APPLIED AND ENVIRONMENTAL MICROBIOLOGY,0099-2240/01/$04.0010 DOI: 10.1128/AEM.67.9.4192–4198.2001

Sept. 2001, p. 4192–4198 Vol. 67, No. 9

Copyright © 2001, American Society for Microbiology. All Rights Reserved.

Production of Recombinant a-Galactosidases inThermus thermophilus

OLAFUR FRIDJONSSON1* AND RALF MATTES2

Prokaria Ltd., 112 Reykjavik, Iceland,1 and Institut fur Industrielle Genetik,Universitat Stuttgart, 70569 Stuttgart, Germany2

Received 5 March 2001/Accepted 26 June 2001

A Thermus thermophilus selector strain for production of thermostable and thermoactive a-galactosidase wasconstructed. For this purpose, the native a-galactosidase gene (agaT) of T. thermophilus TH125 was inactivatedto prevent background activity. In our first attempt, insertional mutagenesis of agaT by using a cassettecarrying a kanamycin resistance gene led to bacterial inability to utilize melibiose (a-galactoside) and galac-tose as sole carbohydrate sources due to a polar effect of the insertional inactivation. A Gal1 phenotype wasassumed to be essential for growth on melibiose. In a Gal2 background, accumulation of galactose or itsmetabolite derivatives produced from melibiose hydrolysis could interfere with the growth of the host strainharboring recombinant a-galactosidase. Moreover, the AgaT2 strain had to be Kms for establishment of theplasmids containing a-galactosidase genes and the kanamycin resistance marker. Therefore, a suitable selec-tor strain (AgaT2 Gal1 Kms) was generated by applying integration mutagenesis in combination with phe-notypic selection. To produce heterologous a-galactosidase in T. thermophilus, the isogenes agaA and agaB ofBacillus stearothermophilus KVE36 were cloned into an Escherichia coli-Thermus shuttle vector. The regioncontaining the E. coli plasmid sequence (pUC-derived vector) was deleted before transformation of T. ther-mophilus with the recombinant plasmids. As a result, transformation efficiency and plasmid stability wereimproved. However, growth on minimal agar medium containing melibiose was achieved only following randomselection of the clones carrying a plasmid-based mutation that had promoted a higher copy number and greaterstability of the plasmid.

a-Galactosidases catalyze the hydrolysis of a-1,6-linkeda-galactose residues from oligosaccharides and polymeric ga-lactomannans (9, 25, 26, 42). They have considerable potentialin various industrial applications, e.g., in the sugar industry forthe elimination of D-raffinose from sugar beet syrup. Due tothe elevated temperatures used during the sugar manufactur-ing process, as well as in other industrial applications, stabilityand activity at high temperatures are important properties ofa-galactosidases.

We have been studying a-galactosidases from various bac-teria with regard to their application as oligosaccharide-hydrolyzing enzymes (9, 11, 14). Our intention was to subjecta-galactosidase to thermoadaptation by introducing genes en-coding enzymes inactive at high temperatures into a thermo-philic bacterium for subsequent selection of enzyme variantsactive at high temperatures. We chose Thermus thermophilus asa host due to its high transformation ability (17) and ability touse melibiose (a-galactoside) as a sole carbohydrate source(10). Thermus species have been used for expression of heter-ologous genes and selection of thermostable enzyme variants(16, 19, 34, 36). They possess a natural transformation system(17) and are competent regardless of their growth phase (12).Genetic systems based on the application of autonomouslyreplicating plasmids, as well as integration vectors or vectorscontaining cassettes, for chromosomal integration have beenestablished (13, 18, 22, 23, 35, 40). So far, the only antibioticselection markers described for Thermus bacteria are thermo-

stabilized variants of the kanamycin nucleotidyltransferasegene derived from a thermophilic Bacillus gene (28) or fromthe kan gene of Staphylococcus aureus (24).

Expression of heterologous genes requires the inactivationof analogous genes in the host strain. In our previous work(10), we cloned the a-galactosidase gene (agaT) from T. ther-mophilus TH125 into Escherichia coli and subsequently dis-rupted the gene by site-specific integration of the kanamycinresistance marker into the agaT locus in the T. thermophiluschromosome. Sequence analysis of agaT along with flankingsequences revealed an open reading frame (ORF) downstreamof and overlapping the agaT gene. The predicted translationproduct displayed similarity to galactose-1-phosphate uridylyl-transferases (GalT) of E. coli (2) and Streptomyces lividans (1).The 39 region of agaT and the 59 region of galT were left intactin the site-specific integration due to the overlapping codingregions. However, characterization of the integration mutantsrevealed their inability to use melibiose as well as galactose.This indicated a polar transcriptional effect on the downstreamgalT gene. The polar effect was considered an obstruction forour purpose due to a potential growth inhibition effect of theaccumulated galactose (or its metabolite derivatives) producedfrom melibiose hydrolysis in Gal2 strains harboring recombi-nant a-galactosidases. Interference with growth by galactosehas been described for Gal2 mutants of, e.g., E. coli (30) andBacillus subtilis (20).

In this paper, we describe the establishment of a Thermusstrain suitable for production of heterologous a-galactosidases.Thereby, two problems were circumvented which restricted theuse of the previously constructed agaT deletion strains (10):the galactose-negative phenotype and their kanamycin resis-

* Corresponding author. Mailing address: Prokaria Ltd., Gylfaflot 5,112 Reykjavik, Iceland. Phone: 354 570 7914. Fax: 354 570 7901.E-mail: olafur@prokaria.com.

4192

on August 10, 2020 by guest

http://aem.asm

.org/D

ownloaded from

tance, which otherwise prevented plasmid selection with thekanamycin marker. Further, we demonstrate the practicalvalue of the strain established in this work for the productionof recombinant a-galactosidases and as a potential selectionsystem for a-galactosidases active at high temperatures.

MATERIALS AND METHODS

Bacterial strains and growth conditions. T. thermophilus TH125 (trpB5) (12)was generously provided by T. Hoshino. The Thermus strains were grown understrong aeration in mineral medium 162 (8) with 0.25% tryptone and 0.25% yeastextract at pH 7.5 (T162). Growth under nonselective conditions was carried outat 65 to 70°C. Growth was carried out at 60°C when the cultures containedkanamycin (20 mg ml21) for selection of plasmid-containing cells. Growth of T.thermophilus TH125 on sole carbon sources was tested at 65 to 70°C on agarplates with minimal medium 162 (8) with a slight modification. Instead of titri-plex I, EGTA was used as a chelating agent (15 mg liter21). The mediumcontained galactose (0.3%) or melibiose (0.1, 0.2, or 0.4%) and 0.05% NH4Cl ascarbon and nitrogen sources, respectively, biotin (50 mg liter21), thiamine (1 mgliter21), and tryptophan (50 mg ml21) when needed. The pH was adjusted to 7.8.All of the E. coli plasmids constructed were brought into strain JM109 [supE44D(lac-proAB) hsdR17 recA1 endA1 gyrA96 thi-1 relA1 (F9 traD36 proABlaclqZDM15)] (38) by transformation (6). Transformants were selected on agarplates either for ampicillin resistance (100 mg ml21) or for kanamycin resistance(25 mg ml21).

DNA manipulation and general plasmid construction. Recombinant DNAtechniques, i.e., plasmid preparation, subcloning, agarose gel electrophoresis,and Southern blotting, were performed by the conventional protocol (31). Struc-tures of the plasmids were confirmed by restriction mapping, and the inserts ofpOF5712, pOF5713, and pOF1172 were also confirmed by sequencing. Sequenc-ing reactions of double-stranded DNA were carried out in accordance with thedideoxy-chain termination method with universal and internal primers (32). Theplasmids used in this study are listed in Table 1.

Transformation of T. thermophilus. The method of Koyama et al. (17), with aslight modification, was used for the transformation of T. thermophilus as previ-ously described (9). Transformants were selected on T162-agar plates containing20 mg of kanamycin ml21 incubated at 60°C for 48 h (selection of agaT deletionstrains) or on minimal 162-agar plates containing 0.3% galactose incubated for at70°C for 4 to 7 days (selection of Gal1 strain OF1271).

Construction of Thermus expression plasmids. Thermus expression plasmidswere constructed by cloning the a-galactosidase isogenes from Bacillus stearo-thermophilus KVE39 (11) downstream of the slpA promoter from T. thermophilusHB8 (22, 23) into a plasmid which contained the origin of replication from pMY1(7) and a thermostable kanamycin marker (kan) (28). The construction of plas-mid pOF5714, carrying an AgaA-encoding gene, agaA, is summarized in Fig. 1and explained below. A BamHI-EcoRI fragment containing the kan gene down-stream of the slpA promotor in pMY1 was made blunt ended and cloned into theEcoRV site of pJOE930 (3) to produce pOF1056. agaA from pCG1 (14) wasamplified by PCR with primer S950 (GGAATTCCATATGTCAGTTGCATACAA), containing an NdeI site (underlined), and S952 (GAAGATCTCAATTGTCTTATTGTTGAACAG), with BglII and MunI sites (underlined). The gene wascloned into pOF1154 (a pUC18 derivative with the NdeI restriction site deleted)along with the slpA promotor from pOF1056. This was done in two steps. First,the 39 region of agaA, an NdeI-BglII fragment, and the slpA promotor as anEcoRI-NdeI fragment was ligated into pOF1154 to produce pOF962. The 59region of agaA (NdeI fragment) was then ligated into the NdeI site of pOF962 toproduce pOF964. pIC20R is a pUC-derived plasmid (38) with EcoRI restrictionsites on each side of a polylinker (27). The pTSP1 portion of pMY1 (23)containing repA (minimal replication unit) (7) was cloned in pIC20R as a PstIfragment to produce pOF576. pOF1155 contains the kan gene (28) between the59-flanking sequence and the 39 region of agaT along with the 59 sequence of galTin pOF1154. The kanamycin marker with a preceding Thermus SD sequence inpOF1155 was amplified with primers S1065 (CGGAATTCTACCTGGGCGGCAAGGA), with an EcoRI site (underlined), and S718 (CGGGATCCGTCATCGTTCAAAATGG), with a BamHI site (underlined), and cloned, followingrestriction, between the EcoRI and BamHI restriction sites of pBTac1 (4) toproduce pOF665. The EcoRI restriction site of pOF665 was deleted by perform-ing EcoRI digestion, Klenow filling, and ligation to produce pOF477. The kana-mycin resistance gene, along with the tac promoter (Ptac) in pOF477, was am-plified in a PCR with primers S1318 (CCCCAAGCTTATCGACTGCACGGTG), with a HindIII site (underlined), and S718. The amplified Ptac-kan fragment,following HindIII-BamHI digestion, was ligated between the HindIII and BglIIrestriction sites of pOF576 to produce pOF578. The agaA gene downstream ofthe slpA promotor was cut from pOF964 with EcoRI and MunI, made bluntended, and ligated into the EcoRV site of pOF578 to produce pOF5712. The pICregion of pOF5712 was deleted by EcoRI digestion, and the remaining plasmidwas self-ligated before transformation of T. thermophilus. The correspondingagaB plasmid, pOF5715, was generated in the same way, except that plasmid

TABLE 1. Plasmids used in this study

Plasmid Description Reference

pOF1154 pUC18 with the NdeI restriction site deleted This studypOF1155 kan as an NdeI-BamHI fragment between the 59-flanking sequence and the 39 region of agaT

along with the 59 sequence of galT in pOF1154This study

pOF1053 Identical to pOF1155 except for an NdeI restriction site in the vector This studypOF1271 galT along with an ;1.3-kb upstream sequence from OF1053GD in pOF1154 This studypJOE930 Positive selection vector 3pIC20R Apr, pBR322 ori, lacZ, EcoRI restriction sites on each side of a polylinker 27pCG1 agaA in pUC12 11pCG3 agaB in pUC12 14pMY1 Apr, kan downstream of PslpA, pUC, RepA 23pOF1056 kan downstream of PslpA in pJOE930 This studypBTac1 Apr, pBR322 ori 4pOF665 kan downstream of Ptac in pBTac1 This studypOF477 EcoRI site in pOF655 deleted This studypOF962 39 region of agaA downstream of PslpA in pOF1154 This studypOF963 39 region of agaB downstream of PslpA in pOF1154 This studypOF964 agaA downstream of PslpA in pOF1154 This studypOF965 agaB downstream of PslpA in pOF1154 This studypOF576 repA from pMY1 on a ;4.7-kb PstI fragment in pIC20R This studypOF578 Ptac-kan amplified from pOF477 in pOF576 This studypOF5712 agaA downstream of PslpA from pOF964 in pOF578 This studypOF5713 agaB downstream of PslpA from pOF965 in pOF578 This studypOF5714 pIC portion of pOF5712 deleted This studypOF5715 pIC portion of pOF5713 deleted This studypOF5714M Stable mutant plasmid of pOF5714 (plasmid stability in T. thermophilus) This studypOF10726 pOF5714M linearized with EcoRI in pOF1154 This studypOF1172 NdeI fragment from pOF10726 (agaA) replaced with NdeI fragment from pOF5713 (agaB) This studypOF1176 pUC portion of pOF1172 deleted This study

VOL. 67, 2001 RECOMBINANT a-GALACTOSIDASES IN T. THERMOPHILUS 4193

on August 10, 2020 by guest

http://aem.asm

.org/D

ownloaded from

pCG3 (14) was the initial source of agaB, which was amplified with primers S951(GGAATTCCATATGGCGGTTACATACAA [the NdeI site is underlined])and S952 (GAAGATCTCAATTGTCTTATTGTTGAACAG [the BglII andMunI sites are underlined]). pOF1176 carrying agaB2 is based on the stableplasmid mutant of pOF5714 (designated pOF5714M), which was brought back toE. coli by transformation following linearization with EcoRI and ligation into thepUC18 derivative pOF1154. The NdeI fragment from the resulting plasmid,pOF10726 (with an agaA sequence), was replaced with an NdeI fragment frompOF5713 (with an agaB sequence) to produce pOF1172. The pUC sequence ofpOF1172 was deleted by digestion with EcoRI. The remaining plasmid,pOF1176, was recircularized by ligation and brought into T. thermophilus bytransformation.

Cloning of galT and the upstream sequence region from Gal1 strainOF1053GD. The intact galT gene, along with an about 1.3-kb upstream sequence,in OF1053GD was amplified with primers S944 (CGGAATTCCGCCGCCATGGGAATT), with a EcoRI site (underlined), and S1167 (CCCAAGCTTGGCCGTCACGGCAAC), with a HindIII site (underlined), and cloned into a pUC18derivative (pOF1154) to produce pOF1271.

Enzyme assays. Cells of Thermus cultures were harvested by centrifugation,washed, and resuspended in 10 mM potassium phosphate buffer (pH 6.5). Crudeextracts were prepared by sonication, and debris was removed by centrifugation.The protein concentration of crude extracts was estimated by the method ofBradford (5) using bovine serum albumin as the standard. a-Galactosidase ac-

tivity was determined by measuring the rate of hydrolysis of para-nitrophenyl-a-D-galactoside (4 mg ml21) in 0.1 M potassium buffer (pH 6.5) as previouslydescribed (11). One unit of activity is defined as the amount of enzyme thatliberates 1 mmol of p-nitrophenol per min under given assay conditions. Coloniesthat displayed a-galactosidase activity were detected by histochemical staining.Single colonies were immobilized on a nylon membrane (Qiagen, Hilden, Ger-many). The membrane was placed on filter papers, saturated with phosphatebuffer containing 6-bromo-2-naphthyl-a-D-galactopyranoside (0.5 mg ml21) in apetri plate, and incubated at 50°C for 30 min in a water bath. Following theincubation, the membrane was again placed on a filter paper saturated withphosphate buffer containing Fast Blue RR (1.3 mg ml21). Positive coloniesbecame intensely purple within a few seconds. Production of the recombinanta-galactosidases in T. thermophilus was estimated by sodium dodecyl sulfate(SDS)-polyacrylamide gel electrophoresis (21) of crude extracts.

Nucleotide sequence accession numbers. The GenBank accession numbers ofthe nucleotide sequences of agaA and agaB are AY013286 and AY013287,respectively.

RESULTS AND DISCUSSION

Selection of a Gal1 revertant from a Gal2 strain. Deletionstrain OF1053 (DagaT::kan) was constructed by applying site-

FIG. 1. Construction of Thermus replication vector pOF5714. The procedure used is explained in Materials and Methods. Thin lines representan E. coli cloning vector. Thick lines represent sequences from T. thermophilus, and genes are represented with pointed boxes. Restriction andmodifying enzymes used for the plasmid constructions are indicated. Abbreviation for restriction enzyme sites: B, BamHI; Bg, BglII; E, EcoRI; H,HindIII; M, MunI; N, NdeI; P, PstI; EV, EcoRV.

4194 FRIDJONSSON AND MATTES APPL. ENVIRON. MICROBIOL.

on August 10, 2020 by guest

http://aem.asm

.org/D

ownloaded from

specific integration mutagenesis as previously described (10),using an integration cassette with the kan marker located be-tween the flanking sequences of agaT. The strain was unable toutilize galactose, which was interpreted as a polar transcrip-tional effect of the integration mutagenesis on the expressionof the galT gene. The importance of the Gal1 phenotype forgrowth on melibiose minimal agar medium of AgaT2 strainscarrying recombinant a-galactosidases was revealed in our pre-liminary work by using Gal1 mutants that displayed amplifi-cation of the galT locus in the genome (data not shown).Consequently, the Gal1 phenotype was unstable. Gal1 mu-tants harboring recombinant a-galactosidase grew on minimalmelibiose, whereas strains that had lost the ability to utilizegalactose following deletion of the amplified galT locus wereconcurrently unable to grow on minimal melibiose medium.Subsequently, it was demonstrated that addition of galactose tothe rich culture medium (T162) of Gal2 strains promotedgrowth interference, whereas no growth interference was ob-served for Gal1 strains following the addition of galactose(results not shown). A Gal1 revertant of OF1053, designatedOF1053GD, was isolated following incubation on galactoseminimal medium at 70°C for 6 days. Southern hybridization of

the mutant chromosomal DNA revealed a deletion of BglII-BamHI restriction sites upstream of the intact galT gene instrain OF1053 (data not shown). The intact galT gene, alongwith upstream sequences, was cloned as explained in Materialsand Methods. The resulting plasmid was designated pOF1271.Sequence analysis of the cloned fragment revealed a deletionof a 1,257-bp fragment in the kan::agaT fusion gene, beginning119 bp downstream of the start codon of the kan gene to 154nucleotides upstream of the putative start codon of galT. Thedeletion resulted in the formation of a new ORF, from thestart codon of the kan gene to a stop codon about 2 bp up-stream the putative ribosome binding site of galT. Figure 2shows a map of AgaT2 strain OF1053 and deletion strainOF1053GD according to the restriction and sequence analysis.To demonstrate that the Gal1 phenotype of strain OF1053GDwas dependent on galT and its upstream sequences, pOF1271was used to transform Kmr Gal2 strain OF1053 to strainOF1271 with a Kms Gal1 phenotype. The site-specific inser-tion of the integration module in pOF1271 into the chromo-some of OF1053 was verified by Southern blotting (results notshown).

The fact that agaT overlaps galT in the progenitor strain T.thermophilus TH125 indicates translational coupling of thosegenes, which may explain the polar effect of the agaT inser-tional inactivation. Ribosome progression along the mRNAfrom agaT may be required to open the mRNA at the initiationsite of galT, which is otherwise trapped in a secondary struc-ture. Indeed, regions of dyad symmetry are observed in the 39region of agaT (Fig. 3). Following translation of kan in theintegration mutants (OF1053), ribosomes are released about750 nucleotides upstream of the ribosome binding site of galT.Thereby, the translational initiation site of galT may remainenclosed in a secondary structure, which blocks the access of aribosome and eventually protein synthesis. The ORF preced-ing galT in OF1053GD (and OF1271) possibly contributes tothe translational initiation of the galT gene by translation cou-pling. Translational coupling is known to occur at an intercis-tronic boundary of the E. coli galactose operon; i.e., the galKgene is translationally coupled to galT immediately preceding

FIG. 2. Map of strains OF1053 and OF1053GD. The 1-kb up-stream region of agaT is represented by a open box, and correspondinggenes by pointed boxes. Restriction fragments detected by Southernhybridization, referred to in Results, by using a galT fragment as aprobe are indicated below the maps, along with their sizes in kilobases.

FIG. 3. Overlapping coding regions of agaT and galT in T. thermophilus TH125. The divergent broken arrows indicate regions of dyadsymmetry. The ORF, of agaT and galT are shown as shaded boxes. The putative ribosome binding site (RBS) of galT is underlined, as well as astop codon corresponding to the translation termination codon of the ORF preceding galT in strain OF1053GD. The GenBank accession numberof the nucleotide sequence containing the a-galactosidase gene and flanking sequences in T. thermophilus TH125 is AF135399 (10).

VOL. 67, 2001 RECOMBINANT a-GALACTOSIDASES IN T. THERMOPHILUS 4195

on August 10, 2020 by guest

http://aem.asm

.org/D

ownloaded from

galK (33). Gene clusters containing closely linked or overlap-ping genes are a common feature of Thermus bacteria. This isgenerally true of organisms with small genomes (15, 29, 39).Due to the high GC content of Thermus RNA molecules,formation of stable folding structures at high temperatures ispossible. Translational coupling with upstream ORFs may thusbe an important factor in the expression of closely linked genesin a polycistronic message. Such a mechanism has been pro-posed to play a role in the regulated expression of the Thermusstrain ZO5 pyr gene cluster (37).

Production of recombinant a-galactosidases in T. ther-mophilus OF1053GD. agaA and agaB from B. stearothermophi-lus KVE36 were used as test genes for the expression of het-erologous a-galactosidase genes in T. thermophilus. Therespective gene products are designated AgaA and AgaB. Al-though the enzymes share 97% amino acid sequence identity,their properties are different (14). AgaA displays maximal hy-drolyzing activity at 65 to 67°C under given assay conditions(14) and a high affinity for melibiose and raffinose. On theother hand, AgaB displays very low activity at 65 to 67°C(maximal hydrolyzing activity at 45 to 50°C) and a low affinityfor melibiose and raffinose. The aim was to use AgaA as apositive control enzyme during the development of a selectionsystem based on the coupling of cell growth with enzyme ac-tivity. A future approach will be the thermoadaptation ofAgaB, i.e., selection for enhanced activity at elevated temper-atures in the thermophilic bacterium T. thermophilus.

Plasmids containing the a-galactosidase genes downstreamof the slpA promoter from plasmid pMY1 (23) were con-structed as described in Materials and Methods and Fig. 1. Thekan gene (28) with a Thermus ribosome binding site down-stream of a the E. coli tac hybrid promoter (4) was used as aplasmid selection marker. The origin of replication came froma pTSP1 portion of pMY1 (7). The pIC region (E. coli plasmidsequence) of pOF5712 and pOF5713 was deleted by EcoRIdigestion, and the remaining plasmid segments were recircu-larized by ligation (pOF5714 and pOF5715) before the trans-formation of T. thermophilus. In this way, the transformationefficiency was 1 order of magnitude higher than that of plas-mids without the deletion (pOF5712 and pOF5713; ;103 ver-sus 102 transformants per mg of DNA, respectively). Further-more, the E. coli plasmid sequences contributed to theinstability of the shuttle vector in strain OF1053GD (Fig. 4A).How they affected the shuttle vector’s stability remains unclear.However, such an effect is known to occur in other shuttlevector systems, e.g., for E. coli-Streptomyces (41). StrainOF1053GD harboring pOF5714 (agaA with the pIC sequencedeleted), however, exhibited poor growth on agar mediumcontaining melibiose, even though further selection with kana-mycin was applied (data not shown). A mutant was isolatedthat grew significantly faster than the wild type on minimalmelibiose agar medium. Colonies appeared following 4 days ofincubation, compared to 7 to 8 days for the wild type. Highera-galactosidase activity, observed in crude extracts of the mu-tant strain compared to the progenitor (Fig. 4B), correlatedwith a higher concentration of the recombinant enzyme in thecrude extract, consistent with the intensity of a band detectedby SDS-polyacrylamide gel electrophoresis (Fig. 5). The plas-mid was isolated from this strain and introduced into plasmid-free strain OF1053GD. The resulting strain grew on minimal

melibiose agar plates and displayed a-galactosidase activityidentical to that of the original mutant strain. Moreover, thestability of the mutant plasmid was significantly higher thanthat of the progenitor plasmid (Fig. 4A). The copy number ofthe plasmids in Thermus cells in the exponential growth phasewas determined. The number was about threefold higher incells carrying the mutant plasmid than in cells carrying theprogenitor (15 to 16 versus 5 to 6 for pOF5714M andpOF5714, respectively). More than 90% of the T. thermophilusOF1053GD cells transformed with pOF5714M contained theplasmid following overnight cultivation (14 h) in a nonselective

FIG. 4. (A) Plasmid stability in strain OF1053GD. Stability wasdefined as the titer of cells with a-galactosidase activity against thetotal cell titer following overnight growth in T162 nonselective me-dium. OF1053GD strains harboring the different a-galactosidase plas-mids were cultivated in T162 kanamycin medium. Mid-exponential-phase cells were diluted in nonselective T162 medium (to 5 3 106 cellsml21). Following cultivation at 67°C for 14 h, the cells were diluted andplated on nonselective T162-agar medium (triplicates). The plateswere incubated at 67°C for 2 days for growth of single colonies. Col-onies that displayed a-galactosidase activity were identified by histo-chemical staining as explained in Materials and Methods. The meanvalues are indicated by column height. Maximum variation was lessthan 5%. (B) a-Galactosidase activity in crude extracts of OF1053GDcells harboring different plasmids containing a-galactosidase genes andcultivated as explained above. Activity tests were done in triplicate.The maximum variation from the mean values (shown) was less than5%. pOF5712, shuttle vector; pOF5714, vector following deletion of E.coli pIC sequences by EcoRI digestion and self-ligation; pOF5714M, astable mutant plasmid. pOF5713, pOF5715, and pOF1176 are thecorresponding AgaB-type plasmids.

4196 FRIDJONSSON AND MATTES APPL. ENVIRON. MICROBIOL.

on August 10, 2020 by guest

http://aem.asm

.org/D

ownloaded from

medium. Further, the plasmid supported the growth of T.thermophilus OF1053GD on a minimal agar medium contain-ing melibiose. Analysis of this plasmid mutation will be thesubject of another study.

The corresponding stable AgaB-type plasmid (pOF1176[agaB2]) was constructed from pOF5714M. The structure ofthe inserted a-galactosidase gene in the corresponding shuttlevector, pOF1172, was verified by sequence analysis. Althoughthe 39 region of the gene was derived from agaA, the geneproduct, designated AgaB2, exhibited the characteristic prop-erties of AgaB, such as optimum activity at a temperature of50°C and a low affinity for melibiose and raffinose. Growth onminimal melibiose agar medium of strains harboring a-galac-tosidases AgaA and AgaB2 was tested under different condi-tions (temperature and melibiose concentration). The resultsare summarized in Table 2. The host strains harboringpOF5714M grew well at 67°C on agar medium with all of theconcentrations of melibiose tested. The strains harboringpOF1176 did not grow at 67°C on 0.1 and 0.2% melibioseminimal agar medium.

Concluding remarks. We succeeded in establishing a strainsuitable for the expression of heterologous a-galactosidasegenes, which enables selection based on the coupling of growthwith enzyme activity, i.e., an AgaT2 strain that is capable ofmetabolizing galactose and permits the application of the kanmarker for plasmid selection. The results presented in thispaper demonstrate that T. thermophilus can be used for theexpression of heterologous a-galactosidase genes. Recombi-nant a-galactosidases can support the growth of agaT deletion-containing strains on minimal agar medium containing melibi-ose as a sole carbohydrate source. Although T. thermophilusOF1053GD/pOF5714M (agaA) grows slowly on such a me-dium, selection of thermostable enzyme mutants, e.g., fromAgaB2, should be possible. By varying the temperature andmelibiose concentration, we established growth conditionssuitable for the thermoadaptation of AgaB2. Work dealingwith the selection of thermostable enzyme variants by usingthis thermophile is in progress.

ACKNOWLEDGMENTS

We thank Gisela Kwiatkowski for technical assistance and JosefAltenbuchner and Joachim Klein for critical reading of the manuscript.Also, we thank T. Hoshino for T. thermophilus strain TH125 and J.Berenguer for plasmid pMY1.

This work was supported by the Bundesministerium fur Bildung,Wissenschaft, Forschung und Technologie.

REFERENCES

1. Adams, C. W., J. A. Fornwald, F. J. Schmidt, M. Rosenberg, and M. E.Brawner. 1988. Gene organization and structure of the Streptomyces lividansgal operon. J. Bacteriol. 170:203–212.

2. Adhya, S. 1987. The galactose operon, p. 1503–1512. In F. C. Neidhardt, J. L.Ingraham, K. B. Low, B. Magasanik, M. Schaechter, and H. E. Umbarger(ed.), Escherichia coli and Salmonella typhimurium: cellular and molecularbiology. American Society for Microbiology, Washington, D.C.

3. Altenbuchner, J., P. Viell, and I. Pelletier. 1992. Positive selection vectorsbased on palindromic DNA sequences. Methods Enzymol. 216:457–466.

4. Amann, E., J. Brosius, and M. Ptashne. 1983. Vectors bearing a hybridtrp-lac-promoter useful for regulated expression of cloned genes in Esh-cerichia coli. Gene 25:167–178.

5. Bradford, M. M. 1976. A rapid and sensitive method for the quantitation ofmicrogram quantities of protein utilizing the principle of protein-dye bind-ing. Anal. Biochem. 72:248–254.

6. Chung, C. T., S. L. Niemela, and R. H. Miller. 1989. One-step preparation ofcompetent Escherischia coli: transformation and storage of bacterial cells inthe same solution. Proc. Natl. Acad. Sci. USA 86:2172–2175.

7. de Grado, M., I. Lasa, and J. Berenguer. 1998. Characterization of a plasmidreplicative origin from an extreme thermophile. FEMS Microbiol. Lett.165:51–57.

8. Degryse, E., N. Glansdorff, and A. Pierard. 1978. A comparative analysis ofextreme thermophilic bacteria belonging to the genus Thermus. Arch. Mi-crobiol. 117:189–196.

9. Fridjonsson, O., H. Watzlawick, A. Gehweiler, T. Rohrhirsch, and R. Mattes.1999. Cloning of the gene encoding a novel thermostable a-galactosidasefrom Thermus brockianus ITI360. Appl. Environ. Microbiol. 65:3955–3963.

10. Fridjonsson, O., H. Watzlawick, and R. Mattes. 2000. The structure of thea-galactosidase gene loci in Thermus brockianus ITI360 and Thermus ther-mophilus TH125. Extremophiles 4:23–33.

11. Ganter, C., A. Bock, P. Buckel, and R. Mattes. 1988. Production of thermo-stable recombinant a-galactosidase suitable for raffinose elimination fromsugar beet syrup. J. Biotechnol. 8:301–310.

12. Hidaka, Y., M. Hasegawa, T. Nakahara, and T. Hoshino. 1994. The entirepopulation of Thermus thermophilus cells is always competent at any growthphase. Biosci. Biotech. Biochem. 58:1338–1339.

13. Hoshino, T., H. Maseda, and T. Nakahara. 1993. Plasmid marker rescuetransformation in Thermus thermophilus. J. Ferment. Bioeng. 76:276–279.

14. Janz, L., C. Ganter, J. Stezowski, and R. Mattes. 1991. Elucidation offunctional domains in thermostable isoenzymes of a-galactosidase in Bacillusstearothermophilus. Enzymatic properties are encoded in a genetically ex-changeable domain, p. 170–173. In M. Reuss, H. Chmiel, E.-D. Gilles, andH.-J. Knackmuss (ed.), Biochemical engineering—Stuttgart. Gustav Fischer,Stuttgart, Germany.

15. Kosuge, T., K. Tabata, and T. Hoshino. 1994. Molecular cloning and se-

FIG. 5. SDS–10% polyacrylamide gel with crude extracts fromOF1053GD. Strains harboring different a-galactosidase plasmids werecultivated in T162 nonselective medium as explained in the legend toFig. 4 for the stability experiments. Crude extracts were prepared, and10 mg of protein was loaded in each lane of the SDS-gel. Lanes: 1,strain without plasmid; 2, strain harboring pOF5712 (with the E. colipIC plasmid sequence); 3, pOF5713 (with pIC sequences); 4, pOF5714(pIC sequence deleted); 5, pOF5715 (pIC sequence deleted); 6,pOF5714M (stable plasmid mutant containing agaA); 7, pOF1176 (sta-ble plasmid containing agaB2). Molecular mass markers are on the leftof lane 1, and the sizes (in kilodaltons) of the marker proteins areindicated. Bands attributed to the ;80 kDa AgaA and AgaB2 proteinsare indicated by the arrowhead.

TABLE 2. Growth of T. thermophilus OF1053GD with pOF5714Mor pOF1176 on 162 minimal agar medium

containing various melibiose concentrationsa

Plasmid

Growth at 60°Cat a [melibiose] of:

Growth at 67°Cat a [melibiose] of:

0.4% 0.2% 0.1% 0.4% 0.2% 0.1%

pOF5714M 111 111 111 111 111 111pOF1176 111 11 1 1 2 2

a 111, growth following 3 to 4 days of incubation; 11, growth following 5 to6 days of incubation; 1, growth following 7 days of incubation; 2, no growth.

VOL. 67, 2001 RECOMBINANT a-GALACTOSIDASES IN T. THERMOPHILUS 4197

on August 10, 2020 by guest

http://aem.asm

.org/D

ownloaded from

quence analysis of the proBA operon from an extremely thermophilic eu-bacterium Thermus thermophilus. FEMS Microbiol Lett. 123:55–62.

16. Kotsuka, T., S. Akanuma, M. Tomuro, A. Yamagishi, and T. Oshima. 1996.Further stabilization of 3-isopropylmalate dehydrogenase of an extremethermophile, Thermus thermophilus, by a suppressor mutation method. J.Bacteriol. 178:723–727.

17. Koyama, Y., T. Hoshino, N. Tomizuka, and K. Furukawa. 1986. Genetictransformation of the extreme thermophile Thermus thermophilus and ofother Thermus spp. J. Bacteriol. 166:338–340.

18. Koyama, Y., Y. Arikawa, and K. Furukawa. 1990. A plasmid vector for anextreme thermophile, Thermus thermophilus. FEMS Microbiol. Lett. 72:97–102.

19. Koyama, Y., S. Okamoto, and K. Furukawa. 1990. Cloning of a- and b-ga-lactosidase genes from an extreme thermophile, Thermus strain T2, and theirexpression in Thermus thermophilus HB27. Appl. Environ. Microbiol. 56:2251–2254.

20. Krispin, O., and R. Allmansberger. 1998. The Bacillus subtilis galE gene isessential in the presence of glucose and galactose. J. Bacteriol. 180:2265–2270.

21. Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly ofthe head of bacteriophage T4. Nature 227:680–685.

22. Lasa, I., J. R. Caston, L. A. Fernandez-Herrero, M. A. de Pedro, and J.Berenguer. 1992. Insertional mutagenesis in the extreme thermophilic eu-bacteria Thermus thermophilus HB8: expression of a heterologous, plasmid-borne kanamycin nucleotidyl-transferase gene. Appl. Environ. Microbiol.58:421–425.

23. Lasa I., M. de Grado, M. A. de Pedro, and J. Berenguer. 1992. Developmentof Thermus-Escherichia shuttle vectors and their use for expression of theClostridium thermopcellum celA gene in Thermus thermophilus. J. Bacteriol.174:6424–6431.

24. Liao, H., T. McKenzie, and R. Hageman. 1986. Isolation of a thermostableenzyme variant by cloning and selection in a thermophile. Proc. Natl. Acad.Sci. USA 83:576–580.

25. Luonteri, E., M. Tenkanen, and L. Viikari. 1998. Substrate specificities ofPenicillium simplicissimum a-galactosidases. Enzyme Microb. Technol. 22:192–198.

26. Margolles-Clark, E., M. Tenkanen, E. Luonteri and M. Penttila. 1996. Threea-galactosidase genes of Thrichoderma reesei cloned by expression in yeast.Eur. J. Biochem. 240:104–111.

27. Marsh, J. L., M. Erfle, and E. J. Weykes. 1984. The pIC plasmid and phagevectors with versatile cloning sites for recombinant selection by insertionalinactivation. Gene 32:481–485.

28. Matsumura, M., Y. Katakura, T. Imanaka, and A. Shuichi. 1984. Enzymaticand nucleotide sequence studies of a kanamycin-inactivation enzyme en-coded by a plasmid from thermophilic bacilli in comparison with that en-

coded by plasmid pUB110. J. Bacteriol. 160:413–420.29. Pfeiffer, T., D. Jorcke, R. Feltens, and R. K. Hartmann. 1995. Direct linkage

of str-, S10- and spc-related gene clusters in Thermus thermophilus HB8, andsequences of ribosomal proteins L4 and S10. Gene 167:141–145.

30. Rosenberg, D., and A. S. Keston. 1967. Interference with growth of galac-tokinaseless Escherichia coli mutants by galactose. Arch. Biochem. Biophys.120:239–241.

31. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: alaboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, ColdSpring Harbor, N.Y.

32. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequencing withchain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 7:5463–5467.

33. Schumperli, D., K. McKenney, D. A. Sobieski, and M. Rosenberg. 1982.Translational coupling at an intercistronic boundary of the Escherichia coligalactose operon. Cell 30:865–871.

34. Tamakoshi, M., A. Yamagishi, and T. Oshima. 1995. Screening of stableproteins in an extreme thermophile Thermus thermophilus. Mol. Microbiol.16:1031–1036.

35. Tamakoshi, M., M. Uchida, K. Tanabe, S. Fukuyama, A. Yamagishi, and T.Oshima. 1997. A new Thermus-Escherichia coli shuttle integration vectorsystem. J. Bacteriol. 179:4811–4814.

36. Touhara, N., H. Taguchi, Y. Koyama, T. Ohta, and H. Matsuzawa. 1991.Production and extracellular secretion of aqualysin 1 (a thermophilic sub-tilisin type protease) in a host-vector system for Thermus thermophilus. Appl.Environ. Microbiol. 57:3385–3387.

37. Van de Casteele, M., P. Chen, M. Roovers, C. Legrain, and N. Glansdorff.1997. Structure and expression of a pyrimidine gene cluster from the extremethermophile Thermus strain ZO5. J. Bacteriol. 179:3470–3481.

38. Vieira, J., and J. Messing. 1982. The pUC plasmids and M13mp7 derivedsystem for insertion mutagenesis and sequencing with synthetic universalprimers. Gene 19:259–268.

39. Vornlocher, H. P., R. Kreutzer, and M. Sprinzl. 1997. Organization of theThermus thermophilus nusA/infB operon and overexpression of the infB genein Escherichia coli. Biochimie 79:195–203.

40. Weber, J. M., S. P. Johnson, V. Vonstein, M. J. Casadabanand, and D. C.Demirjian. 1995. A chromosome integration system for stable gene transferinto Thermus flavus. Bio/Technology 13:271–275.

41. Wohlleben, W., and A. Puhler. 1987. The Streptomyces ghanaensis low copyplasmid pSG2 and its use for vector construction. Arch. Microbiol. 148:298–304.

42. Zeilinger, S., D. Kristufek, I. Arisan-Atac, R. Hodits, and C. P. Kubicek.1993. Conditions of formation, purification, and characterization of an a-ga-lactosidase of Trichoderma reesei RUT C-30. Appl. Environ. Microbiol. 59:1347–1353.

4198 FRIDJONSSON AND MATTES APPL. ENVIRON. MICROBIOL.

on August 10, 2020 by guest

http://aem.asm

.org/D

ownloaded from