Production of a full-length infectious GFP-tagged cDNA cloneof Beet mild yellowing virus for the study of plant–polerovirusinteractions

Mark Stevens Æ Felicita Vigano

Received: 7 July 2006 / Accepted: 29 September 2006 / Published online: 2 December 2006� Springer Science+Business Media, LLC 2006

Abstract The full-length cDNA of Beet mild yellow-

ing virus (Broom’s Barn isolate) was sequenced and

cloned into the vector pLitmus 29 (pBMYV-BBfl). The

sequence of BMYV-BBfl (5721 bases) shared 96% and

98% nucleotide identity with the other complete se-

quences of BMYV (BMYV-2ITB, France and BMYV-

IPP, Germany respectively). Full-length capped RNA

transcripts of pBMYV-BBfl were synthesised and

found to be biologically active in Arabidopsis thaliana

protoplasts following electroporation or PEG inocula-

tion when the protoplasts were subsequently analysed

using serological and molecular methods. The BMYV

sequence was modified by inserting DNA that encoded

the jellyfish green fluorescent protein (GFP) into the

P5 gene close to its 3¢ end. A. thaliana protoplasts

electroporated with these RNA transcripts were bio-

logically active and up to 2% of transfected protoplasts

showed GFP-specific fluorescence. The exploitation of

these cDNA clones for the study of the biology of beet

poleroviruses is discussed.

Keywords Beet mild yellowing virus � Polerovirus �Luteoviridae � Sugar beet � Arabidopsis � Green

fluorescent protein

Introduction

The genus Polerovirus (family Luteoviridae) includes

at least three closely related viruses that infect various

beet species [1], all of which significantly decrease the

yield of sugar beet [2]. In Europe, Beet mild yellowing

virus (BMYV) is regarded as the most important beet

polerovirus, but is often closely associated with Beet

chlorosis virus (BChV), a recently identified polerovi-

rus that has gained in importance in commercial crops

[3, 4]. All beet poleroviruses are transmitted by aphids

in a persistent manner, the principal vector being

Myzus persicae [5]. Control of these viruses in crops

relies heavily on insecticides as currently no major

genes have been identified that can be exploited in

breeding programmes. Further characterisation of

these viruses, along with the development of virus-

specific tools, will assist with the identification of future

strategies for disease management.

BMYV is regarded as a typical polerovirus because,

as with other species within the genus, it is present in

low titres within infected cells and is usually limited to

the phloem, sieve elements and companion cells.

Hence, purification of these viruses from infected plant

tissue often does not result in high yields. Also, as

BMYV is only naturally transmitted by specific aphid

vectors, unless mechanically co-inoculated with Pea

enation mosaic virus-2 [6] or delivered via particle

bombardment [7], alternative strategies are essential to

study viral gene expression or plant–virus–vector

interactions at the molecular level. The characteristics

of the virus genome add further limitations to the

investigation of gene expression as BMYV carries a

non-retroviral RNA that does not include a DNA

intermediate step within its replication cycle. The

The nucleotide sequence data reported in this paper have beensubmitted to the GenBank nucleotide sequence database andhave been assigned the accession number EF107543.

M. Stevens (&) � F. ViganoBroom’s Barn Research Station Higham, Bury St. Edmunds,Suffolk IP28 6NP, UKe-mail: mark.stevens@bbsrc.ac.uk

F. Viganoe-mail: felicita.vigano@bbsrc.ac.uk

123

Virus Genes (2007) 34:215–221

DOI 10.1007/s11262-006-0046-z

BMYV genome is a linear plus sense single stranded

RNA of approximately 5.7 Kb in length and comprises

six major open reading frames (ORFs 0–5) [8]. ORFs

0–2 are thought to be translated directly from the

genomic RNA and code for proteins of which several

are involved in virus replication e.g. RNA dependent

RNA polymerase and helicase. ORFs 3–5 are tran-

scribed from a subgenomic RNA and encode the

structural genes (major and minor coat proteins) and a

putative movement protein [8].

The exploitation of full length infectious clones that

correspond to the genomes of RNA viruses has greatly

enhanced the potential for studying plant–virus–vector

interactions. For example, infectious clones have been

developed for several poleroviruses, such as Potato

leafroll virus (PLRV) [9, 10], and Beet western yellows

virus (BWYV) [11]. The use of full length infectious

clones, coupled with site-directed mutagenesis and an

efficient inoculation method for either the RNA tran-

scripts [12] or cDNA, via agroinoculation [13], pro-

vides opportunities to assay the biological activity and

functionality of these viruses.

In this paper the full-length sequence of a UK iso-

late of BMYV has been determined and a full-length

cDNA clone of the genome was constructed fused to

the bacteriophage T7 RNA polymerase promoter. The

green fluorescence protein (GFP) gene was also

incorporated into the 3¢ region of the BMYV cDNA

providing a marker system to allow the study of these

viruses in planta without the need for aphid transmis-

sion.

Materials and methods

Plasmid construction

Previously constructed partial cDNA clones (pTG1 and

pTG2) of the Broom’s Barn, Suffolk, UK isolate of

BMYV [14] were used for the construction of the

full-length cDNA into the plasmid pLitmus 29 (New

England BioLabs). Plasmid TG1 contained the first

3541 base pairs (bp) (ORFs 0–2) within the 5¢ region,

whilst plasmid TG2 (2335 bp) included the structural

genes towards the 3¢ end of the virus (ORFs 3–5). The

two cDNAs encompassed the entire genome but over-

lapped by 156 bases within the intergenic region. To

remove the overlapping sequence, a PCR-based strat-

egy was deployed using Pfu DNA polymerase (Strata-

gene) and oligonucleotides (TG1+/TG3–, Table 1)

designed to amplify the TG1 sequence without the extra

bases; the TG2 sequence was amplified in its entirety.

Non-viral SpeI and PstI sites were incorporated into

oligonucleotides TG1+ and TG2– respectively to allow

incorporation of the two cDNAs, by replacing the

SpeI—PstI fragment of pLitmus 29, during ligation of

the two purified PCR products and the plasmid back-

bone. After transformation of ultra-competent E. coli

(XL10-Gold, Invitrogen), colonies were identified that

contained pLitmus 29 plus the BMYV genome in the

sense orientation. Analysis of four plasmids by primer

walking was used to confirm the presence and sequence

of the entire full-length BMYV-BBfl cDNA. The

sequence of BMYV-BBfl was compared with full length

sequences of the isolates BMYV-2ITB, France [15] and

BMYV-IPP, Germany [16].

The full-length cDNA of BMYV was then modified

by inserting DNA encoding the jellyfish green fluo-

rescent protein (Clontech, UK) into the P5 gene as a

translational fusion. This was achieved by cloning the

PCR amplified fragment of GFP into the unique

restriction site (HindIII) of BMYV at nucleotide 5481.

The presence of the GFP sequence in the BMYV-BBfl

cDNA was confirmed by PCR.

In vitro transcription

In vitro transcription of both pBMYV-BBfl and

pBMYV-BBfl-GFP, previously linearised using

restriction endonuclease BssHII, was carried out using

the T7 RiboMAX RNA production system (Promega,

UK) incorporating the m7 G Cap analog.

Table 1 Sequences of synthetic oligonucleotides used to construct the full-length cDNA of BMYV and BMYV-BBfl-GFP

Primer Location inBMYV-BBfl-GFP

Sequence 5¢-3¢ Length Tm

TG1SpeI+ 1–20 cgactcactagtgacaaaagaaaccagcgagg 32 mer 75.5TG3– 3367–3388 ggctgcactggaaggaccagc 21 mer 72.5TG2+ 3388–3406 acaaaagatataacgagg 18 mer 48.0TG2PstI– 6430–6449 aaataactgcagacaccgaagtgccgtaggg 31 mer 76.7GFPHindIII+ 5481–5505 aaatgcaagcttatggtgagcaagggcgag 30 mer 77.7GFPHindIII– 6188–6229 tggcacaagcttttacttgtacagctcgtcc 31 mer 75.0

Restriction sites within oligonucleotides are italicised, viral sequences are highlighted in bold

216 Virus Genes (2007) 34:215–221

123

Production and transfection of A. thaliana

protoplasts

Wild-type A. thaliana seeds, ecotype Columbia 4 (ob-

tained from Nottingham Arabidopsis Stock Centre,

UK, accession number N933), were sterilised and sown

in phytatrays (Sigma) containing 50 ml of growth

medium (0.8% agar, 1% sucrose, 5 mM MES pH 5.7

and 0.5· MS salts). The seeds were germinated and

grown under controlled conditions at 22�C with an 11 h

photoperiod (to delay flowering).

Leaves from 3 to 4 week old A. thaliana were cut

into small pieces in 9 cm Petri dishes. Leaf tissue was

incubated for 1 h in 15 ml of 0.5 M mannitol and then

incubated overnight with 15 ml of enzyme solution

(pH 5.5) containing 1% (w/v) Cellulase Onozuka R-10,

0.25% (w/v) Macerozyme R-10, 8 mM CaCl2 and

0.5 M mannitol. Undigested material and cell debris

were removed by filtration through 850, 100 and 50 lm

nylon filters, respectively. Protoplasts were washed

twice with W5 wash solution, pH 5.8 (154 mM NaCl2,

125 mM CaCl2 � 2H2O, 5 mM KCl, 5 mM glucose and

0.5 M mannitol) and then separated by gravity sedi-

mentation on a 21% sucrose cushion. The protoplasts

were re-suspended and counted in 0.7 M mannitol for

electroporation or mannitol/magnesium solution,

pH5.6 (15 mM MgCl2, 0.1% MES and 0.4 M mannitol)

for PEG-mediated inoculation.

Fifty micrograms of RNA transcript were dispensed

into 0.4 cm electrode gap cuvettes (BioRad, product

165-2088). After adding approximately 1 · 106

protoplasts, two exponential pulses of electricity

(10 lF, 296 V, 3.4 ms) were given using the GenePul-

ser Xcell (BioRad). The cuvettes were incubated on ice

for 20 min in the dark; 150 ll aliquots were then

transferred to Petri dishes and diluted with 5 ml of

protoplast culture medium (MS salts, 0.4 M glucose,

0.4 M mannitol, 1 mg/ml 2,4-dichlorophenoxyacetic

acid and 0.15 mg/ml kinetin). The dishes were then

sealed with parafilm and incubated at room tempera-

ture in the dark. Aliquots were harvested at 0, 24, 48

and 72 h post-transfection by centrifugation (700 rpm

for 10 min.). The resulting pellets were either assessed

immediately or stored at –80�C for subsequent

analysis.

For PEG inoculation, approximately 1 · 106 pro-

toplasts and 50 lg of the RNA transcript were dis-

pensed into Petri dishes and 300 ll of 40% PEG

solution was added prior to incubation at room tem-

perature for 10 min. The protoplasts were then diluted

into 5 ml of protoplast culture medium, divided into

aliquots as described for electroporation and harvested

by centrifugation (700 rpm for 10 min.).

Analysis of transfected protoplasts

Minus-strand DIG-labelled probes specific to the viral

positive strand were prepared by digesting pBMYV-

BBfl with SpeI and XcmI to produce a 406 bp fragment

which was then labelled using the DIG RNA labelling

kit from Roche.

Total RNA was isolated from transfected protoplasts

using the PureScript RNA extraction kit (Gentra).

Aliquots (2 ll) of total RNA were pipetted onto a

positively charged nylon membrane (Roche) and fixed

by baking at 120�C for 30 min. Pre-hybridisation,

hybridisation and stringency washes were all performed

at 68�C using a standard RNA hybridisation buffer (50%

deionised formamide, 5· SSC, 0.1% N-lauroylsarcosine,

0.02% SDS, 2% Blocking solution from the Dig Wash &

Block Buffer kit, Roche and 4.8 ml DPEC water). The

positive strand-specific probes were used in accordance

with the manufacturer’s instructions (Roche). The

detection step was performed using a-DIG alkaline

phosphatase conjugated antibodies followed by either a

colorimetric (BCIP/NBT substrate solutions from Sig-

ma) or a chemiluminescent assay (CPD Star reagents

from Amersham Life Science).

The coat protein of BMYV was detected by western

blot analysis. Transfected protoplast samples were

boiled in gel loading buffer (250 mM Tris–HCl pH 6.8,

2% SDS, 10% glycerol, 20 mM DTT, 0.01% Brom-

ophenol blue) for 10 min. Twenty-five microlitres of

each sample were analysed on a 4–20% Tris–HCl

denaturing polyacrylamide gel (BioRad). Protein

standards (BioRad cat.161-0324) and BMYV purified

viral particles were also included. The gel was run in

gel running buffer (25 mM Tris base, 192 mM glycine

and 0.1% SDS) at 150 V. The proteins were trans-

ferred from gel to membrane (Millipore Immunobilon-

P PVD, Sigma) using a semi-dry blotter (Sigma) that

was run at 0.8 mA/cm2 of membrane for 30 min. The

membrane was then blocked overnight with PBS

(1 · in 1 l:8 g NaCl, 0.2 g KH2PO4, 0.2 g KCl, 2.9 g

Na2HPO4 � 12H2O) containing 5% (w/v) skimmed

milk powder, and viral proteins were detected using a

polyclonal anti-BMYV [17], followed by a calf intes-

tinal alkaline phosphatase-conjugated anti-rabbit anti-

body (both used at 1/1000 dilution); proteins were

visualised using NBT/BCIP (Sigma).

The Nikon Eclipse ME 600L fluorescent microscope

was used to detect the green GFP fluorescence by

examining 10 ll aliquots of transfected and non-

transfected protoplasts that had been incubated for

72 h. Protoplasts were excited using either blue

(488 nm) and/or UV light. The Z-stepper software

(Syncroscopy, www.syncoscopy.com) was also used to

Virus Genes (2007) 34:215–221 217

123

obtain three-dimensional images of transfected

protoplasts.

Results

Construction of BMYV-BBfl cDNA

The full-length cDNA of BMYV-BB was generated by

PCR from pTG1 and pTG2 and the 156 bp overlap of

the BMYV cDNA in the two plasmids was removed

by the design of appropriate oligonucleotides. The

sequences were then successfully cloned into pLitmus

29 via the three-way ligation strategy. Sequence anal-

ysis of the 5¢ end of pBMYV-BBfl showed no non-viral

bases between the BMYV sequence and the T7 pro-

moter; inclusion of such bases can subsequently affect

the yield and infectiousness of viral transcripts [18].

BMYV-BBfl (GenBank EF107543) was shown to have

96% and 98% nucleotide sequence identity with

BMYV-2ITB (France) and BMYV-IPP (Germany)

respectively by alignment of the three sequences using

the Vector NTI program (Informax, Invitrogen).

In addition, the GFP sequence was successfully

0 24 48 72

No RNA

RNA No transfection

PEG inoculation

Electroporation

A

0

5

10

15

20

25

30

0 24 48 72

Time (hours post-inoculation)

Den

sito

met

ric

Mea

sure

men

t (n

g)

Electroporationmean

B

Fig. 1 Comparison of RNA dot blots of the electroporation andPEG-mediated transfection of A. thaliana protoplasts withBMYV-BBfl-GFP. Protoplasts were isolated from 3 to 4 week-old A. thaliana plantlets; the cells obtained were then countedand transformed with BMYV-BBfl-GFP RNA transcripts byelectroporation or PEG-mediated inoculation in parallel exper-iments. Total RNA was isolated and spotted on nylon mem-branes. The latter were probed with DIG-labelled RNA probesconstructed from the pBMYV-BBfl clone. Hybridisation andstringent washes were performed at 68�C and the CPD star

chemiluminescence reagent (Amersham Biosciences) was usedfor detection on radiographic film. The program Gene Toolsfrom Syngene was used to assign a densitometric measurementto each dot blot so that these could be compared and analysed.(A) RNA dot blot results from the analysis of A. thalianaprotoplasts up to 72 h post-transfection. (B) Analysis andcomparison of the results obtained from the electroporation ofA. thaliana protoplasts via densitometric measurements of thedot blots

218 Virus Genes (2007) 34:215–221

123

introduced into the HindIII site within P5 (position

5481) of BMYV-BBfl (data not shown).

Analysis of transfected protoplasts

BMYV RNA could be readily detected by dot blot

analysis from protoplast extracts that were transfected

with BMYV at time zero when using the PEG inocu-

lation procedure, although between 24 and 48 h post-

transfection RNA transcript levels had declined

significantly. However, after 72 h there was an increase

in the amount of RNA detected (Fig. 1). At the initial

sampling point, it was presumed that the RNA tran-

scripts outside the protoplasts were being detected as

the protoplasts were not washed following transfection

in order to preserve their number and integrity after

chemical or electrical shock. Rapid degradation of

RNA outside the protoplasts then followed, leading to

the observed decline in RNA levels. At 72 h an in-

crease in the BMYV RNA concentration was

observed, associated with BMYV replication within

protoplasts reaching detectable levels as determined by

the colorimetric and chemiluminescent substrate sys-

tems used; the latter being more sensitive (data not

shown). A similar pattern was seen when BMYV RNA

transcripts were electroporated into protoplasts.

However, after an initial decline at 24 h, RNA levels

then increased after 48 h (Fig. 1). It was presumed that

electroporation may have delivered a higher concen-

tration of BMYV transcript and/or possibly more

protoplasts were infected using this method, although

green fluorescence was observed in 2% of protoplasts

regardless of method.

A 22-kDa band, equal in size and corresponding to

the major coat protein obtained from the purified

BMYV virions, was identified by western blot analysis

from A. thaliana protoplasts 48 and 72 h post-trans-

fection. This result suggests that the BMYV RNA

transcripts had successfully replicated, transcribed and

been packaged into new viral particles within the

protoplasts, thus confirming that the transient expres-

sion assay had been successful.

Fluorescent microscopy of protoplasts following

PEG inoculation or electroporation showed that pro-

toplasts transfected with either buffer only or BMYV-

BBfl transcripts appeared red in colouration at 488 nm

excitation due to chlorophyll autofluorescence

(Fig. 2A and B). However, after 72 h approximately

2% of protoplasts transfected with BMYV-BBfl-GFP

transcripts displayed a green fluorescence when either

PEG inoculated or electroporated samples were

analysed (Fig. 2C–E).

Discussion

The full-length sequence of an UK isolate of BMYV,

isolated from sugar beet, was successfully amplified

and cloned into pLITMUS 29, directly following the T7

polymerase promoter. The BMYV-BBfl sequence was

found to share at least 96% identity at the nucleotide

level with two other complete sequences of BMYV

from France and Germany. Molecular and serological

methods showed that in vitro RNA transcripts were

biologically active in A. thaliana protoplasts and

fluorescent microscopy demonstrated that the GFP

Fig. 2 Analysis of A. thalianaprotoplasts using fluorescentmicroscopy (488 nmexcitation) 72 h post-transfection. (A and B) Non-transfected protoplasts (A·20 and B ·40 magnificationrespectively). (C-E)Protoplasts transfected withBMYV-BBfl-GFP byelectroporation (·40magnification). Image E wasobtained using the Z-stepperprogram (Syncroscopy) thatallows the construction ofthree dimensionalphotographs based on acollection of auto-montagealgorithms

Virus Genes (2007) 34:215–221 219

123

sequence, cloned in frame into the P5 gene, was suc-

cessfully incorporated into viral particles and was

expressed within infected protoplasts.

The percentage of A. thaliana protoplasts displaying

green fluorescence was low, similar to previous findings

with the transfection of PLRV-GFP cDNA into Nico-

tiana benthamiana protoplasts [19]. In this study, agro-

inoculation or aphid transmission of PLRV-GFP to test

plants showed that specific fluorescence was associated

with vascular tissue and some epidermal cells, although

fluorescence was mainly confined to single cells. It

appears that intact PLRV-GFP is unable to move sys-

temically, however, naturally occurring deletion mu-

tants of PLRV-GFP (often lacking regions within the

GFP and P5 sequences) were detected in other tissues.

Therefore, although the cell-to-cell movement function

of P5 GFP-tagged cDNA clones of poleroviruses

appears to be disrupted, they provide valuable tools for

the study of the early stages of virus infection [19]. An

unmodified full length infectious clone of a German

isolate of BMYV, under the control of an enhanced

cauliflower mosaic virus 35S promoter, has also been

recently produced and agroinoculated into several

hosts including sugar beet and N. benthamiana.

Systemic BMYVfl infections were found in both species

although only 25% of sugar beet were BMYV-positive

when tested by immunological methods [16]. Incorpo-

ration of BMYV-BBfl-GFP into a binary vector to

enable agroinoculation will allow the study of the

impact of the GFP sequence on the movement of

BMYV.

Analysis of available sequence data shows that

BMYV, BChV, BWYV-USA and Turnip yellows virus

(TuYV, syn. BWYV) are all closely related within the

3¢ end of their genomes [3, 4, 20, 21]. In contrast, there

is little sequence identity within the 5¢ region, partic-

ularly ORF0. Several functions have been associated

with ORF0 including a role in symptom development

[22], as a suppressor of post-transcriptional gene

silencing [23] and it is thought to be involved in host

specificity [24]. In relation to the beet poleroviruses,

the host range of BMYV and TuYV is similar. How-

ever, BMYV infects beet species whereas brassica

species are non-hosts; the opposite applies for TuYV

[25]. Very few isolates have been identified in Europe

that are able to infect both crop species [26]. Virus

isolates capable of infecting both beet and brassica

crops would be at a significant epidemiological

advantage, and a serious threat to agricultural pro-

duction, as in the northern hemisphere sugar beet is

grown from March to December and brassica crops

such as oilseed rape are sown in August and harvested

the following July, providing an ideal green bridge for

these viruses. Therefore, the full-length cDNA of

BMYV will be further exploited and chimeric virus

constructs will be developed by exchanging ORF0 se-

quences of BMYV with TuYV in order to investigate

potential host range determinants amongst the beet

poleroviruses. Knowledge of the sequence motifs or

specific base substitutions that control host specificity

amongst the beet poleroviruses will ultimately lead to

the development of molecular markers. Analysis of

field isolates will then determine whether such se-

quences can be found within natural viral populations

infecting sugar beet, brassica crops or common weed

hosts.

Similarly, the host range of BChV is limited to beet

species and Chenopodium capitatum [3], but is a virus

species gaining in importance in sugar beet production

systems across Europe. To understand why the host

range of BChV is limited primarily to beet species,

specific motifs within the 5¢ end of BMYV-BBfl will be

replaced with those from BChV. Parallel investigations

are also ongoing to determine the host range of BChV

amongst a range of A. thaliana ecotypes and their

mutants. By exploiting the infectious transcripts,

reverse genetics and the host–non-host interactions in

A. thaliana a clearer understanding of the relationships

between the beet poleroviruses and their hosts will be

established.

Acknowledgements This work was funded from the Biotech-nology and Biological Sciences Research Council CSG grant toRothamsted Research. Broom’s Barn Research Station is adivision of Rothamsted Research.

References

1. M. Stevens, B. Freeman, H.-Y. Liu, E. Herrbach, O. Lemaire,Mol. Plant Pathol. 6, 1 (2005)

2. M. Stevens, P.B. Hallsworth, H.G. Smith, Ann. Appl. Biol.144, 113 (2004)

3. S. Hauser, M. Stevens, M. Beuve, O. Lemaire, Arch. Virol.147, 745 (2002)

4. M. Stevens, N.J. Patron, C.A. Dolby, R. Weekes, P.B. Halls-worth, O. Lemaire, H.G. Smith, Plant Pathol. 54, 100 (2005)

5. A.M. Dewar, D. A. Cooke, in Sugar beet, ed. byA.P. Draycott (Blackwell Publishing Ltd, Oxford, 2006),p. 316

6. M. Mayo, E. Ryabov, G. Fraser, M. Taliansky, J. Gen. Virol.81, 2791 (2000)

7. K. Hoffmann, M. Verbeek, A. Romano, A.M. Dullemans,J.F. van den Heuvel, F. van der Wilk, J. Virol. Methods 91,197 (2001)

8. M.A. Mayo, W.A. Miller, in The Luteoviridae eds. byH.G. Smith, H. Barker (CABI Publishing, Wallingford,1999), p. 23

9. L.F. Franco-Lara, K.D. McGeachy, U. Commandeur, R.R.Martin, M.A. Mayo, H. Barker, J. Gen. Virol. 80, 2813 (1999)

10. E. Sadowy, K. Pluta, B. Gronenborn, D. Hulanicka, ActaBiochim. Pol. 45, 611 (1998)

220 Virus Genes (2007) 34:215–221

123

11. R.M. Leiser, V. Ziegler-Graff, A. Reutenauer, E. Herrbach,O. Lemaire, H. Guilley, K. Richards, G. Jonard, Proc. Natl.Acad. Sci. USA 89, 9136 (1992)

12. F. Sanchez, D. Martinez-Herrera, I. Aguilar, F. Ponz, VirusRes. 55, 207 (1998)

13. J.D. Mutterer, V. Ziegler-Graffand, K. Richards, in TheLuteoviridae eds. by H.G. Smith, H. Barker (CABIPublishing, Wallingford, 1999), p. 43

14. N. Patron, Ph.D Thesis, University of East Anglia (1999),p. 1

15. H. Guilley, K.E. Richards, G. Jonard, Arch. Virol. 140, 1109(1995)

16. D. Stephan, E. Maiss, J. Gen. Virol. 87, 445 (2006)17. H.G. Smith, I. Barker, G. Brewer, M. Stevens, P.B. Halls-

worth, Eur. J. Plant Pathol. 102, 163 (1996)18. J.C. Boyer, A.L. Haenni, Virology 198, 415 (1994)19. K.M. Nurkiyanova, E.V. Ryabov, U. Commandeur, G.H.

Duncan, T. Canto, S.M. Gray, M.A. Mayo, M.E. Taliansky,J. Gen. Virol. 81, 617 (2000)

20. J.R. de Miranda, M. Stevens, E. de Bruyne, H.G. Smith, C.Bird, R. Hull, Arch. Virol. 140, 2183 (1995)

21. J. Schubert, F. Rabenstein, K. Graichen, K. Richter, Arch.Phytopathol. Pflanzenschutz. 31, 519 (1998)

22. F. van der Wilk, P. Houterman, J. Molthoff, F. Hans, B.Dekker, J. van den Heuvel, H. Huttinga, R. Goldbach, Mol.Plant Microbe Interact. 10, 153 (1997)

23. S. Pfeffer, P. Dunoyer, F. Heim, K.E. Richards, G. Jonard,V. Ziegler-Graff, J. Virol. 76, 6815 (2002)

24. E. Sadowy, A. Wisniewska, M. Juszcsuk, C. David, W.Zagorski-Ostoja, B. Gronenborn, M.D. Hulanicka, J. Gen.Virol. 82, 1529 (2001)

25. K. Graichen, F. J. Rabenstein, Plant Dis. Prot. 103, 233(1996)

26. H. Lot, V. Maury-Chovelon Phytoparasitica 13, 277 (1985)

Virus Genes (2007) 34:215–221 221

123