio alginolyticus and Vibrio splendidus from Aquacultured Carpet Shell Clam
(Ruditapes decussatus) Larvae Associated with Mass Mortalities. Applied and
Environmental Microbiology, 71, 98-104.
APPENDIX –A References
158
Gomez-Leon, J., Villamil, L., Salger, S.A., Sallum, R., Remacha-Triviño, A., Leavitt, D.F. &
Gomez-Chiarri, M. (2008) Survival of eastern oysters Crassostrea virginica from
three lines following experimental challenge with bacterial pathogens. Diseases of
Aquatic Organisms, 79, 95-105.
Gonzalez, M., Gueguen, Y., Desserre, G., De Lorgeril, J., Romestand, B. & Bachère, E.
(2007) Molecular characterization of two isoforms of defensin from hemocytes of the
oyster Crassostrea gigas. Developmental & Comparative Immunology, 31, 332-339.
Gosling, E. (1984) The systematic status of Mytilus galloprovincialis in western Europe: a
review. Malacologia, 25, 551-568.
Gosling, E. (2003) Bivalve Molluscs Biology, Ecology and Culture. Blackwell publishing,
Great Britain, 2 ed., 443 pages.
Goulletquer, P., Soletchnik, P., Le Moine, O., Razet, D., Geairon, P. & Faury, N. (1998)
Summer mortality of the Pacific cupped oyster Crassostrea gigas in the Bay of
Marennes-Oleron (France). In: CIEM Conseil International pour l'Exploration de la
Mer (ed. by.
Grothe, E., Moo-Young, M. & Chisti, Y. (1999) Fermentation optimization for the production
of poly (β-hydroxybutyric acid) microbial thermoplastic. Enzyme and microbial
technology, 25, 132-141.
Gueguen, Y., Bernard, R., Julie, F., Paulina, S., Delphine, D.-G., Franck, V., Philippe, B. &
Evelyne, B. (2009) Oyster hemocytes express a proline-rich peptide displaying
synergistic antimicrobial activity with a defensin. Mol Immunol, 46, 516-522.
Gueguen, Y., Herpin, A., Aumelas, A., Garnier, J., Fievet, J., Escoubas, J.-M., Bulet, P.,
Gonzalez, M., Lelong, C., Favrel, P. & Bachère, E. (2006) Characterization of a
Defensin from the Oyster Crassostrea gigas: recombinat production, folding, solution
structure, antimicrobial activities, and gene expression. Journal of Biological
Chemistry, 281, 313-323.
Hada, H.S., West, P.A., Lee, J.V., Stemmler, J. & Colwell, R.R. (1984) Vibrio tubiashii sp.
nov., a Pathogen of Bivalve Mollusks. International Journal of Systematic
Bacteriology, 34, 1-4.
Halami, P.M. (2008) Production of polyhydroxyalkanoate from starch by the native isolate
Bacillus cereus CFR06. World Journal of Microbiology and Biotechnology, 24, 805-
812.
Halet, D., Defoirdt, T., Van Damme, P., Vervaeren, H., Forrez, I., Van De Wiele, T., Boon,
N., Sorgeloos, P., Bossier, P. & Verstraete, W. (2007) Poly-beta-hydroxybutyrate-
accumulating bacteria protect gnotobiotic Artemia franciscana from pathogenic Vibrio
campbellii. Federation of European Microbiological Societies Microbiology Ecology,
60, 363-369.
Hall-Stoodley, L., Costerton, J.W. & Stoodley, P. (2004) Bacterial biofilms: from the Natural
environment to infectious diseases. Nature Reviews Microbiology, 2, 95-108.
Hancock, R.E. & Scott, M.G. (2000) The role of antimicrobial peptides in animal defenses.
Proceedings of the National Academy of Sciences, 97, 8856-8861.
APPENDIX –A References
159
Hancock, R.E.W. & Rozek, A. (2002) Role of membranes in the activities of antimicrobial
cationic peptides. Federation of European Microbiological Societies Microbiology
Letters, 206, 143-149.
Hasan, I., Sugawara, S., Fujii, Y., Koide, Y., Terada, D., Iimura, N., Fujiwara, T., Takahashi,
K.G., Kojima, N. & Rajia, S. (2015) MytiLec, a mussel R-type lectin, interacts with
surface glycan Gb3 on Burkitt’s lymphoma cells to trigger apoptosis through multiple
pathways. Mar Drugs, 13, 7377-7389.
Hasegawa, H., Lind, E.J., Boin, M.A. & Häse, C.C. (2008) The Extracellular Metalloprotease
of Vibrio tubiashii Is a Major Virulence Factor for Pacific Oyster (Crassostrea gigas)
Larvae. Applied and Environmental Microbiology, 74, 4101-4110.
Hatakeyama, T., Furukawa, M., Nagatomo, H., Yamasaki, N. & Mori, T. (1996)
Oligomerization of the hemolytic lectin CEL-III from the marine invertebrate
Cucumaria echinata induced by the binding of carbohydrate ligands. Journal of
Biological Chemistry, 271, 16915-16920.
Hatcher, A., Grant, J. & Schofield, B. (1997) Seasonal changes in the metabolism of cultured
mussels (Mytilus edulis L.) from a Nova Scotian inlet: the effects of winter ice cover
and nutritive stress. Journal of Experimental Marine Biology and Ecology, 217, 63-78.
Hellio, C., Bado-Nilles, A., Gagnaire, B., Renault, T. & Thomas-Guyon, H. (2007)
Demonstration of a true phenoloxidase activity and activation of a ProPO cascade in
Pacific oyster, Crassostrea gigas (Thunberg) in vitro. Fish Shellfish Immunology, 22,
433-440.
Hernández-López, J., Gollas-Galván, T. & Vargas-Albores, F. (1996) Activation of the
prophenoloxidase system of the brown shrimp Penaeus californiensis Holmes).
Comparative Biochemistry and Physiology Part C: Pharmacology, Toxicology and
Endocrinology, 113, 61-66.
Herrera, B. & Toranzo, A. (2005) Vaccination strategies to prevent emerging diseases for
Spanish aquaculture. Developmental Biology Basel, 121, 85-95.
Hidu, H. & Tubiash, H.S. (1963) A bacterial basis for the growth of antibiotic treated bivalve
larvae. In: Proceedings of the National Shellfisheries Association (ed. by, pp. 25-39.
Hine, P., Wesney, B. & Hay, B. (1992) Herpesviruses associated with mortalities among
hatchery-reared larval Pacific oysters Crassostrea gigas. Diseases of Aquatic
Organisms, 12, 135-142.
Hine, P.M. (1999) The inter-relationships of bivalve haemocytes. Fish & Shellfish
Immunology, 9, 367-385.
Hishiya, A. & Takayama, S. (2008) Molecular chaperones as regulators of cell death.
Oncogene, 27, 6489-6506.
Hong, X.-T., Xiang, L.-X. & Shao, J.-Z. (2006) The immunostimulating effect of bacterial
genomic DNA on the innate immune responses of bivalve mussel, Hyriopsis cumingii
Lea. Fish & Shellfish Immunology, 21, 357-364.
Hooper, C., Hardy-Smith, P. & Handlinger, J. (2007) Ganglioneuritis causing high mortalities
in farmed Australian abalone (Haliotis laevigata and Haliotis rubra). Australian
Veterinary Journal, 85, 188-193.
APPENDIX –A References
160
Hubert, F., Cooper, E.L. & Roch, P. (1997) Structure and differential target sensitivity of the
stimulable cytotoxic complex from hemolymph of the Mediterranean mussel Mytilus
galloprovincialis. Biochimica et Biophysica Acta (BBA)-Molecular Basis of Disease,
1361, 29-41.
Hubert, F., Noël, T. & Roch, P. (1996) A Member of the Arthropod Defensin Family from
Edible Mediterranean Mussels (Mytilus galloprovincialis). European Journal of
Biochemistry, 240, 302-306.
Hubert, F., Van Der Knaap, W., Noël, T. & Roch, P. (1996) Cytotoxic and antibacterial
properties of Mytilus galloprovincialis, Ostrea edulis and Crassostrea gigas (bivalve
molluscs) hemolymph. Aquatic Living Resources, 9, 115-124.
Huffman, J.E. & Tripp, M. (1982) Cell types and hydrolytic enzymes of soft shell clam (Mya
arenaria) hemocytes. Journal of Invertebrate Pathology, 40, 68-74.
Hung, N.V., De Schryver, P., Tam, T.T., Garcia-Gonzalez, L., Bossier, P. & Nevejan, N.
(2015) Application of poly-β-hydroxybutyrate (PHB) in mussel larviculture.
Aquaculture, 446, 318-324.
Ishizaki, A., Tanaka, K. & Taga, N. (2001) Microbial production of poly-D-3-
hydroxybutyrate from CO2. Applied Microbiology and Biotechnology, 57, 6-12.
Itoh, N. & Takahashi, K.G. (2007) cDNA cloning and in situ hybridization of a novel
lysozyme in the Pacific oyster, Crassostrea gigas. Comparative Biochemistry and
Physiology Part B: Biochemistry and Molecular Biology, 148, 160-166.
Iwanaga, S. & Lee, B.-L. (2005) Recent advances in the innate immunity of invertebrate
animals. BMB Reports, 38, 128-150.
Jeanthon, C., Prieur, D. & Cochard, J.-C. (1988) Bacteriological survey of antibiotic-treated
sea waters in a Pecten maximus hatchery. Aquaculture, 71, 1-8.
Jeffries, V.E. (1982) Three Vibrio strains pathogenic to larvae of Crassostrea gigas and
Ostrea edulis. Aquaculture, 29, 201-226.
Jendrossek, D. (1998) Microbial degradation of polyesters: a review on extracellular poly
(hydroxyalkanoic acid) depolymerases. Polymer Degradation and Stability, 59, 317-
325.
Jendrossek, D. & Handrick, R. (2002) Microbial degradation of polyhydroxyalkanoates. Annu
Rev Microbiol, 56, 403-432.
Jenssen, H., Hamill, P. & Hancock, R.E.W. (2006) Peptide Antimicrobial Agents. Clinical
Microbiology Reviews, 19, 491-511.
Jiang, H., Dong, H., Zhang, G., Yu, B., Chapman, L.R. & Fields, M.W. (2006) Microbial
diversity in water and sediment of Lake Chaka, an athalassohaline lake in
northwestern China. Applied Environmental Microbiology, 72, 3832-3845.
Johnson, J.D. & Fleshner, M. (2006) Releasing signals, secretory pathways, and immune
function of endogenous extracellular heat shock protein 72. Journal of Leukocyte
Biology, 79, 425-434.
Jones, J., Scotti, P., Dearing, S. & Wesney, B. (1996) Virus-like particles associated with
marine mussel mortalities in New Zealand. Diseases of Aquatic Organisms, 25, 143-
149.
APPENDIX –A References
161
Jorgensen, C.B. (1990) Bivalve filter feeding: hydrodynamics, bioenergetics, physiology and
ecology, Fredensborg, Denmark: Olsen & Olsen.
Jorgensen, C.B. (1996) Bivalve filter feeding revisited. Marine Ecology Progress Series, 142,
287-302.
Jorquera, M.A., Valencia, G., Eguchi, M., Katayose, M. & Riquelme, C. (2002) Disinfection
of seawater for hatchery aquaculture systems using electrolytic water treatment.
Aquaculture, 207, 213-224.
Kahar, P., Tsuge, T., Taguchi, K. & Doi, Y. (2004) High yield production of
polyhydroxyalkanoates from soybean oil by Ralstonia eutropha and its recombinant
strain. Polymer Degradation and Stability, 83, 79-86.
Karunasagar, I., Pai, R., Malathi, G. & Karunasagar, I. (1994) Mass mortality of Penaeus
monodon larvae due to antibiotic-resistant Vibrio harveyi infection. Aquaculture, 128,
203-209.
Kashket, E.R. (1987) Bioenergetics of lactic acid bacteria: cytoplasmic pH and
osmotolerance. FEMS Microbiology Letters, 46, 233-244.
Kasuya, K.-I., Doi, Y. & Yao, T. (1994) Enzymatic degradation of poly [(R)-3-
hydroxybutyrate] by Comamonas testosteroni ATSU of soil bacterium. Polymer
Degradation and Stability, 45, 379-386.
Kato, N., Konishi, H., Shimao, M. & Sakazawa, C. (1992) Production of 3-hydroxybutyric
acid trimer by Bacillus megaterium B-124. Journal of Fermentation and
Bioengineering, 73, 246-247.
Keenan, T.M., Nakas, J.P. & Tanenbaum, S.W. (2006) Polyhydroxyalkanoate copolymers
from forest biomass. Journal of Industrial Microbiology and Biotechnology, 33, 616-
626.
Kemper, N. (2008) Veterinary antibiotics in the aquatic and terrestrial environment.
Ecological indicators, 8, 1-13.
Kesarcodi-Watson, A., Kaspar, H., Lategan, M.J. & Gibson, L. (2008) Probiotics in
aquaculture: The need, principles and mechanisms of action and screening processes.
Aquaculture, 274, 1-14.
Kesarcodi-Watson, A., Kaspar, H., Lategan, M.J. & Gibson, L. (2009) Screening for
probiotics of Greenshell™ mussel larvae, Perna canaliculus, using a larval challenge
bioassay. Aquaculture, 296, 159-164.
Kesarcodi-Watson, A., Kaspar, H., Lategan, M.J. & Gibson, L. (2009) Two pathogens of
Greenshell™ mussel larvae, Perna canaliculus: Vibrio splendidus and a V.
coralliilyticus/neptunius-like isolate. Journal of Fish Diseases, 32, 499-507.
Kesarcodi-Watson, A., Kaspar, H., Lategan, M.J. & Gibson, L. (2010) Alteromonas macleodii
0444 and Neptunomonas sp. 0536, two novel probiotics for hatchery-reared
Greenshell™ mussel larvae, Perna canaliculus. Aquaculture, 309, 49-55.
Kesarcodi-Watson, A., Miner, P., Nicolas, J.-L. & Robert, R. (2012) Protective effect of four
potential probiotics against pathogen-challenge of the larvae of three bivalves: Pacific
oyster (Crassostrea gigas), flat oyster (Ostrea edulis) and scallop (Pecten maximus).
Aquaculture, 344-349, 29-34.
APPENDIX –A References
162
Kim, B.S. & Chang, H.N. (1995) Control of glucose feeding using exit gas data and its
application to the production of PHB from tapioca hydrolysate by Alcaligenes
eutrophus. Biotechnology Techniques, 9, 311-314.
Kim, B.S., Lee, S.C., Lee, S.Y., Chang, H.N., Chang, Y.K. & Woo, S.I. (1994) Production of
poly (3‐hydroxybutyric acid) by fed‐batch culture of Alcaligenes eutrophus with
glucose concentration control. Biotechnology and Bioengineering, 43, 892-898.
Kimes, N.E., Grim, C.J., Johnson, W.R., Hasan, N.A., Tall, B.D., Kothary, M.H., Kiss, H.,
Munk, A.C., Tapia, R., Green, L., Detter, C., Bruce, D.C., Brettin, T.S., Colwell, R.R.
& Morris, P.J. (2012) Temperature regulation of virulence factors in the pathogen
Vibrio coralliilyticus. Multidisciplinary Journal of microbial ecology, 6, 835-846.
Koller, L. (1990) Immunotoxicology: functional changes. Immunotoxicology of metals and
immunotoxicology. Plenum Press, New York, 23, 233-284.
Kris-Etherton, P.M., Harris, W.S., Appel, L.J. & Committee, F.T.N. (2002) Fish
Consumption, Fish Oil, Omega-3 Fatty Acids, and Cardiovascular Disease.
Circulation, 106, 2747-2757.
Kubota, Y., Watanabe, Y., Otsuka, H., Tamiya, T., Tsuchiya, T. & Matsumoto, J.J. (1985)
Purification and characterization of an antibacterial factor from snail mucus.
Comparative Biochemistry and Physiology Part C: Comparative Pharmacology, 82,
345-348.
Kuchel, R.P., Raftos, D.A. & Nair, S. (2010) Immunosuppressive effects of environmental
stressors on immunological function in Pinctada imbricata. Fish & Shellfish
Immunology, 29, 930-936.
Labreuche, Y., Lambert, C., Soudant, P., Boulo, V., Huvet, A. & Nicolas, J.-L. (2006)
Cellular and molecular hemocyte responses of the Pacific oyster, Crassostrea gigas,
following bacterial infection with Vibrio aestuarianus strain 01/32. Microbes and
Infection, 8, 2715-2724.
Labreuche, Y., Soudant, P., Gonçalves, M., Lambert, C. & Nicolas, J.-L. (2006) Effects of
extracellular products from the pathogenic Vibrio aestuarianus strain 01/32 on
lethality and cellular immune responses of the oyster Crassostrea gigas.
Developmental & Comparative Immunology, 30, 367-379.
Lacoste, A., Jalabert, F., Malham, S., Cueff, A., Gelebart, F., Cordevant, C., Lange, M. &
Poulet, S. (2001) A Vibrio splendidus strain is associated with summer mortality of
juvenile oysters Crassostrea gigas in the Bay of Morlaix (North Brittany, France).
Diseases of Aquatic Organisms, 46, 139-145.
Lambert, C., Soudant, P., Jegaden, M., Delaporte, M., Labreuche, Y., Moal, J. & Samain, J.-
F. (2007) In vitro modulation of reactive oxygen and nitrogen intermediate (ROI/RNI)
production in Crassostrea gigas hemocytes. Aquaculture, 270, 413-421.
Lane, E. & Birkbeck, T.H. (2000) Species specificity of some bacterial pathogens of bivalve
molluscs is correlated with their interaction with bivalve haemocytes. Journal of Fish
Diseases, 23, 275-279.
Lang, R.P., Bayne, C.J., Camara, M.D., Cunningham, C., Jenny, M.J. & Langdon, C.J. (2009)
Transcriptome Profiling of Selectively Bred Pacific Oyster Crassostrea gigas Families
that Differ in Tolerance of Heat Shock. Marine Biotechnology, 11, 650-668.
APPENDIX –A References
163
Laranja, J.L.Q., Ludevese-Pascual, G.L., Amar, E.C., Sorgeloos, P., Bossier, P. & De
Schryver, P. (2014) Poly-β-hydroxybutyrate (PHB) accumulating Bacillus spp.
improve the survival, growth and robustness of Penaeus monodon (Fabricius, 1798)
postlarvae. Veterinary Microbiology, 173, 310-317.
Lavine, M. & Strand, M. (2002) Insect hemocytes and their role in immunity. Insect Biochem
Mol Biol, 32, 1295-1309.
Le Deuff, R.-M., Nicolas, J.-L., Renault, T. & Cochennec, N. (1994) Experimental
transmission of a herpes-like virus to axenic larvae of Pacific oyster, Crassostrea
gigas. Bulletin of the European Association of Fish Pathologists, 14, 69-72.
Lee, R., Lovatelli, A. & Ababouch, L. (2012) Bivalve depuration: fundamental and practical
aspects. FAO Fisheries Technical paper, 511.
Lee, S.I.a.B.L. (2005) Recent Advances in the Innate Immunity of Invertebrate Animals.
Recent Advances in the Innate Immunity of Invertebrate Animals, 38, 128-150.
Lee, S.Y. (1996a) Bacterial polyhydroxyalkanoates. Biotechnology and Bioengineering, 49,
1-14.
Lee, S.Y. (1996b) Plastic bacteria? Progress and prospects for polyhydroxyalkanoate
production in bacteria. Trends in Biotechnology, 14, 431-438.
Lee, S.Y., Choi, J.-I., Han, K. & Song, J.Y. (1999) Removal of endotoxin during purification
of poly (3-hydroxybutyrate) from gram-negative bacteria. Applied and Environmental
Microbiology, 65, 2762-2764.
Leippe, M. & Renwrantz, L. (1988) Release of cytotoxic and agglutinating molecules by
Mytilus hemocytes. Developmental & Comparative Immunology, 12, 297-308.
Lewis, T.E., Garland, C.D., O'brien, T.D., Fraser, M.I., Tong, P.A., Ward, C., Dix, T.G. &
Mcmeekin, T.A. (1988) The use of 0.2-µm membrane-filtered seawater for improved
control of bacterial levels in microalgal cultures fed to larval Pacific oysters
(Crassostrea gigas). Aquaculture, 69, 241-251.
Lhafi, S. & Kuhne, M. (2007) Occurrence of Vibrio spp. in blue mussels (Mytilus edulis)
from the German Wadden Sea. International Journal of Food Microbiology, 116, 297
- 300.
Li, H., Parisi, M.-G., Toubiana, M., Cammarata, M. & Roch, P. (2008) Lysozyme gene
expression and hemocyte behaviour in the Mediterranean mussel, Mytilus
galloprovincialis, after injection of various bacteria or temperature stresses. Fish &
Shellfish Immunology, 25, 143-152.
Li, H., Venier, P., Prado-Alvárez, M., Gestal, C., Toubiana, M., Quartesan, R., Borghesan, F.,
Novoa, B., Figueras, A. & Roch, P. (2010) Expression of Mytilus immune genes in
response to experimental challenges varied according to the site of collection. Fish &
Shellfish Immunology, 28, 640-648.
Li, X., Yang, Q., Dierckens, K., Milton, D.L. & Defoirdt, T. (2014) RpoS and Indole
Signaling Control the Virulence of Vibrio anguillarum towards Gnotobiotic Sea Bass
(Dicentrarchus labrax) Larvae. PLoS One, 9, e111801.
Licheng, H., Zhao Jian Min & Sheng, S.L. (2009) A review of advances in research on marine
molluscan antimicobial pepetides and their potential application in aquaculture.
Molluscan research, 29, 17-26.
APPENDIX –A References
164
Liltved, H. & Cripps, S. (1999) Removal of particle‐associated bacteria by prefiltration and
ultraviolet irradiation. Aquaculture Research, 30, 445-450.
Ling, E. & Yu, X.-Q. (2005) Prophenoloxidase binds to the surface of hemocytes and is
involved in hemocyte melanization in Manduca sexta. Insect Biochem Mol Biol, 35,
1356-1366.
Lipp, P., Brown, B., Liston, J. & Chew, K. (1976) Recent findings on the summer diseases of
Pacific oysters. In: Proceedings of the National Shellfisheries Association (ed. by, pp.
9-10.
Liu, P., &, L.K. & Sn, C. (1996) Pathogenicity of Vibrio parahaemolyticus in tiger prawn,
Penaeus monodon. Lett Appl Microbiol, 22, 413-416.
Liu, Y., De Schryver, P., Van Delsen, B., Maignien, L., Boon, N., Sorgeloos, P., Verstraete,
W., Bossier, P. & Defoirdt, T. (2010) PHB-degrading bacteria isolated from the
gastrointestinal tract of aquatic animals as protective actors against luminescent
vibriosis. FEMS Microbiology Ecology, 74, 196-204.
Lobel, P.B., Belkhode, S.P., Jackson, S.E. & Longerich, H.P. (1990) Recent taxonomic
discoveries concerning the mussel Mytilus: Implications for biomonitoring. Archives
of Environmental Contamination and Toxicology, 19, 508-512.
Lodeiros, C., Freites, L., Fernández, E., Vélez, A. & Bastardo, J. (1989) Efecto antibiótico de
tres bacterias marinas en la supervivencia de larvas de la viera Pecten ziczac
infectadas con el germen Vibrio anguillarum. Boletín instituto Oceanográfico de
Venezuela. Universidad Oriente, 28, 165-169.
Lodeiros, C.S., Bolinches, J., Dopazo, C.P. & Toranzo, A.E. (1987) Bacillary necrosis in
hatcheries of Ostrea edulis in Spain. Aquaculture, 65, 15-29.
Lopez, C., Carballal, M., Azevedo, C. & Villalba, A. (1997) Enzyme characterisation of the
circulating haemocytes of the carpet shell clam, Ruditapes decussatus (Mollusca:
Bivalvia). Fish & Shellfish Immunology, 7, 595-608.
Luengo, J.M., GarcıA, B., Sandoval, A., Naharro, G. & Olivera, E.a.R. (2003) Bioplastics
from microorganisms. Current Opinion in Microbiology, 6, 251-260.
Luna-Acosta, A., Bustamante, P., Godefroy, J., Fruitier-Arnaudin, I. & Thomas-Guyon, H.
(2010) Seasonal variation of pollution biomarkers to assess the impact on the health
status of juvenile Pacific oysters Crassostrea gigas exposed in situ. Environmental
Science and Pollution Research, 17, 999-1008.
Luna-Acosta, A., Saulnier, D., Pommier, M., Haffner, P., De Decker, S., Renault, T. &
Thomas-Guyon, H. (2011) First evidence of a potential antibacterial activity involving
a laccase-type enzyme of the phenoloxidase system in Pacific oyster Crassostrea
gigas haemocytes. Fish & Shellfish Immunology, 31, 795-800.
Luna-Gonzalez, A., Maeda-Martínez, A., Sainz, J. & Ascencio-Valle, F. (2002) Comparative
susceptibility of veliger larvae of four bivalve mollusks to a Vibrio alginolyticus
strain. Diseases of Aquatic Organisms, 49, 221-226.
Luna-González, A., Maeda-MartıNez, A.N., Vargas-Albores, F., Ascencio-Valle, F. &
Robles-Mungaray, M. (2003) Phenoloxidase activity in larval and juvenile
homogenates and adult plasma and haemocytes of bivalve molluscs. Fish & Shellfish
Immunology, 15, 275-282.
APPENDIX –A References
165
Madison, L.L. & Huisman, G.W. (1999) Metabolic Engineering of Poly(3-
Hydroxyalkanoates): From DNA to Plastic. Microbiology and Molecular Biology
Reviews, 63, 21-53.
Magnesen, T. & Jacobsen, A. (2012) Effect of water recirculation on seawater quality and
production of scallop (Pecten maximus) larvae. Aquacultural Engineering, 47, 1-6.
Marinho-Soriano, E., Azevedo, C.a.A., Trigueiro, T.G., Pereira, D.C., Carneiro, M.a.A. &
Camara, M.R. (2011) Bioremediation of aquaculture wastewater using macroalgae and
Artemia. International Biodeterioration & Biodegradation, 65, 253-257.
Marques, A., Dinh, T., Ioakeimidis, C., Huys, G., Swings, J., Verstraete, W., Dhont, J.,
Sorgeloos, P. & Bossier, P. (2005) Effects of Bacteria on Artemia franciscana
Cultured in Different Gnotobiotic Environments. Applied and Environmental
Microbiology, 71, 4307-4317.
Mccarter, L.L. (2001) Polar flagellar motility of the Vibrionaceae. Microbiology and
Molecular Biology Reviews, 65, 445-462.
Mcdonald, J., Seed, R. & Koehn, R. (1991) Allozymes and morphometric characters of three
species of Mytilus in the Northern and Southern Hemispheres. Marine Biology, 111,
323-333.
Mchenery, J.G., Birkbeck, T.H. & Allen, J.A. (1979) The occurrence of lysozyme in marine
bivalves. Comparative Biochemistry and Physiology Part B: Comparative
Biochemistry, 63, 25-28.
Mcphearson, R.M., Depaola, A., Zywno, S.R., Motes, M.L. & Guarino, A.M. (1991)
Antibiotic resistance in Gram-negative bacteria from cultured catfish and aquaculture
ponds. Aquaculture, 99, 203-211.
Merrifield, D.L., Dimitroglou, A., Foey, A., Davies, S.J., Baker, R.T., Bøgwald, J., Castex,
M. & Ringø, E. (2010) The current status and future focus of probiotic and prebiotic
applications for salmonids. Aquaculture, 302, 1-18.
Mitta, G., Hubert, F., Dyrynda, E.A., Boudry, P. & Roch, P. (2000a) Mytilin B and MGD2,
two antimicrobial peptides of marine mussels: gene structure and expression analysis.
Developmental & Comparative Immunology, 24, 381-393.
Mitta, G., Hubert, F., Noel, T. & Roch, P. (1999a) Myticin, a novel cysteine-rich
antimicrobial peptide isolated from haemocytes and plasma of the mussel Mytilus
galloprovincialis. European Journal of Biochemistry, 265, 71 - 78.
Mitta, G., Vandenbulcke, F., Hubert, F. & Roch, P. (1999b) Mussel defensins are synthesised
and processed in granulocytes then released into the plasma after bacterial challenge.
Journal of Cell Science, 112, 4233-4242.
Mitta, G., Vandenbulcke, F., Hubert, F., Salzet, M. & Roch, P. (2000d) Involvement of
Mytilins in Mussel Antimicrobial Defense. Journal of Biological Chemistry, 275,
12954-12962.
Mitta, G., Vandenbulcke, F., Noel, T., Romestand, B., Beauvillain, J.C., Salzet, M. & Roch,
P. (2000c) Differential distribution and defence involvement of antimicrobial peptides
in mussel. Journal of Cell Science, 113, 2759-2769.
APPENDIX –A References
166
Mitta, G., Vandenbulcke, F. & Roch, P. (2000b) Original involvement of antimicrobial
peptides in mussel innate immunity. Federation of European Biochemical Societies
Letters, 486, 185-190.
Mothes, G., Schubert, T., Harms, H. & Maskow, T. (2008) Biotechnological coproduction of
compatible solutes and polyhydroxyalkanoates using the genus Halomonas.
Engineering in Life Sciences, 8, 658-662.
Mudliar, S., Vaidya, A., Kumar, M.S., Dahikar, S. & Chakrabarti, T. (2008) Techno-
economic evaluation of PHB production from activated sludge. Clean Technologies
and Environmental Policy, 10, 255-262.
Mukai, K., Yamada, K. & Doi, Y. (1993) Enzymatic degradation of poly (hydroxyalkanoates)
by a marine bacterium. Polymer Degradation and Stability, 41, 85-91.
Mulero, I., García-Ayala, A., Meseguer, J. & Mulero, V. (2007) Maternal transfer of
immunity and ontogeny of autologous immunocompetence of fish: a minireview.
Aquaculture, 268, 244-250.
Munoz, P., Meseguer, J. & Esteban, M.Á. (2006) Phenoloxidase activity in three commercial
bivalve species. Changes due to natural infestation with Perkinsus atlanticus. Fish &
Shellfish Immunology, 20, 12-19.
Murchelano, R.A., Brown, C. & Bishop, J. (1975) Quantitative and Qualitative Studies of
Bacteria Isolated from Sea Water Used in the Laboratory Culture of the American
Oyster, Crassostrea virginica. Journal of the Fisheries Research Board of Canada, 32,
739-745.
Najdegerami, E.H., Tran, T.N., Defoirdt, T., Marzorati, M., Sorgeloos, P., Boon, N. &
Bossier, P. (2012) Effects of poly-β-hydroxybutyrate (PHB) on Siberian sturgeon
(Acipenser baerii) fingerlings performance and its gastrointestinal tract microbial
community. FEMS Microbiology Ecology, 79, 25-33.
Nakamura, A., K.G.T. & Mori, A.K. (1999) Vibriostatic Bacteria Isolated from Rearing
Seawater of Oyster Brood Stock: Potentiality as Biocontrol Agents for Vibriosis in
Oyster Larvae. Fish Pathology, 34, 139 - 144.
Nakayama, K., Nomoto, A.M., Nishijima, M. & Maruyama, T. (1997) Morphological and
Functional Characterization of Hemocytes in the Giant ClamTridacna crocea. Journal
of Invertebrate Pathology, 69, 105-111.
Nathalie, L., Serge, R., (2001) Toll-like receptor 4: the missing link of the cerebral innate
immune response triggered by circulating gram-negative bacterial cell wall
components. Federation of American Societies for Experimental Biology, 15, 155-163.
Natrah, F.M., Ruwandeepika, H.A., Pawar, S., Karunasagar, I., Sorgeloos, P., Bossier, P. &
Defoirdt, T. (2011) Regulation of virulence factors by quorum sensing in Vibrio
harveyi. Veterinary Microbiology, 154, 124-129.
Nehlig, A. (2004) Brain uptake and metabolism of ketone bodies in animal models.
Prostaglandins, Leukotrienes and Essential Fatty Acids, 70, 265-275.
Nevejan, N., De Schryver, P., Wille, M., Dierckens, K., Baruah, K. & Van Stappen, G. (2016)
Bacteria as food in aquaculture: do they make a difference? Reviews in Aquaculture.
APPENDIX –A References
167
Newell, R.I. & Moran, D. (1989) Species profiles: Life histories and environmental
requirements of coastal fishes and invertebrates (North and Mid-Atlantic). In: (ed. by.
DTIC Document, Maryland University Cambridge Horn Point Environment Labs.
Newton, K., Peters, R. & Raftos, D. (2004) Phenoloxidase and QX disease resistance in
Sydney rock oysters (Saccostrea glomerata). Developmental & Comparative
Immunology, 28, 565-569.
Nhan, D.T., Wille, M., De Schryver, P., Defoirdt, T., Bossier, P. & Sorgeloos, P. (2010) The
effect of poly β-hydroxybutyrate on larviculture of the giant freshwater prawn
Macrobrachium rosenbergii. Aquaculture, 302, 76-81.
Nickerson, K.W. (1982) Purification of poly-β-hydroxybutyrate by density gradient
centrifugation in sodium bromide. Applied and Environmental Microbiology, 43,
1208-1209.
Nicolas, J., Gatesoupe, F., Froueli, S., Bachere, E. & Gueguen, Y. (2007) What alternatives to
antibiotics are conceivable for aquaculture. Animal Production Science, 20, 253-258.
Nicolas, J.L., Comps, M. & Cochennec, N. (1992) Herpes – like virus infecting Pacific oyster
larvae, Crassostrae gigas. Bulletin of the European Association of Fish Pathologists,
12, 11 – 13
Nicolas, J.L., Corre, S., Gauthier, G., Robert, R. & Ansquer, D. (1996) Bacterial problems
associated with scallop Pecten maximus larval culture. Diseases of Aquatic
Organisms, 27, 67 - 76.
Nilsen, I. & Myrnes, B. (2001) The gene of chlamysin, a marine invertebrate-type lysozyme,
is organized similar to vertebrate but different from invertebrate chicken-type
lysozyme genes. Gene, 269, 27 - 32.
Noël, D., Pipe, R., Elston, R., Bachère, E. & Mialhe, E. (1994) Antigenic characterization of
hemocyte subpopulations in the mussel Mytilus edulis by means of monoclonal
antibodies. Marine Biology, 119, 549-556.
Nottage, A.S. & Birkbeck, T.H. (1990) Interactions between different strains of Vibrio
alginolyticus and hemolymph fractions from adult Mytilus edulis. Journal of
Invertebrate Pathology, 56, 15-19.
Olafsen, J.A. (2001) Interactions between fish larvae and bacteria in marine aquaculture.
Aquaculture, 200, 223-247.
Ostle, A.G. & Holt, J.G. (1982) Nile blue A as a fluorescent stain for poly-beta-
hydroxybutyrate. Applied and Environmental Microbiology, 44, 238-241.
Ottaviani, E. & Franceschi, C. (1998) A new theory on the common evolutionary origin of
natural immunity, inflammation and stress response: the invertebrate phagocytic
immunocyte as an eye-witness. Domestic Animal Endocrinology, 15, 291-296.
Ottaviani, E., Petraglia, F., Montagnani, G., Cossarizza, A., Monti, D. & Franceschi, C.
(1990) Presence of ACTH and β-endorphin immunoreactive molecules in the
freshwater snail Planorbarius corneus (L.) (Gastropoda, Pulmonata) and their possible
role in phagocytosis. Regulatory Peptides, 27, 1-9.
Padhi, A. & Verghese, B. (2008) Molecular diversity and evolution of myticin-C
antimicrobial peptide variants in the Mediterranean mussel, Mytilus galloprovincialis.
Peptides, 29, 1094-1101.
APPENDIX –A References
168
Paillard, C., Le Roux, F. & Borrego, J.J. (2004) Bacterial disease in marine bivalves, a review
of recent studies: Trends and evolution. Aquatic Living Resources, 17, 477-498.
Paillard, C., Maes, P. & Oubella, R. (1994) Brown ring disease in clams. Annual Review of
Fish Diseases, 4, 219-240.
Pallavicini, A., Del Mar Costa, M., Gestal, C., Dreos, R., Figueras, A., Venier, P. & Novoa,
B. (2008) High sequence variability of myticin transcripts in hemocytes of immune-
stimulated mussels suggests ancient host–pathogen interactions. Developmental &
Comparative Immunology, 32, 213-226.
Parisi, M.-G., Li, H., Toubiana, M., Parrinello, N., Cammarata, M. & Roch, P. (2009)
Polymorphism of mytilin B mRNA is not translated into mature peptide. Mol
Immunol, 46, 384-392.
Parry, H. & Pipe, R. (2004) Interactive effects of temperature and copper on
immunocompetence and disease susceptibility in mussels (Mytilus edulis). Aquatic
Toxicology, 69, 311-325.
Patnaik, P.R. (2005) Perspectives in the Modeling and Optimization of PHB Production by
Pure and Mixed Cultures. Critical Reviews in Biotechnology, 25, 153-171.
Philip, S., Keshavarz, T. & Roy, I. (2007) Polyhydroxyalkanoates: biodegradable polymers
with a range of applications. Journal of Chemical Technology and Biotechnology, 82,
233-247.
Pillay, T.V.R. & Kutty, M.N. (2005) Aquaculture: principles and practices, Blackwell
Publishing, Oxford.
Pipe, R.K. (1990) Hydrolytic enzymes associated with the granular haemocytes of the marine
mussel Mytilus edulis. The Histochemical Journal, 22, 595-603.
Pipe, R.K. (1992) Generation of reactive oxygen metabolites by the haemocytes of the mussel
Mytilus edulis. Developmental & Comparative Immunology, 16, 111-122.
Prado, S., Romalde, J.L. & Barja, J.L. (2010) Review of probiotics for use in bivalve
hatcheries. Veterinary Microbiology, 145, 187-197.
Pruzzo, C., Gallo, G. & Canesi, L. (2005) Persistence of vibrios in marine bivalves: the role
of interactions with hemolymph components. Environmental Microbiology, 7, 761 -
772.
Pujalte, M.J., Ortigosa, M., Macián, M.C. & Esperanza Garay (1999) Aerobic and facultative
anaerobic heterotrophic bacteria ssociated to Mediterranean oysters and seawater.
International microbial, 2, 259 - 266.
Quillaguamán, J., Delgado, O., Mattiasson, B. & Hatti-Kaul, R. (2006) Poly (β-
hydroxybutyrate) production by a moderate halophile, Halomonas boliviensis LC1.
Enzyme and microbial technology, 38, 148-154.
Quillaguamán, J., Muñoz, M., Mattiasson, B. & Hatti-Kaul, R. (2007) Optimizing conditions
for poly (β-hydroxybutyrate) production by Halomonas boliviensis LC1 in batch
culture with sucrose as carbon source. Applied Microbiology and Biotechnology, 74,
981-986.
APPENDIX –A References
169
Raby, D., Mingelbier, M., Dodson, J., Klein, B., Lagadeuc, Y. & Legendre, L. (1997) Food-
particle size and selection by bivalve larvae in a temperate embayment. Marine
Biology, 127, 665-672.
Rasmussen, L., Hage, E. & Karlog, O. (1985) Light and electronmicroscopic studies of the
acute and long-term toxic effects of N-nitrosodipropylamine and N-methylnitrosurea
on the marine mussel Mytilus edulis. Marine Biology, 85, 55-65.
Rasmussen, L.P. (1986) Virus-associated granulocytomas in the marine mussel, Mytilus
edulis, from three sites in Denmark. Journal of Invertebrate Pathology, 48, 117-123.
Reddy, C., Ghai, R. & Kalia, V.C. (2003) Polyhydroxyalkanoates: an overview. Bioresource
Technology, 87, 137-146.
Reid, G., Sanders, M.E., Gaskins, H.R., Gibson, G.R., Mercenier, A., Rastall, R., Roberfroid,
M., Rowland, I., Cherbut, C. & Klaenhammer, T.R. (2003) New Scientific Paradigms
for Probiotics and Prebiotics. Journal of Clinical Gastroenterology, 37, 105-118.
Rekecki, A., Gunasekara, R., Dierckens, K., Laureau, S., Boon, N., Favoreel, H., Cornelissen,
M., Sorgeloos, P., Ducatelle, R. & Bossier, P. (2012) Bacterial host interaction of
GFP‐labelled Vibrio anguillarum HI‐610 with gnotobiotic sea bass, Dicentrarchus
labrax (L.), larvae. Journal of Fish Diseases, 35, 265-273.
Ren, H., Musch, M.W., Kojima, K., Boone, D., Ma, A. & Chang, E.B. (2001) Short-chain
fatty acids induce intestinal epithelial heat shock protein 25 expression in rats and IEC
18 cells. Gastroenterology, 121, 631-639.
Renault, T. (1996) Appearance and spread of diseases among bivalve mollusks in the northern
hemisphere in relation to international trade. Revue Scientifique Et Technique-office
International Des Epizooties, 15, 551-561.
Renault, T., Cochennec, N., Le Deuff, R.-M. & Chollet, B. (1994) Herpes-like virus infecting
Japanese oyster (Crassostrea gigas) spat. Bulletin of the European Association of Fish
Pathologists, 14, 64-66.
Renwrantz, L. (1990) Internal defence system of Mytilus edulis, Manchester University Press,
Manchester, pp 256-275.
Ricke, S. (2003) Perspectives on the use of organic acids and short chain fatty acids as
antimicrobials. Poultry Science, 82, 632-639.
Ringø, E., Olsen, R.E., Gifstad, T.Ø., Dalmo, R.A., Amlund, H., Hemre, G.I. & Bakke, A.M.
(2010) Prebiotics in aquaculture: a review. Aquaculture Nutrition, 16, 117-136.
Riquelme, C., Araya, R. & Escribano, R. (2000) Selective incorporation of bacteria by
Argopecten purpuratus larvae: implications for the use of probiotics in culturing
systems of the Chilean scallop. Aquaculture, 181, 25-36.
Riquelme, C., Araya, R., Vergara, N., Rojas, A., Guaita, M. & Candia, M. (1997) Potential
probiotic strains in the culture of the Chilean scallop Argopecten purpuratus
(Lamarck, 1819). Aquaculture, 154, 17-26.
Riquelme, C., Hayashida, G. & Araya, R. (1996) Isolation of a native bacterial strain from the
scallop Argopecten purpuratus with inhibitory effects against pathogenic vibrios.
Oceanographic Literature Review, 2, 144.
APPENDIX –A References
170
Riquelme, C.E., Jorquera, M.A., Rojas, A.I., Avendaño, R.E. & Reyes, N. (2001) Addition of
inhibitor-producing bacteria to mass cultures of Argopecten purpuratus larvae
(Lamarck, 1819). Aquaculture, 192, 111-119.
Rizzi, M., Wittenberg, J.B., Coda, A., Fasano, M., Ascenzi, P. & Bolognesi, M. (1994)
Structure of the sulfide-reactive hemoglobin from the clam Lucina pectinata:
Crystallographic analysis at 1.5 Å resolution. Journal of molecular biology, 244, 86-
99.
Roberfroid, M. (2007) Prebiotics: the concept revisited. The Journal of Nutrition, 137, 830S-
837S.
Roch, P. (1999) Defense mechanisms and disease prevention in farmed marine invertebrates.
Aquaculture, 172, 125-145.
Roch, P., Hubert, F., Van Der Knaap, W. & Noël, T. (1996) Present knowledge on the
molecular basis of cytotoxicity, antibacterial activity and stress response in marine
bivalves. Italian Journal of Zoology, 63, 311-316.
Rojas, R., Miranda, C.D., Opazo, R. & Romero, J. (2015) Characterization and pathogenicity
of Vibrio splendidus strains associated with massive mortalities of commercial
hatchery-reared larvae of scallop Argopecten purpuratus (Lamarck, 1819). Journal of
Invertebrate Pathology, 124, 61-69.
Romalde, J. & Barja, J. (2010) Bacteria in mollusks: good and bad guys. In: Current
Research, Technology and Education Topics in Applied Microbiology and Microbial
Biotechnology, Microbiology Series No 2, Vol. I (ed A. Méndez‐Vilas).
Romalde, J.L., Area, E., Sánchez, G., Ribao, C., Torrado, I., Abad, X., Pintó, R.M., Barja,
J.L. & Bosch, A. (2002) Prevalence of enterovirus and hepatitis A virus in bivalve
mollusks from Galicia (NW Spain): inadequacy of the EU standards of
microbiological quality. International Journal of Food Microbiology, 74, 119-130.
Romalde, J.L., Dieguez, A.L., Lasa, A. & Balboa, S. (2013) New Vibrio species associated to
molluscan microbiota: a review. Frontiers in Microbiology, 4, 413.
Ruiz-Ponte, C., Samain, J., Sanchez, J. & Nicolas, J. (1999) The benefit of a Roseobacter
species on the survival of scallop larvae. Marine Biotechnology, 1, 52-59.
Ruwandeepika, H.a.D., Defoirdt, T., Bhowmick, P.P., Karunasagar, I., Karunasagar, I. &
Bossier, P. (2011) In vitro and in vivo expression of virulence genes in Vibrio isolates
belonging to the Harveyi clade in relation to their virulence towards gnotobiotic brine
shrimp (Artemia franciscana). Environmental Microbiology, 13, 506-517.
Sainz-Hernandez, J.C. & Maeda-Martinez, A.N. (2005) Sources of Vibrio bacteria in mollusk
hatcheries and control methods: a case study. Aquaculture Research, 36, 1611-1618.
Salimi, L., Jamili, S., Motalebi, A., Eghtesadi-Araghi, P., Rabbani, M. & Rostami-Beshman,
M. (2009) Morphological characterization and size of hemocytes in Anodonta cygnea.
Journal of Invertebrate Pathology, 101, 81-85.
Sandaa, R.-A., Brunvold, L., Magnesen, T. & Bergh, Ø. (2008) Monitoring the opportunistic
bacteria Pseudoalteromonas sp. LT-13 in a great scallop, Pecten maximus hatchery.
Aquaculture, 276, 14-21.
APPENDIX –A References
171
Sandlund, N., Torkildsen, L., Magnesen, T., Mortensen, S. & Bergh, Ã.I. (2006)
Immunohistochemistry of great scallop Pecten maximus larvae experimentally
challenged with pathogenic bacteria. Diseases of Aquatic Organisms, 69, 163-173.
Sapkota, A., Sapkota, A.R., Kucharski, M., Burke, J., Mckenzie, S., Walker, P. & Lawrence,
R. (2008) Aquaculture practices and potential human health risks: current knowledge
and future priorities. Environment International, 34, 1215-1226.
Sauve, G. (2013) Molluscan shellfish safety, Springer, Charlottetown, PEI, Canada.
Schikorski, D., Faury, N., Pepin, J.F., Saulnier, D., Tourbiez, D. & Renault, T. (2011)
Experimental ostreid herpesvirus 1 infection of the Pacific oyster Crassostrea gigas:
Kinetics of virus DNA detection by q-PCR in seawater and in oyster samples. Virus
Research, 155, 28-34.
Schmiel, D.H. & Miller, V.L. (1999) Bacterial phospholipases and pathogenesis. Microbes
and Infection, 1, 1103-1112.
Schmitt, P., De Lorgeril, J., Gueguen, Y., Destoumieux-Garzón, D. & Bachère, E. (2012)
Expression, tissue localization and synergy of antimicrobial peptides and proteins in
the immune response of the oyster Crassostrea gigas. Developmental & Comparative
Immunology, 37, 363-370.
Schmittgen, T. & Livak, K. (2008) Analyzing real-time PCR data by the comparative C (T)
method Nature Protocols, 3, 1101–1108.
Schneider, S.M., Rosskopf, E.N., Leesch,J.G., Chellemi, D.O., Bull,C.T., Mazzol, M., (2003)
Research on alternatives to methyl bromide: Pre – plant and post – harvest. Pest
Management Science, 59, 814 – 826.
Schröder, J.-M. (1999) Epithelial peptide antibiotics. Biochemical Pharmacology, 57, 121-
134.
Seafood-Industry-Training-Organisation (2006) Biology of the New Zealand Greenshell
Mussel. Learning Resource for Unit Standard, 3, 40 p.
Seo, J.-K., Crawford, J.M., Stone, K.L. & Noga, E.J. (2005) Purification of a novel arthropod
defensin from the American oyster, Crassostrea virginica. Biochemical and
Biophysical Research Communications, 338, 1998-2004.
Shi, H., Shiraishi, M. & Shimizu, K. (1997) Metabolic flux analysis for biosynthesis of poly
(β-hydroxybutyric acid) in Alcaligenes eutrophus from various carbon sources.
Journal of Fermentation and Bioengineering, 84, 579-587.
Shiraki, M., Endo, T. & Saito, T. (2006) Fermentative production of (R)-(−)-3-
hydroxybutyrate using 3-hydroxybutyrate dehydrogenase null mutant of Ralstonia
eutropha and recombinant Escherichia coli. Journal of bioscience and bioengineering,
102, 529-534.
Situmorang, M.L., De Schryver, P., Dierckens, K. & Bossier, P. (2016) Effect of poly-β-
hydroxybutyrate on growth and disease resistance of Nile tilapia Oreochromis
niloticus juveniles. Veterinary Microbiology, 182, 44-49.
Smaal, A.C. (2002) European mussel cultivation along the Atlantic coast: production status,
problems and perspectives. Hydrobiologia, 484, 89-98.
APPENDIX –A References
172
Smith, V.J. & Söderhäll, K. (1991) A comparison of phenoloxidase activity in the blood of
marine invertebrates. Developmental & Comparative Immunology, 15, 251-261.
Soletchnik, P., Ropert, M., Mazurié, J., Fleury, P.G. & Le Coz, F. (2007) Relationships
between oyster mortality patterns and environmental data from monitoring databases
along the coasts of France. Aquaculture, 271, 384-400.
Sommer, F. & Backhed, F. (2013) The gut microbiota [mdash] masters of host development
and physiology. Nature Reviews Microbiology, 11, 227-238.
Song, L., Wang, L., Qiu, L. & Zhang, H. (2010) Bivalve immunity. In: Invertebrate immunity,
pp. 44-65. Springer.
Song, X., Wang, H., Xin, L., Xu, J., Jia, Z., Wang, L. & Song, L. (2016) The immunological
capacity in the larvae of Pacific oyster Crassostrea gigas. Fish & Shellfish
Immunology, 49, 461-469.
Sonthi, M., Toubiana, M., Pallavicini, A., Venier, P. & Roch, P. (2011) Diversity of coding
sequences and gene structures of the antifungal peptide mytimycin (MytM) from the
Mediterranean mussel, Mytilus galloprovincialis. Marine Biotechnology, 13, 857-867.
Spanggaard, B., Jørgensen, F., Gram, L. & Huss, H.H. (1993) Antibiotic resistance in bacteria
isolated from three freshwater fish farms and an unpolluted stream in Denmark.
Aquaculture, 115, 195-207.
Steinbüchel, A. & Valentin, H.E. (1995) Diversity of bacterial polyhydroxyalkanoic acids.
FEMS Microbiology Letters, 128, 219-228.
Stuart, J.A. & Ballantyne, J.S. (1996) Correlation of environment and phylogeny with the
expression of β-hydroxybutyrate dehydrogenase in the mollusca. Comparative
Biochemistry and Physiology Part B: Biochemistry and Molecular Biology, 114, 153-
160.
Suantika, G., Dhert, P., Rombaut, G., Vandenberghe, J., De Wolf, T. & Sorgeloos, P. (2001)
The use of ozone in a high density recirculation system for rotifers. Aquaculture, 201,
35-49.
Sudesh, K., Abe, H. & Doi, Y. (2000) Synthesis, structure and properties of
polyhydroxyalkanoates: biological polyesters. Progress in Polymer Science, 25, 1503-
1555.
Sugumar, G., Nakai, T., Hirata, Y., Matsubara, D. & Muroga, K. (1998) Vibrio splendidus
biovar II as the causative agent of bacillary necrosis of Japanese oyster Crassostrea
gigas larvae. Diseases of Aquatic Organisms, 33, 111 - 118.
Suguna, P., Binuramesh, C., Abirami, P., Saranya, V., Poornima, K., Rajeswari, V. &
Shenbagarathai, R. (2014) Immunostimulation by poly-β hydroxybutyrate–
hydroxyvalerate (PHB–HV) from Bacillus thuringiensis in Oreochromis
mossambicus. Fish & Shellfish Immunology, 36, 90-97.
Sui, L., Cai, J., Sun, H., Wille, M. & Bossier, P. (2012) Effect of poly-beta-hydroxybutyrate
on Chinese mitten crab, Eriocheir sinensis, larvae challenged with pathogenic Vibrio
anguillarum. Journal of Fish Diseases, 35, 359-364.
Sui, L., Liu, Y., Sun, H., Wille, M., Bossier, P. & De Schryver, P. (2014) The effect of poly-
β-hydroxybutyrate on the performance of Chinese mitten crab (Eriocheir sinensis
Milne-Edwards) zoea larvae. Aquaculture Research, 45, 558-565.
APPENDIX –A References
173
Sullivan, L.J. & Gifford, D.J. (2009) Preservation of the larval ctenophore Mnemiopsis leidyi
A. Agassiz (Ctenophora, Lobata). Journal of Plankton Research. Oxford University
Press, 0, 1-6.
Summerfelt, S.T. (2003) Ozonation and UV irradiation—an introduction and examples of
current applications. Aquacultural Engineering, 28, 21-36.
Sun, B., Zhang, X.-H., Tang, X., Wang, S., Zhong, Y., Chen, J. & Austin, B. (2007) A Single
Residue Change in Vibrio harveyi Hemolysin Results in the Loss of Phospholipase
and Hemolytic Activities and Pathogenicity for Turbot (Scophthalmus maximus).
Journal of Bacteriology, 189, 2575-2579.
Sun, C.Q., O'connor, C.J., Turner, S.J., Lewis, G.D., Stanley, R.A. & Roberton, A.M. (1998)
The effect of pH on the inhibition of bacterial growth by physiological concentrations
of butyric acid: Implications for neonates fed on suckled milk. Chemico-Biological
Interactions, 113, 117-131.
Suriyamongkol, P., Weselake, R., Narine, S., Moloney, M. & Shah, S. (2007)
Biotechnological approaches for the production of polyhydroxyalkanoates in
microorganisms and plants—a review. Biotechnology Advances, 25, 148-175.
Sutton, D. & Garrick, R. (1993) Bacterial disease of cultured giant clam Tridacna gigas
larvae. Diseases of Aquatic Organisms, 16, 47-53.
Takahashi, K.G., Nakamura, A. & Mori, K. (2000) Inhibitory Effects of Ovoglobulins on
Bacillary Necrosis in Larvae of the Pacific Oyster, Crassostrea gigas. Journal of
Invertebrate Pathology, 75, 212-217.
Tan, J., Lancaster, M., Hyatt, A., Van Driel, R., Wong, F. & Warner, S. (2008) Purification of
a herpes-like virus from abalone (Haliotis spp.) with ganglioneuritis and detection by
transmission electron microscopy. Journal of Virological Biology, 149, 338-341.
Tendencia, E.A. & De La Peña, L.D. (2001) Antibiotic resistance of bacteria from shrimp
ponds. Aquaculture, 195, 193-204.
Thai, T., Wille, M., Garcia-Gonzalez, L., Sorgeloos, P., Bossier, P. & De Schryver, P. (2014)
Poly-ß-hydroxybutyrate content and dose of the bacterial carrier for Artemia
enrichment determine the performance of giant freshwater prawn larvae. Applied
Microbiology and Biotechnology, 98, 5205-5215.
Thomas-Guyon, H., Gagnaire, B., Bado-Nilles, A., Bouilly, K., Lapègue, S. & Renault, T.
(2009) Detection of phenoloxidase activity in early stages of the Pacific oyster
Crassostrea gigas (Thunberg). Developmental & Comparative Immunology, 33, 653-
659.
Tincu, J.A. & Taylor, S.W. (2004) Antimicrobial Peptides from Marine Invertebrates.
Antimicrobial Agents and Chemotherapy, 48, 3645-3654.
Tirapé, A., Bacque, C., Brizard, R., Vandenbulcke, F. & Boulo, V. (2007) Expression of
immune-related genes in the oyster Crassostrea gigas during ontogenesis.
Developmental & Comparative Immunology, 31, 859-873.
Tokiwa, Y. & Ugwu, C.U. (2007) Biotechnological production of (R)-3-hydroxybutyric acid
monomer. Journal of Biotechnology, 132, 264-272.
APPENDIX –A References
174
Torkildsen, L., Lambert, C., Nylund, A., Magnesen, T. & Bergh, Ø. (2005) Bacteria
associated with early life stages of the great scallop, Pecten maximus: impact on larval
survival. Aquaculture International, 13, 575-592.
Tubiash, H. & Otto, S. (1986) Bacterial problems in oysters. A review. Pathology in Marine
Aquaculture. Bredene, Belgium, European Aquaculture Society Publications, 9, 233-
242.
Tubiash, H.S., Chanley, P.E. & Leifson, E. (1965) Bacillary Necrosis, a Disease of Larval and
Juvenile Bivalve Mollusks I. Etiology and Epizootiology. Journal of Bacteriology, 90,
1036-1044.
Tubiash, H.S., Colwell, R.R. & Sakazaki, R. (1970) Marine vibrios associated with bacillary
necrosis, a disease of larval and juvenile bivalve mollusks. Journal of Bacteriology,
103, 271.
Tutar, L. & Tutar, Y. (2010) Heat shock proteins; an overview. Current Phamaceutical
Biotechnology, 11, 216-222.
Uchino, K., Saito, T. & Jendrossek, D. (2008) Poly(3-Hydroxybutyrate) (PHB) Depolymerase
PhaZa1 Is Involved in Mobilization of Accumulated PHB in Ralstonia eutropha H16.
Applied and Environmental Microbiology, 74, 1058-1063.
Urbányi, B., Horváth, Á. & Bokor, Z. (2008) Artificial fertilization in aquaculture species:
from normal practice to chromosome manipulation. Methods in Reproductive
Aquaculture—Marine and Freshwater Species. CRC Press, Boca Raton, 183-218.
Uriarte, I., FarıAs, A. & Castilla, J.C. (2001) Effect of antibiotic treatment during larval
development of the Chilean scallop Argopecten purpuratus. Aquacultural
Engineering, 25, 139-147.
Valappil, S.P., Boccaccini, A.R., Bucke, C. & Roy, I. (2007) Polyhydroxyalkanoates in
Gram-positive bacteria: insights from the genera Bacillus and Streptomyces. Antonie
van Leeuwenhoek, 91, 1-17.
Vasconcelos, G. & Lee, J. (1972) Microbial flora of Pacific oysters (Crassostrea gigas)
subjected to ultraviolet-irradiated seawater. Applied Micriobiology, 23, 11-16.
Verschuere, L., Rombaut, G., Sorgeloos, P. & Verstraete, W. (2000) Probiotic Bacteria as
Biological Control Agents in Aquaculture. Microbiology and Molecular Biology
Reviews, 64, 655-671.
Vijayendra, S., Rastogi, N., Shamala, T., Kumar, P.A., Kshama, L. & Joshi, G. (2007)
Optimization of polyhydroxybutyrate production by Bacillus sp. CFR 256 with corn
steep liquor as a nitrogen source. Indian Journal of Microbilogy, 47, 170-175.
Vulevic, J., Rastall, R.A. & Gibson, G.R. (2004) Developing a quantitative approach for
determining the in vitro prebiotic potential of dietary oligosaccharides. FEMS
Microbiology Letters, 236, 153-159.
Waechter, M., Le Roux, F., Nicolas, J., Marissal, E. & Berthe, F. (2002) Characterisation of
Crassostrea gigas spat pathogenic bacteria. Comptes Rendus Biologies, 325, 231.
Waikato, U.O. (2013) Mussel life cycle. [Online] at:
http://biotechlearn.org.nz/focus_stories/farming_green_lipped_mussels/images/mussel
_life_cycle.
APPENDIX –A References
175
Wang, F. & Lee, S.Y. (1997) Poly (3-Hydroxybutyrate) Production with High Productivity
and High Polymer Content by a Fed-Batch Culture of Alcaligenes latus under
Nitrogen Limitation. Applied and Environmental Microbiology, 63, 3703-3706.
Weltzien, F., A;, Hemre;, G.I., Evjemo;, J.O., Olsen;, Y. & Fyhn, H.J. (1999) Beta
Hydroxybutyrate in developing nauplii of brine shrimp (Artemia franciscana K.)
under feeding and non-feeding conditions. Comparative Biochemistry and Physiology,
125, 63-69.
Whelan, J.A., Russell, N.B. & Whelan, M.A. (2003) A method for the absolute quantification
of cDNA using real-time PCR. Journal of Immunological Methods, 278, 261-269.
Widdows, J. (1991) Physiological ecology of mussel larvae. Aquaculture, 94, 147-163.
Widdows, J., Donkin, P., Staff, F., Matthiessen, P., Law, R., Allen, Y., Thain, J., Allchin, C.
& Jones, B. (2002) Measurement of stress effects (scope for growth) and contaminant
levels in mussels (Mytilus edulis) collected from the Irish Sea. Marine Environmental
research, 53, 327-356.
Wildish, D. & Kristmanson, D. (1993) Hydrodynamic control of bivalve filter feeders: a
conceptual view. In: Bivalve Filter Feeders, pp. 299-324. Springer.
Winter, J. (1973) The filtration rate of Mytilus edulis and its dependence on algal
concentration, measured by a continuous automatic recording apparatus. Marine
Biology, 22, 317-328.
Wittke, M. & Renwrantz, L. (1984) Quantification of cytotoxic hemocytes of Mytilus edulis
using a cytotoxicity assay in agar. Journal of Invertebrate Pathology, 43, 248-253.
Yamane, T., Fukunaga, M. & Lee, Y.W. (1996) Increased PHB productivity by high‐cell‐density fed‐batch culture of Alcaligenes latus, a growth‐associated PHB producer.
Biotechnology and Bioengineering, 50, 197-202.
Yang, Q., Anh, N.D.Q., Bossier, P. & Defoirdt, T. (2014) Norepinephrine and dopamine
increase motility, biofilm formation, and virulence of Vibrio harveyi. Frontiers in
Microbiology, 5, 584.
Yang, Q. & Defoirdt, T. (2015) Quorum sensing positively regulates flagellar motility in
pathogenic Vibrio harveyi. Environmental Microbiology, 17, 960-968.
Yanyan, Z., Sulian, R., Dexiu, W. & Weibo, S. (2006) Structure and classification of
haemocytes in the bivalve molluscMeretrix meretrix. Journal of Ocean University of
China, 5, 132-136.
Yik Sung, Y., Van Damme, E.J., Sorgeloos, P. & Bossier, P. (2007) Non-lethal heat shock
protects gnotobiotic Artemia franciscana larvae against virulent Vibrios. Fish Shellfish
Immunol, 22, 318-326.
Yildiz, F.H. & Visick, K.L. (2009) Vibrio biofilms: so much the same yet so different. Trends
in Microbiology, 17, 109-118.
Yousefian, M. & Amiri, M.S. (2009) A review of the use of prebiotic in aquaculture for fish
and shrimp. African Journal of Biotechnology, 8.
Yue, X., Liu, B. & Xue, Q. (2011) An i-type lysozyme from the Asiatic hard clam Meretrix
meretrix potentially functioning in host immunity. Fish & Shellfish Immunology, 30,
550-558.
APPENDIX –A References
176
Zaidi, C., Tukimat, L., Muzzneena, A. & Mazlan, A. (2003) Effects of egg density during
incubation on the quality and viability of mussel larvae, Mytilus edulis L. Pakistan
Journal of Biological Science, 6, 1041-1045.
APPENDIX B Summary / Samenvatting
177
SUMMARY
The blue mussel (Mytilus edulis) is an important species in Europe, not only as a model for
environmental studies but also as aquaculture species. For this reason, the blue mussel was
considered an ideal bivalve model species for this study. One of the main problems in the
culture of bivalve mollusks are the repetitive episodes of mortality which seriously reduce
the commercial production as illustrated by the phenomenon of summer mortality (SM) in
juvenile oysters Crassostrea gigas in France, and brown ring disease (BRD) in adult carpet
shells (Ruditapes semidecussatus) in Spain. Not only the grow out production but also
bivalve hatcheries are hit by production losses. Disease outbreaks during larval stages are
often caused by Vibrionaceae as primary agents. Traditional methods to combat bacterial
diseases such as enhanced water treatment with UV and ozone or the use of antibiotics
proved to be insufficient, costly and in the case of antibiotics even compromising for the
environment and human health. In the last decade, a lot of research has been dedicated to
finding alternative methods to control disease outbreaks. Several studies have
demonstrated that the use of poly-β-hydroxybutyrate (PHB) might constitute an ecological
and economical, sustainable alternative to fight infections in aquaculture. PHB is the most
common polyhydroxyalkanoate that is accumulated as carbon and energy reserve by a wide
variety of prokaryotes and may account for 90% of the cellular dry weight in some specific
bacteria, e.g., Ralstonia. This PhD research is the first study to evaluate the use of PHB as an
innovative production strategy to improve the performance of bivalve larvae. The following
three approaches were used:
(1) First, the application of PHB in mussel larvae cultures in crystalline form (PHB-C: i.e.
extracted from the bacterial cells) and amorphous form (PHB-A: i.e. still contained in the
bacterial cells) was compared. PHB was supplied at concentrations of 0.1 mg L-1, 1.0 mg L-1,
and 10.0 mg L-1 to the culture water of the larvae, starting 2 days after fertilization. The
results indicated that PHB-C was ineffective while the supplementation of 1 mg L-1 PHB-A
combined with microalgae significantly increased the survival. It did not, however, stimulate
the growth of the larvae and had no beneficial effect on the metamorphosis process. The gut
APPENDIX B Summary / Samenvatting
178
microbiota of the mussel larvae was not significantly modulated by PHB supplementation in
terms of diversity and abundance and, therefore, could not be related to the larval
performance. Upon further investigation, a total of 22 PHB-degrading isolates were
identified from the mussel larvae fed with either crystalline PHB or amorphous PHB. 16 of
which belonged to the genus Pseudoalteromonas. Hypothesizing better survival and growth
by adding a strong PHB-degrading bacterium to the mussel culture in combination with
amorphous PHB, the isolate ARC4B5 was administered at a concentration of 106 CFU mL-1,
but the strain surprisingly suppressed larval growth.
(2) Secondly, the possible antimicrobial effect of PHB and its monomer in mussel larvae was
investigated. Their protective effect against two pathogenic bacteria Vibrio splendidus and
Vibrio coralliilyticus was studied both in vitro and in vivo at pH7 and pH8. pH-dependency
can be explained by the fact that fatty acids can pass the cell membrane only in their
undissociated form, which is more prominent at lower pH. For the in vitro tests, the
monomer β-hydroxybutyrate (β-HB) was used since bacteria can degrade PHB into β-HB
which is known to have antimicrobial activities. Only the highest concentration (125 mM)
significantly decreased the growth of the pathogens compared to the other concentrations
at both pH levels, except for V. coralliilyticus at pH8. The influence of β-HB on the virulence
factors of the pathogens was dependent on the dosage, Vibrio species, and pH. A clear
pattern could not be distinguished. The highest β-HB concentration (125 µM) inhibited some
virulence factors of the pathogenic bacteria such as hemolysis, phospholipase, but also
stimulated caseinase in V. splendidus at pH7 and V. coralliilyticus at pH8. In addition, β-HB
had no effect on gelatinase, lipase, and biofilm formation. The concentration of 125 µM is
biologically speaking irrelevant for mussel larvae and hence the results should be put in the
right perspective
Concerning the in vivo tests, survival of mussel larvae that received PHB-A at a
concentration of 1 mg L-1 PHB-A 6h before the challenge, was higher compared to the
survival of the larvae that received the PHB-A pre-treatment 24h before the challenge.
Larvae that received PHB-A 6h before the challenge showed a 55% and 25% increase in
survival compared to the controls when measured 96h after exposure to the pathogens V.
splendidus and V. coralliilyticus respectively.
APPENDIX B Summary / Samenvatting
179
(3) Finally, the impact of amorphous poly-β-hydroxybutyrate (PHB-A) (1mg PHB-A L-1) on
gene expression of the antimicrobial peptides (AMPs) mytimycin, mytilinB, defensin and the
hydrolytic enzyme lysozyme in exposed mussel larvae was looked into during in vivo
challenge tests with V. coralliilyticus (105 CFU mL-1). Phenoloxidase (PO) activity in the
challenged mussel larvae was also evaluated. RNAs were isolated from mussel larvae tissue,
and AMPs were quantified by q-PCR using 18SrRNA gene as a housekeeping gene. The
results of this study demonstrated PHB-A regulated immune gene expression in mussel
larvae, as revealed by PO activity in unchallenged and challenged (48h after exposure)
larvae. This may at least partly explain why larval survival increases in the presence of PHB-
A.
It was demonstrated that 2 day-old blue mussel larvae activate the expression of the three
AMPs, mytimycin, mytilinB and defensin upon invasion by the pathogen V. coralliilyticus. The
level of expression is up- and down-regulated in the first 12hours after exposure in an
unclear pattern, but rapidly increases from 24 to 48 h post-exposure. The expression of
lysozyme, however, remains very low and stable during the first 48 h after challenge. The
mytimycin gene is one of the genes with the strongest expression in blue mussel larvae.
In conclusion, it can be stated that the biological compound PHB supplied as freeze-dried
Ralstonia can bring added value to bivalve larvae culture by its ability to fight pathogenic
infections and stimulate immune gene expression of these species. The fact that PHB-A
seems to have a positive role opens also the possibility to apply microbial biomass rich in
PHB rather than PHB-C, which needs to be chemically extracted, increasing the price of its
production. A thorough validation of the benefits of PHB-A at a commercial hatchery level
might provide the necessary data to verify the economic feasibility of PHB-A application as a
disease controlling tool.
180
APPENDIX B Summary/Samenvatting
181
SAMENVATTING
De blauwe mossel (Mytilus edulis) is een belangrijke soort in Europa, niet alleen vanuit
ecologisch standpunt maar ook als aquacultuur soort. Dit is de reden waarom de blauwe
mossel ook voor deze studie als model heeft gediend voor de klasse van de bivalven. Een
van de belangrijkste problemen waarmee de sector te kampen heeft, zijn de recurrente
periodes van mortalteit die de commerciële productie zware slagen kan toedienen zoals
geïllustreerd door het fenomeen van zomermortaliteit bij juveniele holle oester Crassostrea
gigas in Frankrijk and de bruine ringziekte bij adulte tapijtschelpen (Ruditapes
semidecussatus) in Spanje. Niet alleen de schelpdierproducenten maar ook de broedhuizen
van schelpdieren worden geconfronteerd met zware verliezen. Ziektes gedurende het larvale
stadium worden vaak veroorzaakt door Vibrionaceae als primaire vectoren. Traditionele
methoden om deze bacteriële ziekten te bestrijden zoals het doorgedreven zuiveren van het
water met UV en ozon of het gebruik van antibiotica blijken niet zo efficiënt te zijn, kostelijk
en bovendien, in het geval van antibiotica, zelfs compromitterend voor het milieu en de
menselijke gezondheid. In het laatste decennium, is veel onderzoek gewijd aan het
ontwikkelen van alternatieve methodes om het uitbreken van ziektes in de hand te houden.
Verschillende studies hebben aangetoond dat het gebruik van poly-β-hydroxybutyrate (PHB)
een ecologisch en economisch verantwoord alternatief kan betekenen om infecties in
aquaculture te bestrijden. PHB is de meest voorkomende polyhydroxyalkanoate dat als
koolstof en energie reserve wordt opgeslagen door een wijd gamma aan prokaryoten, tot
zelfs 90% van het droog celgewicht in specieke bacteriële stammen zoals Ralstonia. Dit
doctoraatsonderzoek heeft voor de eerste keer de applicatie van PHB in mollusken en dus
ook in blauwe mossellarven geëvalueerd. Drie strategieën werden gevolgd:
(1) Als eerste werd de toediening van PHB in het kweekwater van mossel larven onder
crystallijne vorm (d.i. geëxtraheerd uit de bacteriële cellen, PHB-C)) en amorfe vorm (d.i. nog
ingecapseld in de gevriesdroogde bacteria, PHB-A) met elkaar vergeleken. PHB werd
toegediend in concentraties van 0,1 mg L-1, 1,0 mg L-1 and 10,0 mg L-1, startend 2 dagen na
de bevruchting van de eitjes. De resultaten toonden aan dat PHB-C geen impact had terwijl
APPENDIX B Summary/Samenvatting
182
de supplementatie van 1,0 mg L-1 PHB-A in combinatie met microalgen leidde tot significante
verhoging van de larvale overleving. Er was echter geen effect op de larvale groei noch op
het proces van de metamorphose. De samenstelling en rijkdom van de intestinale microbiële
flora van de mossellarven was niet significant gewijzigd door de toediening van PHB en kon
dus niet gerelateerd worden aan de larvale performantie. In een volgende stap werden in
het totaal 22 PHB-afbrekende isolaten gekarakterizeerd afkomstig van mossel larven die
PHB-C of PHB-A waren toegediend. Alle isolaten behoorden toe tot het genus
Pseudoalteromonas. De hypothese dat de toevoeging van een sterk PHB-afbrekende
bacterium een positieve invloed zou hebben op overleving en groei van de mossellarven
wanneer die toegevoegd werd aan het kweekwater samen met PHB-A, werd ontkracht
gezien de toevoeging van ARC4B5 aan 106 CFU mL-1 de larvale groei zelfs onderdrukte.
(2) Vervolgens werd de mogelijke anti-bacteriële werking van PHB en het afgeleid
monomeer product onderzocht. Hun beschermende werking tegen twee pathogenen voor
bivalven, Vibrio splendidus en Vibrio coralliilyticus werd zowel in vitro als in vivo uitgetest bij
pH7 en pH8. De pH afhankelijkheid kan verklaard worden door het feit dat de vetzuren
alleen in ongedissocieerde vorm doorheen de celwand kunnen passeren en deze vorm is
meer vertegenwoordigd bij lage pH. Voor de in vitro tests werd de monomeer β-
hydroxybutyrate (β-HB) gebruikt omdat bacteriën PHB degraderen naar β-HB dat bewezen
anti-microbiële activiteiten heeft. Alleen de hoogste concentratie (125 mM) inhibeerde
significant de groei van beide pathogenen onafhankelijk van de pH, met uitzondering van V.
coralliilyticus by pH8. De impact van β-HB op de virulentie factoren van de pathogenen was
afhankelijk van de concentratie, Vibrio soort en pH. Er kon geen duidelijk patroon
waargenomen worden. De hoogste β-HB concentratie (125 µm) inhibeerde sommige
virulentie factoren van de pathogenen zoals haemolyisis and phospholipase maar
stimuleerde ook de productie van caseinase in V. splendidus bij pH7 en V. coralliilyticus bij
pH8. Het gebruik van β-HB had geen effect op gelatinase, lipase en biofilm vorming. De
concentratie van 125 µM is biologisch gesproken echter irrelevant voor mossellarven en de
resultaten moeten dus voorzichtig geïnterpreteerd worden.
In de in vivo testen werd duidelijk dat de overleving van de mossel larven die PHB-A (1,0 mg
L-1 ) 6 hr voor de challenge toegediend kregen, hoger was dan de overleving bij larven die
APPENDIX B Summary/Samenvatting
183
PHB-A 24hr voor de challenge kregen. In vergelijking met de controle dieren, vertoonden
deze eerstgenoemde larven een toename in overleving van 55% en 25% na 96h blootstelling
aan de pathogenen V. splendidus en V. coralliilyticus respectivelijk.
(3) Tenslotte werd de impact van PHB-A (1,0 mg L-1 ) op de genexpressie van de
antimicrobiële peptides (AMPs) mytimycin, mytilinB, defensin en van het hydrolytisch
enzyme lysozyme bestudeerd tijdens in vivo challenge tests met V. coralliilyticus (105 CFU
mL-1). Phenoloxidase activiteit (PO) in de larven werd ook gemeten. RNA werd geïsoleerd
van gehomogeniseerde mossel larven en de expressie van de AMPs werd gekwantificeerd
met q-PCR en met 18SrRNA gen als huishoudgen. Uit deze studie komt naar voor dat PHB-A
de immuun genexpressie in larven kan regelen gezien de PO activiteit zowel in de controle
als blootgestelde larven toeneemt na 48h. Dit zou deels kunnen verklaren waarom de larvale
overleving toeneemt wanneer PHB-A wordt toegediend aan het kweekwater.
Er is aangetoond dat larven van 2 dagen-oud de expressie van drie AMPs, mytimycin,
mytilinB en defensin activeren bij een invasie van de pathogeen V. coralliilyticus. Het
expressie niveau gaat op en neer in de eerste 12 uren na blootstelling zonder patroon, maar
stijgt snel na 24 tot 48 uur blootstelling. De expressie van lysozyme echter blijft heel laag en
stabiel gedurende de eerste 48 uur na blootstelling. Het mytimycin-gen is een van de genen
die het sterkst tot expressie komt in blauwe mossellarven.
Als besluit van deze studie kan gesteld worden dat PHB, aangeleverd in de vorm van
gevriesdroogde Ralstonia een toegevoegde waarde kan bieden voor larvale cultuur van
bivalven dankzij zijn directe werking op de pathogeen en stimulerend effect op de expressie
van immuun-gerelateerde genen. Dit opent de mogelijkheid om microbiële biomassa rijk aan
PHB te gebruiken eerder dan PHB-C dat eerst chemisch geëxtraheerd moet worden wat de
productiekost opdrijft. Een grondige validatie van de voordelen van PHB-A op het niveau van
een commercieel broedhuis kan de nodige data aanleveren om de economische
haalbaarheid van het gebruik van PHB-A als ziekte controlerend middel te evalueren.
184
APPENDIX C Extra – experiment
185
EXTRA- EXPERIMENT
Below are the results of an experiment supplementary to the results already shown in fig 4.2
APPENDIX C Extra – experiment
186
Figure 4.2. (Repeat experiment). Survival of blue mussel challenge with V. coralliilyticus and
V. splendidus at 105CFU mL-1 under different experimental condition.
........................................................................................................................................................................................................................................................................ !
~ i
EL. ~ -----x "i 60 '\ I ------s-... ____
8 ~ 40 \ !
0 24 48 72 96
Post exposurejh)
·····+ ··· Control ---0-- V. splendidus
-I'HB - ->f - V. splendidus + I'HB
Challenge test z. 1 mg PHB L-1 ; Z4h
100
_80
ê60
~40 l 20
-~ ' '
...
\ \
\
0 J.._ ______ -"'0:::-:=-",-=-~----~
0 24 48 72 96
Post exposure jh)
·····+ ····· Control ---8-- V. splendidus
____.._.. I'HB - ->f - V.splendidus+ I'HB
Challenge test 3. 10 mg PHB L·1; 6h
100
20 0 J.._ ______________ _
0 24 48 72 96
Post exposure lh)
·····+ ····· control ---8-- V. splendidus
---+-PHB - -::+ - V. splendidus + PHB
Challenge 4. 10 mg PHB L·1; Z4h
100
80
20
0
0 24 48 72 96
ut ' i 20 \ i o - a -s l
0 24
·····+ ····· Control
____.._.. I'HB
48 72 96
Post exposurelh)
---e--- V. coralliilyticus
- -;~- V. coralliilyticus+ I'HB
: i
I i
I i i
·----··· ... • • i '\ i
100
40 '\ ! 2: _L_ _______ \_\===-!~[+- !
0
·····+ ···· Control
____.._.. I'HB
24 48 72 96 i ;
Post exposure lh) ! ;
---8-- V. coralliilyticus 1 i
- ->f - V. coralliilyticuS+ I'HB ~
i i
~ ,: .,. I l 60 ' ;
l : _L_ _______ '_\_\--"'~L-:::-:::-~-=- ti'---- I 0 24 48 72 96 !
Post exposurejh) I i
·····+ ···· Control ---8-- V. coralliilyticus ~ - -::+ - V. coralliilyticus .. I'HB i
i i
'\, i m '\\.._______ I
0 L_ __________ ~=~=~=~-~ i
100
0 24 48 72 96 ! ;
Post exposure (h) I hl i Post exposure i ···+ ··· Control ---8-- V. splendidus ·····+ ···· Control ---e-- V. coralliilyticus !
____.._.. I'HB - ->f - V. splendidus .. I'HB ____.._.. I'HB ---><:--- V. coralliilyticu<-> I'HB ~ .................................................................................................................................................................................................................................................................... .!
APPENDIX –D Acknowledgement
187
ACKNOWLEDGEMENTS
First of all, I am very grateful to the Vietnamese government (The Vietnam International
Education and Development, and Aquaculture Biotechnology program of Ministry of
Agriculture and Rural Development) and the VLIR-OI project ZEIN2011PR389 (University of
Ghent, Belgium) for their financial support in completing my PhD research program.
For over more than four years, this dissertation would not have been possible without the
guidance and help of several individuals who have contributed directly or indirectly to bring
this thesis to a successful end.
My special thanks goes to my promotor Prof. dr. ir. Peter Bossier, for his kind support and
overall guidance in the completion of my PhD. He was always available during his very busy
schedule to give me useful feedback, suggestions and corrections in every aspect related to
my PhD work. I considered myself very lucky to have had the chance to work under the
supervision of such a kind person and a well-kown professor in his field.
My deepest gratitude goes to Dr. ir. Nancy Nevejan, for her guidance and especially for her
patience in correcting my papers and the manuscript of this thesis. I would also like to thank
her for her support not only in my scientific work but also for my family situation. I will never
forget you, together with your husband Marc, looking for a solution to help my small son,
where you introduced us and explained all to the doctor in an Antwerp hospital for the
Cochlear implant for my small son.
A special thank you goes to Dr. Peter De Schryver, who has always stood by me, from
designing the scientific experiments to the practical work in the beginning of my PhD. He has
been contributing to all the papers during my study. I also want to thank him for his patience
during the corrections of my papers.
I am very grateful to Dr. Ana Bossier for her support and critical thesis correction. I also wish
to thank her for the suggestions and comments on the manuscript. Many thanks for the
home made cakes and your willingness to look after of me when I got sick. Thank you very
much!
APPENDIX –D Acknowledgement
188
I also wish to express my deep gratitude to Em. prof. dr. Patrick Sorgeloos, for giving me an
opportunity to study and do research in both the international master program and the PhD
degree at the Laboratory of Aquaculture & Artemia Reference Center, University of Ghent,
Belgium. Thank you very much.
I would like to thank all the members of the examination and reading committee. Thanks a
lot for sharing your expertise and knowledge. I am very grateful for your critical comments
and suggestions towards improving the quality of this manuscript.
I am also grateful to all the staff at the Research Institute for Aquaculture #3: former director
Prof. Dr. Nguyen Chinh, Assoc. Prof. Dr. Nguyen Thi Xuan Thu, Dr. Dao Van Tri, Dr. Nguyen
Viet Nam, Dr. Truong Ha Phuong, Dr. Vo The Dung, Mr. Nguyen Co Thach, Mr. Pham Vu Hai
and current director Dr. Nguyen Huu Ninh for always supporting me, giving me the
opportunity to study abroad, and encouraging me during my study period. Also, my
particular thanks goes to my close family friends at home, Binh Hieu, Phong Vi, Thoa Chinh,
Hien Thien, Tam Phuc, Phuong Tinh. You have always been helpful and encouraged my
family when I was not at home. Thank you very much!
My moments at ARC with my colleagues will be cherished forever. I would like to give all of
you a great thank you: Marc Verschraeghen, Tom Baelemans, Alex Pieters, Caroline Van
Geeteruyen, Mathieu Wille, Jorg Desmyter, Brigitte Van Moffaert, Anita De Haese, Geert Van
de Wiele, Christ Mahieu, Prof. dr. Gilbert Van Stappen, Jean Dhont, Kristof Dierckens,
Margriet Drouillon, Kenny Vandenbroucke, Michael Yufeng Niu, Kartik Baruah and Parisa
Norouzitallab. Thank you for always being available to help me during my lab work at ARC.
Especially, to the mussel team Mieke Eggermont and Aäron Plovie, thank you for your kind
help and always accompanying me during the experiments with our lovely mussel larvae. To
all ARC staff members, thanks for the good friendship and assistance. I think I will miss all of
you.
Many thanks to Dr. Tinh, who recommended me the ARC before I started my PhD
application and to Dr. Phuoc for his continuous support, suggestions and scientific
comments on the manuscript. Special thanks to my PhD colleagues: XHong, VDung, Toi, Van,
Tho, Joseph, Gladys, Eamy, Bai Nan, Lenny, Sofie, Hu Bing, Li Xuan, Ramin, Mohamed,
Spyros, Bay, Loan, Manh, Dipesh, Sony, Rajeish, Duy, Ruy, Navid, Bárbara and Thai, thanks
APPENDIX –D Acknowledgement
189
for sharing the secret experience, co-operation, and science discussions. I wish you all the
best!
To the Vietnamese people and students who are living Belgium: Tam Anh, Thu Ha, Xuan
Hong, Viet Hong, Dung, Giang, Thuc, Nguyen, Phuc, Loc, Toi, Tuyen, Hanh Tien, Tuan, Luong,
Linh, Duy, Ha, Phuong, Cuong, Ngoc, Thai, and family Giang Duc, Phuong Thuong, Thuy Khai,
Han Dung, Ha Tu, Thuy Anh, Quan Ut, Tho Ut, Trang Quan, thanks for a nice friendship and
social activities that made my life much more colorful during my stay in Ghent.
To my master students Tam and Christine Ludevese for their support and assistance during
extensive periods of the experiment. Thank you!
I was lucky to live in OBSG, a beautiful and friendly place for students from developing
countries who study in Gent. I would like to thank Father Charles de Hemptinne, and all the
staff for all their service and the accommodation during my stay in Ghent.
Great thanks to all members of my family: my mother, brothers and sisters, my mother in
law, brothers in law, and my sisters in law who have always supported me and expected me
to finish my PhD degree. I know that words are not enough to express my gratitude to them.
This thesis is a present for them. Thank you.
I am especially thankful to my foreign family Heidrun Inger Wergeland and Ian Mayer for
their continuous encouragement and contribution during my study. I do not know how to
express my gratitude for what you have done for me. Thank you.
Finally, I would like to dedicate this thesis to my lovely wife Thanh Thuy, my daughter Anh
Thi and my small son Anh Khoi for their support, encouragement and their patience during
the 4 years of my PhD research. My wife has worked hard to take care of our children and
has suffered a lonely life during the time I have not been at home. Behind the success of my
PhD research as well as the success of my life were always her silent sacrifices. And I would
like to say sorry to my little son for leaving him when he was only 2 weeks old until now.
Thank you very much!
Ghent, 02/05/2016
Hung
190
APPENDIX –E Curriculum vitae
191
CURRICULUM VITAE
A. PERSONAL DATA
Full name: Nguyen Van Hung
Day of birth: March 12, 1973
Place of birth: Binh Dinh, Viet Nam
Nationality: Vietnamese
Organization: Mariculture Research and Development Center, Research Institute for
Aquaculture No.3, Ministry of Agriculture and Rural Development, Viet Nam.
Position: Researcher/ Scientific staff
Head office: 33 Dangtat, Nhatrang, Vietnam
Telephone: + 84.58 3831 138, Fax: + 84.58 3831 846
E-mail: [email protected] / [email protected]
B. EDUCATION
2011 – 2016: PhD in Applied Biological Science at Laboratory of Aquaculture & Artemia
Reference Center, Faculty of Bioscience Engineering, University of Ghent, Belgium.
2003 – 2005: Master of Science in Aquaculture, University of Ghent, Belgium
1993 – 1998: Aquaculture Engineering, Nhatrang University of Fisheries, Vietnam.
C. PROFESSIONAL ACTIVITIES
2009–2014: Vice-director of Mariculture Research and Development Center.
2007-2010: National Project: Preservation of the gene pool of Aquaculture marine species in
Vietnam (Coordinator).
2008: Institute project: The use of probiotic in marine fish parramundi (Lates calcarifer) and
orange- spotted grouper (Epinephelus coioides) larvae and fingerling (Coordinator).
APPENDIX –E Curriculum vitae
192
2008-2010: National project KC.06/06-10: Research on seed production and grow out the
technology of three economic value marine fish (Co-coordinator).
2008-2010: National project KC.06/06-10: Research on seed production and grow out the
technology of three coral ornamental fish to export (Co-coordinator).
2007: Cooperation project between Vietnam-Russian tropical Center- Moscow University
and Research Institute for Aquaculture no.3. Project Title: Induced Oocyte maturation and
gamete quality in coral reef fish species with alternative reproductive strategies
(Coordinator).
2006-2008: Cooperation project (JICA and RIA3): Economic marine finfish Research and
Development: Broodstock management, Implantation for hormone stimulation to spawning,
Biological reproduction, larval rearing, and live food (Group leader/ Scientific staff).
2002-2003: Cooperation project with ICLARM (World fish center) Project title: Seed
production, nursery rearing and grow out of Sea-cucumber Holothuria scabra (Staff
member).
2000-2001: National project: Reproduction and grow out of Abalone Haliotic asinina (Staff
member).
1998-1999: National Project: Seed production technology and grow out of Yellow pearl
oyster Pinctada maxima Jameson, 1901 (Staff member).
D. PUBLICATIONS & INTERNATIONAL CONFERENCES
Publication in international peer-reviewed journals
Hung, N. V., De Schryver, P., Tam, T. T., Garcia-Gonzalez, L., Bossier, P. & Nevejan, N. 2015.
Application of poly-β-hydroxybutyrate (PHB) in mussel larviculture. Aquaculture 446(0) p:
318-324.
International conferences
Hung, N.V., N. Nevejan., P. De Schryver., Dung, N.V., P. Bossier 2016. Poly-ß-hydroxybutyrate
(PHB) regulates the immune response in mussel larvae challenged with Vibrio coralliilyticus.
European Marine Science Educators Association 2016 Conference 2016: VIVES, Brugge,
Belgium (Poster presentation)
APPENDIX –E Curriculum vitae
193
Hung, N.V., P. De Schryver, T. T. Tam, L. Garcia-Gonzalez, P. Bossier and N. Nevejan, 2013.
Effect of Poly - β - hydroxybutyrate on bivalve larvae culture. World Aquaculture Society
Conference, Ho Chi Minh City, Vietnam (Oral presentation).
Hung, N.V., P. De Schryver, T. T. Tam, P. Bossier and N. Nevejan, 2013. The use of poly - β -
hydroxybutyrate in bivalve larviculure. Larvi 2013 Conference, 6th fish & shellfish larviculture
symposium, Ghent Belgium (Poster presentation).
Hung, N.V., D.A. Pavlov, Nata’ya G. Emel’yanova and Thuan, L.T.B. 2007. Induced oocyte
maturation and gamete quality in coral reef fish species with alternative reproductive
strategies. Asia Pacific Aquaculture conference in Ha Noi, Viet Nam (Poster presentation).
Hung, N.V., Tri, D. V, Norihisa, I. 2007. Spawning of Coral trout grouper Plectropomus
leopardus in Nha Trang, Viet Nam. Asia Pacific Aquaculture conference in Ha Noi, Viet Nam
(Oral presentation).
Publications at national level
Thoa, N.T., Thuy, N.T.T., Hung, N.V., 2015. The first studies of several common diseases and
the prevention of diseases in the reproduction of frog crab (Ranina ranina Linnaeus, 1758).
Journal of Agriculture and Rural Development (6), p: 101-107 (Abstract in English).
Thuy, N.T.T., Thoa, N.T., Phuong, D.T., Hung, N.V., 2014. Reproductive biology of the red frog
crab (Ranina ranina Linnaeus, 1758) from Khanh Hoa province, Vietnam. Journal of
Agriculture and Rural Development (5), p: 77-85 (Abstract in English).
Hung N.V., Binh D.T., 2010. Application of mtDNA to evaluate the population diversity of
coral trout grouper (Plectropomus leopardus) distributed in Vietnam coastal area. Journal of
Biotechnology, Nha Trang University (Abstract in English).
Hung N.V., Bon. L. Q, 2008. Research population genetic on coral trout grouper in Khanh Hoa
and Hai Phong coastal area. Fisheries Technological science No.6/2009 ISN 1859 -1299 p: 12-
14 (Abstract in English).
APPENDIX –E Curriculum vitae
194
Hung N.V., Bon. L. Q, Dung.N.V and Ishibashi N., 2009. Research on some reproduction
biology of coral trout grouper (Plectropomus leopardus) in Khanh Hoa coastal area.
Agriculture publishing house HCM, Vietnam p: 445 – 453 (Abstract in English).
Hung N.V., N.T.T.Hien, V.T.T. Em, 2009. Research on food and nutrition demand of coral
trout grouper (Plectropomus leopardus) from larvae rearing to fingerling stage. Agriculture
publishing house HCM, Vietnam (Abstract in English).
Hung N.V., D.T. Phuong, V.T.T. Em, N.D.Tinh, 2009. The effects of some probiotic on growth
and survival rate in larvae rearing or orange spot grouper (Epinephelus coioides) and seabass
(Lates calcarifer). Agriculture publishing house HCM, Vietnam (Abstract in English).
Hung N.V., L.Q. Bon, H.T. Ngoc, 2009. Status of gene pool preservation of aquaculture
marine, brackish species. Agriculture publishing house HCM, Vietnam (Abstract in English).
Hung N.V., Tra. N.T.P; Anh. N.T.K, 2008. Research on some biological characteristic of
damselfish (Dascyluss trimaculatus). Agriculture publishing house HCM, Vietnam p: 454-464
(Abstract in English).
Hung, N.V., Phuong, D.T., Thuy, T.T., 2009. Evaluate fertility of male, white shrimp
(Litopenaeus vannamei) F1 generation derived from Hawaii. Agriculture publishing house
HCM, Vietnam, p: 822 – 832 (Abstract in English).
Thuy, N.T.T., Hung, N.V., Thuy, T.N., 2009. Detecting parasites and bacteria in damselfish
(Dascyllus trimaculatus) cultured at Nhatrang with the exophthalmia and ulcerative
infection. Agriculture publishing house HCM, Vietnam, p: 694 – 702 (Abstract in English).
Hung, N.V., Bon, L.Q., Duy, V.D., Ngoc, H.T., Minh, D.M., 2008. Some classification and
population genetic features of Brown- marbled grouper (Epinephelus fuscoguttatus,
Forssakal 1775) in Khanh Hoa coastal area. Fisheries Technological Science No. 9/2008 ISSN
1859 -1299 p: 32 – 34 (Abstract in English).
E. DOCTORAL TRAINING SCHOOL / PROFESSIONAL TRAINING COURSES
Specialist courses
APPENDIX –E Curriculum vitae
195
- Applying Chemical Tools to study Biology, held by VIB, University of Antwerp,
Belgium.
- Basis of biology for engineers, held by IMEC, University of Leuven, Belgium.
- Microbial Community Management in Aquaculture, held by ARC, Ugent, Belgium.
Transferable skills
-Personal Effectiveness held by Doctoral Traning School, Ugent, Belgium.
-Project management held by Doctoral Traning School, Ugent, Belgium.
-Scientific writing skill, held by Doctoral Training School -VIB, Ugent, Belgium.
-Effective scientific communication held by Doctoral Traning School, Ugent, Belgium.
-Advanced Conference Skills in English held by Doctoral Traning School, Ugent,
Belgium.
Professional training courses
2009: Practice on molecular biotechnology held by Biotechnology Institute, Ha Noi, Vietnam.
2007: Grouper Hatchery Training course funded by Network of Aquaculture Centers in Asia –
Pacific (NACA). Held at Brackishwater Aquaculture Development Center- Situbondo,
Research Institute for Mariculture, Gondol, Indonesia.
2006: Intensive Aquaculture production, Environmental, considerations & Food safety. Held
at Ministry of Agriculture and Rural Development, Center for International
Agriculture Development Cooperation Cinadco, Israel.
2003: Babylon Seed production technology funded and held by Ocean Wave Seafood,
Melbourne, Australia.
1999: Taxonomy and diversity of Tropical marine mollusk held by DANIDA, Denmark.
G. THESIS SUPERVISION
1. Tran Thanh Tam, 2013. The use of poly-β-hydroxybutyrate to increase robustness in blue
mussel larviculture. Master of Sciences in Aquaculture at the Faculty of Bioscience
engineering, Ghent University, Belgium.
APPENDIX –E Curriculum vitae
196
2. Christine Llorente Ludevese, 2015. Antimicrobial effect of poly-β-hydroxybutyrate (PHB)
on blue mussel larviculture. Master of Sciences in Aquaculture at the Faculty of Bioscience
engineering, Ghent University, Belgium.