Proceedings of the 3rd international cashew conference

Proceedings of the Third International Cashew Conference

“Cashew for Health Wealth and Environment”

Held at Serena Hotel, Dar Es Salaam, Tanzania

16-19 November 2015

Proceedings of the Third International Cashew Conferenceii

Sponsors

1. Cashewnut Board of Tanzania (CBT), Tanu Road, P.O. Box 533 Mtwara Tanzania

2. Cashewnut Industry Development Trust Fund (CIDTF), Tanu Road P.O. Box 1252 Mtwara Tanzania

3. Naliendele Agricultural Research Institute (NARI), 10 Newala Road P.O. Box 509 Mtwara Tanzania

4. The Public Service Pensions Fund (PSPF), Golden Jubilee-Front Tower 6-13 floor Between Ohio and Kibo Street, P.O. Box 4843 Dar Es Salaam

5. CRDB Bank, Azikiwe Street, P.O. Box 268, Dar Es Salaam

6. Masasi Mtwara Cooperative Union (MAMCU) Ltd, Ushirika Building a long Tanu Road, P.O. Box 660 Mtwara

7. Mohamed Enterprises Tanzania Ltd (METL). 20th Floor Golden Jubilee Towers, Ohio Street, P.O. Box 20660 Dar Es Salaam

Proceedings of the Third International Cashew Conference iii

Editors

Masawe P.A.L., Kafiriti E.M., Mneney E.E., Shomari S.H., Kullaya A.K., Kasuga L.J.F., Bashiru R.A., Kabanza A. and B. Kidunda

Copyright © 2015, Naliendele Agricultural Research Institute. All rights reserved. No part of this publication may be reproduced in any form or by any means, electronically, mechanically, by photocopying, recording or otherwise, without the prior permission of the copyright owner.

ISBN: 978-9987-446-10-0

Published by

Naliendele Agricultural Research Institute

10 Newala Road

P.O. Box 509

Mtwara Tanzania

Designed & Printed by Colour Print Tanzania Ltd

P.O. Box 76006Tel: +255 22 245 [email protected]

www.colourprint-tz.com

Citation:

Masawe P.A.L., Kafiriti E.M., Mneney E.E., Shomari S.H., Kullaya A.K., Kasuga L.J.F., Bashiru R.A., Kabanza A. and B. Kidunda., (eds) (2015). Proceedings of the Third International Cashew Conference, Dar Es Salaam, Tanzania, 16-19th November 2015.

Proceedings of the Third International Cashew Conferenceiv

Contents

Preface ...................................................................................................................... vii

Acknowledgements .................................................................................................. viii

Opening Speech ...........................................................................................................xi

Biodata of authors .....................................................................................................xix

Breeding ...................................................................................................................... 1

Performance of 29 Cashew Hybrids under Conditions of Coastal Areas of ...................2

Chambezi Bagamoyo in Tanzania ..................................................................................2

The performance of 25 Brazilian dwarf cashew clones under conditions of Nachingwea

in Southern Tanzania ..................................................................................................12

Evaluation of Selected Half-Sib Progenies of AZA2 for Resistance to Cashew Leaf and Nut Blight Disease ......................................................................................................24

Preliminary Observations of Cashew Hybrids Developed for Resistance to Leaf and

Nut Blight Disease ......................................................................................................31

Cashew Germplasm Evaluation in Coastal Kenya .......................................................38

Planting material production ..................................................................................... 43

Influence of scion’s stockplant Phenological Stage in Success of Grafting of Cashew Seedlings in Côte d’Ivoire ...........................................................................................44

Evaluation of Effect of Plastic Bags Size and Duration of Stay in the Nursery on the

Performance of Grafted Cashew Seedling ....................................................................51

Advances in Biotechnology ........................................................................................ 60

‘Next-Generation’ Sequencing Technologies in Cashew (Anacardium occidentale L.) research .......................................................................................................................61

Effects of Genotype, Growth Regulators and Salt Composition on Tissue Culture of

Cashew (Anacardium occidentale L.) in Tanzania .........................................................71

Overview of the Application of Molecular Marker Technologies in Cashew (Anacardium occidentale L.): Past, current and future prospects............................ .....83

Colletotrichum Species Associated with Cashew Anthracnose in Mozambique ...........98

Proceedings of the Third International Cashew Conference v

Contents

Soil and plant nutrition ........................................................................................... 109

Preliminary Study on the Variations of Cashew Leaf Nutrient Content from Initial Flowering to Fruiting Period .....................................................................................110

Effects of Nitrogen, Phosphorous and Potassium Fertilisation on the Infestation of Cashew Apple and Nut Borer, Nephopteryx sp. ........................................................117

Integrated Soil Management Practices for Improving Soil Fertility in Cashew Growing

Areas of the Southern Zone of Tanzania ....................................................................130

Crop Protection ....................................................................................................... 142

Determining the Current Abundances and Distributions of the African Weaver Ant, Oecophylla longinoda Latreille (Hymenoptera: Formicidae) in Cashew Growing Areas in Tanzania ...................................................................................................................143

Prospective Study of the Insect Fauna Associated with Anacardium occidentale

L. (Salpindales: Anacardiaceae) in Five Producing Areas of Côte d’Ivoire ..................149

Investigations on Major Cashew Diseases in Côte d’Ivoire ........................................158

Assessing Factors Limiting the Adoption of Pesticide Use Technologies in

Cashew Production. A Case Study in Mtwara District, Tanzania ...............................167

Major Insect Pests of Cashew (Anacardium occidentale L.) and their Control in

China ........................................................................................................................176

The Role of Environmental Factors on the Growth and Development of Cryptosporiopsis sp fungus: The Pathogen of Leaf and Nut Blight Disease on Cashew .........................188

Evaluation of Five Selected Potential Botanicals Against Cashew Powdery

Mildew Disease .........................................................................................................198

Value addition and post harvest technologies ..............................................................208

Technological and Commercial Options for the Economic Utilisation of the

Cashew Apple ...........................................................................................................209

The Role of Warehouse Receipt System in Cashew nut Marketing in Tanzania .........217

Proceedings of the Third International Cashew Conferencevi

Contents

Extension and technology transfer ........................................................................... 224

Adoption of Cashew Production Technologies by Farmers in North-Eastern

Tanzania ...................................................................................................................225

Assessing Farmers’ Awareness on the Utilisation of the Weaver Ant, Oecophylla longinoda Latreille for the Control of Cashew Insect Pests in the Eastern Zone of Tanzania ......233

Capacity Development Through Master Training Programme for Cashew Value Chains Promotion in West-Africa ...................................................................................................242

Country Papers ........................................................................................................................249

Status of Cashewnut Industry in Tanzania .................................................................250

The Status of the Cashew Industry in Malawi ...........................................................256

Nigerian Cashew Economy-Dimensions to Growth Paradigm ..................................263

Proceedings of the Third International Cashew Conference vii

Preface

As Editors of Third International Cashew Conference, we are delighted to introduce the proceedings of the 3rd International Cashew Conference that was held at the Serena Hotel in Dar es Salaam, Tanzania from 16-19th November 2015. This Conference Proceedings contains written versions of most of the contributions presented during the conference.

The Third International Cashew Conference was organised by the Naliendele Agricultural Research Institute of the Ministry of Agriculture Food Security and Cooperatives, in collaboration with the Cashewnut Board of Tanzania (CBT) and Cashewnut Industry Development Trust Fund (CIDTF). This conference was a continuation of a series of international conferences devoted to cashew. Previous conferences were held in Dar es Salaam and Entebbe in 1997 and 2011, respectively.

The conference brought together more than 140 experts from 22 countries. The event provided a platform for discussing recent developments in a wide variety of topics in cashew value chain including: crop improvement, protection, advances in biotechnology, value addition, technology transfer, marketing and policy issues. There were nearly 35 oral and poster presentations out of which 29 were accepted for publication in the conference proceedings following peer- review process.

The two days of lively and stimulating debates generated a lot of interesting and practical recommendations and resolutions. The general recommendation from the conference was the call for African governments to take bold steps and invest in value addition and biotechnology innovations.

In the organisation of the conference, particular attention was given to having quality presentations and interactive discussions. To capture participant’s reflections and views on the conference, delegates were given the opportunity to evaluate the conference by fill in a feedback questionnaire. Overall, most participants felt the conference was very good, professionally organised and the topics covered met their needs and expectations. Also, most of them felt that discussions and deliberations from the presentations were handled with high level of satisfaction.

These proceedings provide a permanent record of what was presented and will be an informative and valuable resource for cashew experts especially the young scientists. We hope you will find the proceedings interesting and helpful.

We look forward to seeing you again at the Fourth International Cashew Conference.

The Editors

Proceedings of the Third International Cashew Conferenceviii

Acknowledgements

The editors on behalf of all the authors wish to extend our sincere gratitude and appreciation to all those who made the publication of these proceedings of the Third International Cashew Conference possible. Some of these are mentioned below but there are many others who deserve recognition but have not been included because of space limitation.

We would like to acknowledge financial support from the Cashewnut Board of Tanzania, Cashew Industry Development Trust Fund, Naliendele Agricultural Research Institute, Masasi Mtwara Cooperative Union (MAMCU) Ltd, Public Service Pensions Fund, CRDB Bank and Mohamed Enterprises Tanzania Ltd.

Special thanks also go to Dr Deoscorous Bernard Ndoloi from the Department of Languages and Linguistics of University of Dar Es Salaam for proof reading all conference papers.

Last but not least we would like to thank all authors for their cooperation during the review and editing process.

Proceedings of the Third International Cashew Conference ix

Welcome Statement

Welcome Statement by Chairperson of Conference Organizing Secretariat

Prof. Peter A.L. Masawe

Permanent Secretary, Ministry of Agriculture Food Security and Cooperatives Mrs Sophia Kaduma, Deputy Chairperson of the Board of Directors of the Cashewnut Board of Tanzania (CBT), Chairperson of the Board of Directors of Cashew Industry Development Trust Fund (CIDTF), distinguished delegates, ladies and gentlemen.

On behalf of the conference secretariat, I would like to take this opportunity to welcome all of you to this 3rd International Cashew Conference. The organizing secretariat is happy to see that most of our participants if not all have arrived safely and it is a great honour to have you here with us today.

Mr Chairman, I am pleased to inform you that we have about 140 participants from 22 countries, representing different Governments, Non Governmental Organizations, National and International institutions worldwide. These delegates are from Kenya, Mozambique, Malawi, Ghana, Cote d’Ivoire, Togo, Algeria, Nigeria, Sri-Lanka, Burkna Faso, India, China, Australia, Zimbabwe, Marshall Island, Cape Verde, Uganda, Philippine, Netherland, Yemen, Pakistan and Tanzania.

With great satisfaction, we recognize the presence of representatives from Local, Regional and International Organizations, cashew authorities and cashew boards like African Cashew Initiative (ACi-GIZ), African Cashew Alliance (ACA), Cashew and Cotton Authority Cote d’Ivoire (CCA), Project of support to the agricultural in Côte d’Ivoire (PSAC), UMH-Foundation, Aga Khan Foundation, Cashew Promotion Institute (INCAJU) Mozambique, University of Dar es Salaam (UDSM), Nelson Mandela African Institute of Science and Technology (NM-AIST), Mtwara and Masasi Cooperative Union (MAMCU), Cashewnut Board of Tanzania (CBT), Cashew Industry Development Trust Fund (CIDTF) just to mention a few.

Mr Chairman, ladies and gentlemen, this conference has been organized to bring together cashew stakeholders to exchange information, knowledge and technologies that have been generated over the last five years in the entire value chain.

We are grateful to Cashewnut Board of Tanzania, Cashew Industry Development Trust Fund, Naliendele Agricultural Research Institute, Cashew processors/exporters (Export Trading Company, Mohamed Enterprises), CRBD Bank Ltd, and Mtwara & Masasi Cooperative Union for their generous moral, technical and financial support that made this event possible.

Mr Chairman, distinguished members of the podium, ladies and gentlemen, I would now like to take this opportunity to welcome the Permanent Secretary Ministry of Agriculture Food Security and Cooperatives to deliver her welcome address.

Proceedings of the Third International Cashew Conferencex

Opening Speech

Permanent Secretary Ministry of Agriculture Food Security and Cooperatives Tanzania

Ms Sophia E. Kaduma

Chairperson Cashew Board of Tanzania

Chairperson Cashew Industry Development Trust Fund

Representative of Ministry of Agriculture of Cote d’Ivoire, Ms Kramo Yaha Yvette Mireille

Representative of Cashew and Cotton Authority from Cote d’Ivoire Ms Mariam Gnrere Wattara

Representative of Ministry of Food and Agriculture, Ghana, Mr Isaac Freeman Konadu

Representative from African Cashew Alliance, Ghana, Dr. Sunil Dahiya

Representative from African Cashew Initiative, Ghana, Mr Ernest Mintah

Deputy Director of the Cashew Promotion Institute of Mozambique (INCAJU) Dr. Carlos P. Mucavele

Representatives of Farmers from United States of America and Cote d’Ivoire

Representative of National Cashew Association of Nigeria, Mr Sotonye Anga

Representative from Ministry of Agriculture Malawi

Representative of Processors from India, Nitin Chandrakant Sawant

Representative of traders from Zimbabwe, Mr Fahadi Saleh Nahdi

Representatives of High Learning Institutions from Australia, China, Cote d’Ivoire, India, Malawi, Kenya and Tanzania

Representatives of ACi–GIZ Burkina Faso, Mr Mohamed Salifou Issaka

Input Suppliers from Marshall Islands, Sri Lanka and Pakistan

Equipment Manufacturers from Philippines and Netherlands

Representatives of Financial Institutions CRDB.

Representative from Social Security Funds (PSPF)

Representatives of various organizations and companies, MAMCU, Mohamed Enterprises Tanzania Ltd and others

Proceedings of the Third International Cashew Conference xi

Opening Speech

Policy Maker from Yemen

Members of the Media

Distinguished Participants

Ladies and Gentlemen

Good Morning

I am greatly honoured and privileged to be given this opportunity to address and open this Third International Cashew Conference, organised by the Naliendele Agricultural Research Institute of the Ministry of Agriculture Food Security and Cooperatives, in collaboration with the Cashew nut Board of Tanzania (CBT) and Cashew nut Industry Development Trust Fund (CIDTF).

Distinguished Participants, before I proceed, I wish to take this opportunity on behalf of the Ministry of Agriculture Food Security and Cooperatives and on my own behalf to welcome you all to Tanzania, the land of Kilimanjaro and Spice Islands of Zanzibar. For those who are coming beyond our borders, I hope everyone arrived safely and we are very happy to have you with us today. I also hope that all of you will find your stay in this beautiful city pleasant and memorable despite the busy schedule ahead of you.

Chairperson, this is an important conference that brings together diverse actors from institutions and sectors involved in all aspects of the cashew value chain including research organizations, advisory and extension service providers, farmers, processors, farmer organisations, academics, government officials, policy makers, private sector representatives, strategic partners, civil society and representatives of the media. Going through the list, I am pleased to learn that invited participants are coming from very diverse background and it is my hope that you have come to this conference with vast experiences, skills, knowledge, technologies and lessons to share with other cashew actors from all over the world.

Distinguished Participants, as you know, this is the third time that Tanzania is organising this important event, having done so in 1997 the First Cashew and Coconut Conference in Dar es Salaam and the Second International Cashew Conference in Kampala Uganda in 2011. Tanzania has over the past few years hosted various meetings and workshops involving cashew because the country has made a lot of good progress and has a wealth of experiences and lessons to share with the rest of the world.

To mention but a few, Tanzania is the only cashew producing country in the world that markets cashew through warehouse receipt system. The warehouse receipt system has contributed to increased farm gate price as well as quality of raw cashew nuts in the country. The country is now finalizing arrangements to involve cashew warehouses in the commodity exchange program. This will enhance transparency in the price discovery system and further improve farm gate price of raw cashew nuts.

I am also proud to inform you that the Naliendele Agricultural Research Institute in Tanzania is the centre of excellence for cashew in Africa with world-class experts in the entire cashew value chain.

Proceedings of the Third International Cashew Conferencexii

Opening Speech

It provides training and technical backstopping to other cashew growing countries in the continent. I am sure most of you have greatly benefitted from the services provided by this institute. Tanzania has developed various innovative technologies and products that have played an important role in enhancing cashew productivity and production. I have the honour to inform you that Tanzania is the only country in Africa that has developed cashew varieties and cashew hybrids following international procedures for plant variety release, which is in line with International Union of Protection of Varieties (UPOV). All 16 varieties and 22 elite hybrids which are very high yielding with excellent nut quality are now protected varieties.

I am encouraged to note that through utilisation and adoption of these improved technologies, the cashew production increased drastically from 16,000 metric tonnes in 1973/74 to 158,000 metric tonnes in 2011 and set a new record of about 200,000 metric tonnes in 2014/15 season.

Chairperson, Tanzania is also one of the few countries in Africa that has put in place a mechanism of stakeholders financing the cashew industry. The Cashew nut Industry Development Trust Fund (CIDTF) is an important body in the cashew value chain that was established by stakeholders in 2010. The main function of the CIDTF is to finance all shared functions in research, farming inputs, processing, marketing and branding. The CIDTF has made significant progress especially in the area of empowering the various actors of the value chain to access credit and agricultural inputs. These are some of the successes that the country is very proud of. I hope you will hear more about these achievements and capacities during the conference proceedings.

Distinguished Participants, the Government of the United Republic of Tanzania recognizes the role that agriculture plays in the socio economic development. In Tanzania the agricultural sector is the most important in terms of its contribution to the Gross Domestic Product (GDP), export earnings and employment. The agricultural sector provides livelihood to more than 75 percent of the population, account for about 24 percent of GDP, and about 24 percent of total exports.

Chairperson, when we trace the role of cashew in the economy of Tanzania we find that it has been an important crop since independence in 1961. Cashew has been the main cash crop for more than 500,000 households. Cashew nut production in Tanzania increased gradually through the 1960 and has now reached about 200,000 metric tonnes. This level of production is a positive achievement not only for researchers and scientists, but also for all the other cashew value chain actors including extension staff, marketing experts, input suppliers and farmers. In spite of these success stories, cashew production and productivity has remain low in some areas due to several factors including high incidences of diseases and insect pests, inadequate input supply, inadequate value addition and low use of available knowledge and technologies such as good agricultural practices, new cashew varieties and hybrids. Some of these production challenges will be discussed in greater details during this conference.

Distinguished Participants, I wish to bring to your attention the fact that Tanzania is fully aware on the need to add value to our products through promotion of cashew processing technologies. The Government of Tanzania is taking concerted efforts to make sure that most of the cashew nut

Proceedings of the Third International Cashew Conference xiii

Opening Speech

produced is processed in the country using small, medium to large scale processing facilities. To kick start the process, CIDTF will finance establishment of three processing industries in Tanzania. I am glad to note that there is slots in your program to further discuss the processing initiatives and strategies.

Chairperson, now turning to the theme of the workshop, I have been informed that the objectives of the workshop are (i) To share the latest knowledge on cutting-edge technologies in cashew research, production, processing, value addition and marketing, and (ii) To identify opportunities and challenges for enhancing sustainable cashew production and productivity. I note with great interest the diverse topics that will be covered during the conference. They range from basic research in biotechnology to post harvest technologies. Your deliberations need to focus on innovations and technologies that address challenges and demands of all actors along the cashew value chain and which are efficient, cost effective and affordable to end users. I encourage all stakeholders in this conference to translate the information and ideas gathered into actions that will bring about sustainable development and improved livelihoods to all cashew farmers in the world.

Distinguished Participants, before I conclude, I would like to take this opportunity on behalf of the Government of United Republic of Tanzania and on my own behalf to thank the sponsors of this conference, namely, CBT, CIDTF, NARI, MAMCU, CRDB, PSPF, Mohamed Enterprises Tanzania Ltd and others for their invaluable support. I very much appreciate their support and I sincerely hope that similar support will be provided in the future. I would also like to extend my gratitude to the organizers of the event for making it a reality. Allow me, also, to take this opportunity to say a big thank you to all of you for availing yourselves to this conference. I hope you will also use this opportunity to visit some of our tourist sites of this beautiful country.

Distinguished Participants, in concluding, I would once again like to express my sincere appreciation for the courtesy and privilege extended to me in order to be with you this morning and share some few ideas with you.

With these remarks let me wish you a pleasant and successful conference. I hope that the ideas that will be generated here will be disseminated widely with the aim of advancing science in cashew industry and improving livelihoods within our region and beyond. It is now my pleasure and honour to declare the Third International Cashew Conference is officially opened.

Thank you very much

Obrigado

Merci

Asanteni sana

Proceedings of the Third International Cashew Conferencexiv

Themes and papers presented

Breeding

1. Performance of 29 Cashew Hybrids under Conditions of Coastal Areas of Chambezi Bagamoyo in Tanzania

P. A. L. Masawe, F. A. Kapinga, J. Madeni and Z. S. Ngamba

2. The performance of 25 Brazilian Dwarf cashew Clones under Conditions of Nachingwea in Southern Tanzania

P.A.L. Masawe, F.A. Kapinga, J. Madeni and Z. S. Ngamba

3. Evaluation of Selected Half-Sib Progenies of AZA2 for Resistance to Cashew Leaf and Nut Blight Disease


4. Preliminary Observations of Cashew Hybrids Developed for Resistance to

Leaf and Nut Blight Disease


5. Cashew Germplasm Evaluation in Coastal Kenya

F. Muniu

Planting Material Production

6. Influence of Scion’s Stockplant Phenological Stage in Success of Grafting of Cashew Seedlings in Côte d’Ivoire

J.B.A. Djaha, C.K. Kouakou, A. A. N’Da Adopo, A. H. Djidji and M.Y. Minhibo

7. Evaluation of Effect of Plastic Bags Size and Duration of Stay in the Nursery on the Performance of Grafted Cashew Seedling

R. A. Bashiru

Advances in Biotechnology

8. ‘Next-Generation’ Sequencing Technologies in Cashew (Anacardium occidentale L.) research

A. E. Croxford and E. E. Mneney

9. Effects of Genotype, Growth Regulators and Salt Composition on Tissue Culture of Cashew (Anacardium occidentale L.) in Tanzania

E.E. Mneney

10. Overview of the Application of Molecular Marker Technologies in Cashew (Anacardium occidentale L.): Past, current and future prospects

Emmarold E. Mneney and Adam E. Croxford

Proceedings of the Third International Cashew Conference xv


11. Colletotrichum Species Associated with Cashew Anthracnose in Mozambique

M.J.Comé, C.A.Almeida, L.K.Turquete, L.M.Abreu, L.H.Pfenning

Soil and Plant Nutrition

12. Preliminary Study on the Variations of Cashew Leaf Nutrient Content from Initial Flowering to Fruiting Period

J. H. Wang, H. J. Huang, W. J. Huang and Z. R. Zhang

13. Effects of Nitrogen, Phosphorous and Potassium Fertilisation on the Infestation of Cashew Apple and Nut Borer, Nephopteryx sp.

Z. R. Zhang, J. H. Wang, W. J. Huang, H. J. Huang

14. Integrated Soil Management Practices for Improving Soil Fertility in Cashew Growing Areas of the Southern Zone of Tanzania

A.K. Kabanza, J.J. Tenga, M.M. Kwikima, and R. Msoka

Crop Protection

15. Determining the Current Abundances and Distributions of the African Weaver Ant, Oecophylla longinoda Latreille (Hymenoptera: Formicidae) in Cashew Growing Areas in Tanzania

W. Nene and S. H. Shomari

16. Prospective Study of the Insect Fauna Associated with Anacardium occidentale L. (Salpindales: Anacardiaceae) in Five Producing Areas of Côte d’Ivoire

E. N. Akessé , S-W.M. Ouali-N’goran, O.R. N’Dépo, T. Koné and D. Koné

17. Investigations on Major Cashew Diseases in Côte d’Ivoire

S. Soro , N. Silué, G.M. Ouattara, M. Chérif, Camara,F. Sorho, N.M. Ouali,K. Abo, M. Koné, D. Koné

18. Assessing Factors Limiting the Adoption of Pesticide Use Technologies in Cashew Production. A Case Study in Mtwara District, Tanzania

S. F. Magani,W. Nene and S. H. Shomari

19. Evaluation of Five Selected Potential Botanicals against Cashew Powdery Mildew Disease

S. H. Shomari , D. Menge and W. Nene

Proceedings of the Third International Cashew Conferencexvi


20. Major Insect Pests of Cashew (Anacardium occidentale L.) and their Control in China

Z. R. Zhang, J. H. Wang, W. J. Huang and H. J. Huang

21. The Role of Environmental Factors on the Growth and Development of Cryptosporiopsis sp fungus: The Pathogen of Leaf and Nut Blight Disease on Cashew

D. Menge, S. H. Shomari and W. Nene

Value Addition and Post Harvest Technologies

22. Technological and Commercial Options for the Economic Utilisation of the Cashew Apple

J. Mathew, A. Sobhana and C. Mini

23. The Role of Warehouse Receipt System in Cashew nut Marketing in Tanzania

M. Malegesi

Extension and Technology Transfer

24. Adoption of Cashew Production Technologies by Farmers in North-Eastern Tanzania

B.R. Kidunda and L.J.Kasuga

25. Assessing Farmers’ Awareness on the Utilisation of the Weaver Ant, Oecophylla longinoda Latreille for the Control of Cashew Insect Pests in the Eastern Zone of Tanzania

W. Nene, D. F. Mwakanyamale, S. H. Shomari and B. Kidunda

26. Capacity Development through Master Training Programme for Cashew Value Chains Promotion in West-Africa

Tandjiekpon, R. Weidinger, A. Agyepong, C. Benon, M. Salifou

Country Papers

27. Status of Cashewnut Industry in Tanzania

M. Malegesi

28. The Status of the Cashew Industry in Malawi

F.M. Chipojola and E.M. Kondowe

29. Nigerian Cashew Economy-Dimensions to Growth Paradigm

S. Anga

Proceedings of the Third International Cashew Conference xvii

Closing Remarks

Mudhihir M. Mudhihir

Deputy Chairperson of the Board of Directors of Cashewnut Board of Tanzania

Chairperson, Conference organizers, distinguished delegates, ladies and gentlemen, it is with great pleasure and honour that I accept the invitation to address this gathering as you come to the official closure of this Third International Cashew Conference organised by the Naliendele Agricultural Research Institute of the Ministry of Agriculture Food Security and Cooperatives, in collaboration with the Cashewnut Board of Tanzania (CBT) and Cashewnut Industry Development Trust Fund (CIDTF). I hope the presentations and discussions over the past two days have enabled you to draw lessons and experiences from one another that you can all take back with you. I thank you for coming to Tanzania and hope you had a pleasant stay here.

Ladies and gentlemen, I am particularly delighted to learn that this is the second time Tanzania is honoured to host this important conference, having done so in 1997. In this respect, I would like to extend my sincere appreciation to the Government of Tanzania and the organisers of this event for putting together an excellent conference.

Chairperson, I am aware that during the conference more than 30 papers were presented and discussed. I trust you had fruitful deliberations and took good advantage of this opportunity to exchange experiences and ideas on how best to address cashew production challenges. I also believe you have been able to identify key success factors and innovative approaches in linking ideas, strategy and action. I am confident that the presentations, experience shared as well as knowledge gained during the conference will enable you to make significant contribution towards transforming the cashew industry in your respective countries and in all cashew growing areas in the world. The cashew farmers and other value chain actors expect you to put in place efficient and effective strategies of implementing the outcomes of this conference. The ultimate goal is the attainment of a better life for all cashew stakeholders.

Ladies and gentlemen, despite the many successes recorded in this conference, some cashew producing countries are still faced with many technical and institutional challenges. These include marketing constraints, outbreak of new pests and diseases, technical know- how and inadequate planting materials.

I challenge you to look for innovative and sustainable strategies for addressing the challenges. In an effort to tackle the marketing constraints, I am encouraged to note that the Governments of Tanzania and Mozambique have put in place warehouse receipt system. It is evident from the papers presented that the system has empowered small-scale producers by building their entrepreneurial and organizational capacity and improving their links to markets.

Chairperson, whilst significant progress has been made in relation to cashew improvement using conventional methods, considerable scope still exists to further enhance cashew production and productivity using modern techniques such as biotechnology. I am pleased to note that Cashew improvement programs have started incorporating these tools into their plans for a wide range of purposes varying from simple fingerprint comparisons to gene discovery and marker-assisted breeding.

Proceedings of the Third International Cashew Conferencexviii

Closing Remarks

Dear participants, in an attempt to make an assessment of this conference, I would like to remind you of a statement made by the Permanent Secretary Ministry of Agriculture Food Security and cooperatives in her opening speech. She said “I encourage all stakeholders in this Congress to translate the information and ideas gathered into actions that will bring about sustainable development and improved livelihoods to cashew farmers and all other stakeholders involved in the cashew value chain”. I hope you will agree with me that all your deliberations will count for nothing if not put in practice.

Ladies and gentlemen, let me take this opportunity once again to thank the organizers of this conference for a job very well done. Allow me to also commend the contribution of the various sponsors including Cashewnut Board of Tanzania, Cashew Industry Development Trust Fund, Naliendele Agricultural Research Institute, Cashew processors/exporters (Export Trading Company, Mohamed Enterprises Tanzania Ltd), CRBD Bank Ltd, Mtwara & Masasi Cooperative Union and Public Services Pension Fund (PSPF). We don’t take this for granted and I encourage you to keep up the good spirit.

I also greatly appreciate the support we have received from the members of the media, in covering the conference activities. It is very important that the knowledge and ideas generated are disseminated to a wider readership and category of audience.

Chairperson, Conference organizers, Distinguished delegates, ladies and gentlemen, I am informed that some of you will be visiting the historical and tourist sites of Bagamoyo and Mikumi. I wish you safe and enjoyable trips. This is indeed a great opportunity to discover the beauty and charm of Tanzania and its people.

With these few remarks, Ladies and gentlemen, I would now like to take this opportunity to wish you all the best as you go back to your respective homes, and declare this Third International Cashew Conference officially closed.

Proceedings of the Third International Cashew Conference xix

BIODATA OF AUTHORS

Proceedings of the Third International Cashew Conferencexx

Biodata of Authors

Professor Peter A.L. Masawe is a Principal Agricultural Research Officer, a Cashew Breeder and Cashew Value Chain Specialist with over 29 years experience in cashew industry and 27 years of cashew project management and supervision in Sub Saharan Africa. He is currently the Lead Scientist for National Cashew Research Programme in Tanzania and a Coordinator of the Regional Cashew Improvement Network for Eastern and Southern Africa, which was funded by Common Fund for Commodities based in Amsterdam. The regional network covers seven countries and these are Ethiopia, Kenya, Madagascar, Malawi, Mozambique, Tanzania and

Uganda. He is also an Adjunct Professor at The Nelson Mandela African Institute of Science and Technology in Arusha Tanzania.

From 2006 and 2007 he was employed by African Development Bank (AfDB) as a Technical Advisor to the Cashew Development Project in Ghana.

He was employed by the World Bank as international cashew expert in Mozambique from 2000-2003.

Prof Peter Masawe is one of the most prominent cashew breeders in the world. He released 16 cashew varieties (2006) and 22 new cashew hybrids (2015) making Tanzania the first country in Africa if not in the world to release commercial cashew varieties (tested in replicated trials in contrasting agro-ecological sites) protected by International Union of Protection of Varieties (UPOV). He is an author/co-author of 5 cashew books:- “Tanzanian Cashew Cultivars” (2006)- ISBN 9987-446-01-9 and Linking Farmers Extension and Research at Community level (2013) ISBN 9987-446-02-7, Tanzanian’s cashew value chain-A diagnostic 2011, Diseases and insect pest of cashew in Tanzania (December 2014) ISNB: 9987- 446-09-4, Data quality control standards of descriptors for cashew (December 2014) ISBN: 9987- 446-06-X and Cashew Cultivation and Processing 2015 (in press).

He is an international consultant in cashew value chain and he has done several consultancies in Benin, Burkina Faso, Ethiopia, Ghana, Ivory Coast, Kenya, Madagascar, Malawi, Mozambique, Togo, Uganda and Zambia. He has over 30 publications in cashew.

Proceedings of the Third International Cashew Conference xxi

Biodata of Authors

Mr. F.K. Muniu is a Kenyan horticulturalist with 20 years research experience in vegetables, fruits and tree crops of the coastal region of Kenya. National Coordinator Nuts Research in Kenya Agricultural and Livestock Research Organization. A Member of Cashew and Coconut Industry Revitalization Technical Team.

Proceedings of the Third International Cashew Conferencexxii

Jean-Baptiste Akadié DJAHA was born 12 May 1959 in Divo, Republic of Côte d’Ivoire. He holds a Bachelor in Mathematics and Natural Science (Divo Modern Secondary High School), Agronomy Engineering Diploma (National Agronomic Superior School) and Master in Plant Physiology (National University of Côte d’Ivoire).

Researcher since 1991 in Research Institute for Fruits and Citrus (IRFA) in Azaguié station, Jean-Baptiste Akadié DJAHA worked successively on plantain, cultivated fruits crops (Agronomy), wild edible fruit species

of forest and savannah (Management of genetic resource). During this period, he participated in AISA (Ivorian Association of Agricultural Sciences) project intended to domesticate some major edible wild fruits trees of forest and savannah in Côte d’Ivoire. This work permited him to take inventory of wild species, create nursery, botanical garden for wild edible fruit trees and collect data.

From 1999 to 2002 Jean-Baptiste Akadié DJAHA worked on cashew in management of genetic resource and vegetative propagation.

From 2003 to 2008 He worked on passion fruit in collaboration with the Ivorian extension service (ANADER) in farmers fields. Then, always on passion fruit he worked in collaboration with the Food Technology Laboratory of Abobo-Adjamé University, and the Agronomy Department of Agronomic Superior School. The collaboration concerned research activities and supervision of students.

Since 2009 in Lataha/Korhogo research station of CNRA, Jean-Baptiste Akadié DJAHA works mainly on cashew (Management of Genetic Resource, Agronomy and Physiology). Actually he works on the project titled: varietal improvement of cashew. This project is executed in the framework of an agreement CNRA – FIRCA (Inter professional Fund for Agricultural Research and Council), on the behalf of Cashew operators sector of Côte d’Ivoire. This project includes: farm surveys to identify high producing trees, tree commission in collections at research stations, characterize them, implement pilot fields and mass production of grafted plants in nurseries to make them available to producers. In the framework of the project, in addition to the research activities, he supervises students from Universities and Agricultural Superior Schools.

Jean-Baptiste Akadié DJAHA is author of various publications on cashew and other fruit crops.

Biodata of Authors

Proceedings of the Third International Cashew Conference xxiii

Ramadhan A. Bashiru was born in 1959 in Lushoto -Tanga Tanzania. He holds a diploma in crop production awarded in 1985 at Ukiriguru Ministry of Agriculture Training Institute and also a degree of Bachelor of Science in crop science and production awarded in 1990 at Sokoine University of Agriculture-Morogoro Tanzania. In 1994 he joined Wye College - University of London in UK to undertake a one-year degree of Masters in Crop Science and Tropical and Sub-tropical Horticulture.

Mr. Bashiru is a senior Horticulturist (agronomist) and a Principal Agricultural Research Officer with over 25 years experience in cashew management and production. He is the Head of cashew agronomy research section, National co-ordinator of cashew nurseries and the head of Horticulture department at Naliendele Agricultural Research Institute.

He worked with the Cashew Improvement programme in Tanzania funded by the World Bank and British Overseas Development Administration (ODA) currently known as Department of International Development (DfID). During this period he participated in the development and transfer of proven cashew technologies to farmers. He has been actively involved in the cashew production chain with a view to cashew propagation, orchard establishment, and rehabilitation and upgrading.

He has done a number of consultancies in human capacity building in cashew propagation and establishment of nurseries in West, East and Southern African countries.

Mr. Bashiru is a member of International horticultural society. He is an author or co-author of a number of peer reviewed papers published in national and international journals, a number of pamphlets, fliers, and video films and an author of the handbook “Mwongozo wa usimamizi wa kitalu na ubebeshaji wa mikorosho (i.e cashew nursery management and grafting)” (ISBN 9987-446-07-8).

Biodata of Authors

Proceedings of the Third International Cashew Conferencexxiv

Dr E. Mneney is a plant biotechnologist with three decades of experience in research and development of various agricultural innovations. He holds a PhD in Biotechnology from the University of London and an MSc in Tropical Horticulture from Reading University, UK. His current research interests are tissue culture, molecular breeding for stress tolerance and development of fast tracking approaches for seed/ seedling multiplication and dissemination for various crops including sorghum, maize, millets, cassava, banana, sweet potato and cashew.

He also has experience in technology transfer; innovation and value chain approaches; and biosafety. Besides this research career, Dr Mneney has for the past 12 years served at the University of Dar Es Salaam and Nelson Mandela African Institute of Science and Technology as part-time lecturer, teaching Agricultural biotechnology and molecular breeding courses for BSc, MSc and PhD programmes. He has published widely and supervised several postgraduate students. Dr Mneney has also participated and provided leadership to several collaborative research and development programs.

Biodata of Authors

Proceedings of the Third International Cashew Conference xxv

Adam Croxford was born in Perth, Western Australia and went to the University of Western Australia (UWA), where he obtained a Bachelor of Science degree in Agriculture with Honours in Plant Breeding. For his Honours project he researched the use of DNA technology in apple breeding working with the Department of Agriculture and Food, Western Australia (DAFWA). After graduation, he won a scholarship from the Department for International Development in the United Kingdom (DFID) to study cashew breeding in Tanzania. He completed his doctoral studies at the University of Reading in 2005 with his PhD dissertation

entitled “A molecular study of the breeding system of cashew (Anacardium occidentale L.) in Tanzania”.

Following graduation, Dr Croxford commenced a post-doctoral position at the University of Reading, UK researching the genetics of lupin breeding. In 2007, he accepted a position at the University of Wales, Aberystwyth, UK to work with oil palm breeding in Indonesia. In this position, he worked at developing saturated linkage maps and QTL analysis for enhancement of the African oil palm (Elaeis guineensis) germplasm. In 2012, Dr Croxford accepted a position at the University of Adelaide, South Australia where he currently works in the development of plant biotechnology for both agricultural and ecological projects. He has published extensively in the field of Agricultural Biotechnology.

Biodata of Authors

Proceedings of the Third International Cashew Conferencexxvi

Mateus J. Comé is an Agronomy Engineer and Master in Plant Pathology. He works as a researcher at the Cashew Promotion Institute in Mozambique.

His professional experience is connected to agronomy and plant pathology, especially in areas related to integrated management of pests and diseases, epidemiology of crop diseases, diagnosis and control of crop diseases, and development of new techniques for the optimization of the production process of different crops.

He works at the cashew sector since the year of 2004, and his experience is deeply connected to the applied research of cashew in Mozambique, focus area of integrated management of diseases.

Mateus studied at Eduardo Mondlane University in Mozambique and, at the Federal University of Lavras, State of Minas Gerais, Brazil, where he obtained the Master’s Degree in Plant Pathology. He also did various training courses, from which the first international training in production, post-harvesting and industrial processing of cashew, performed at Brazilian Corporation for Tropical Agriculture and Industry Research (EMBRAPA) Tropical Agro-industry is highlighted in cashew area. In addition, he also participated in various events addressing about agronomy, plant pathology and many others such as the last two international cashew conferences that took place in Africa.

He is currently employed in the Cashew Promotion Institute (INCAJU) and, his good human relationship, dynamism, ability for team working, good health and posture, high sense of responsibility, good organizational and time management skills, and good interpersonal and communication skills, make him a relevant person in his profession.

Biodata of Authors

Proceedings of the Third International Cashew Conference xxvii

Zhang Zhongrun, male, associate professor, born on 19th August 1979 in Hainan. In 2005 He graduated from South China Agricultural University and was awarded a degree of agriculture master. From 2005 to date, he worked in Tropical Crops Genetic Resources Institute (TCGRI) of Chinese Academy of Tropical Agricultural Sciences (CATAS).

Mr. Zhang Zhongrun is a crop protection specialist in cashew industry. He has been involved in cashew value chain for 10 years and has operated in some countries including Mozambique, Tanzania, Thailand and

Vietnam.

He is in charge of 6 ministerial and provincial research projects such as National Natural Science Foundation of China and Natural Science Foundation of Hainan Province. He had published 16 scientific papers, and was chief editor of 4 cashew books “Cashew Insect Pests and Diseases”, “Cashew Insect Pests and Diseases in Mozambique”, “Cashew Insect Pests and Diseases in Tanzania” and “Cashew Cultivation and Processing”, won 2 provincial awards in science and technology.

Biodata of Authors

Proceedings of the Third International Cashew Conferencexxviii

Dr. Andrew K. Kabanza is a Senior Agricultural Research Officer, Soil Scientist in the Ministry of Agriculture Food Security and Cooperatives of Tanzania since 2004. His main research interests include: land use and evaluation, soil erosion, soil erosion control, soil and water conservation where he has several publications.

He obtained his undergraduate Degree in General Agriculture in 1998 and Masters Degree in Soil Science & Land Management from Sokoine University of Agriculture Morogoro, Tanzania in 2003. He further

completed his PhD studies in Bioscience Engineering in 2013 from KU Leuven, Belgium. Currently he is the Head of Special program (Soils) at Naliendele Agricultural Research Institute working on soil fertility management, soil and water conservation in cashew fields and conservation agriculture.

Biodata of Authors

Proceedings of the Third International Cashew Conference xxix

Wilson A. Nene is a Tanzanian working under the Ministry of Agriculture Food Security and Cooperatives as an Agricultural Research Officer. He has over 10 years experience in crop production and management of farm land. In 2011 he joined for a PhD in Crop Science at Sokoine University of Agriculture, Tanzania, a program sandwiched with Aarhus University in Denmark. His major research areas are on Integrated Pest Management approaches for sustainable agriculture. He obtained a PhD diploma in biological control at Aarhus University, Denmark in 2013. Nene also has knowledge and skills in climate change and variability (CC&V) and

statistics which he obtained from Reading University.

He worked as a research assistant in 2005-2006 under Vlaamse Interuniverstaire Raad (VLIR). His research was to assess the effect of cover crops on soil moisture retention, soil loss control, soil fertility and vegetable yield in Northern part of Uluguru Mountain, Tanzania. In 2006-2007, he worked as Agronomist at a large scale sugar estate called Mtibwa. Currently, he is working in crop protection section where his main researches include: ecological pest management, biopesticides and biological pest management practices.

Biodata of Authors

Proceedings of the Third International Cashew Conferencexxx

Dr. Soro Sibirina is a Lecturer and Researcher in Phytopathology at the University Jean Lorougnon Guédé (UJLoG) of Daloa in Côte d’Ivoire. Dr. Soro studied at Nangui Abrogoua University (UNA) and Félix Houphouët-Boigny University (UFHB) of Côte d’Ivoire where he obtained a PhD in Biology and Crop Protection and a Master of Natural Sciences.

Since 2012, he works in cashew sector at National Center Research of Agricultural at Korhogo in the North of Côte d’Ivoire before joining the

UJLoG. Now, he is the sub-coordinator of two Projects of “ Improvement crop management and sustainable management control of cashew pest and diseases in Côte d’Ivoire ” financed by ACi – GIZ and the Council of Cotton and Cashew Nut. His professional life has been connected to the management of Crop Protection and agricultural resources as a researcher member of National Programme of Research in Cashew financed by Council of Cotton and Cashew of Côte d’Ivoire.

Biodata of Authors

Proceedings of the Third International Cashew Conference xxxi

Suitbert Francis Magani is a Researcher and works with Cashew Agronomy at the Agricultural Research Institute (ARI), Naliendele, Mtwara. He worked in the Agricultural Extension Department as Field Officer in Mayanga Division Mtwara District from 1986 to 1994. His main activities were; Training and Visiting the rural farming communities to advice on good agricultural practices (GAP) for cashew production during Cashew Improvement Pilot Project (CIPP) intervention in 1990s. He also concentrated on setting up Demonstration plots and organizes Farmers’ Field Day as part of technology transfer.

In 1995 he joined Naliendele Agriculture Research Institute where he worked as Technician.The institute conducts On-station and On-farm trials as part of participatory outreach programs. His main activities were; experimental design, layout, field supervision and data management.

Mr. Magani studied Rural Sociology at the University of Dar-es-salaam (UDSM), Tanzania where he obtained a (BA.) in Rural Sociology in 2010. He undertook postgraduate studies at the Sokoine University of Agricultural (SUA) where he obtained a Masters of Arts (MA) in Rural Development in 2013. His main research activities in the Cashew Agronomy Department were; developing appropriate agronomical practices to cashew growers and technology transfer to rural farming community. Others include; developing packages for rehabilitation of abandoned or neglected cashew orchards and upgrading of cashew orchards aiming at increasing farm productivity.

In 2015 he was stationed at Mkumba Research Sub-station as Officer In charge. His main responsibilities includes supervising all research activities conducted at Mkumba sub-station. Organizing and mobilizing resources including human resources to enable smooth operation of research activities in the area. Other major activities include Budget preparation, quarterly and progressive report writing and submit to ZDRD (S).

Biodata of Authors

Proceedings of the Third International Cashew Conferencexxxii

Dr Shamte H. Shomari, a retired Principal Agricultural Research Officer, based at Naliendele Agricultural Research Institute, Mtwara has a wide experience on cashew crop for more than 35 years. Graduated in 1980 with a Masters degree in Crop Protection at the University College Dublin, Ireland, joined Naliendele Institute in the same year as the Director of the centre. At the same time, to ensure that he continues with his profession, he was attached to cashew research section as cashew pathologist.

In 1990 Dr. Shomari was appointed as the Zonal Director of Research for the Southern Zone. However, with those additional administrative duties, he continued to be an active cashew pathologist. In 1992 He joined Birmingham University in the United Kingdom and successfully awarded a PhD degree in Biological Sciences in 1996.

During his career as a cashew pathologist, from 1980 to 2010, Dr Shomari has been involved in the screening of most pesticides currently used by cashew farmers against diseases and insect pests in Tanzania. Meanwhile, he has been coordinating annual training programmes to cashew farmers and extension officers in appropriate techniques to combat diseases and pests which to date has trained 3,500 participants.

At present Dr. Shomari has been employed by the Ministry of Agriculture Food Security and Cooperatives based at Naliendele Agricultural Research Institute as a cashew pathologist with Cashew Research Programme.

Biodata of Authors

Proceedings of the Third International Cashew Conference xxxiii

Dr. Jose Mathew Born on 18th July 1955. He obtained his PhD from Tamil Nadu Agricultural University, Coimbatore. He joined Kerala Agricultural University (KAU) as Scientist in 1977 and has been working at different capacities in KAU till July 2015 when he retired from service as Director of Extension.

He headed the Cashew Research Station, Madakkathara, a premiere research institute on cashew in India, including a major Centre of the All India Coordinated Research Project, for eight years.

He contributed in the development of twelve technologies for the economic utilization of cashew apple and also the release of cashew hybrid H 1593 as variety “Poornima”.

He undertook 20 research projects in cashew as Principal Investigator and Associate Investigator as well as 20 farmer participatory research programmes. He published 64 research papers in journals and seminars and 39 books/ book chapters/technical bulletins/ reports on cashew. He published 21 extension articles in Malayalam and five articles in English.

He has undertaken an assignment for UNIDO during 2007-08 for the establishment of a commercially viable cashew apple processing and demonstration facility at Naliendele Agricultural Research Institute, Mtwara, Tanzania.

He has organized more than 100 trainings on various aspects of cashew plantation management including an international training programme sponsored by USAID during 2009 for participants from Senegal, West Africa.

Biodata of Authors

Proceedings of the Third International Cashew Conferencexxxiv

Mr Mangile Malegesi is an Acting Branch Manager for Cashewnut Board of Tanzania, Dar es Salaam Branch. He joined the Cashewnut Board of Tanzania in August 2009 as Processing Officer. Prior to that he worked with private sector in Tanzania. His profession is Food Science.

Mr Malegesi studied at Sokoine University of Agriculture in Tanzania and awarded Bachelor of Science in Food Science and Technology. Currently he is pursing Master of Business Administration in Cooperate Management at Mzumbe University in Tanzania.

Biodata of Authors

Proceedings of the Third International Cashew Conference xxxv

Bakari R. Kidunda is a Senior Agricultural Research Officer (SARO) employed by the Permanent Secretary Ministry of Agriculture Food Security and Cooperatives working in the department of Research and Development (R&D), duty station being Naliendele Agricultural Research Institute, Mtwara, Tanzania. He has over 10 years of experience as agricultural research officer. He has three publications as author or co-author. In 2015/16 season, he worked as a sub-consultant under Small and Medium Agribusiness Enterprises Development Services Ltd (SMAED Services Ltd Kenya), conducted a baseline Study of Climate

Smart Agriculture in Tanzania for Sustainable Food Production and Increased Incomes (AGRA/NORAD Project).

In 2015, he worked as a sub-consultant under COWI Tanzania Ltd on Crop Replacement Value Assessment Project in Lindi region, project funded by British Gas (BG Tanzania). In 2014, he worked as a sub-consultant under Small and Medium Agribusiness Enterprises Development Services Ltd (SMAED Services Ltd Kenya), conducted a baseline survey project for selected crops in Tanzania; a Project on Scaling Seeds and Technologies Partnerships (SSTP); USAID/AGRA G8 cooperative agreement. In 2012, he worked as a consultant on establishing a simple estimation method for revenue collection for Mtwara district funded by GIZ Tanzania.

He undertook undergraduate studies at Sokoine University of Agriculture (SUA), Morogoro Tanzania from 1999 to 2002 where he obtained a B.Sc. in Agricultural Economics and Agribusiness. In 2006 he again joined SUA to pursue M.Sc. in agricultural economics and graduated in 2010.

Biodata of Authors

Proceedings of the Third International Cashew Conferencexxxvi

André M. Tandjiekpon is the Production Director for African Cashew Initiative (ACi) at Regional Office in Burkina Faso. He worked many years in Benin for Government institutions and development programs until 2009 before joining the GIZ to conduct Aci project for Benin as National Coordinator. His professional life has been connected to the management of forest and agricultural resources as a team member, team leader, coordinator and director of projects financed by donors such as AFD, World Bank, IDA, DANIDA, BTC, GIZ, BOAD, ADB, FAO, UNDP and ITC. Since 1997, he works on the cashew sector with over

25 publications and reports as authors or co-authors.

André studied at Polytechnic School of the National University of Benin and the Faculty of Letter and Arts at the same university where he obtained a Master of Natural Sciences and Master’s Degree in Geography. He undertook a postgraduate course at the International Institute of Aerospace Survey and Earth Sciences (ITC) in Enschede (Netherlands) where he obtained a Postgraduate Degree in management of forest resources. He joined the Graduate School at the University of Abomey, where he obtained a Masters in environmental management and sustainable development. He is a professional Gestalt in organizational and institutional development, graduated from the OSD - Ghana Centre in collaboration with Integrative Gestalt Organization & Systems Development Study Centre - Ohio, United States and International Organizations and Development Programs Ohio, USA.

Biodata of Authors

Proceedings of the Third International Cashew Conference xxxvii

Felix Mereka Chipojola is currently the National Research Coordinator for Horticulture under the Department of Agricultural Research Services, Ministry of Agriculture, Irrigation and Water Development in Malawi. He coordinates research activities in fruits, coffee, tree nuts, flowers, vegetables, spices, cassava, sweetpotato, potato, cocoyams and yams. His research area includes Cashew nuts, Macadamia nuts, Coffee and Fruits as Principal Agricultural Research Scientist and recently has released four high yielding Macadamia Clones for production by the farming community in Malawi. He worked for twelve years in the Private Sector

in a reputable Tea Company from 1987-1999 as Manager. He has also served as a Sweetpotato Platform Member under the Regional Agricultural and Environment Innovations Network (RAEIN) –Africa since 2010 to 2013. He is the member of the Steering Committee of Africa RISING which is supporting research activities in Malawi, Tanzania, Zambia and Western Africa countries.

He has authored and co-authored four and two publications respectively, five Annual Horticulture Commodity Group reports and presented scientific papers in Tanzania and South Africa. Felix holds a Master of Science Degree in Horticulture, Bachelor of Science Degree in General Agriculture and Diploma in Agriculture from Bunda College of Agriculture, University of Malawi.

Biodata of Authors

Proceedings of the Third International Cashew Conferencexxxviii

Sotonye Anga, Agribusiness strategist and enterprise development expert with corporate experience spanning 20 years in plantation development, value addition to crops, export of Agricultural commodities and trade consultancy across Africa, Asia and Europe.

Mr Anga has authored well over 330 questions and answers covering Life, Psychology, Philosophy, Negotiation, Agriculture, Business, and Customer service management that have been read by over one million and eight hundred people worldwide.

He is different things to different people including a Motivational speaker, success coach, advisor to Governments and Captains of industry, international consultant, businessman and author of way too many presentations. His works are widely used across the world, shaping global prosperity, people development, peace, Agriculture and food security.

Anga with a passion for agriculture has been involved in creating various Agribusiness models, facilitating project finance, and market linkages between producers (farmers) and buyers.

A global AGvocate. Anga’s presentations on Agriculture and people development have attractedseveral downloads with a record of over Four Million (4,000,000) on-line views contributing immensely to the development of Agriculture globally. Over 10,000 men and women have benefited from Mr Anga’s Agribusiness training across Africa and beyond since 1996.

He has written over 300 articles promoting agribusiness.

Mr Anga is the managing director of Universal Quest Nigeria Limited, a major Agribusiness company registered in Nigeria, and operating across Africa, trading Agricultural commodities such as cashew nuts, sesame seeds, sheanut, ginger, sorghum and bulk grains. We are currently working at establishing 100,000 tons grain silo and 10,000 tons capacity cashew processing factory in Nigeria.

Biodata of Authors

Proceedings of the Third International Cashew Conference xxxix

Dr Ouali - N’goran S. Mauricette is University Professor, specialist in Biology and ecophysiology of insects. She conducts research both in the laboratory and field. Her areas of expertise are:

Analysis of agronomic problems and identification of problems in insect pests and vectors of diseases of vegetable crops, corn, cocoa, cotton, cashew. The study of the dynamics of insect populations in a culture system from semi to harvesting and conservation; the realization of pesticides in field tests and laboratory; the use of essential oils and insect

natural enemies (parasitoids) for effective control. Laboratory pests and insect breeding as well as microscopic dissection of animal tissues (reproductive system, digestive system).

Dr OUALI - N’GORAN S. Mauricette holds a Bachelors degree (1989), Masters Degree in Animal Science (1994) and a PhD degree in Entomology agricultural from the University of Cocody Abidjan-Côte d’Ivoire. Dr OUALI - N’GORAN S. Mauricette supervises several Masters and PhD students. She collaborated with AKESSE Ettien Narcice on the work on insect pests of cashew in Ivory Coast.

Biodata of Authors

Proceedings of the Third International Cashew Conferencexl

Dr Menge Dominic holds a Bachelor of science in Botany (Plant Biotechnology), Master of Science in Botany (Plant Physiology) and a Ph.D. (2015) in Plant Science from Jomo Kenyatta University of Agriculture and Technology. His academic disciplines are in the areas of plant physiology and pathophysiology. Dr. Menge Dominic is a highly creative molecular plant pathophysiologist whose research interest focuses on changes taking place in plants due to diseases. His research includes how diseases operate in plants and recommendation of proper treatment.

Dr Menge is equipped with plant physiology techniques and working knowledge of molecular biology methods used to dissect the modes of action of disease resistance in plants. He is involved in a multi-disciplinary research team developing plant productivity systems. He has an experience working in matrixed environment with proven communication skills, leadership ability and project management experience. The ability to prioritize under pressure and adapt to changing demands, and make rapid progress against goals despite tight timelines are critical skills.

Biodata of Authors

Proceedings of the Third International Cashew Conference 1

Breeding

BREEDING

Proceedings of the Third International Cashew Conference2

Breeding

Performance of 29 Cashew Hybrids under Conditions of Coastal Areas of Chambezi Bagamoyo

in Tanzania

P. A. L. Masawe*, F. A. Kapinga, J. Madeni and Z. S. Ngamba

Cashew Research Programme, Naliendele Agricultural Research Institute

P.O. Box 509 Mtwara Tanzania

*Email of the corresponding author: [email protected]

Abstract

Cashew hybridisation by controlled hand pollination was achieved in Tanzania for the first time in 1991. This led to development of a number of hybrids, which were evaluated in a replicated trial in 1992. More hybrids were produced in 1994 and 1995 and planted at Naliendele Agricultural Research Institute trial blocks. These hybrids were subjected to mass selection out of which 29 elite cashew hybrids were picked for further evaluation. The elite hybrids were evaluated at Chambezi Research Substation in Bagamoyo, which is one of the major cashew growing districts in the coastal region, to find out if they were suitable in the area. Most hybrids gave higher yield compared to the control variety AC4. Apart from higher yields, 10 hybrids demonstrated higher nut quality and hence were recommended for commercialisation in Bagamoyo and other areas with similar climatic conditions, in Tanzania.

Key words: cashew, tree, hybrid, yield, nut quality

Introduction

Cashew (Anacardium occidental Linn) is a tree crop that has gained substantial economic importance in many tropical countries, including Tanzania. However, the biggest problem in cashew production in Africa is lack of improved cashew varieties (Mole, 2000). This is due to the fact that the majority of the trees in farmers’ fields have been raised from unselected seeds. Ohler (1979) citing Lefèbvre (1971), in Madagascar, found remarkable variations among trees established by seed from a single tree. Even where high yielding mother trees were identified, it was not possible to multiply them because vegetative propagation techniques were not in place until late 1980s (Shrestha, 1989). Several attempts were made in many countries to establish cashew genetic trials but little achievements were attained due to inconsistent funding as well as lack of qualified personnel (Masawe and Kapinga, 2010a). In mid 1990s, the Government of Tanzania introduced cashew export levy to support the industry, including cashew research. This enabled cashew research to establish several genetic trials, which led to release of 16 cashew varieties (Masawe, 2006). Parallel to genetic trials, hybridisation by hand pollination was initiated and the first cashew hybrids were developed in Tanzania in 1991 (Masawe, 1994).


Breeding

The second and third batches of cashew hybrids were produced in 1994 and 1995. Evaluation of these hybrids was carried out for 10 years at Naliendele Agricultural Research Institute from 1992 to 2002, from which 29 elite hybrids were selected for further evaluation in an advanced cashew trial. The objective of this trial was to find out if the selected hybrids would perform well in terms of yield and nut quality attributes under condition of Chambezi, Bagamoyo.

Bagamoyo District lies between 370 and 390 Longitude and between 600 and 700

Latitude (District Profile, 2006, 2009). The district has seasonal average temperatures ranging from 130 C to 300 C and humidity as high as 98% (EPMS, 2006). Rainfall ranges between 800 - 1200 mm per annum. The short rains (vuli) season starts from October to December while the long rains (masika) season starts from March to May (District Profile, 2006; Andrew, 2009; Mushi, 2009). The driest months are June to September when monthly rainfall is generally less than 50 mm per month. Dominant soil types include sand, loam, sandy-loam and clay (District profile, 2006).

Materials and methods

Twenty-nine high yielding elite cashew hybrids with good nut quality were selected from hybrids developed by hand cross-pollination that was done in 1991, 1994 and 1995. These hybrids were vegetatively propagated at Naliendele Agricultural Research Institute cashew nursery in October 2004. Grafted seedlings were transported to Chambezi research substation in Bagamoyo (Coast Region) for trial establishment in March 2005. A high yielding cashew variety (AC4) was used as control bringing the total number of entries to 30. The list of selected cashew hybrids and their performance during selection are shown in Table 1a, Table 1b and Table 1c.

The trial layout was a randomised complete block design with three replicates. The spacing used was 12 m between rows, 12 m within rows, and the plot size was four trees. Formative pruning was carried out to form the desirable umbrella shaped tree canopy to enable easy nut collection underneath the trees as well as to allow tractor and other machinery to operate in the farm. Gap filling was undertaken in the second year to maintain optimum plant population. The powdery mildew disease was controlled using a water-based fungicide (Triadimenol) at a rate of 15 mls/litre (spayed three times at an interval of 21 days). Insect pests were controlled using insecticide Lambada cynhalothrin at a rate of 5 mls/litre applied when symptoms of attack were noted. The yield and nut quality were recorded on a tree basis. Analysis of variance was carried out using GenStat statistical analysis package, and Duncan’s multiple range test was used to rank means.


Breeding

Tabl

e 1a

: Yie

ld (k

g) a

nd n

ut q

ualit

y pa

ram

eter

s of t

en se

lect

ed h

ybri

ds d

evel

oped

in 1

991

at N

alie

ndel

e

S/N

Nam

e at

mas

s se

lect

ion

Tree

N

o

Entr

y na

me

of

hybr

id

Yiel

d (K

g)N

utw

t (g

)K

ernw

t (g

)O

T%

1994

(a

ge 3

yr

s)

1995

(a

ge 4

yr

s)

1996

(a

ge 5

yr

s)

1997

(a

ge 6

yr

s)

1998

(a

ge 7

yr

s)

1999

(a

ge 8

yr

s)

2000

(a

ge 9

yr

s)

2001

(a

ge 1

0 yr

s)

2002

(a

ge 1

1 yr

s)

1T

1956

.24

H19

1.02

4.15

7.20

10.6

317

.73

13.9

824

.53

25.1

421

.64

10.4

02.

9027

.88

2T

18.

2H

1 0.

681.

959.

0314

.97

22.2

019

.33

28.5

236

.18

29.0

48.

902.

8031

.46

3T

2844

.07

H28

0.81

2.36

7.58

11.9

116

.85

15.9

626

.63

28.4

315

.75

8.70

2.60

29.8

9

4T

1454

.09

H14

0.

323.

243.

3514

.88

17.6

918

.22

32.3

428

.12

27.1

18.

702.

4027

.59

5T

1556

.05

H15

3.66

5.45

6.71

4.42

14.1

312

.35

28.0

225

.55

25.3

68.

502.

5029

.41

6T

1754

.05

H17

1.66

1.89

0.66

4.96

17.1

07.

4829

.88

38.8

429

.81

8.00

2.10

26.2

5

7T

2722

.05

H27

1.90

5.26

6.04

10.0

218

.47

16.8

022

.50

18.7

720

.20

7.80

2.20

28.2

1

8T

1148

.2H

110.

522.

148.

146.

9919

.90

13.2

821

.67

32.5

726

.61

7.70

2.30

29.8

7

9T

354

.28

H3

0.41

3.49

7.60

10.5

016

.84

13.0

126

.01

21.9

222

.07

7.40

2.40

32.4

3

10T

2952

.18

H29

1.39

2.55

5.93

9.70

24.8

420

.32

26.6

913

.21

29.6

96.

902.

1030

.43

Key

:Yr

s =Ye

ar o

f dat

a re

cord

Nut

Wt =

Nut

wei

ght (

g)K

ernW

t = K

erne

l wei

ght (

g)%

OT

=Per

cent

age

kern

el o

uttu

rn (s

hell/

kern

el ra

tio)

Sour

ce: A

nnua

l Cas

hew

Res

earc

h Re

port

200

2


Breeding

Table 1b: Yield (kg) and nut quality parameters of six selected hybrids from hybrids developed

in 1994 at Naliendele

S/N

Name at mass selec-tion

Tree No

Entry name of hy-brids

Yield (kg)Nut-wt (g)

Kern-wt (g) OT%1998

(age 4yrs)

1999 (age 5yrs)

2000 (age 6yrs)

2001 (age 7yrs)

2002 (age 8yrs)

1 T16 4.17 H16 2.52 9.61 11.42 11.17 15.30 9.40 2.70 28.722 T25 10.6 H25 0.98 6.68 10.03 13.67 9.99 8.80 3.00 34.093 T22 4.11 H22 1.14 5.49 11.70 12.59 11.54 7.70 2.10 27.274 T12 9.12 H12 0.89 7.12 10.10 9.14 7.75 7.60 2.30 30.265 T2 3.16 H2 0.52 5.69 8.37 8.48 8.39 7.50 2.40 32.006 T5 3.11 H5 0.06 6.82 13.31 19.05 13.02 7.50 2.30 30.67

Key:NutWt = Nut weight (g)KernWt = Kernel weight (g)%OT = Percentage kernel outturn (shell/kernel ratio)Source: Annual Cashew Research Report 2002

Table 1c: Yield (kg) and nut quality parameters of 13 selected hybrids developed in 1995 at

Naliendele

S/N

Name at mass selec-tion

Tree No

Entry name of hybrid

Yield (kg)Nut-Wt (g)

Kern-Wt (g)

OT%1998 (age 2yrs)

1999 (age 3yrs)

2000 (4yrs)

2001 (age 5yrs)

2002 (age 6yrs)

1 T13 7.4 H13 1.58 8.68 11.86 35.56 21.30 8.70 2.50 28.742 T4 8.8 H4 0.00 3.93 6.30 10.38 8.45 8.70 2.70 31.033 T6 16.1 H6 0.92 5.45 7.21 17.42 12.06 8.60 2.50 29.074 T30 15.1 H30 0.00 2.74 5.02 16.75 10.04 8.60 2.40 27.915 T9 3.12 H9 0.04 4.09 9.00 15.11 12.94 8.50 2.30 27.066 T23 11.12 H23 0.24 9.59 11.98 17.89 20.41 7.80 2.50 32.057 T24 15.2 H24 0.19 2.74 4.80 9.07 7.70 7.80 2.50 32.058 T21 4.12 H21 0.46 3.20 6.96 11.77 9.04 7.60 2.20 28.959 T10 8.4 H10 0.11 2.65 5.21 10.59 10.29 7.60 2.30 30.2610 T8 15.12 H8 0.19 5.13 6.59 16.88 8.62 7.50 2.30 30.6711 T18 2.4 H18 0.00 3.13 7.18 17.24 11.07 7.20 2.20 30.5612 T7 5.8 H7 0.00 7.43 13.31 43.27 41.84 7.10 2.00 28.1713 T26 2.1 H26 0.66 3.96 7.77 13.25 9.54 7.00 2.20 31.43

Key:NutWt = Nut weight (g)KernWt = Kernel weight (g)%OT=Percentage kernel outturn (shell/kernel ratio)


Breeding

Results and Discussion

The results of analysis of variance for yields (from year 2009 to 2014), nut weight, kernel weight and percentage out-turn are presented in Table 2a. It is clear that there were highly significant differences between hybrids in yield across years (except 2010), nut weight, kernel weight and percentage kernel out-turn at p<0.01 (Table 2a). This suggests that it is possible to identify hybrids that perform better than others. Replicates were not significantly different in all parameters studied. The interaction of Rep x Hybrids (like the hybrids) were highly significantly different in all parameters studied except the 2010 yield.

The coefficients of variation for yields decreased with age as observed in previous cashew genetic trials conducted in Tanzania (Masawe and Kapinga, 2010b; Masawe et al., 2010; Kasuga, 2010) and it recorded as low as 36% (for yield in year 2013) from 85.3% (for yield in year 2009) (Table 2a).

Table 2a: Analysis of variance for cashew yield and nut quality parameters of hybrids at Chambezi

Bagamoyo 2014

Source df

Mean squares

Y2009 Y2010 Y2011 Y2012 Y2013 Y2014 NutWt Kern-Wt %OT

Hybrids29 0.72* 22.24 13.64* 191.10* 130.32* 155.37* 4.30* 0.26*

20.75*

Rep 2 0.54 62.7 5.78 24.22 42.96 15.64 0.68 0.29 20.66RepxHy-brids 57 0.98* 22.29 16.54* 123.53* 138.67* 164.15* 4.48* 0.34* 17.97*Error 172 0.220 13.440 4.280 40.370 33.880 26.310 0.640 0.110 5.930Mean 0.55 4.88 2.58 13.82 16.15 13.64 8.45 2.42 28.72CV(%) 85.30 75.10 80.10 46.00 36.00 37.60 9.50 13.40 8.5

Source: Annual Cashew Research Report 2002*P ≤ 0.01

Y2009 = Yield (kg) in 2009

NutWt = Nut weight (g)

KernWt = Kernel weight (g)

%OT = Percentage kernel out-turn (ratio of kernel to nut)


Breeding

The coefficients of variation for yields appeared to be slightly higher but were still within range acceptable in cashew trials (Neto, 1992; Masawe et al., 2005). High coefficients of variation have also been reported by other authors (Kasuga, 2003; Uaciquete et al., 2010; Dadzie et al., 2014). The coefficients of variation for nut quality ranged from 8.5% (for percentage out-turn) to 13.40% (for kernel), which was very good.

When Duncan’s multiple range test was used to rank means for yield and nut quality, results were slightly variable; however, they provided clear indications of good performance of the hybrids. Ranking of yields over years showed control variety AC4 to rank 29th (0.26 kg), 28th (2.96 kg), 29th (0.81 kg), 29th (5.68 kg), 30th (10.22 kg) and 27th (9.30 kg) in years 2009, 2010, 2011, 2012, 2013 and 2014, respectively (Table 2b), which suggests that the majority of the hybrids were superior to control variety AC4. When looking at nut count per kilogramme, the data showed that control variety AC4 had nut count of 114 which was basically very good because processing factories accept nut count of equal or less that 200. This is due to the fact that nut count below 200 will not be easily processed due to its small size. Some hybrids like H8 and H29 produced 23.05 kg/tree and 22.18 kg/trees in 2013 and 2014, respectively without irrigation or fertiliser. Such high yields were also reported in India but the cashew trees studied were planted using manure and chemical fertiliser1. Information from Kerala Agricultural University in India2 showed that two new cashew hybrids released had yield of 13.65 kg/tree/year to 14.65 kg/tree/year; however, the age of the hybrids and the design of the trial were not mentioned. Nevertheless, these yields are similar to those of hybrids evaluated in this trial. Sethi et al. (2015) evaluating hybrids planted at a spacing of 4 m x 4 m in India also reported yields between 1.8 kg to 4.34 kg per tree at the age of 10 years. Hybridisation and selection experiment carried out in cashew to identify a compact or dwarf F1 hybrid suitable for high density planting system, reported the highest cumulative yield of three years to be 3.5 kg nuts per tree (Aneesa et al., 2011). According to Adeigbe et al. (2015), on-farm evaluation of cashew accessions introduced in Nigeria from different countries in 1980s led to release of genotypes yielding an average of 10 kg/tree or 1000 kg/ha. On ranking means for nut weight, the data revealed 10 hybrids, which had nuts with higher weight than the control variety AC4. When mean kernel weight and percentage kernel out-turn were ranked, the control variety AC4 ranked 10th (2.49 g) and 20th (28.35%) which further demonstrated the superiority of some hybrids against the control variety AC4.

When looking at nut count per kilogramme, the control variety AC4 had nut count of 114 nuts per kilogramme which was very good; however, 10 hybrids had nut count lower than the control, which again showed the potential of some of the hybrids. Twenty six hybrids gave yields higher than the control variety AC4.

1 http://agricoop.nic.in/imagedefault/horticulture/Cashewnut%20Cultivation.pdf2 http://old.kau.edu/kaunews/Cashewhybrid.htm#top


BreedingTa

ble

2b: R

anki

ng m

eans

for

yiel

d (k

g), n

ut w

eigh

t (g)

, ker

nel w

eigh

t (g)

and

per

cent

age

out-

turn

(OT

%) f

or e

lite

hybr

ids a

t Cha

mbe

zi

No

Hyb

rids

Yiel

d (k

g)N

utW

tK

ernW

t%

OT

Nut

s /kg

Y200

9Y2

010

Y201

1Y2

012

Y201

3Y2

014

1H

30.

46 c

-f(17

)6.

26 a

-e(5

)0.

96 e

-g(2

8)16

.33

a-d(

8)17

.38

b-g(

13)

10.3

6 g-

j(24)

9.46

a(1

)2.

62 a

(1)

27.8

9 c-

h(22

)10

6

2H

90.

38 d

-f(21

)2.

69 e

(30)

1.95

c-g

(22)

6.63

g-h

(28)

12.0

7 g-

i(26)

13.3

4 c-

j(16)

9.21

a-b

(2)

2.54

a-b

(8)

27.6

0 e-

i(24)

108

3H

270.

43 c

-f(19

)8.

09 a

(1)

1.94

c-g

(23)

15.4

0 a-

d(12

)15

.58

c-i(1

8)11

.69

e-j(1

9)9.

21 a

-b(3

)2.

58 a

(7)

28.0

8 c-

h(21

)10

8

4H

240.

82 b

-d(4

)4.

64 a

-e(1

9)2.

87 b

-e(1

2)12

.21

d-g(

24)

14.9

8 c-

i(19)

17.5

8 b-

c(4)

9.15

a-c

(4)

2.59

a(6

)28

.67

a-h(

19)

109

5H

281.

36 a

(1)

4.91

a-e

(14)

3.23

b-d

(9)

16.9

4 a-

d(7)

12.3

3 f-i

(25)

9.57

j(26

)9.

14 a

-c(5

)2.

47 a

-c(1

2)27

.11

f-i(2

6)10

9

6H

160.

38 d

-f(22

)3.

60 c

-e(2

4)2.

44 b

-g(1

6)12

.43

c-f(2

3)11

.94

g-i(2

8)8.

73 i-

j(29)

9.04

a-d

(6)

2.44

a-c

(15)

27.0

2 f-i

(27)

111

7H

150.

32 e

-f(27

)3.

30 c

-e(2

6)0.

55 g

(30)

5.30

h(3

0)10

.66

h-i(2

9)10

.69

f-j(2

3)8.

94 a

-e(7

)2.

36 a

-d(2

2)26

.44

h-i(2

9)11

2

8H

220.

55 b

-f(13

)5.

44 a

-e(1

0)2.

82 b

-f(13

)14

.44

b-e(

13)

14.3

4 d-

i(21)

15.2

5 b-

g(12

)8.

87 a

-f(8)

2.38

a-d

(19)

26.9

7 g-

i(28)

113

9H

140.

81 b

-d(5

)3.

15 d

-e(2

7)1.

97 c

-g(2

1)7.

48 f-

h(27

)13

.57

d-i(2

3)15

.46

b-f(1

1)8.

85 a

-f(9)

2.24

b-d

(26)

25.4

5 i(3

0)11

3

10H

80.

57 b

-f(12

)5.

49 a

-e(8

)3.

57 b

-c(6

)20

.73

a(1)

23.0

5 a(

1)19

.27

a-b(

3)8.

84 a

-f(10

)2.

61 a

(3)

29.7

0 a-

e(7)

113

11AC

40.

26 f(

29)

2.96

e(2

8)0.

81 f-

g(29

)5.

68 h

(29)

10.2

2 i(3

0)9.

30 h

-j(27

)8.

79 a

-g(1

1)2.

49 a

-c(1

0)28

.35

b-h(

20)

114

12H

300.

39 c

-f(20

)2.

82 e

(29)

3.75

a-c

(3)

13.4

2 c-

f(16)

12.0

5 g-

i(27)

12.2

7 d-

j(17)

8.78

a-g

(12)

2.60

a(4

)29

.84

a-e(

5)11

4

13H

190.

26 f(

28)

4.23

b-e

(22)

1.31

d-g

(27)

11.5

2 d-

g(25

)17

.69

a-g(

10)

11.6

4 e-

j(21)

8.66

b-h

(13)

2.61

a(2

)30

.20

a-c(

3)11

5

14H

110.

24 f(

30)

5.26

a-e

(12)

1.86

c-g

(24)

9.04

e-h

(26)

19.1

1 a-

e(6)

16.2

3 b-

e(8)

8.66

b-h

(14)

2.37

a-d

(20)

27.6

6 d-

i(23)

115

15H

210.

46 c

-f(16

)5.

77 a

-e(6

)2.

94 b

-e(1

1)12

.92

c-f(2

1)19

.39

a-d(

4)13

.70

c-i(1

4)8.

62 b

-h(1

5)2.

48 a

-c(1

1)28

.74

a-h(

18)

116

16H

260.

62 b

-f(10

)4.

29 b

-e(2

1)3.

19 b

-d(1

0)16

.11

a-d(

10)

20.2

6 a-

c(3)

19.8

9 a-

b(2)

8.48

b-i(

16)

2.50

a-c

(9)

29.6

1 a-

e(10

)11

8

17H

230.

86 b

-c(3

)4.

79 a

-e(1

5)3.

39 b

-c(8

)15

.51

a-d(

11)

17.4

8 a-

g(12

)13

.85

c-h(

13)

8.46

b-i(

17)

2.59

a(5

)30

.62

a-b(

2)11

8

18H

60.

78 b

-e(6

)7.

57 a

-b(2

)4.

16 a

-b(2

)13

.87

c-e(

15)

14.9

3 c-

-i(20

)16

.72

b-d(

7)8.

39 c

-j(18

)2.

39 a

-c(1

7)28

.87

a-g(

16)

119

19H

20.

58 b

-f(11

)4.

43 b

-e(2

0)2.

43 b

-g(1

7)20

.40

a-b(

2)17

.27

b-g(

14)

10.3

3 g-

j(25)

8.33

d-k

(19)

2.46

a-c

(13)

29.3

9 a-

f(12)

120

20H

250.

49 b

-f(14

)5.

38 a

-e(1

1)3.

41 b

-c(7

)13

.36

c-f(1

8)14

.20

d-i(2

2)11

.11

f-j(2

2)8.

23 e

-k(2

0)2.

44 a

-c(1

4)29

.68

a-e(

8)12

1

21H

130.

37 d

-f(23

)6.

68 a

-d(4

)5.

48 a

(1)

16.2

6 a-

d(9)

19.1

8 a-

e(5)

15.6

6 b-

f(9)

8.11

f-k(

21)

2.35

a-d

(23)

29.0

0 a-

g(15

)12

3

22H

170.

36 d

-f(25

)4.

74 a

-e(1

7)3.

62 b

-c(4

)18

.68

a-c(

3)18

.93

a-e(

7)17

.57

b-c(

5)8.

10 f-

k(22

)2.

41 a

-c(1

6)29

.65

a-e(

9)12

3

23H

40.

45 c

-f(18

)3.

39 c

-e(2

5)1.

82 c

-g(2

6)13

.22

c-f(1

9)13

.39

e-i(2

4)8.

52 j(

30)

8.02

g-k

(23)

2.21

c-d(

27)

27.4

5 e-

i(25)

125

24H

100.

48 c

-f(15

)6.

92 a

-c(3

)1.

99 c

-g(2

0)18

.65

a-c(

4)22

.55

a-b(

2)15

.51

b-f(1

0)7.

97 h

-k(2

4)2.

38 a

-d(1

8)29

.84

a-e(

6)12

5

25H

290.

62 b

-f(9)

5.15

a-e

(13)

2.07

c-g

(19)

13.3

8 c-

f(17)

18.3

5 a-

e(8)

22.1

8 a(

1)7.

81 i-

k(25

)2.

35 a

-d(2

4)30

.07

a-d(

4)12

8

26H

10.

68 b

-f(7)

4.68

a-e

(18)

2.54

b-g

(15)

12.7

6 c-

f(22)

18.0

0 a-

f(9)

13.6

7 c-

i(15)

7.64

j-l(2

6)2.

20 c

-d(2

8)29

.01

a-g(

14)

131

27H

180.

36 d

-f(26

)4.

75 a

-e(1

6)2.

75 b

-f(14

)17

.20

a-d(

6)15

.83

c-i(1

7)9.

04 h

-j(28

)7.

61 k

-l(27

)2.

19 c

-d(2

9)28

.75

a-h(

17)

131

28H

50.

95 b

(2)

5.66

a-e

(7)

3.61

b-c

(5)

14.1

4 c-

e(14

)17

.65

a-g(

11)

16.7

8 b-

d(6)

7.59

k-l(

28)

2.37

a-d

(21)

31.0

1 a(

1)13

2

29H

70.

36 d

-f(24

)5.

46 a

-e(9

)1.

84 c

-g(2

5)17

.38

a-d(

5)16

.37

c-h(

15)

11.7

1 e-

j(18)

7.59

k-l(

29)

2.25

b-d

(25)

29.5

6 a-

e(11

)13

2

30H

120.

67 b

-f(8)

4.01

b-e

(23)

2.18

b-g

(18)

13.1

3 c-

f(20)

15.8

4 c-

i(16)

11.6

5 e-

j(20)

7.08

l(30

)2.

07 d

(30)

29.2

3 a-

g(13

)14

1

Mea

ns w

ith th

e sa

me

lette

r(s)

in th

e sa

me

colu

mn

are

not s

igni

fican

tly d

iffer

ent f

ollo

win

g D

unca

n’s M

ultip

le R

ange

Tes

t (P

≤ 0.

05).

Num

bers

with

in p

aren

thes

es fo

llow

ing

the

lette

r(s)

stan

d fo

r ran

k.Y2

009

= Yi

eld

(kg)

in 2

009

Nut

Wt =

Nut

wei

ght (

g)

Ker

nWt =

Ker

nel w

eigh

t (g)

%O

T =

Per

cent

age

kern

el o

ut-tu

rnN

uts/

kg =

num

ber o

f nut

s per

kg


Breeding

Conclusion and recommendations

Overall, 26 hybrids gave yields higher than AC4, 10 hybrids had nuts with weight higher than AC4 and more importantly they also had nut count lower than the control variety. It can be concluded that hybrids H3, H9, H27, H24, H28, H16, H15, H22, H14 and H8 which demonstrated to be high yielding with good nut quality compared to control variety AC4 can be recommended for commercialisation particularly in areas with similar climatic conditions like Chambezi Bagamoyo in the Coast Region. The same hybrids can further be used in hybridisation programmes to improve cashew genetic base, in Tanzania.

Acknowledgements

The authors would like to acknowledge funding from the Government of Tanzania through the Ministry of Agriculture, Food Security and Co-operatives, Cashew Research Steering Committee for approving the study, Cashewnut Board of Tanzania and Cashew Industry Development Trust Fund for ensuring funds were timely available. They are also very grateful to Ms Stela Mfune, Messrs Dadili Majune, Khalifa Issa Khasan, Ben Mpangala and Said Mpesi for taking lead in data collection, compilation and computerisation. Many thanks go to Messrs Cuthbert Mtikire, Joseph Komba and George Lucas for their invaluable contribution in maintaining trials and supervision of data recording. We will not be doing justice if we do not appreciate the contribution of our drivers Messrs Twalib Mmole and Hashim Mchotike who played a substantial role in facilitating data collection.

References

Adeigbe, O. O, Olasupo, F. O., Adewale, B. D., and A. A. Muyiwa (2015). A review on cashew research and production in Nigeria in the last four decades. Scientific Research and Essays, 10, 196-209, 15 March, 2015 DOI: 10.5897/SRE2014.5953.

Aneesa, R. M. S., Kumar, N., and R. Marimuthu (2011). Evolving cashew F1 hybrids suitable for high density planting system. Indian Journal of Horticulture, 68, 152-155.

Andrew, B. (2009).The role of indigenous knowledge in adaptation to climate change and variability: The case of Bagamoyo District. MSc. Dissertation, University of Dar es Salaam.

EPMS (2006). Adaptation to climate change through shifting of shallow water wells affected by inundation on the coast regions - Bagamoyo. South-North Adaptation Team, Dar es Salaam.

Dadzie, A. P., Adu-Gyamfi, S., Opoku, J., Yeboah, A., Akpertey, K., Opoku-Ameyaw, M., Assuah, E., Gyedu-Akoto, W., and Danquah (2014). Evaluation of potential cashew clones for utilisation in Ghana. Advances in Biological Chemistry, 4, 232-239.

District profile (2006 & 2009). The Bagamoyo District Profile for year 2006 and 2009. Bagamoyo District, Tanzania.

Kasuga, L. J. F. (2003). Adoption of improved cashew (Anacardium occidentale L.) by smallholder farmers in south-eastern Tanzania. PhD Thesis, University of Reading, UK.


Breeding

Kasuga, L. J. F. (2010). Performance of selected cashew varieties (Anacardium occidentale L.) in the polyclonal seed orchards in south-eastern Tanzania. In Masawe, P.A.L., Esegu, J. F. O., Kasuga, L. J. F., Mneney, E. E., and D. Mujuni (Eds). Proceedings of the Second International Cashew Conference, Kampala, Uganda, 26–29 April 2010. CAB International, Wallingford, UK 83-88.

Lefèbvre, A. (1971). Multiplication végétative de I’acacardier Le greffage de bouregoeon terminal (tip grafting). Fruits, 26, 859-863.

Masawe, P. A. L. (2006). Tanzanian cashew cultivars - Selected clones (1st ed.). Dar es Salaam: Colour Print (T) Ltd.

Masawe, P. A. L. (1994). Aspects of breeding and selecting improved cashew genotypes (Anacardium Occidentale Linn). PhD Thesis, University of Reading.

Masawe, P. A. L., and F. A. Kapinga (2010a). Review of research and development activities on cashew in eastern and southern Africa. In Masawe, P. A. L., Esegu, J. F. O., Kasuga, L. J. F., Mneney, E. E., and D. Mujuni (Eds). Proceedings of the Second International Cashew Conference, Kampala, Uganda, 26–29 April 2010. CAB International, Wallingford, UK 133-139.

Masawe, P. A. L., and F. A. Kapinga (2010b). Preliminary observations on the performance of selected elite cashew hybrids at Nachingwea, southern Tanzania. In Masawe, P. A. L., Esegu, J. F .O., Kasuga, L. J. F., Mneney, E. E., and D. Mujuni (Eds). Proceedings of the Second International Cashew Conference, Kampala, Uganda, 26–29 April 2010. CAB International, Wallingford, UK, 15-19.

Masawe, P. A. L., Kapinga, F. A., and P. D. S. Caligari (2010). Variation in the period of nut harvesting among cashew trees in southern Tanzania. In Masawe, P. A. L., Esegu, J. F. O., Kasuga, L. J. F., Mneney, E. E., and D. Mujuni (Eds). Proceedings of the Second International Cashew Conference, Kampala, Uganda, 26–29 April 2010. CAB International, Wallingford, UK 20-26.

Masawe, P. A. L., Nfune, S., and Z. Mbunda (2005). Performance of cashew hybrids developed from partial diallel crossing between selected clones in Tanzania. Tanzania Research and Training Newsletter, 205-8.

Mole, P. N. (2000). An economic analysis of smallholder cashew development opportunities and linkages to food security in Mozambique’s northern province of Nampula. A PhD dissertation submitted to Michigan State University, Department of Agricultural Economics.

Mushi, R. S, (2009). Climate change and its impacts on the coastal tourism in Bagamoyo District. MSc. Dissertation, University of Dar es Salaam.

Neto, V. (1992). Yield variability of cashew trees in East Africa. PhD Thesis, University of Reading, UK.

Ohler, J. G. (1979). Cashew. Communication No. 71. Department of Agricultural Research, Royal Tropical Institute. Amsterdam, Holland.

Sethi, K., Lenka, P. C., and S. K. Tripthy (2015). Evaluation of cashew (Anacardium occidentale L.)


Breeding

hybrids for vegetative parameters and nut yield. Journal Crop and Weed, 11,152-156.

Shrestha, A. B. (1989). Cashew propagation in Tanzania. Tanzania Research and Training Newsletter, 4, 16-19.

Uaciquete, A., Korsten, L., and J.van der Waals (2010). Leaf and fruit disease of cashew (Anacardium occidentale L) in Mozambique. In Masawe, P. A. L., Esegu, J. F.O., Kasuga, L. J. F., Mneney, E. E., and D. Mujuni (Eds). Proceedings of the Second International Cashew Conference, Kampala, Uganda, 26–29 April 2010. CAB International, Wallingford, UK 61-67.


Breeding

The Performance of 25 Brazilian Dwarf Cashew Clones under Conditions of Nachingwea in

Southern Tanzania

P.A.L. Masawe*, F.A. Kapinga, J. Madeni and Z.S. Ngamba

Cashew Research Programme, Naliendele Agricultural Research Institute P.O. Box 509 Mtwara Tanzania


Abstract

Halfsib progenies of commercial Brazilian dwarf imported in Tanzania in 1992 and 1996 were planted in two separate trial blocks. The first trial was planted at Naliendele Agricultural Research Institute, Mtwara while the second was established at Nachigwea Research Substation located in Lindi Region, southern Tanzania. Mass selection was undertaken in each block of which a total of 25 elite dwarf progenies were selected for advanced trial. The advanced trial was established at Nachingwea in 2004 using commercial cashew variety AC4 as a control. Data was collected for a period of ten years which led into selection of 13 elite clones as improved planting materials for distribution to farmers and also for future use in cashew hybridisation programmes.

Key words: cashew, dwarf, progenies, halfsib, yield

Introduction

The cashew (Anacardium occidentale Linn) is an evergreen tropical tree, with its centre of origin in South and Central America. It was reported by Ohler (1979) that cashew was introduced in East Africa by the Portuguese explorers in 16th century. Since it was not brought as a crop, it is possible that the cashew seeds introduced were unselected. It is therefore likely that a large number of the local cashew trees are from self-multiplication of these seeds originating from a narrow genetic base. This is probably one of the reasons why the majority of the cashew trees in farmers’ fields across Africa have low yields, poor nut quality and appear to be susceptible to many diseases and insect pests. Production from the traditional trees is about 250 kg/ha, compared to over one tone per hectare for the dwarf varieties in Brazil (FAOSTAT, 2011). Average yields of local cashew trees in Africa are around 200 – 300 kg/ha. According to Agriculture Nigeria online hub the world’s average yield is 780 kg/ha1 (however, Nigeria’s average yields range between 200kg and 400 kg/ha).

The average cashew yields in farmers’ fields in Tanzania is about 800 kg/ha (CBT Personal communications) compared to higher yields of 1,225.7 kg/ha reported in Brazil (Rodrigues de Paiva et al., 2008). This calls for the need to introduce more cashew genotypes (Masawe, 2009) that will not only increase the cashew germplasm bank for crop improvement but also provide farmers and investors

1


Breeding

with improved planting materials. The aim of introducing more cashew genotypes was to expand the genetic diversity of cashew in Tanzania, which was reported to be restricted (Masawe, 1990); a fact later confirmed with molecular markers (Mneney et al., 2011; Croxford, 2005). Introducing dwarf cashew is important due to its short stature that is well suited for modern cultivation systems (Cavalcanti et al., 2007).

Cashew breeding programmes typically comprise four stages: plant introduction, progeny testing, individual selection and hybridisation (Barros et al., 2002). In order to improve the cashew gene bank in Tanzania, seeds of four commercial Brazilian dwarfs were imported in the country in two batches. The first batch was introduced in1992 (Anonymous, 1993) and the second one in 1996 (Anonymous, 1997). The seeds were planted at Naliendele Agricultural Research Institute (NARI) trial block in 1993 and at Nachingwea in 1996. Yields and nut quality attributes (nut weight, kernel weight and percentage out-turn) were recorded on individual tree basis for four years, in Nachingwea and five years at NARI. Mass selection was undertaken at both sites and 25 high yielding individual half-sib dwarf progenies were selected. These elite progenies were vegetatively propagated and planted in a replicated trial. The main objective was to identify superior dwarf cashew clones, which were suitable under conditions of Nachingwea.


The planting of the half-sib progenies of the Brazilian dwarf of commercial clones (CCP95, CCP09, CCP1001, CCP76) was carried out at NARI trial block located in Mtwara, in 1996. The soils at Mtwara are sandy-to-sandy loam and soil fertility is slightly low. Rainfall is of the mono-modal type, with annual rainfall of about 1083 mm (Table 5) falling in a single 5 - 6 months (December - April). The average high temperatures range from 29-31oC while the average low temperatures range from 19 - 23oC (Table 5). The second batch of the half-sib progenies of the Brazilian dwarf of commercial clones (CP06, CP09 and CP1001) were planted at Nachingwea in 1993. The evaluation of the dwarf clones selected from both trials took place at Nachingwea where the soil fertility is likely to be much higher than in Mtwara. However, the site had been planted with annual crops for years, which likely depleted its fertility. Rainfall at Nachingwea is also mono-modal, and the annual rainfall is 877 mm (Table 6), which is very low compared to Mtwara. Generally, cashew trees grow better and produce bigger nuts where rains are high (Anonymous, 2012). The average high temperatures range from 29-33oC while the average low temperatures range from 16 - 22oC (Table 6).

Twenty-five high yielding half sib progenies of Brazilian dwarfs were selected from two different collections described above. Sixteen of them were selected from a collection made in 1996 at NARI (Table 1), while nine were from a collection made in 1993 at Nachingwea (Table 2). These high yielding elite dwarf cashew progenies were reproduced by vegetative propagation (tip grafting) in October 2004 at NARI. Seeds from a semi-dwarf cashew variety AZA2 were used to raise the rootstalk. The grafted seedlings were transported to Nachingwea substation (Lindi Region) for transplanting, which took place in January 2005. The experimental layout was a randomised complete block design,


Breeding

three replicates and four trees per plot. The spacing used was 12 m between rows and 12 m within rows. A single guard row of grafted cashew clones (left-overs) was planted on the periphery of the trial. A high yielding commercial cashew variety AC4 (also grafted) was used as control. The total number of entries including control variety was 26. For the purpose of proper interpretation, the entry materials were named “Clone” indicating that they were not originating from seeds. The clones (Brazilian halfsib progenies) were given codes from B1 to B25, while the control variety remained to be AC4. Control of diseases and insect pests was carried out as recommended by Boma et al. (1997), Topper et al. (1997), Sijaona (2013) at the early stages of the tree development to allow proper growth of the trees. There was no irrigation or use of fertilisers during the years of observations. However, harrowing, weeding, heavy and light pruning were carried out as recommended.

Data on yield (from 2009 to 2014) and nut quality (nut weight, kernel weight and percentage kernel out-turn) was recorded annually, on a tree basis (Masawe et al., 2013). However, data on nut quality, which was used in the analysis, had been collected in 2014, at NARI. The analysis of variance was carried out using the GenStat statistical analysis package, while Duncan’s multiple range test was used to rank the means.


Breeding

Tabl

e 1:

Yie

ld a

nd n

ut q

ualit

y pa

ram

eter

s of B

razi

lian

dwar

f hal

f-si

b pr

ogen

ies s

elec

ted

from

Nal

iend

ele

tria

l blo

ck in

199

6

S/N

oH

alf

-sib

pr

ogen

yT

re

e N

oLo

catio

nN

ame

of

Clo

ne

Yiel

d (k

g)W

eigh

t (g)

)O

T%

1999

(Age

3 y

rs)

2000

(Age

4 y

rs)

2001

(Age

5 y

rs)

2002

(Age

6 y

rs20

03(A

ge 7

yrs

)N

utK

erne

l

1C

CP9

511

.13

Nal

iend

ele

B16

0.18

1.19

2.01

2.08

4.37

11.9

03.

2627

.39

2C

CP9

511

.12

Nal

iend

ele

B14

0.06

3.91

7.27

7.46

12.1

111

.63

3.21

27.6

03

CC

P09

10.8

Nal

iend

ele

B20.

354.

005.

186.

149.

2211

.63

3.22

27.6

94

CC

P09

9.3

Nal

iend

ele

B24

0.58

3.29

3.83

4.68

6.16

11.6

33.

0926

.57

5C

CP9

511

.16

Nal

iend

ele

B25

0.00

0.29

1.39

2.78

2.24

11.1

12.

9826

.82

6C

CP0

99.

12N

alie

ndel

eB6

0.66

4.38

5.62

6.99

10.9

611

.11

3.24

29.1

67

CC

P95

13.6

Nal

iend

ele

B30.

604.

687.

427.

108.

8910

.87

2.91

26.7

78

CC

P95

11.1

1N

alie

ndel

eB4

0.00

1.69

0.92

1.96

3.44

10.6

43.

0028

.20

9C

CP1

001

2.12

Nal

iend

ele

B10

0.00

5.04

8.12

15.7

713

.04

10.4

23.

0028

.79

10C

CP9

511

.3N

alie

ndel

eB1

10.

001.

173.

462.

381.

8210

.20

2.60

25.4

911

CC

P76

3.16

Nal

iend

ele

B82.

257.

838.

7810

.03

16.3

110

.20

2.90

28.4

312

CC

P76

14.9

Nal

iend

ele

B15

0.73

2.62

1.71

2.68

3.25

10.2

02.

6726

.18

13C

CP0

99.

15N

alie

ndel

eB1

20.

231.

182.

872.

134.

2010

.20

2.96

29.0

214

CC

P09

10.6

Nal

iend

ele

B21

0.20

2.93

3.96

3.29

4.40

10.2

02.

9428

.82

15C

CP0

910

.5N

alie

ndel

eB9

0.04

5.31

4.27

10.6

211

.12

10.2

02.

9028

.43

16C

CP7

612

.4N

alie

ndel

eB5

0.68

4.78

4.36

4.22

4.33

10.0

02.

8928

.90

Key

: O

T%

=Per

cent

age

kern

el o

ut-tu

rn

kg=k

ilogr

amm

e

g=gr

amSo

urce

: Ano

nym

ous 2

003


Breeding

Tabl

e 2:

Yie

ld a

nd n

ut q

ualit

y pa

ram

eter

s of B

razi

lian

dwar

f hal

f-si

b pr

ogen

ies s

elec

ted

from

Nac

hing

wea

tria

l blo

ckin

199

3

S/N

oH

alf

-sib

pr

ogen

yT

re

e N

oLo

catio

nC

lon

al

En

try

nam

e

Yiel

d (k

g)W

eigh

t (g)

OT

%19

98(A

ge 5

yrs

)19

99 (A

ge 6

yrs

) 20

00(A

ge 7

yrs

) 20

01(A

ge 8

yrs

)N

utK

erne

l

1 C

P09

7.4

Nac

hing

wea

B19

7.0

6 1

0.28

12.

58 1

1.64

10.

64 3

.30

31.

04

2 C

P06

8.1

6N

achi

ngw

ea B

1 4

.00

3.4

2 6

.32

10.

80 8

.62

2.4

4 2

8.26

3 C

P09

4.6

Nac

hing

wea

B22

3.0

8 4

.22

4.2

2 1

0.90

8.0

6 2

.27

28.

11

4 C

P09

11.

17N

achi

ngw

eaB2

3 2

.72

3.9

8 4

.34

4.8

4 8

.06

2.1

6 2

6.8

5 C

P100

1 1

6.7

Nac

hing

wea

B20

11.

02 1

2.92

9.4

6 1

1.64

7.8

3 2

.10

26.

86

6 C

P09

4.1

5N

achi

ngw

ea B

18 6

.60

6.4

6 4

.72

5.4

2 7

.65

2.2

1 2

8.86

7 C

P100

1 1

4.7

Nac

hing

wea

B13

6.1

4 1

2.98

8.1

8 1

4.14

7.3

3 2

.00

27.

27

8 C

P100

1 2

.3N

achi

ngw

ea B

7 6

.58

2.5

2 4

.30

4.7

4 7

.14

2.1

0 2

9.42

9 C

P09

10.

9N

achi

ngw

ea B

17 4

.22

6.4

2 4

.77

4.3

8 7

.13

3.1

4 4

4.02

Key

: O

T%

=Per

cent

age

kern

el o

ut-tu

rnkg

=kilo

gram

me

g=

gram

Sour

ce: A

nony

mou

s 200

1


Breeding

Results

Analyses of variance for yields and nut quality attributes (nut weight, kernel weight and percentage kernel out turn) are presented in Table 3. There were highly significant differences (p <0.01) between clones in yields across years, nut weight and kernel weight and percentage kernel out turn. Also, replicates were significantly different in all parameters studied except yield in year 2011, 2012, nut weight, kernel weight and percentage out-turn. The interaction of replicate x clones was highly significantly different in all parameters studied except kernel weight (Table 3). Generally, there was an increasing trend in trial mean yields from year to year except in 2014 when low yields were recorded compared to the previous year due to an outbreak of mealy bugs observed in the field during fruiting (Table 3). The coefficient of variation for yields ranged from 23% (Y2014) to 53.4% (Y2010). Such higher CVs in cashew have also been reported by other authors (Neto et al,. 1992; Neto and Caliagri, 1997; Neto, 1992; Mead and Martin, 1992; Nair and Prabhakaran, 1983; Dadzie et al., 2014). The Duncan multiple range test on yields from 2009 to 2014 revealed that the control variety AC4 gave the lowest yields compared to most clones as it ranked 22nd, 26th, 25th, 26th, 26th and 26th in years 2009, 2010, 2011, 2012, 2013 and 2014, respectively (Table 4).

When ranking means for nut weight, which was considered as second criteria for selecting the clones in this trial, the data demonstrated that 16 clones (B3, B16, B25, B15, B7, B11, B5, B17, B9, B4, B2, B13, B10, B23, B20 and B12) had nut weight higher than the control variety AC4 (Table 4). On ranking means for kernel weight, the control variety AC4 ranked 13th. The control variety ranked last (26th) in percentage kernel out-turn (24.36%) which further demonstrated the superiority of the clones under observation.

Table 3: Analysis of variance for yields, nut quality parameters of 25 selected clones at Nachingwea

Source df

Yield (kg) Weight (g) %OT

Y2009 Y2010 Y2011 Y2012 Y2013 Y2014 NutWt KernWt

Rep 210.929* 29.308* 9.543 28.742 54.310* 91.005* 1.0545 0.0191 0.943

Clone 2514.356* 12.763* 29.395* 69.621* 33.164* 97.645* 32.1901* 2.6623* 49.668*

RepxClone 49 3.485* 16.574* 8.074* 15.479* 19.269* 19.854* 1.5202* 0.1858 12.315*

Error 1.892 3.638 3.355 7.996 6.427 5.532* 0.708 0.131 5.624

Mean 2.72 3.57 4.03 8.25 10.00 10.2 8.65 2.46 27.19

CV(%) 50.5 53.4 45.4 34.3 25.3 23 9.7 14.7 8.7

*P ≤0.01

Y2009= Yield (kg) in 2009NutWt = Nut weight (g), KernWt = Kernel weight (g), %OT = Percentage kernel out-turn


Breeding

Tabl

e 4:

Ran

king

mea

ns fo

r yi

elds

and

nut

qua

lity

para

met

ers o

f 25

clon

es a

t Nac

hing

wea

No

Clo

ne

Yiel

d (k

g)W

eigh

t (g)

%O

TY2

009

5 yr

sY2

010

6 yr

sY2

011

7 yr

sY2

012

8 yr

sY2

013

9yrs

Y201

410

yrs

Nut

Wt

Ker

nWt

1B3

2.45

e-j(1

4)3.

84b-

f(12)

3.66

c-e(

14)

9.57

b-f(8

)10

.72b

-e(1

0)10

.23e

-i(13

)11

.32a

(1)

2.87

b-c(

3)25

.89e

-i(18

)

2B1

62.

30f-j

(15)

3.29

b-f(1

5)3.

48d-

e(18

)6.

78g-

i(21)

7.77

g-h(

23)

9.77

g-j(1

5)11

.25b

(2)

2.78

b-e(

7)25

.36g

-i(21

)

3B2

52.

68d-

i(12)

3.09

c-f(1

7)4.

47b-

d(13

)8.

04d-

i(13)

11.0

8a-d

(9)

12.1

6c-f(

8)10

.48c

(3)

2.75

b-f(9

)25

.76f

-i(19

)

4B1

52.

99d-

g(9)

4.37

a-d(

6)3.

58d-

e(16

)8.

07d-

i(12)

11.3

9a-d

(6)

8.19

h-l(1

8)10

.39c

-d(4

)2.

82b-

c(5)

25.3

6g-i(

22)

5B7

3.48

b-f(7

)2.

85d-

g(20

)5.

34a-

c(8)

10.7

7a-c

(5)

10.4

8c-f(

11)

12.9

4b-d

(5)

10.3

3c-d

(5)

2.63

c-f(1

2)25

.32g

-i(23

)

6B1

13.

39c-

f(8)

4.46

a-d(

4)5.

58a-

b(4)

12.0

4a-b

(2)

11.4

a-d(

5)8.

66h-

k(16

)10

.03c

-e(6

)2.

76b-

f(8)

27.0

4d-h

(12)

7B5

1.29

j(25)

4.40

a-d(

5)2.

65e-

f(19)

6.39

h-i(2

2)10

.08c

-g(1

4)6.

66k-

l(24)

9.69

d-f(7

)2.

45e-

g(16

)25

.92e

-i(17

)

8B1

72.

21f-j

(16)

4.13

b-e(

10)

2.03

e-f(2

4)6.

05i(2

3)11

.11a

-d(7

)6.

73k-

l(23)

9.67

d-f(8

)2.

56c-

g(14

)24

.76h

i(25)

9B9

3.75

a-e(

6)4.

22b-

e(7)

5.44

a-b(

7)11

.05a

-c(4

)11

.57a

-c(4

)11

.65d

-g(9

)9.

66c-

f(9)

2.82

b-d(

6)27

.89d

-f(9)

10B4

3.88

a-d(

5)4.

81a-

c(3)

6.21

a-b(

2)12

.75a

(1)

9.57

c-h(

15)

14.2

1b-c

(3)

9.49

e-g(

10)

2.47

d-g(

15)

24.8

0h-i(

24)

11B2

1.98

g-j(1

8)3.

38b-

f(14)

2.60

e-f(2

0)7.

18e-

i(16)

9.37

c-h(

17)

6.21

l(25)

9.05

f-h(1

1)2.

75b-

f(10)

26.7

7d-h

(13)

12B1

31.

95g-

j(20)

2.17

f-g(2

5)1.

73f(2

5)5.

36i(2

5)11

.09a

-d(8

)7.

02k-

l(22)

9.02

f-h(1

2)2.

86b-

c(4)

30.7

8a-b

(3)

13B1

02.

88d-

h(10

)4.

17b-

e(8)

4.66

b-d(

11)

7.44

e-i(1

5)9.

32c-

h(18

)12

.94c

-d(4

)8.

80g-

h(13

)3.

53a(

1)28

.81b

-d(5

)

14B2

34.

873a

(1)

2.92

d-g(

19)

5.48

a-b(

5)9.

45b-

g(9)

13.0

5a-b

(2)

10.0

4f-i(

14)

8.73

h(14

)2.

41f-g

(17)

26.7

1d-h

(15)

15B2

04.

61a-

c(3)

3.14

c-f(1

6)5.

12b-

d(9)

9.75

b-e(

7)9.

00d-

h(19

)14

.94a

-b(2

)8.

68h(

15)

3.05

b(2)

31.4

9a(1

)


Breeding

16B1

21.

50i-j

(24)

6.04

a(1)

2.14

e-f(2

2)6.

93f-i

(18)

13.4

1a(1

)8.

18h-

l(19)

8.44

h(16

)2.

06h-

i(20)

25.5

5g-i(

20)

17AC

41.

53i-j

(23)

2.75

d-g(

21)

1.39

f(26)

2.43

j(26)

8.39

e-h(

21)

6.16

l(26)

8.32

h(17

)2.

59c-

g(13

)24

.36i

(26)

18B1

1.27

j(26)

4.13

b-e(

9)5.

09b-

d(10

)7.

11e-

i(17)

10.2

5c-f(

13)

12.3

1c-e

(7)

8.29

h(18

)2.

63c-

f(11)

30.6

4a-c

(4)

19B2

41.

95g-

j(19)

3.07

c-f(1

8)3.

50d-

e(17

)6.

87f-i

(20)

7.51

h(25

)11

.51d

-g(1

0)7.

50i(1

9)2.

08h-

i(19)

27.9

5d-f(

8)

20B1

44.

29a-

c(4)

3.40

b-f(1

3)5.

65a-

b(3)

9.27

c-g(

10)

11.7

8a-c

(3)

7.64

j-l(2

1)7.

49i(2

0)2.

02h-

j(21)

26.5

2d-i(

16)

21B2

21.

75g-

j(21)

2.71

d-g(

23)

2.29

e-f(2

1)5.

40i(2

4)8.

11f-h

(22)

11.1

3d-g

(11)

7.47

i(21)

1.97

h-j(2

2)27

.23d

-g(1

1)

22B8

2.71

d-i(1

1)4.

09b-

e(11

)4.

55b-

d(12

)10

.55a

-d(6

)10

.29c

-f(12

)8.

55h-

k(17

)7.

32i-j

(22)

2.27

g-h(

18)

28.6

9c-d

(6)

23B1

92.

63d-

i(13)

2.41

e-g(

24)

5.47

a-b(

6)8.

88c-

h(11

)9.

52c-

h(16

)12

.58c

-d(6

)6.

66j-k

(23)

1.93

i-j(2

3)30

.96b

(2)

24B6

2.16

f-j(1

7)2.

75d-

g(22

)3.

60d-

e(15

)7.

44e-

i(14)

8.95

d-h(

20)

8.05

i-l(2

0)6.

04k-

l(24)

1.72

j-k(2

5)28

.15d

-e(7

)

25B1

81.

59h-

j(22)

1.22

g(26

)2.

10e-

f(23)

6.91

f-i(1

9)7.

55h(

24)

10.3

4e-h

(12)

5.77

l(25)

1.75

i-k(2

4)27

.45d

-g(1

0)

26B2

14.

68a-

b(2)

5.11

a-b(

2)6.

98a(

1)11

.99a

-b(3

)7.

28h(

26)

16.5

1a(1

)5.

08m

(26)

1.50

k(26

)26

.73d

-h(1

4)N

ote: •

Mea

ns w

ith th

e sa

me

lette

r(s)

in th

e sa

me

colu

mn

are

not s

igni

fican

tly d

iffer

ent f

ollo

win

g D

unca

n’s M

ultip

le R

ange

Tes

t (P

≤ 0.

01).

•N

umbe

rs w

ithin

par

enth

eses

follo

win

g th

e le

tter(

s) st

and

for r

anki

ng•

Y200

9= Y

ield

(kg)

in 2

009

•N

utW

t = N

ut w

eigh

t in

gram

s•

Ker

nWt =

Ker

nel w

eigh

t in

gram

s•

%O

T =

Per

cent

age

kern

el o

ut-tu

rn (s

helli

ng p

erce

ntag

e)•

kg a

nd g

= k

ilogr

amm

e an

d gr

am


Breeding

Discussion

In 2014, cashew clones in this trial were ten years old and yields were supposed to be increasing. However, data in 2014 indicated that some dwarf clones produced slightly lower yields than the previous year mainly due to an outbreak of cashew mealy bugs. Nevertheless, such average tree yields were not too low because they have also been reported in other countries (Sethi et al., 2015). The significant differences noted in yield across years indicated that it was possible to identify clones that performed better than others including the control variety AC4.

At the age of five and six years (2009 and 2010) the control variety AC4 ranked 23rd and 21st in yield. Similar observations were noted at the age of seven to ten years when the control variety ranked 26th, 26th, 23rd and 26th in yield, which clearly demonstrated that the majority of the clones were performing better than the control variety. Previous records have shown that the control variety AC4, which is one of the highest yielding cashew varieties, released in Tanzania had an average yield of 59 kg/tree/season at the age between 9 and 15 years (Masawe, 2006). In this trial the yield of the control variety was very low most likely due to a combination of factors, among them depleted soil fertility and low rainfall at this site. However, the dwarf clones gave higher yields than the control variety AC4. This is evidence that as far as yield is concerned, most clones were better than the control variety AC4.

When clones were ranked by nut weight, kernel weight and percentage out-turns the control variety ranked 17th (8.32g), 13th (2.59 g) and 26th (24.36%), respectively. This further shows that the majority of clones were still performing better than the control variety. Since yield is the most important criterion of any crop, and most clones gave yields higher than the control variety, the clones were further assessed by nut weight to find out which ones had higher nut weight. In this ranking 16 clones (B3, B16, B25, B15, B7, B11, B5, B17, B9, B4, B2, B13, B10, B23, B20 and B12) gave nuts, which had higher weights than the control variety AC4 (Table 4). It was also evident that all dwarf clones studied gave higher percentage out-turn than the control variety AC4 (Table 4) indicating that the previous selection was done correctly. In terms of kernel weight, 13 hybrids had kernel weights greater than the control variety AC4.


Breeding

Tabl

e 5:

Tem

pera

ture

s and

pre

cipi

tati

on in

Mtw

ara

Mon

thJa

nFe

bM

arAp

rM

ayJu

neJu

lyAu

gSe

pO

ctN

ovD

ecM

ean/

Tota

lAv

erag

e hi

gh in

°C30

3031

3130

2929

3030

3031

3130

.17

Aver

age

low

in °C

2323

2322

2119

1919

1920

2223

21.0

8Av

. pre

cipi

tatio

n - m

m21

018

320

815

347

1614

1012

2858

144

1083

Sour

ce: W

eath

erba

se 2

015

Tabl

e 6:

Tem

pera

ture

s and

pre

cipi

tati

on in

Nac

hing

wea

Mon

thJa

nFe

bM

arAp

rM

ayJu

neJu

lyAu

gSe

pO

ctN

ovD

ecM

ean/

Tota

lAv

erag

e hi

gh in

°C31

3231

3029

2828

3031

3333

3330

.8Av

erag

e lo

w in

°C22

2121

2018

1615

1618

1921

2219

.1

Av. p

reci

pita

tion

- mm

163

208

163

135

233

33

53

7494

877

Sour

ce: W

eath

erba

se 2

015


Breeding

Conclusion

Considering the fact that all clones had percentage out-turn higher than AC4, and most clones had higher yields than the variety AC4, and 16 clones gave nut weight higher than the control variety, it can be concluded that the16 clones (except clone B12 which had low kernel weight of 2.06 g) are without doubt elite candidates for direct planting as well as use in future cashew hybridisation programmes. This is due to the fact that big nuts are likely to produce big kernels, which fetch high prices in the international market. The 15 clones (B3, B16, B25, B15, B7, B11, B5, B17, B9, B4, B2, B13, B10, B23 and B20) can now be recommended as improved planting materials for growing in areas with climatic and soil conditions similar to Nachingwea.

Acknowledgements

The authors would like to acknowledge funding from the Government of Tanzania through the Ministry of Agriculture, Food Security and Co-operative, Cashew Research Steering Committee for approving this study, Cashewnut Board of Tanzania (CBT) and Cashew Industry Development Trust Fund (CIDTF) for ensuring funds were timely made available. We are also very grateful to Ms Stela Mfune, Messrs. Dadili Majune, Khalifa Issa Khasan, Ben Mpangala, and Said Mpesi for taking lead in data collection, compilation and computerisation. Many thanks go to Mr. Cuthbert Mtikire, Mr. Joseph Komba and Mr. George Lucas for their invaluable contribution in maintaining trials and supervision of data recording. Last but not least, we appreciate the contribution of our drivers Mr. Twalib Mmole and Hashim Mchotike who played a substantial role in facilitating data collection.

References

Anonymous (1993, 1997 and 2012). Annual cashew research reports for 1993, 1997 and 2012. Ministry of Agriculture Food Security and Co-operatives, Tanzania.

Barros, L. M., Paiva, J. R., Crisostomo, J. R., and J. J. V. Cavalcanti (2002). Cajueiro. In Melhoramento de Fruteiras Tropicais. (Bruckner, C. H. Ed.), UFV, Viçosa, pp. 159-176.

Boma, F., Topper, C. P., and J. Anthony (1997). Valuation of various sulphur formulations for the control of powdery mildew (Oidium anacardii Noack) on cashew in Tanzania. In Masawe, P. A. L., Esegu, J. F. O., Kasuga, L. J. F., Mneney, E. E., and D. Mujuni (Eds.) Proceedings of the Second International Cashew Conference, (pp. 228-235), Kampala, Uganda, 26–29 April 2010. CAB International, Wallingford, UK.

Cavalcanti, J. J. V, de Resende, M. D., Crisustomo, J. R., Levi, B. M., and J. R. de Paiva (2007). Genetic control of quantitative traits and hybrid breeding strategies for cashew improvement. Crop Breeding and Applied Biotechnology 7,186-195.

Croxford, A. E. (2005). A molecular study of the breeding system of cashew (Anacardium occidentale L.) in Tanzania. PhD Thesis, University of Reading, Reading, UK.

Dadzie, A. M., Adu-Gyamfi1, P. K. K., Opoku, S. Y., Yeboah, J., Akpertey, A., Opoku-Ameyaw, K., Assuah, M., Gyedu-Akoto, E., and Danquah, W. B. (2014). Evaluation of potential cashew clones for utilisation in Ghana. Advances in Biological Chemistry, 04, 10.

FAOSTAT (2011). Food and Agricultural Organisation of United Nations Statistic Division. Major food and agricultural commodities and producers – Countries by commodity.


Breeding

Masawe, P. A. L. (2006). Tanzanian cashew cultivars - Selected clones. Dar es Salaam: Colour Print (T) Ltd.

Masawe, P. A. L. (1990). The need for an improved cashew genetic base in Tanzania. In Proceedings of the First National Workshop on Plant Genetic Resources and Biotechnology, (pp. 209-213), Arusha, Tanzania, 16–20 January 1990.

Mead, R., and A. Martin (1992). Draft report on farmer participation research, on-farm research and cashew research. Naliendele Agricultural Research Institute, Mtwara, Tanzania.

Mneney, E. E., Mantell, S. H., and M. Bennett (2001). Use of random amplified polymorphic DNA RAPD) markers to reveal genetic diversity within and between populations of cashew (Anacardium occidentale L.). Journal of Horticultural Science and Biotechnology 76, 375-383.

Nair, R. B., and P.V. Prabhakaran (1983). Optimum size and shape of plots in field experiments with cashew. Agricultural Research Journal of Kerala, 21, 27-34.

Neto, V., and Caligari, P. D. S. 1997. The effect of variability on cashew yield trials. In Topper, C. P., Caligari, P. D. S., Kullaya, A. K., Shomari, S. H., Kasuga, L. J., Masawe, P. A. L. and A. A. Mpunami (Eds.). Proceedings of the International Cashew and Coconut Conference, (pp. 74-75), Dar es Salaam, Tanzania, 17–21 February 1997.

Neto, V., Caligari, P. D. S., and R. Mead (1994). Yield variability of cashew trees in East Africa. International Symposium on Plantation Crops (PLACROSYM XI) 30/11 to 3/12 1994, Calicut Kerala, India.

Neto, V. (1992). Yield variability of cashew trees in East Africa. PhD Thesis, University of Reading, UK.

Masawe, P. A. L. (2009). Modern agro-practices in cashew. Journal of Science, Technology and Management, 2, 9-16.

Rodrigues de Paiva, J., Cavalcanti, J. J. V., de Moura Barros, L., Crisóstomo, J. R., Lima, A. C., Cardoso, J. E., Mesquita, A. L. M., and J. L. Mosca (2008). BRS 275 (BRS Dão): Hybrid clone of dwarf x common or giant cashew. Crop Breeding and Applied Biotechnology, 8, 248-250.

Sethi, K., Lenka, P. C., and S. K. Tripathy (2015). Evaluation of cashew (Anacardium occidentale L.) hybrids for vegetative parameters and nut yield. Journal Crop and Weed, 11, 152-156.

Topper, C. P., Boma, F., and H. Mhando (1997). Evaluation of fungicides for the control of powdery mildew (Oidium anacardii Noack) on cashew in Tanzania. B. On-farm testing of fungicide control strategies. In Topper, C. P., Calig-ari, P. D. S., Kullaya, A. K., Shomari, S. H., Kasuga, L. J., Masawe, P. A. L. and A. A. Mpunami (Eds.). Proceedings of the International Cashew and Coconut Conference, (pp. 270-276). Dar es Salaam, Tanzania, 17–21 February 1997.


Breeding

Evaluation of Selected Half-Sib Progenies of AZA2 for Resistance to Cashew Leaf and Nut Blight Disease

P.A.L. Masawe*, F.A. Kapinga, J. Madeni and Z. S. Ngamba



Abstract

Cashew leaf and nut blight disease caused by fungus (Cryptosporiopsisspp) is the second most important disease for cashew in Tanzania after powdery mildew. Cashew variety AZA2 is one of the varieties, which is resistant to cashew leaf and nut blight disease. Studies were undertaken in AZA2 half-sib progenies at Nachingwea to identify few high yielding clones that appeared to be tolerant to the disease. A total of 19 half-sib progenies of AZA2 variety were selected for further evaluation in hotspot locations at Naliendele experimental blocks. Two cashew varieties AZA2 (resistant to cashew leaf and nut blight disease) and AC4 (highly susceptible to the disease) were used as control. Results indicated that some half-sib progenies maintained to be high yield and also resistant to the disease. Few were highly resistant but had low yields while one clone was highly susceptible than AC4. Five clones were identified as tolerant to the disease and have been recommended for inclusion in the list of improved planting materials particularly for hotspot areas. The presence of highly resistant/susceptible clones with low yields opens the possibility of mark assisted breeding for high yielding varieties as well as varieties that are resistant to cashew leaf and nut blight disease.

Key words: Cashew, half-sib, resistance, disease, blight

Introduction

Cashew has been one of the most important export crops in Tanzania since independence. Cashew production increased drastically in 1960s towards mid- 1970s, thereafter there was production decline. The reasons for the decline in cashew nut production were reviewed by Ellias (1980) and Brown et al., (1984). It was noted that complex factors were involved of which the most important were abandonment of farms (due to villagilisation), and overcrowding of the cashew trees and powdery mildew disease (Castellani and Casulli, 1981; Intini, 1987). The control measure for powdery mildew disease was developed and practised by cashew farmers (Sijaona, 1984; Shomari, 1988). However, in 2003 a new disease ‘cashew leaf and nut blight’ (caused by Cryptosporiopsis spp) was reported for the first time, attacking cashew in Tanzania (Sijaona et al., 2005). Although the chemical control measure for the disease is in place, it appears to be too expensive for poor-resourced farmers, because it is not systemic and it must be re-applied whenever it rains during the fruiting season.


Breeding

In this context, only few farmers are financially capable of controlling the disease using fungicides. It is on this understanding that it was necessary to develop cashew varieties that are resistant to the disease, which would be more beneficial to farmers. Cashew variety AZA2 is resistant to the disease. There is high possibility of getting individual trees from AZA2 half-sib progenies, which are resistant to the disease. It view of this, it was important to search for resistant materials from AZA2 progenies located in the seed multiplication block at Nachingwea. This block is five hectares and was established in late 1980s at a spacing of 12m between rows and 12 m within rows with plant population of about 300 half-sib progenies.

These progenies were evaluated for yield, nut quality and disease tolerance. Those that appeared to be tolerant to cashew leaf and nut blight disease were selected for further evaluation in a replicated trial at Naliendele Agricultural Research Institute (NARI), a hot spot for the disease. The objective was to find out if some of the progenies would continue to be high yielding with disease tolerance/resistance to the cashew leaf and nut blight disease, which is currently responsible for low cashew productivity across the country. Identification of such clones will be very beneficial to farmers because they will need to take care of powdery mildew, and no longer cashew leaf and nut blight disease.


Nineteen half-sib progenies of cashew variety AZA2 were selected from its half-sib progeny population block located at Nachingwea research substation. The main criteria used for selection were high yield, big nut size (>7g), and higher percentage out-turn (>25%). The selected clones (AZA2 half-sib progenies) were coded AZA2/1 to AZA2/19. Two clones AC4 and AZA2 were used as check or control in this trial because the former is highly susceptible to cashew leaf and nut blight disease while the latter is resistant to the disease. The total number of entries was twenty-one. Further, clone AZA2 was also specifically used as a check or control for yield and nut quality. These materials were vegetatively propagated and planted at NARI experimental block on 6th February 2007.

The trial layout was a randomised complete block, three trees per plot planted at a spacing of 12m between rows and 10m within rows, in three replicates. Agronomic practices such as annual pruning and weeding were carried out. The cashew yields were recorded on a tree basis. The disease (blight) was scored during the flushing, flowering and fruiting seasons. There was no application of fungicides to control cashew leaf and nut blight disease; however, powdery mildew and sucking pests were controlled at a recommended rate. For easy interpretation of the data, the cloned half-sib progenies in this trial are referred to as ‘Clones’.


Breeding

Table 1: Selected clones (AZA2 half-sib progenies) under evaluation

SN Clone SN Clone

1 AZA2/1 12 AZA2/12

2 AZA2/2 13 AZA2/13

3 AZA2/3 14 AZA2/14

4 AZA2/4 15 AZA2/15

5 AZA2/5 16 AZA2/16

6 AZA2/6 17 AZA2/17

7 AZA2/7 18 AZA2/18

8 AZA2/8 19 AZA2/19

9 AZA2/9 20 AZA2

10 AZA2/10 21 AC4

11 AZA2/11

Results

Analysis of variance for yield (2009, 2010, 2011, 2012 2013 and 2014), nut weight, kernel weight, percentage kernel out-turn (%OT) and blight are presented in Table 2. There were highly significant differences between clones and the interactions of Rep x Clones in all parameters under investigation (at p ≤ 0.01). Trial mean yield in 2014, nut weight and kernel weight, %OT and blight scores were 8.60 kg/tree, 7.01g, 2.05g, 29.19% and 0.88, respectively. The coefficient of variation for data recorded in 2014 ranged from 7.30 (%OT) to 48.10 (blight) (Table 2).

Duncan’s multiple range test for yield in 2014, nut weight, kernel weight, kernel %OT and blight are presented in Table 3. Ranking of the means for yield in year 2014 showed clone AZA2/15 to be the highest yielding clone (16.95 kg/tree), which was in line with observation made in year 2013 (Table 2). However, it was not significantly different with three other clones (AZA2/1, AZA2/3 and AZA2/9) that produced 15.25 kg/tree, 13.83 kg/tree and 13.54 kg/tree, respectively. The control clones AC4 and AZA2 produced 10.27 kg/tree and 7.52 kg/tree and ranked 8th and 12th in yield, respectively. On ranking the mean for nut weight, clone AC4 (control) had the highest mean nut weight (8.51g), but it was significantly different from all other clones except three clones (AZA2/6, AZA2/14 and AZA2/15). Like in the previous years (2010, 2011 and 2013), the lowest mean nut weight was recorded on clone AZA2/4 (5.71g). When considering kernel weight, the highest kernel weight was also recorded on one of the control clones AC4 (2.80g), while the lowest kernel weight was recorded on clone AZA2/4 (1.57g). Regarding %OT, a control AC4 ranked first (32. 96%); and it was not statistically significantly different from two other clones (AZA2/3 and AZA2/8). A clone AZA2/17 had the lowest OT% (26.75%); however, this was relatively very high in the cashew industry as the lowest is supposed to be 20% (Masawe and Kapinga, 2010).

Ranking of the means for cashew leaf and nut blight showed AZA2/3 to be most susceptible (4.25), which was not significantly different with one of the control varieties AC4 (4.08). Clone AZA2/12 appeared to be most resistant (0.00); however, it did not differ with control clone AZA2 and other 12 clones.


Breeding

Tabl

e 2:

Ana

lysi

s of v

aria

nce

for

yiel

d, n

ut w

eigh

t, ke

rnel

wei

ght,

%O

T a

nd b

light

(CLN

B) f

or A

ZA

2 ha

lf-si

bs a

t Nal

iend

ele

Sour

cedf

Mea

n sq

uare

sY2

009

Y201

0Y2

011

Y201

2Y2

013

Y201

4N

utW

tK

ernW

t%

OT

CLN

BD

Rep

20.

2088

1.13

390.

974

20.8

75**

15.1

630

9.60

**1.

661*

0.04

310

.187

10.1

77**

Clo

ne

201.

0985

***

5.20

55**

*21

.013

**91

.361

**14

4.20

**22

5.47

**6.

2674

**0.

9389

**33

.463

**18

.517

**Re

pxC

lone

400.

2317

*1.

3966

***

1.07

18.

151*

*18

.83*

40.3

4**

1.10

48*

0.13

33*

8.05

2*0.

180*

*Er

ror

0.14

40.

633

1.19

43.

985

10.0

0016

.470

0.58

50.

069

4.55

60.

180

Mea

n0.

400.

791.

524.

397.

238.

607.

012.

0529

.19

0.88

CV

(%)

95.4

210

0.96

71.7

045

.50

43.7

047

.20

10.9

012

.80

7.30

48.1

0C

LNBD

Sco

res (

1, 2

, 3,4

, 5,6

): w

here

1 =

tole

rant

and

6 h

ighl

y su

scep

tible

*P ≤

0.0

5**

P ≤

0.01

***

P ≤

0.00

1Y2

009

= yi

eld

(kg)

in 2

009

Nut

Wt =

Nut

wei

ght (

g)K

ernW

t = K

erne

l wei

ght (

g)%

OT

= P

erce

ntag

e ke

rnel

out

-turn

C

LNBD

= C

ashe

w L

eaf a

nd N

ut B

light

Dise

ase


Breeding

Tabl

e 3:

Ran

ked

orde

r of

mea

ns fo

r yi

eld,

nut

wei

ght,

kern

el w

eigh

t, %

OT,

cgc

a, p

lant

hei

ght a

nd b

light

infe

ctio

n on

the

AZ

A2

half-

sibs

at N

alie

ndel

e

No

Clo

ne

Y200

9Y2

010

Y201

1Y2

012

Y201

3Y2

014

Nut

Wt (

g)

Ker

nWt (

g)%

OT

CLN

BD

1A

ZA

2/12

0.14

de(1

7)

0.10

g(19

)0.

437e

(14)

1.14

hij(1

8)2.

473g

h(19

)3.

299i

jk(1

9)6.

759c

de(1

4)1.

882f

g(14

)27

.81g

hi(1

8)0.

000a

(1)

2A

ZA

2/2

0.03

e(21

) 0.

10g(

20)

0.16

6e(1

9)0.

86ij(

20)

1.62

8h(2

1)2.

172k

(21)

7.08

0cd(

9)1.

968d

efg(

12)

27.2

7hi(2

0)0.

0417

a(2)

3A

ZA

2/11

0.26

cde(

15)

0.37

fg(1

5)0.

397e

(15)

2.76

fgh(

14)

6.78

7ef(1

2)7.

039e

fghi

j(13)

6.59

9cde

(15)

1.85

1g(1

6)28

.02g

hi(1

6)0.

0417

a(3)

4A

ZA

20.

48bc

d(7)

0.56

efg(

12)

0.97

6de(

12)

4.15

ef(1

2)6.

616e

f(14)

7.52

7efg

hi(1

2)6.

153e

f(20)

1.77

7gh(

20)

28.9

6efg

h(10

)0.

0833

a(4)

5A

ZA

2/5

0.44

bcd(

9)0.

49fg

(13)

0.38

2e(1

6)3.

16fg

(13)

8.27

7cde

(9)

11.4

66bc

d(6)

6.76

7cde

(12)

1.93

6efg

(13)

28.5

7fgh

i(12)

0.12

5a(5

)

6A

ZA

2/10

0.08

e(18

) 0.

04g(

21)

0.03

9e(2

1)0.

25j(2

1)7.

232d

ef(1

1)2.

441j

k(20

)6.

571c

de(1

7)1.

863g

(15)

28.7

1fgh

i(11)

0.16

67ab

(6)

7A

ZA

2/19

0.32

bcde

(12)

0.

82cd

efg(

9)1.

98cd

(8)

5.75

cde(

7)9.

948a

bcd(

6)9.

711c

def(1

0)7.

151c

d(8)

2.14

9cde

(7)

30.1

0cde

f(6)

0.16

67ab

(7)

8A

ZA

2/9

0.29

cde(

13)

1.39

bcd(

4)2.

77bc

(4)

7.34

abc(

5)10

.478

abc(

4)13

.541

ab(4

)7.

245b

cd(6

)2.

138c

de(9

)29

.49d

efg(

7)0.

250a

b(8)

9A

ZA

2/17

0.06

6e(1

9)

0.16

g(17

)0.

2e(1

8)1.

67gh

ij(17

)2.

633g

h(18

)4.

000h

ijk(1

7)6.

761c

de(1

3)1.

813g

(18)

26.7

5i(2

1)0.

250a

b(9)

10A

ZA

2/7

0.15

de(1

6)

0.21

g(16

)0.

103e

(20)

2.03

ghij(

16)

3.33

3gh(

17)

5.67

7ghi

jk(1

6)6.

255e

f(19)

1.78

7gh(

19)

28.5

6fgh

i(13)

0.25

06ab

(10)

11A

ZA

2/14

0.33

bcde

(11)

0.

66de

fg(1

1)1.

822c

de(9

)5.

41de

(9)

7.74

1cde

f(10)

7.91

3def

g(11

)7.

893a

b(4)

2.20

3cd(

6)27

.94g

hi(1

7)0.

2778

ab(1

1)

12A

ZA

2/4

0.28

cde(

14)

0.40

fg(1

4)0.

516e

(13)

2.27

ghi(1

5)4.

811f

g(16

)6.

726e

fghi

j(14)

5.70

8f(2

1)1.

574h

(21)

27.4

8ghi

(19)

0.34

72ab

(12)

13A

ZA

2/18

0.06

e(20

) 0.

15g(

18)

0.26

1e(1

7)0.

91ij(

19)

2.23

6gh(

20)

3.31

9ijk

(18)

6.50

8de(

18)

1.84

1g(1

7)28

.03g

hi(1

5)0.

4028

ab(1

3)

14A

ZA

2/13

0.62

bc(4

) 1.

13bc

def(6

)1.

797c

de(1

0)6.

72bc

d(6)

9.34

3bcd

e(7)

11.3

55bc

d(7)

6.85

8cde

(10)

1.98

6def

g(11

)28

.96e

fgh(

9)0.

5417

bc(1

4)

15A

ZA

2/15

0.66

b(3)

1.

53bc

(3)

2.47

2bcd

(5)

8.96

a(1)

12.5

67a(

1)16

.953

a(1)

8.45

9a(2

)2.

489b

(2)

29.4

5def

g(8)

0.83

33cd

(15)

16A

ZA

2/6

0.44

bcd(

8)1.

05cd

ef(7

)2.

154c

d(7)

5.53

de(8

)6.

717e

f(13)

6.23

1fgh

ij(15

)8.

045a

(3)

2.32

1bc(

3)28

.34f

ghi(1

4)1.

0833

d(16

)

17A

ZA

2/1

0.35

bcde

(10)

0.83

cdef

g(8)

4.02

7a(2

)7.

47ab

c(4)

11.8

84ab

(2)

15.2

45a(

2)7.

215c

d(7)

2.25

6c(4

)31

.26a

bcd(

4)1.

5833

e(17

)

18A

ZA

2/16

0.58

bc(5

) 0.

76de

fg(1

0)1.

583d

e(11

)4.

2ef(1

1)8.

432c

de(8

)10

.223

bcde

(9)

7.30

7bc(

5)2.

250c

(5)

30.8

6bcd

e(5)

1.63

89e(

18)

19A

ZA

2/8

0.98

a(2)

1.

79b(

2)3.

33ab

(3)

8.02

ab(3

)10

.422

abc(

5)11

.685

bc(5

)6.

835c

de(1

1)2.

138c

de(8

)31

.41a

bc(3

)2.

125f

(19)

20AC

40.

55bc

(6)

1.31

bcde

(5)

2.43

6bcd

(6)

5.25

de(1

0)6.

546e

f(15)

10.2

72bc

de(8

)8.

509a

(1)

2.80

4a(1

)32

.96a

(1)

4.08

33g(

20)

21A

ZA

2/3

1.22

a(1)

2.

67a(

1)4.

16a(

1)8.

33ab

(2)

11.7

42ab

(3)

13.8

28ab

(3)

6.57

5cde

(16)

2.10

5cde

f(10)

32.0

2ab(

2)4.

250g

(21)

Y200

9 =

yiel

d (k

g) in

200

9N

utW

t = N

ut w

eigh

t (g)

Ker

nWt =

Ker

nel w

eigh

t (g)

%O

T =

Per

cent

age

kern

el o

ut-tu

rn

CLN

BD =

Cas

hew

Lea

f and

Nut

Blig

ht D

iseas

e


Breeding

Discussion

The cashew clones in this trial were seven years old by 2014. Results of the analysis of variance showed high significant differences between clones for every character studied. This is an indication that it is possible to identify clones with desirable characters, yield, nut quality and disease resistance.

Duncan multiple range test on yield in 2014 revealed that a significant number of clones was performing better than both controls. A total of 11 clones performed better in yield than control variety AZA2; while 7 clones performed better in yield than control variety AC4. As far as nut weight was concerned, 19 clones had higher nut weight than AZA2 (control variety) while 20 clones had a higher kernel weight, which was very good. This indicated that as far as yield and nut quality were concerned the majority of the clones were performing well compared to the control variety AZA2.

However, the centre of focus of the trial was resistance to cashew leaf and nut blight without conceding yield and nut quality. High significant differences in blight infection were noted among clones. Ranking of the means for blight showed clone AZA2/12 to have higher level of resistance but it did not differ significantly with 12 other clones including variety AZA2 (resistant). The most susceptible clone was AZA2/3, which was not significantly different with control variety AC4.

Based on this data, it can be said that clone AZA2/12 has shown to be resistant to blight, while 11 clones (AZA2/2, AZA2/11, AZA2/5, AZA2/10, AZA2/19, AZA2/9, AZA2/17, AZA2/7, AZA2/14, AZA2/4, AZA2/18) have demonstrated to be tolerant to the cashew leaf and nut blight disease. However, not all of these clones were high yielding; therefore, when considering both characters (yield and blight)) it was apparent that only five clones (AZA2/11, AZA2/5, AZA2/19, AZA2/9 and AZA2/14) were both high yielding and tolerant/resistant to cashew leaf and nut blight disease. These clones can be included in the list of improved planting materials that are tolerant to cashew leaf and nut blight disease. On the other hand, clone AZA2/12 and AZA2/2, which showed to be resistant to cashew leaf and nut blight, can be used in biotechnology studies to find genes responsible for resistance to cashew leaf and nut blight disease.


Cashew clones AZA2/2, AZA2/11, AZA2/5, AZA2/10, AZA2/19, AZA2/9, AZA2/17, AZA2/7, AZA2/14, AZA2/4 and AZA2/18 have shown to be high yielding with good nut quality attributes and are tolerant to cashew leaf and nut blight disease. Therefore, they can now be used as clones for direct planting particularly in areas with high incidences of the disease. The same clones can be used in hybridisation programme to develop more cashew varieties that are resistant to cashew leaf and nut blight disease. The presence of highly resistant/susceptible clones open the possibility of marker assisted breeding for resistance to cashew leaf and nut blight disease.


Breeding

Acknowledgements

The authors would like to acknowledge funding from the Government of Tanzania through the Ministry of Agriculture, Food Security and Co-operatives; the Cashew Research Steering Committee, for approving this study; the Cashew nut Board of Tanzania; and the Cashew Industry Development Trust Fund, for ensuring funds were timely available. We are also very grateful to Ms Stela Mfune, Messrs. Dadili Majune, Khalifa Issa Khasan, Ben Mpangala, Said Mpesi for taking lead in data collection, compilation and computerisation. Many thanks go to Mohamed Hassan for his invaluable contribution in maintaining the trial and supervision of data recording. We will not be doing justice if we do not appreciate the contribution of our drivers Mr. Twalib Mmole and Hashim Mchotike who played a substantial role in facilitating data collection.

References

Brown, L. C., Minja, E., and A. S. Hamad (1984). Cashew production in East Africa. Paper presented at CABI’s First Scientific Conference on Advancing Agricultural Production in Africa, Arusha, Tanzania, 12–18 February 1984.

Castellani, E., and F. Casulli (1981) Observazioni preliminarisu Oidiumanacardii Noack, agente del mal biancodell’anacardio in Tanzania. Rivista di Agricoltura Subtropicale e Tropicale, 75, 211–222.

Ellis, F. (1980). A preliminary analysis of the decline in cashew nut production, 1974-1979: Causes, possible remedies and lessons for rural development policy. Economic Research Bureau, University of Dar es Salaam.

Intini, M. (1987). Phytopathological aspects of cashew (AnacardiumoccidentaleL.) in Tanzania. International Journal of Tropical Plant Diseases, 5, 115–130.

Masawe, P. A. L., and F. A. Kapinga (2010). Preliminary observations on the performance of selected elite cashew hybrids at Nachingwea, southern Tanzania. In Masawe, P. A. L., Esegu, J. F. O., Kasuga, L. J. F., Mneney and D. Mujuni (Eds). Proceeding of the second international cashew conference. Hotel Africana, Kampala, Uganda, 26-29 April 2010. CABI International, Wallingford, UK, 15-19.

Shomari S. H. (1988). A review of cashew research in Tanzania. Paper presented at the Tanzanian Agricultural Research Masterplan Conference, Arusha, 12–15 December 1988.

Sijaona, M. E. R. (1984). Investigation into effectiveness of sulphur W. P. against Oidiumanacardii Noack on five-cashew tree types at Naliendele. Rivista di AgricolturaSubtropicale e Tropicale, 78, 199–209.

Sijaona, M. E. R., Reeder, R. H., and J. M. Waller (2005) Cashew leaf and nut blight – a new disease of cashew in Tanzania caused by Cryptosporiopsisspp. Plant Pathology, 55(4), 576.


Breeding

Preliminary Observations of Cashew Hybrids Developed for Resistance to

Leaf and Nut Blight Disease

P.A.L. Masawe*, F.A. Kapinga, J. Madeni and Z. S. Ngamba


*Email of the corresponding author:[email protected]

AbstractCashew leaf and nut blight disease is one of the major cashew diseases in Tanzania, which is respon-sible for low cashew yields. Hybridisation by controlled hand pollination was undertaken to develop hybrids that are tolerant to the disease. The parents used in developing such hybrids were cashew varieties that showed high levels of tolerance to cashew leaf and nut blight disease. A highly suscep-tible cashew variety (AC4) and resistant one (AZA2) were among the parents used in developing the hybrids. Evaluation of the hybrids in the field revealed that their performance in terms of yield and nut quality was good. Screening of the hybrids against the disease demonstrated that the majority of the hybrids were tolerant to the disease opening an opportunity to get new cashew varieties resistant to the disease.

Key words: cashew, hybrid, disease, blight

Introduction

Cashew is an important export crop in a number of countries in the tropics, including Tanzania. It is known to be a robust crop that can grow even in marginal lands where other crops cannot. Cashew was previously believed to be almost free from serious diseases and insect pests (Ohler, 1979). As the area under cashew cultivation increased, investigation revealed the presence of many diseases attack-ing cashew, although they were not of economic importance (Ohler, 1967). In Tanzania there were no diseases of economic importance in cashew until 1980s when the outbreak of powdery mildew was reported (Castellani and Casulli, 1981; Intini and Sijaona, 1983; Sijaona, 1984; Shomari, 1988; Topper et al., 1997). The disease was reported to have contributed to the decline of cashew produc-tion in Tanzania from 145,000 Mt in 1973/1974 to 16,400 Mt in 1986/1987 (Brown et al., 1984; Shomari, 1988).

Efforts were made to identify fungicides for the control of the disease and over 25 fungicides were registered (TPRI, 2011). However, an outbreak of a new cashew disease [Cashew Leaf and Nut Blight Disease (CLNBD)] was reported for the first time in the cashew industry by Sijaona et al. (2005). The disease was even more severe causing not only crop loss but also lowering the quality of the nuts to a great margin. The fungicides to control this disease are available but they are too expensive and they need to be applied every time it rains during the fruiting season, which seems uneconomical. The ap-


Breeding

plication needs to be repeated because it is not a systemic fungicide. Although some cashew varieties appeared to be highly susceptible to the disease (AC4), other cashew varieties appeared to be tolerant or resistant to the disease (AZA2). Hybridisation by controlled hand pollination was undertaken to develop hybrids that are resistant or tolerant to the disease. These hybrids are being evaluated in this trial to find out if they exhibit this character.


In the 2006 season, scoring for cashew leaf and nut blight disease was undertaken in research blocks at Naliendele Agricultural Research Institute (NARI) to identify cashew clones that appeared to be high-ly susceptible and tolerant to cashew leaf and nut blight disease. Three cashew clones AC4, AC4/285 and AC4/200 appeared to be highly susceptible to CLNBD disease; cashew clones 1.18VM, 11.9PA, 2.4NAS and AD4.1PA appeared to be tolerant; and clone AZA2 appeared to be resistant to the disease. Hybridisation by controlled hand pollination (crossing and some reciprocal crossings) was carried out at NARI experimental blocks using these parents.

Four hundred and fifty (450) hybrid seeds were produced; however, only 254 seedlings successful-ly germinated at NARI nursery. The seedlings were transplanted in Nachingwea in a Randomized Complete Block design. The hybrids were planted in three replicates with plot size of three trees. The spacing used was 12m between rows and 10m within rows. The remaining seedlings were planted at the periphery of the trial as guard rows.

In the 2014/15 season, the hybrids were seven years old. Agronomic practices were undertaken as recommended by the Cashew Research Programme except the application of fungicides to expose the hybrids to CLNBD pathogens. Vegetative measurements (tree height and canopy diameter) were recorded in January 2014. Data analysis was done using statistical analysis package GenStat. Duncan’s Multiple Range Test was used to separate means. The number of entries with their parents was 12 hybrids as shown in Table 1.

Table 1: Selected hybrids (and their parents) developed in 2007 for resistance to cashew leaf and nut blight disease

SN Hybrid SN HybridFemale Male Female Male

1 2.4NAS 11.9PA 7 1.18VM 2.4NAS2 AC4 AD4.1PA 8 AC4/200 AD4.1PA3 AD4.1PA AC4-A 9 AD4.1PA 1.18VM4 AD4.1PA 11.9PA 10 AD4.1PA AC45 AC4 AZA2 11 AC4/285 AZA26 AD4.1PA AC4/200 12 AC4/200 2 .4NAS


Breeding

Res

ults

Tabl

e 2

pres

ents

the

anal

ysis

of v

aria

nce

for y

ield

, nut

wei

ght,

kern

el w

eigh

t, %

OT,

can

opy

grou

nd c

over

ed a

rea

(cgc

a), h

eigh

t and

blig

ht fo

r 201

4. Th

e an

al-

ysis

show

s tha

t the

re w

ere

high

ly si

gnifi

cant

diff

eren

ces b

etw

een

hybr

ids i

n al

l cha

ract

ers u

nder

obs

erva

tion.

The

tria

l mea

ns fo

r yie

ld 2

014,

nut

wei

ght,

kern

el

wei

ght,

% O

T, cg

ca h

eigh

t and

blig

ht w

ere 1

8.10

kg/tr

ee, 7

.37g

, 2.1

7g, 2

9.88

%, 4

9.16

m2 ,

4.39

m an

d 1.

93, r

espe

ctiv

ely.

The c

oeffi

cien

t of v

aria

tion

varie

d fro

m

9.4%

(hei

ght)

to 6

5.2%

(CLN

BD).

Gen

eral

ly, C

V fo

r yie

lds o

ver y

ears

in th

is tr

ial w

ere

very

goo

d co

mpa

red

to m

any

othe

r cas

hew

tria

ls (N

eto,

199

2; N

eto

et

al.,

1994

; Net

o et

al.,

199

6; M

asaw

e an

d K

apin

ga, 2

013;

Bas

hiru

, 201

3; U

aciq

uete

et a

l., 2

013)

.

Tabl

e 2:

Ana

lysi

s of v

aria

nce

for

yiel

d, n

ut w

eigh

t, ke

rnel

wei

ght,

%O

T, c

gca,

pla

nt h

eigh

t and

CLN

BD

for

2007

cro

sses

at N

achi

ngw

ea

Sour

ceD

fM

ean

squa

res

Y201

1Y2

012

Y201

3Y2

014

Nut

Wt

Ker

nWt

%O

Tcg

caH

eigh

t C

LNBD

Rep

217

.488

**15

.969

*18

.988

*3.

71.

115

0.23

50.2

1*42

25.1

**1.

6977

**0.

078

Hyb

rids

1110

.297

**13

.312

**11

.674

**18

7.03

**20

.289

**1.

21**

25.8

0*27

0.7*

0.43

1*5.

281*

Repx

Hyb

rids

197.

364*

*6.

504

6.82

4*42

.22*

7.34

8*0.

593*

6.15

322.

8*0.

5165

**2.

181

Erro

r2.

867

4.57

52.

898

21.6

902.

822

0.27

210

.220

117.

800

0.17

21.

591

Mea

n3.

605.

519.

7218

.10

7.37

2.17

29.8

849

.16

4.39

1.93

CV

(%)

47

.10

38.8

017

.50

25.7

022

.80

21.1

010

.70

22.1

09.

4065

.20

CLN

BD S

core

s (1,

2, 3

,4, 5

,6):

whe

re 1

=to

lera

nt a

nd 6

hig

hly

susc

eptib

le

** P

≤ 0

.01

*p≤

0.05

Y201

1 =

Yiel

d (k

g/tre

e) in

201

1N

utW

t = N

ut w

eigh

t (g)

K

ernW

t = K

erne

l wei

ght (

g)

%O

T =

Per

cent

age

kern

el o

ut-tu

rn (%

)cg

ca =

Can

opy

grou

nd c

over

ed a

rea

(m2 )

Hei

ght =

Hei

ght (

m)

CLN

BD=

Cas

hew

Lea

f and

Nut

Blig

ht D

iseas

e


Breeding

Tabl

e 3:

Ran

ked

orde

r of

mea

ns fo

r yi

eld,

nut

wei

ght,

kern

el w

eigh

t, %

OT,

cgc

a pl

ant h

eigh

t and

CLN

BD

of 2

007

cros

ses a

t Nac

hing

wea

No

Cro

sses

Y201

1Y2

012

Y201

3Y2

014

Nut

Wt

Ker

nWt

%O

Tcg

caH

eigh

t C

LNB

D

1AC

4/28

5 x

AZA2

3.42

3abc

d(7)

5.41

abcd

(8)

8.79

7c(9

)22

.83a

(1)

5.27

5e(1

1)1.

664d

(11)

31.5

4a(1

)50

.70a

bc(5

)4.

363a

b(9)

0.66

7d(1

)

21.

18V

M x

2.4

NAS

2.17

2d(1

1)4.

28bc

d(10

)8.

487c

(12)

10.4

5d(1

1)8.

644a

b(3)

2.40

8ab(

3)27

.97a

b(11

)44

.39b

c(10

)4.

428a

b(6)

1.00

2cd(

2)

3AD

4.1P

A x

AC4

4.99

2a(2

)6.

62ab

(2)

8.90

6c(7

)19

.39a

b(8)

5.17

7e(1

2)1.

604d

(12)

31.3

3a(3

)54

.86a

b(2)

4.06

6b(1

1)1.

196b

cd(3

)

4AC

4 x

AZA2

2.91

6bcd

(9)

4.61

abcd

(9)

10.0

44ab

c(5)

19.8

0ab(

7)7.

165b

cd(7

)2.

227a

bc(7

)31

.40a

(2)

45.3

0bc(

9)4.

435a

b(5)

1.50

0bcd

(4)

5AC

4 x

AD4.

1PA

2.99

4bcd

(8)

6.90

a(1)

11.3

46ab

(2)

20.7

8ab(

5)8.

200a

bc(5

)2.

395a

b(4)

29.1

3ab(

9)54

.46a

b(3)

4.38

1ab(

8)1.

825a

bcd(

5)

6AD

4.1P

A x

AC4/

200

4.74

3ab(

3)6.

49ab

(4)

11.6

96a(

1)19

.91a

b(6)

6.10

8de(

10)

1.81

5cd(

10)

31.1

2a(5

)46

.58b

c(7)

4.08

2b(1

0)1.

833a

bcd(

6)

7AD

4.1P

A x

AC4-

A4.

019a

bc(5

)6.

42ab

(5)

10.1

11ab

c(4)

20.9

2ab(

4)6.

309d

e(9)

1.90

3bcd

(9)

30.3

2a(7

)50

.54a

bc(6

)4.

052b

(12)

2.00

0abc

d(7)

8AC

4/20

0 x

AD4.

1PA

3.61

8abc

d(6)

5.61

abc(

7)11

.13a

b(3)

22.6

3a(2

)6.

770c

de(8

)2.

068b

cd(8

)31

.14a

(4)

46.1

2bc(

8)4.

569a

(3)

2.11

1abc

(8)

92.

4NAS

x 1

1.9P

A2.

647c

d(10

)3.

30d(

12)

8.77

9c(1

1)9.

60d(

12)

9.75

9a(1

)2.

726a

(1)

28.0

7ab(

10)

41.1

4c(1

2)4.

567a

(4)

2.41

7ab(

9)

10AD

4.1P

A x

1.18

VM

2.10

9d(1

2)3.

87cd

(11)

8.79

3c(1

0)13

.73c

d(10

)8.

424a

bc(4

)2.

232a

bc(6

)26

.44b

(12)

43.2

2bc(

11)

4.40

8ab(

7)2.

500a

b(10

)

11AD

4.1P

A x

11.9

PA4.

305a

bc(4

)6.

59ab

(3)

9.69

6bc(

6)21

.09a

b(3)

9.19

8a(2

)2.

680a

(2)

29.1

5ab(

8)54

.08a

b(4)

4.61

1a(2

)3.

054a

(11)

12AC

4/20

0 x

2.4N

AS5.

222a

(1)

6.03

abc(

6)8.

888c

(8)

16.1

0bc(

9)7.

409b

cd(6

)2.

279a

bc(5

)30

.95a

(6)

58.5

8a(1

)4.

701a

(1)

3.10

9a(1

2)

CLN

BD S

core

s (1,

2, 3

,4, 5

,6):-

whe

re 1

=to

lera

nt a

nd 6

hig

hly

susc

eptib

leM

eans

with

the

sam

e le

tter(

s) in

the

sam

e co

lum

n ar

e no

t sig

nific

antly

diff

eren

t fol

low

ing

Dun

can’s

Mul

tiple

Ran

ge T

est (

P ≤

0.05

).N

umbe

rs w

ithin

par

enth

eses

follo

win

g th

e le

tter(

s) st

and

for r

ank.

Not

e:C

LNBD

= C

ashe

w L

eaf a

nd N

ut B

light

Dise

ase

Nut

Wt =

Nut

wei

ght (

g)K

ernW

t = K

erne

l wei

ght (

g)%

OT

= P

erce

ntag

e ou

t-tur

n (%

)cg

ca =

Can

opy

grou

nd c

over

ed a

rea

(m2 )


Breeding

Duncan’s Multiple Range Test on yield in 2014 showed the best hybrid to be AC4/285 x AZA2 (22.83 kg/tree) which was not significantly different compared to seven other hybrids (Table 3). Hybrid 2.4NASx11.9P ranked last in yield (9.60 kg/tree). Ranking means for nut weight, hybrid 2.4NAS x 11.9P appeared to have biggest nut weight (9.76g). Hybrid AD4.1PA x AC4 ranked last in nut weight (5.18g). Considering the kernel weight, 2.4NAS x 11.9P ranked first (2.73g) but it was not significantly different from six other hybrids. Likewise, in nut weight, AD4.1PA x AC4 ranked last also in kernel weight (1.60g). As far as %OT was concerned, hybrid AC4/285 x AZA2 ranked the first (31.54%) but was not statistically significantly different from all other hybrids except one (AD4.1PA x 1.18VM) which ranked last (26.44%). The biggest cgca was recorded on hybrid AC4/200 x 2.4NS (58.58 m2) and hybrid 2.4NAS x 11.9P ranked last with cgca of 41.14 m2. When ranking the means of height, hybrid AC4/200 x 2.4NS (4.70 m) was the tallest hybrid, while hybrid AD4.1PA x AC4-A was the shortest (4.05 m). Ranking of means for cashew leaf and nut blight disease, hybrid AC4/200 x 2.4NAS appeared to be most susceptible (3.11), while hybrid AC4/285 x AZA2 was more resistant (0.67).

Discussion

In the 2014/15 season, the hybrids in this trial were six years old. Analysis of variance has shown that there were highly significant differences among hybrid under study indicating that it was possible to identify high yielding hybrids. The Duncan’s Multiple Range test showed that cashew hybrids in this trial were performing well in yield and eight of them gave yields above the trial mean (18.10 kg/tree). When considering nut weight, six cashew hybrids had nut weight higher than the trial mean (7.37 g) while in kernel weight; seven hybrids had kernel weights, which were higher than the trial mean (2.17 g). This is an indication that as far as these two parameters are concerned it is possible to iden-tify potential hybrids in this trial. It was interesting to note that all hybrids had very high percentage kernel out-turn (except one AD4.1PA x 1.18VM) which had percentage out-turn between 28.97% (1.18VM x 2.4NAS) and 31.54% (AC4/285 x AZA2). In cashew breeding, genotypes (varieties, clones or hybrids) with percentage kernel out-turn higher than 25% are considered to be good (Ma-sawe and Kapinga, 2013). The lowest acceptable percentage out-turn is 20%. Significant differences were observed in vegetative growth (cgca and height) but there was no direct correlation between the two. As far as CLNBD is concerned, the data shows that the majority of the hybrids were tolerant to the disease. However, the absence of a control or check varieties/clones that are susceptible and resistant to CLNBD does not guarantee the presence of high disease pressure during the season under observation. To be able to draw valid conclusions more two years data is necessary.


The data has provided very important information, which may lead into identification of cashew hy-brids tolerant to CLNBD. In future, all upcoming cashew-breeding trials must incorporate check or control varieties, clones or hybrids that are resistant and susceptible to the disease.


Breeding

Acknowledgements

The authors would like to acknowledge funding from the Government of Tanzania through the Min-istry of Agriculture, Food Security and Co-operative, Cashew Research Steering Committee for ap-proving this study; Cashewnut Board of Tanzania (CBT) and Cashew Industry Development Trust Fund (CIDTF) for ensuring funds were timely available. We are also very grateful to Ms Stela Mfune, Messrs. Dadili Majune, Khalifa Issa Khasan, Ben Mpangala, Said Mpesi for taking lead in data collec-tion, compilation and computerisation. Many thanks go to Mohamed Hassan the farm manager for his invaluable contribution in maintaining trials and supervision of data recording. We also appreciate the contribution of our drivers Mr. Twalib Mmole and Hashim Mchotike who played a substantial role in facilitating data collection.

References

Bashiru, R. A. (2013). Improvement of top-working procedures for cashew orchard upgrading in Tanzania. In Masawe, P. A. L., Esegu, J. F. O., Kasuga, L. J. F., Mneney, E. E., and D. Mujuni (Eds). Proceedings of the Second International Cashew Conference, Kampala, Uganda, 26–29 April 2010. CAB International, Wallingford, UK, pp. 34-38.

Brown, L.C., Minjaand, E., and S. Hamad (1984). Cashew production in East Africa. Conference in Advancing Agricultural Production in East Africa, Arusha, Tanzania.

Castellani, E., and F. Casulli (1981). Osservazioni preliminary su Oidium anacardii Noack agente del mal biancodell’anacardio. Rivista di Agricultura Subtropicale e Tropicale, 75, 211-222.

Intini, M., and M. E. R. Sijaona (1983). Calendar of disease control with reference to the phonological phase of cashew (Anacadium occidentaleL.) in Tanzania. Rivista di Agricultura Subtropicale e Tropicale, 76, 419-422.

Masawe, P. A. L., and F. A. Kapinga (2013). Preliminary observations on the performance of selected elite cashew hybrids at Nachingwea, southern Tanzania. In Masawe, P. A. L., Esegu, J. F. O., Kasuga, L. J. F., Mneney, E. E., and D. Mujuni. (Eds). Proceedings of the Second International Cashew Conference, Kampala, Uganda, 26–29 April 2010. CAB International, Wallingford, UK, pp. 15-19.

Neto, V. (1992). Yield variability of cashew trees in East Africa. PhD Thesis, University of Reading, Reading, UK.

Neto, V., Caligari, P. D. S., and R. Mead (1996). Yield variability of cashew trees in East Africa. Journal of Plantation Crops, 24, (Supplement), 419-429.

Neto, V., Caligari, P. D. S., and R. Mead (1994). Yield variability of cashew trees in East Africa. International Symposium on Plantation Crops (PLACROSYM XI) 30/11 to 3/12 1994, Calicut Kerala, India.


Breeding

Ohler, J. G. (1967). Cashew growing. Tropical Abstracts (Netherlands) 22(1), pp. 1-9.

Ohler, J. G. (1979). Cashew. Communication 71, Department of Agricultural Research, Royal Tropical Institute, Amsterdam, The Netherlands.

Shomari, S. H. (1988). A review of cashew research in Tanzania. Paper presented at the Tanzanian Agricultural Research Masterplan Conference, Arusha, 12–15 December 1988.

Sijaona, M. E. R. (1984). Investigation into effectiveness of sulphur W.P. against Oidiumanacardii Noack on five-cashew tree types at Naliendele. Rivista di Agricoltura Sub- tropicale e Tropicale, 78, 199-209.

Sijaona, M. E. R., Reeder, R. H., and J. M. Waller (2005). Cashew leaf and nut blight – a new disease of cashew in Tanzania caused by Cryptosporiopsis spp. Plant Pathology, 55(4), 576.

Topper, C. P., Boma, F., and H. Mhando (1997). Evaluation of fungicides for the control of powdery mildew (OidiumanacardiiNoack) on cashew in Tanzania. B. On-farm testing of fungicide control strategies. Proceedings of the International Cashew and Coconut Conference, Kilimanjaro Hotel, Dar es Salaam 17th to 21st February 1997, pp. 270-276.

TPRI (2011). List of registered pesticides in Tanzania. Release of November 2011.

Uaciquete, A., Korsten, L., and J. van der Waals (2013). Leaf and fruit diseases of cashew (Anacardium occidentale L.) in Mozambique. In Masawe, P. A. L., Esegu, J. F. O., Kasuga, L. J. F., Mneney, E. E., and D. Mujuni (Eds). Proceedings of the Second International Cashew Conference, Kampala, Uganda, 26–29 April 2010. CAB International, Wallingford, UK, pp. 61-67.


Breeding

Cashew Germplasm Evaluation in Coastal Kenya

F.K. Muniu*, W.S. Mwinga and S. MwashumbeKenya Agricultural and Livestock Research Organisation

Mtwapa, Kenya


AbstractCashew is the most important cash crop in coastal Kenya. The major challenges facing cashew produc-tion include uneconomically old orchards, poor quality planting materials, poor agronomic practices, high post-harvest losses, and prevalence of pests and diseases. The majority of trees grown are unim-proved varieties. In an effort to introduce new varieties, a selection programme was initiated. Fourteen cashew clones were evaluated in a randomised complete block design with three replications. Data on tree height, canopy diameter, date to first flowering and harvesting, apple and nut characteristics and yield was collected for seven years. Seven years after planting, four clones have given yields of 38-45 kg of nuts per tree and have been recommended for multiplication by farmers in the region.

Key words: cashew clones, cashew yields, nut, cashew apple

IntroductionCashew is the most important cash crop in coastal Kenya. The major cashew producing districts are Msambweni, Kilifi, Kwale, Malindi and Kaloleni. In 2012, the area under cashew nut was 30,805.60 ha, which produced 29,026 tons, valued at KShs. 1,332,571,400. The contribution of cashew nut was 19.31% of the overall value of nuts. In 2012, the area, yields, and value increased by 1%, 28% and 30%, respectively compared to 2011 (HCDA, 2011). The high increase in value was attributed to improvement in prices achieved through direct negotiations between the processors and growers. A price dialogue forum between the processors and farmers association officials is held annually at the beginning of the harvesting season, to set the minimum farm gate price for in-shell nuts. During the 2011-2012 season, the minimum farm gate price was set at KES 45 per kg. The leading cashew nut producing counties in value are Kilifi (57.2%), Kwale (27.3%), Lamu (10.7%) and Tharaka Nithi (4.4%). The cashew nuts industry directly and indirectly employs 4,000 and 50,000 people, respec-tively.

The major challenges facing cashew nut production include uneconomically old orchards, poor qual-ity planting materials, poor agronomic practices, high post-harvest losses, and prevalence of pests and diseases.

Cashew nut varieties grown in Kenya fall in two categories: local and improved varieties. From a cen-sus conducted in 2008, 1,985,375 cashew nut trees, which accounts for approximately 94.7% of the cashew nut tree population are unimproved varieties. Improved varieties accounted for 5.3% of the tree population (Githende, 2009). The percentage may have changed due to recent efforts in planting improved cashew varieties.


Breeding

Cashew variety improvement in Kenya started with establishment of 101 trees chosen from 300 trees available at Mtwapa. Yields were recorded in the period 1963 to 1968. The yields varied from 0.16 kg to 15.39 kg per tree/annum with an average of 4.01 kg per tree. The field was thinned in 1969 retaining 161 trees that were recorded in the period 1975/76 and 1976/77. Their yield ranged from 0 to 78 kg per tree, with an average of 5.33 kg per tree. The best seven trees were identified; these included A41, A47, A81, A82, A82, A90, and A100. In another selection, five trees JK226, JK292, JK411, JK90 and JK460 were identified for use in a breeding programme.

A recurrent selection programme was initiated on the basis of selected 14 trees: (A41, A47, A81, A82, A90, A100 and A75-83, T83, JK90, JK226, JK292, JK411, JK460 and B1). Seeds from these trees have been distributed to farmers for planting. Vegetative propagation of outstanding trees was used to establish clonal tests at several locations. In April 2005, cashew rootstock was raised from local cashew and grafted with the 14 selected cashew clones in order to evaluate their performance in terms of yield and quality and tolerance to major pests and diseases.

Materials and methodsRootstock of local cashew was raised at KALRO Mtwapa in February 2005. It was grafted with scion from 14 selected high yielding cashew identified in a recurrent selection programme. The 14 clones were A41, A47, A81, A82, A90, A100 and A75-83, T83, JK90, JK226, JK292, JK411, JK460 and B1. Five trees of each of the 14 clones were planted in July 2005 in a randomised complete block de-sign with three replications at spacing of 12m x 12m. The trees were well maintained through regular weeding, and pest and disease control measures were undertaken. Data on tree height and canopy diameter was taken on a quarterly basis. The dates for first flowering and harvesting were also taken. Apple and nut characteristics were recorded. Yield data was also collected for five years.

ResultsTable 1 illustrates tree height (m), canopy diameter (m) and apple characteristics of 14 Kenyan cashew clones in 2010. Tree height and canopy size varied significantly (p<0.05). The tallest clone was MT10 at 6.4m while the shortest was A41 at 4.5m. The highest canopy width was recorded in Clone A82. Apple colour ranged from red to light yellow. The majority of the clones had a rounded apple shape (Table 1).


Breeding

Table 1: Height, canopy width and apple characteristics of 14 Kenyan cashew clones in 2010

Clone Height (m)

Canopy width (m)

Apple colour

Apple shape

A 81 6.2 8.9 Red RoundedA 82 5.7 10.3 Red RoundedA 100 5.4 7.9 Red AngularA 75/83 5.4 7.3 Red RoundedA 90 4.6 6.6 Red RoundedA 41 4.5 7.9 Red FlattenedJK 90 5.0 8.3 Yellow AngularJK 460 5.3 8.4 Light Yellow AngularJK 228 5.6 9.3 Red FlattenedJK 292 4.9 6.7 Yellow AngularT 83 5.2 8.2 Red RoundedA 47 5.1 8.6 Yellow RoundedJK 411 4.8 8.5 Red FlattenedMT 10 6.4 9.0 Yellow Angular

Table 2 presents the apple and nut characteristics of 14 cashew clones in coastal Kenya.

Table 2: Apple and nut characteristics of 14 Kenyan cashew clones

Clone Apple weight(g)

Nut weight (g)

Apple lengthcm

Apple width cm

A 81 29.0 4.0 2.8 2.3A 82 32.5 9.0 2.7 2.1A 100 29.0 5.0 3.0 2.6A75/83 25.0 5.0 2.8 2.7A 90 22.5 7.5 3.7 2.1A 41 40.0 2.5 2.4 2.2JK 90 40.0 5.0 3.4 2.5JK 460 39.0 2.5 2.1 2.4JK 228 22.5 2.5 2.7 2.1JK 292 22.5 2.5 3.1 2.1T 83 25.0 5.0 2.7 1.8A 47 36.0 6.5 2.9 2.1JK 411 30.0 5.0 2.8 2.3MT 10 21.0 4.0 2.7 2.9

Five-year yields of cashew clones are shown in Table 3. The best performance of 45 kg per tree was achieved in clone A75/83. Other clones that have shown consistent high yields are A81, A82 and A100.


Breeding

Table 3: Five-year yields (2009-2013) in kg for 14 cashew clones in coastal Kenya

Clone Yield/Year (Kg)

Y2009 Y2010 Y2011 Y2012 2013

A 81 9 11 27 29 38A 82 10 12 25 30 40A 100 12 20 24 31 38A75/83 10 25 30 35 45A 90 8 14 20 32 33A 41 7 10 27 32 36JK 90 7 12 25 31 35JK 460 9 20 24 30 34JK 228 10 25 27 30 34JK 292 8 14 20 32 37T 83 9 11 20 25 30A 47 8 12 23 30 34JK 411 6 18 27 30 36MT 10 8 20 27 30 36

DiscussionThere were significant differences in tree height and canopy width among the 14 cashew clones. The two parameters are important for both productivity and orchard management especially in determin-ing spacing. Clones with high canopy width mean that if closely spaced, the canopies would close in very fast. They would need to be planted at wider spacing.

Apple physical characteristics varied among the clones, in shape, colour, weight, length and width. The cashew apple can be a valuable product in the cashew value chain if it is commercially exploited (Sobhana et al., 2010). Based on apple colour, shape and size, various types of cashew can be identified in the Kenyan cashew germplasm (Raul et al., 1997). Development of value added products from cashew apple would depend on the apple types.

The results of this work indicate that there are Kenyan clones with good potential for increasing ca-shew nut productivity. The yields of 30-40 kg per tree at five years indicate an enormous opportunity for increasing cashew production in Kenya. The genetic base of Kenyan cashew germplasm is very low (Muniu, 2010). In recent years some introductions from Tanzania have been established and their performance is still being monitored. More introductions need to be acquired in order to widen the genetic base. In Tanzania, performance of hybrids has shown to be significantly better than control non-hybrids (Masawe and Kapinga, 2010.)


Breeding

ConclusionThere is a need to collect germplasm from all cashew growing areas in the country and to introduce material from other countries. This will provide a basis for developing local hybrids.

Acknowledgements We acknowledge funding from the Common Fund for Commodities which supported the establish-ment of this trial through the Regional Cashew Improvement Network for Eastern and Southern Africa (RECINESA) and KALRO, after the exit of CFC.

ReferencesGithende, G. (2009). Cashewnut subsector in Kenya: Findings of cashewnut tree census and baseline

survey in the Coast Province. Institution Development and Management Services, Mombasa Kenya.

Muniu, F. K. (2010). Status of cashew industry in Kenya. Proceedings of the Second International Ca-shew Conference, Kampala, Uganda, 26-29 April 2010, 168-182.

HCDA (2012). Validated Report, Nairobi.

Masawe, P. A. L., and F. A. Kapinga (2010). Preliminary observations on the performance of selected elite cashew hybrids at Nachingwea, Southern Tanzania. Proceedings of the Second International Cashew Conference, Kampala, Uganda, 26-29 April 2010.

Raul, M. A., Ana, M. S., Paulo, P. T., and S. Manuel (1997). Physical characterisation of cashew (Anacardium Occidentale L) nuts produced by selected nuts in Guinea-Bisau. In Topper, C. P., Caligari, P. D. S., Kullaya, A. K., Shomari, S. H., Masawe, P. A. L., and A. Mpunani (Eds.). Proceedings of the International Cashew and Coconut Conference Trees for life-Key to Develop-ment.. Biohybrids International, Reading UK., 121-127.

Sobhana, A., Matthew, J., and C. Mini (2010). Utilisation of cashew apple in the food industry in In-dia. Proceedings of the Second International Cashew Conference, Kampala, Uganda, 26-29 April 2010, 150-156.


Breeding

PLANTING MATERIAL PRODUCTION



Influence of Scion’s Stockplant Phenological Stage in Success of Grafting of Cashew Seedlings in Côte d’Ivoire

J.B.A. Djaha*, C.K. Kouakou, A. A. N’Da Adopo, A. H. Djidji and M.Y. Minhibo

Centre National de Recherche Agronomique (CNRA)Abidjan, 01 BP 1740 Abidjan 01, Côte d’Ivoire

*E-mail of the corresponding author: [email protected]

Abstract

Cashew (Anacardium occidentale L.) is an important cash crop in Côte d’Ivoire but productivity has remained low due to the use of low yielding genetic potential materials. High yielding cashew trees have been identified but multiplication by grafting has been constrained by limited supply of scions coupled with low percentage success rates. Due to these challenges, the number of grafted plants produced and disseminated to growers has been very limited. The use of only one type of scion with a dormant terminal bud allows for a limited grafting period. Thus, strategies must be developed to satisfy the demand of improved planting material. The objective of this study was to identify other types of scions that could improve the performance of grafting. The trial was conducted using a randomised complete block design with 4 treatments of scions and 3 replications. Four phenological stages, namely herbaceous scion, semi-hard one, hard one and floral twig were grafted onto 120 plants from the same rootstock, by the same grafter. Time between grafting and beginning of appearance of leaves at the top of the scions was recorded. Time between grafting and appearance of maximum scions beginning to have leaves was recorded. Grafting success rate was also recorded. Given the conditions of Côte d’Ivoire, leaves appeared mostly 16 days after grafting. Grafting success was 75% for herbaceous scions and floral twigs, and 85% for semi-hard and hard scions. There was no significant difference between treatments. The 4 types of twigs could be used as scions.

Keywords: cashew, scion, phenological stages, grafting success rate



Introduction

Cashew (Anacardium occidentale L.) is native to South America particularly Brazil and Peru (Trevian et al., 2005). It was introduced in other tropical countries in the sixteenth century by the Portuguese (Martin et al., 1997). The crop was brought into Côte d’Ivoire in 1951 and was mainly planted as forest trees through the 1950s both in savannah and in pre-forest areas (Goujon et al., 1973). Currently, cashew is rapidly becoming one among the important commercial export crops. In 2001, domestic production of cashew nuts was about 100,000 tones, obtained from an estimated acreage of 260,000 ha (N’da Adopo et al., 2001). Statistics show that in 2010 cashew production was more than 330,000 tones mainly due to the expansion of cultivated areas.

In Cote d’Ivoire, cashew plantations were being raised mostly from seed nuts collected from un-selected mother trees. Yield from such trees is very low ranging from 300 to 500 kg/ha (CNRA, 2003). Generally, due to out-crossing, cashew progeny trees established from seeds do not resemble the yielding characteristics of the mother tree. Propagation by vegetative methods such as detached scion grafting is the only feasible and practical way that can be used to multiply true to type cashew varieties. Currently, efforts have been directed towards the improvement of productivity. Research established fifteen ha of cashew orchards to produce scions in three regions (north, northwest and northeast) in 2010, with selected plant material. The orchards were planted at a plant density of 204 trees per hectare. The aim of establishing the cashew orchard was to provide scions for commercial multiplication of improved planting materials by grafting.

Grafting is a standard horticultural practice well established in other fruit crops like mango and citrus in Côte d’Ivoire. However, in cashew there were some challenges limiting mass propagation by grafting. The main reason for inadequate supply of grafted seedlings lies on the fact that grafting was mainly using brown scions with dormant buds which were not available throughout the season. Chipojola et al. (2013) have demonstrated that immature scions can be used to produce successful grafted seedlings. The grafting period could also have great impact on the success of grafts. Mulla et al. (2011), working on Syzygium cumini Skeels, observed that the day of graft-take was shorter when grafting was done in June and higher success rate was registered in May and November.

The aim of this work was to look for an alternative type of scions for cashew grafting in order to increase the quantity and quality of grafts to be produced. The specific objective of this study was to evaluate the influence of scion mother tree periodic growth events on detached scion on grafting success.




The work was carried out at the Fruit Trees Research Station of CNRA based in Lataha Korhogo in the north of Côte d’Ivoire. The site is situated between 9° 34’ north latitude and 5° 34’ west longitude, and is at an altitude of 350 meters above sea level. It experiences tropical wet and dry seasons. The dry season occurs from November to April and the rainy season occurs from May to October. The average annual rainfall ranges between 1400 and 1,000 mm. Climate data recorded during the test period is shown in Table 1.

Table1: Climate data during the experiment period

Period August September OctoberRain fall (mm) 235.7 255.8 117.3Maximum temperature (°C) 24.47 20.34 26.27Minimum temperature (°C) 22.41 18.87 23.51

Rootstocks preparation

Seeds for rootstocks were harvested from the genotype KK of cashew collections planted at the Forestry Research Station, CNRA. The seeds were sorted by visual observation to get clean healthy seeds, then they were immersed in a container half filled with water to separate floaters and sinkers. The sinkers were then soaked in water for 48 hours to stimulate early germination. The pre-germinated seeds were sown 4 cm deep with seed scar facing upward at a spacing of 15 cm within lines in a germination bed. The seeds were then covered with straw and watered early in the morning and/or in the evening. The pre-germinated seeds were transplanted to growing pots measuring 30 cm in height and 10 cm diameter containing substrate consisting of loam, sand and manure in equal proportions. Pots were perforated on the sides and at the bottom to facilitate free water draining. Rootstocks were ready for grafting after 30 days from the pre-germination day.

Scions preparation

The different kinds of scion were obtained from a single clone LA X 4297 in the scions orchard of the Fruit Research Station of CNRA. They were collected on the same day. The different kinds were distinguished by 4 different growth stages: herbaceous (tender) scion, semi-hard wood, hard wood and floral twig (Figure 1).



Figure 1: Scions of different phenological stagesFrom left to right: herbaceous (H), semi-woody (SW), woody (W) and floral twig (F)

Seedlings grafting

Apical wedge/cleft grafting was performed in the morning at 8 a.m. up to 11 a.m., for three consecutive days, by the same grafter. The experimental design which was a randomised complete block with 4 treatments (types of scions), 3 replications (blocks) and 10 plants per plot resulted in 120 of observation plots. The grafted seedlings were visited every day to observe signs of sprouting of successful scions. Maintenance of grafted plants consisted of watering 2 times a day, removing suckers, covering caps and binding tapes. Data recorded included days from grafting to when signs of scion sprouting were observed, and number of successful grafted seedlings. Data was entered into a computer spread sheet (Excel) and analysis of variance (ANOVA) was performed using the statistical software - Statistica 7.1.

Results

Day of graft-take was 16 days for the 4 types of scions. Average grafting success was 35% for herbaceous scions and 45% for semi-woody and woody grafts. The lowest grafting success was 10% for the floral twigs (Table 2). Day of maximum graft-take is the day after grafting when the highest rate of grafting success was obtained. This parameter informs about the speed of scions sprouting. Day of maximum

H FW SW



graft-take was 16, 33 for herbaceous scion, 16 for the semi-woody one, 18 for the woody one and 18, 33 for the floral twig (Table 2).

Grafting success rate, at the day of maximum graft-take was 41.66 % for herbaceous scions, 45% for semi-woody scions and 51.66% for the woody one. The lower rate of success in grafting was 26.66% for floral twigs (Table 2). There was no significant difference between the types of scions (P = 0,122) (Table 2).

Average grafting success was 80%. However, an average success rate of 75% was obtained for herbaceous scions and flowering twigs, while semi- woody and woody scions had graft success of 85 %. No significant difference was observed between treatments (P = 0.135) (Table 2).

Graft-take period duration is the time interval between the beginning and the end of graft-take. The average graft-take period duration was 1 day for herbaceous scions, 8.5 days for the semi-woody one, 9.5 days for the woody one, and 13 days for floral twigs (P=0,033) (Table 2).

This study was conducted with the aim of increasing the supply capacity of cashew scions. Success in grafting using herbaceous, semi-woody, woody and floral twig scions was compared. Apart from the rate of sprouted scions at the day of graft-take and time interval between beginning and end of graft-take, there was no significant difference between the parameters.

Table 2: Day of graft-take and rate of grafting success

Variable

Scions phenological stagesHerbaceous

scionSemi-woody scion

Woody scion

Floral twig

Prob

Percent of sprouted scions at the day of graft-take (%)

35 45 45 10 0,046

Day after grafting when the high-est rate of sprouted scions is ob-served (DAGraft)

16, 33 16 18 18,33 0,077

Rate of grafting success at the day when the highest rate of sprouted scions is observed (%)

41,66 45 51,66 26,66 0,122

Days between beginning and end of graft-take

1 8,5 9,5 13 0,033

Rate of grafting success during the experiment

75 85 85 75 0,135

Key: DAGraft = Day after grafting



Discussion

Table 2 presents the number of days to grafts success and number of successful grafted seedlings for each type of scion evaluated. The results indicate that the days taken from grafting to scion sprouting (days) were fewer than the 19.9 days obtained with side grafting by Djaha et al. (2012), and 21 days obtained by Chipojola et al. (2013). The fast union healing obtained in this trial could be due to the apical grafting technique used. Djaha et al. (2012) and Chipojola et al. (2013) used side grafting in which sap flow is shared between rootstock and scion. Instead, in the apical grafting, the stem of the rootstock is cut and sap flow is towards the graft union. Another factor that contributed to fast scion sprouting could be the difference of age of the rootstocks used in this experiment compared to those used with side grafting. Chipojola et al. (2013) conducted grafting onto rootstocks older than 4 months, whereas in this work (also similarly with Asante (2001) rootstocks of ages 1 month and 1.5 months respectively were used.

The duration of graft union healing was shorter for herbaceous scions, intermediate for woody and semi- woody scions and longer for floral twigs. This suggests that if the scion is tender it sprouts earlier. The results from this trial were the same as those of Chipojola et al. (2013) which showed that the immature scions (tender scions) take less time to unite with rootstock than mature ones (woody and floral twigs). According to these authors, the short recovery period of immature scions (herbaceous) is attributable to the quality of rootstock used. This has been the case in this work where scions rootstocks aged 1 month after germination were used. Thus, with proper planning of rootstock production, immature scions can be used in vegetative propagation, as well as mature ones.

The success rate was 75% for herbaceous and floral twig scions, and 85% for semi-woody and woody scions. Our results are in agreement with those obtained by Bashiru (1997) on cashew in Tanzania. No significant difference was observed between different types of scions despite their growth stage differences. Results obtained from this work match those of Scheidecker (1961) which showed that extreme anatomical differences may not play a big role in the success of grafting. Similarly, Araujo et al. (2002) showed that the phenological stage of the mother tree from which the scions are taken has no influence on the grafting success rate.

Conclusion

The study was conducted with the aim of increasing the supply capacity of cashew scions. Success in grafting using herbaceous scions, semi-woody ones, woody ones and floral twigs were compared. According to the results obtained, herbaceous, semi-woody, woody and floral twigs scions can be used in cashew grafting. They complement the dormant terminal bud currently used for cashew grafting in Côte d’Ivoire.

Further studies to evaluate the field performance of plants grafted with the four scion types are recommended.



Acknowledgements

We thank the cashew sector in Côte d’ Ivoire whose funding through FIRCA helped to make this work successful.

References

N’da Adopo, A. A., N’guessan, K. A., Kehe, M., DEA, B. G., and E. Koffi (2001). Impact de l’anacardieret du manguier sur l’environnement et les revenus des paysans au Nord de la Côte d’Ivoire. Future of perennial crops investment and sustainability in the humid tropics. Yamoussoukro, Côte d’Ivoire, 5-9 novembre 2001.

Araujo, F. P., and N. M. T. Castro (2002). The influence of physiological factors on grafting of umbú at different times of the year. Revista Brasileira Fruticultura, 24(3), 752-755.

Asante, A. K. (2001). Compatibility studies on cashew-mango graft combination. Ghana Journal of Agricultural Science, 34, 3-9.

Bashiru, R. A. 1997. Studies on vegetative propagation methods of cashew in Tanzania. Proceedings of the International Cashew and Coconut Conference, Dar es Salaam, Tanzania, 302-308.

Boutherin, D., and G. Bron (1989). Multiplication des plantes horticoles. Éditions technique et documentation. Lavoisier, Paris.

Chipojola, F. M., Mwase, W. F., Kwapata, M. B., Njoloma, J. P., Bokossi, J. M., and M. F. Maliro (2013). Effect of tree age, scion source and grafting period on the grafting success of cashew nut (Anacardium occidentale L.). African Journal of Agricultural Research, 8(46), 5685-5790.

Deloire, A. (1981). Etude histologique du greffage herbacé de combinaison compatible dugenre Vitis. Vitis, 20, 85-92.

Djaha, A. J. B., N’da Adopo, A. A., Koffi, K. E., Ballo, K. C., and M. Coulibaly (2012). Croissance et aptitude au greffage de deux génotypes d’anacardier (Anacardium occidentale L.) utilisés comme porte-greffe en Côte d’Ivoire. International Journal of Biological and Chemical Sciences, 6 (4), 1453-1466.

Goujon, P., Lefèbvre, A., Leturcq, P., Marcellesi, A. P., and J. C. Praloran (1973). Etudes sur l’anacardier. Etudes sur l’anacardier. Revue Bois et Forêts des Tropiques, 151, 27-53.

Mulla, B. R., Angadi, S. G., Karadi, R., Patil, V. S, Mathad, J. C., and U. V. Mummigatti (2011). Studies on softwood grafting in jamum (Syzygium cumini SKEELS.). Acta Horticulturae, 890, 117-122.

Scheidecker, D. (1961). La greffe, ses conditions anatomiques, ses conséquences physiologiques et ses résultats génétiques éventuels. Année Biologique, Tome 37, Fascicule 3-4, 116-117.



Evaluation of Effect of Plastic Bags Size and Duration of Stay in the Nursery on the Performance of Grafted Cashew Seedling

R. A. Bashiru

Cashew Research Programme, Naliendele Agricultural Research Institute,

P.O. Box 509 Mtwara, Tanzania

Email of the corresponding author: [email protected]

Abstract

In Tanzania, different plastic bags of different sizes have been used for raising cashew seedlings but the most cost effective type has not been ascertained. Normally, seedlings raised in plastic bags are recommended to be kept in the nursery for short time of about six months. However, in most cases, seedlings overstay in the nursery because the onset and amount of rainfall received in most cashew growing areas is unpredictable. When the seedlings overstay in the nursery, they develop a defective root system and are slow to resume growth after transplanting. In this study the effects of plastic plant bag sizes and duration of stay of seedlings in the nursery on the growth of grafted seedlings in the nursery and after transplanting were determined. Seedlings raised in plastic bags of two different sizes were kept in the nursery at Naliendele Agricultural Research Institute, in three time intervals. Results showed non-significant differences between plastic bag sizes in terms of rootstock thickness at rootstock cotyledonary stage thus percentage success rates in grafting. Grafted seedlings can be retained in the nursery for one year without fertiliser top up, with a well-established root system. No significant difference was observed on the root structure after transplanting. It was concluded that a 5cm diameter filled plastic bag could be used for raising cashew seedlings.

Key words: plastic bag, volume, holding time



Background

Cashew (Anacardium occidentale L.) is the main cash crop in the southern zone of Tanzania although it is also grown in other regions. Traditionally, cashew was mainly propagated by seeds but currently it is propagated vegetatively by either grafting or budding. Plastic plant bags are widely used to propagate cashew because the crop is highly sensitive to bare-root transplanting. Roots of bare-root cashew seedlings succumb to desiccation and damage during handling, which leads to poor post-transplanting performance and high mortality rate. Bag production does not only protect the root system from damage during movement of seedlings and at transplanting, but also promotes better post transplanting establishment, reduces nursery space, transportation and labour costs (Mathers et al., 2007; Scott et al., 1998). This has been possible due to protection of root systems in soil media up to the time of transplanting. Root regeneration is of importance because new root growth enables the seedling to establish functional connection with the soil, thereby overcome the moisture stress imposed by transplanting (Edward et al., 2007).

Plastic bags of different sizes have been tested, but the most cost effective one has not been identified. Currently, an eight-centimetre diameter filled plastic bag had been found to be suitable because it produces strong seedlings, which guarantees survival after transplanting. However, this bag size was not economic as it occupies large space in the nursery, takes more substrate and it is bulky and therefore expensive in terms of labour and transport.

Normally, it is recommended that seedlings raised in plastic bags should be kept in the nursery for a short time (about 6 months) (Anonymous, 2001). Under normal circumstances, in most times, seedlings stay longer than this period because the planting out depends on the on-set of the main rains. Keeping seedlings in the nursery for too long is undesirable as it may lead to development of a defective root system of the seedlings (Edwin, 2002). The deformities get amplified during the post transplanting period in the fields. Some field planted trees showing stunted growth, wilting or a dying condition from unknown maladies had been associated with this phenomenon (Anonymous, 2000). Cashew plants grow well where the soil into which the plants are planted is in a condition which encourages rapid development of both lateral and vertical roots (Ngatunga, 2000; Argles, 1976). The objective of the trial was to determine the effects of plastic bag sizes and duration of stay of grafted cashew seedlings in the nursery and after transplanting in the field.


Two separate experiments to evaluate the effects of plastic bag sizes on grafted seedlings held at different time intervals in the nursery and after planting out were conducted at Naliendele Agricultural Research Institute (NARI) cashew nursery from November 2008 to February 2010.

Effects of plastic bag sizes

In this experiment, two sizes of open-bottomed plastic bags (sleeve) comprising 7cm and 10cm diameter when filled with a substrate (Plate 1a, 1b and1c) were superimposed on three grafting time intervals: January 2009, July 2010 and December 2010.



All plastic bags were filled with substrate containing 70% sandy soil and well decomposed manure, and then supplemented with 20 g of NPK (10:20:10:0.1B) per litre of soil mix. The mixture was moistened and then firmly pressed into bags to a depth of about three-quarters of the height of the plastic bags. The bags were then topped up more loosely with mixture and pressed down slightly to about 2 cm below the top. Healthy, clean, medium size mature cashew seed nuts were immersed in clean water to separate floaters and then soaked for 24 hours before they were sown. All plastic bags were kept under a 63% black nylon net shade during the course of the experiment to protect the seedlings from intense sun radiation.

Data collected included seedling height, girth, percentage success of grafts and root system structure. Girth was taken around the node of the bottom leaves (the graft union point). Data was analysed using a statistical analysis package Genstat – two samples T-test.

Plate 1a: Plants in small and in big plastic bags

Plate 1b: Small (5cm diame-ter) filled plastic bags

Plate 1c: Big (7.5 cm diame-ter) filled plastic bags

Effect of time intervals

In the second experiment, the grafted seedlings held for three, six and 12 months were transplanted in the nursery at NARI whose soil was sandy-loam (about 70% sand). The experiment was the progression of growth of plastic bag plants in field conditions after transplanting. Two factors were investigated including the effect of duration of stay of seedlings in the nursery and the effect of bag sizes. The treatments were applied in a completely randomised block design, in a factorial arrangement, with three replicates. Plot size was two trees. The plants transplanted in February 2011 were uprooted in February 2013 to investigate the root system structure. Lateral roots were exposed by removing the soil with a small nursery hand tool (scoop). Tap roots and other vertical roots were exposed by digging close to the base of the trunk from where they were readily traced. The pits were deepened to follow the course of the roots. The root structure measurements recorded included the longest lateral root, the depth of the tap root and total number of roots. Data was analysed using “Two-way ANOVA (in Randomized Blocks)” using Genstat.



Results

Results on rootstock growth in girth (Figure 1a) and percentage success rate in grafting (Figure 1b) showed non-significant differences (P >0.05) between the plastic bag sizes.

Results

Fig. 1a: Effect of polythene container size on rootstock growth in girth.

Fig. 1b: Effect of polythene container size on graft percent success.

Figure 2.1 Effects of time of stay in the nursery and

size of container on the growth of tap roots.

Vertical bars represent SE.

Figure 2.2 Effects of time of stay in the

nursery and size of container on the growth of

lateral roots. Vertical bars represent SE.

Plates 2a, 2b and 2c are cashew grafted seedlings uprooted from small (5cm) and big (10cm) diameter plastic bags held in the nursery at different time intervals. There were no notable differences between the height of seedling shoots grown on small and big plastic bags held for three and six months in the nursery. Significant differences were noted between big and small plastic bags held for 12 months in terms of leave health. Seedlings growing in big plastic bags had green healthier leaves than those in small plastic bags, which appeared to senesce.

Spiralling of lateral roots was apparent on the surface of the intact soil ball when the plastic bags were removed. The density of roots on the surface of the soil ball appeared to increase with increasing time of stay of seedlings in the nursery. The three-months old seedlings had few and less brittle lateral roots than the six and 12 months old seedlings whose roots appeared to be bag-bound. No tap root coiling was observed in all plastic bag sizes at all holding times in the nursery.



Plate 2a. Uprooted seedlings from small (A) and big (B) plastic bags held for three months in the nursery.

Plate 2b: Uprooted seedlings from small (A) and big (B) plastic bags held for six months in the nursery

Plate 2c: Uprooted seedlings from small (A) and big (B) plastic bags held for twelve months in the nursery

Figure 2a below presents the effects of time of stay in the nursery and size of bag on the growth of roots of grafted seedlings. No significant statistical difference (P>0.05) was detected between plastic plant bags sizes, duration of stay of seedlings in the nursery, and plastic plant bag size x duration of stay interaction. The main tap and vertical (sinker) roots were traced to a mean depth of 115 cm and sinker roots were apparent (Plate 2a to 2f ).

The mean length of the longest lateral roots is presented in Figure 2b. Significant interaction was recorded between size x duration of stay at (P<0.05). The small bags that had stayed in the nursery for 3 months recorded the longest (242 cm) mean lateral roots and this was significantly different from roots generated in other bag sizes. The shortest mean root length was 90cm and the lateral root mean length was 145 cm.

Figure 2c shows the effects of time of stay in the nursery and bag size on the mean number of roots per plant. There were no significant statistical difference (P>0.05) observed between the durations of stay in the nursery, plastic bag (PB) size and interaction. However, the highest number (7) and lowest one were recorded from small PB at 3 months, and big bag at 6 months duration of stay in the nursery, respectively.



Figure 2a: Effects of time of stay in the nursery on the growth of tap roots in different plastic bag (PB) sizes. Vertical bars represent SE.

Figure 2b: Effects of time of stay in the nursery on the growth of lateral roots in different plastic bag (PB) sizes. Vertical bars represent SE.

Figure 2c: Effects of time of stay in the nursery and size of plastic bag (PB) on the number of roots. Vertical bars represent SE.

Observation on the root system of young cashew trees revealed three categories: clear single vertical tap root (Plates 3a and 3b), obliquely branched tap root with sinker roots (Plate 3c and 3d), and J-shaped tap roots (Plate 3e and 3f ). The observations indicated the proportions of the trees with clear tap roots was 37% of the total number of uprooted trees, the proportion of obliquely branched tap root with sinker roots was 37% while the remaining proportion was J-shaped root system.

Dep

th o

f Tap

root

s (cm

)

Time of stay in the nursery

Small PB Big PB

Leng

th o

f the

late

ral r

oot (

cm)

Time of stay in the nursery

Small PB Big PB

No.

of ro

ots

Time of stay in the nursery Small PB Big PB

Results









Results











Plate 3a:Upright vertical tap root with lateral roots

Plate 3b: Clear single tap root with lateral roots

Plate 3c: Obliquely branched tap root with sinker roots

Plate 3d: Branched tap root with lateral roots.

Plate 3e: J-shaped tap root with sinker and lateral roots

Plate 3f: J-shaped tap root with lateral roots

Plate 3: Comparison of root structures of two year-old grafted trees grown in the nursery.

Discussion

The insignificant differences of rootstock girth and percentage success rate between the small and big plastic bags were apparent. This means both plastic bag sizes produced rootstocks, which had attained good stem girth suitable for grafting and therefore similar percentage success rates. These similarities could be attributed to the age of rootstocks when cotyledons were still attached, and the node of the bottom two leaves where grafting was done. At this age, both seedlings were still utilising food reserves from the cotyledons. It was most likely that if grafting had been made higher above the two bottom leaves when the cotyledon had withered, then the small plastic bags would appear to have a relatively small stem diameter. The small plastic bags (5cm diameter) were growing at relatively high density compared to those in the big plastic bags, which grew at relatively low density (10cm diameter). Normally, plastic bag seedling quality increases with a decrease in growing density and vice versa (Scott et al., 1998). For cashew commercial propagation a plastic bag of 5 cm diameter would appear to be the minimum size that could be used in cashew seedling nurseries, as a bag smaller than this may not provide stem girth suitable for grafting.



The time intervals for holding grafted seedlings in the nursery did not affect the seedlings growth in height. Both sizes of plastic bags produced plants with uniform heights and grafted seedlings appeared to have good shoot-root ratio (8cm rooting depth, i.e. plastic bag height and approximately 8cm seedling shoot height), thus the seedlings were of good quality. The uniform growth probably resulted from supply of diminishing nutrients to the seedlings, as they were growing in a limited quantity of substrate without fertiliser supplement. Seedlings in the small plastic bags were healthy than those retained for 24 months which looked senescing. This suggests that seedlings can be held in the nursery for 12 months without much nutrient stress.

During hot and dry weather, the substrate in the small plastic bag gets dry fast. Therefore, when using small plastic bags it is vital to carefully monitor moisture levels and to use a substrate that has a high water holding capacity.

The roots structure in both sizes of plastic bags indicated a normal taproot - not spiralled, twisted, kinked or strangled. This was because tap roots were air-pruned (burned off) at the open-bottomed plastic bags – plastic spread sheet interface.

The root systems of the two-year old uprooted grafted cashew plants indicated strong and highly branched root structures, enabling efficient uptake of water and nutrients. The mean length and depth of roots (Figure 2a and 2b) observed in this trial, was just similar to the findings reported by Tsakiris et al., (1967). Seedlings in the small bags, at 3 months of stay in the plastic bag before transplanting, appeared to have larger roots and well-formed root structure than other plants held at different time intervals. The shortest time interval (three months) of retaining a plant in a small plastic bag before transplanting produced a clear strong tap root. This suggests that the root would have met no obstacle in its course of downward growth, would not have traversed the whole length of the plant bag, and would not have outgrown at the open base of plastic bag. This is the desired root system in cashew as it anchors the tree and taps water from low soil horizons. The second category of roots observed in this experiment was multiple tap roots, coupled with downward growing ‘sinker’ roots. These are outgrowths from the air-pruned tap root at the open base of the plastic bag. Therefore, air-pruning promotes a branched root system, prevents roots from spiralling and plants can be held in plastic bags longer. J-roots are roots diverged from their normal course by obstacles; this is not a good structure because it does not anchor the plant properly.


Nursery operators can adopt the small bags since high grafting percentage success rates are achievable; seedlings can overstay in the nursery for one season without significant effects on root structure after transplanting. However, the substrate filled in the small plastic bags requires more improvement in terms of moisture holding capacity and nutrients.


Acknowledgements

I would like to acknowledge funding from the Government of Tanzania through the Ministry of Agriculture, Food Security and Co-operatives, the Cashew Research Programme for approving the study, and the Cashew Industry Development Trust Fund (CIDTF) for ensuring timely availability of funds. I am also very grateful to Mr. Musa Sungura and Mr. Bashiru Libubulu for taking lead in data collection. Many thanks go to Mr. Yusuf Masanja who played a substantial role in facilitating data collection.

References

Anonymous 2000. Annual Cashew Research Reports for year 2000. Ministry of Agriculture Food Security and Cooperatives Tanzania.

Anonymous 2001. Annual Cashew Research Reports for year 2000. Ministry of Agriculture Food Security and Cooperatives Tanzania, Vol.2.

Argles, G. K. (1976). Anarcadium occidentale L – Cashew. In R. J. Garner (Ed). The propagation of tropical fruit tree. Horticultural reviews No.5 CAB International. Wallford, UK.

Edward, R.W, Vitols, K. C., and A. Park (2007). Root characteristics and growth of bag and bare-root seedlings of oak (Quercasrubra L.) in Ontario Canada. New Forests, 34, 163-176.

Edwin, D. C, Eduardo, O. M., Nestor, O. G., Arturo, E. P., and L. H. John (2002). Nursery management in relation to root deformation, sowing and shading. ACIAR Smallholder Forestry Project.

Mathers, H. M., Lowe, S. B., Scagel, S., Struve, D. K., and case IT (2007). Abiotic factors influencing root growth of woody nursery plants in bags. HortTechnology, 17(2), 151-162.

Ngatunga, E. L. (2000). Cashew management and its effect on soil and intercrops: The case of sulphur dusting in South-eastern Tanzania. D. Phil. Thesis, Katholieke Universiteit Leuven.

Scott, D. S., and R. J. Duval (1998). The effect of bag size. Workshop proceedings. Hortsciency, 8(4), 495-498.

Tsakiris, A., and P. J. Northwood (1967). Cashew nut production in southern Tanzania – The root system of the cashew nut tree. East African Agricultural and Forestry Journal, 33(l), 83-87.



Advances in Biotechnology Advances in Biotechnology

ADVANCES INBIOTECHNOLOGY



‘Next-Generation’ Sequencing Technologies in Cashew (Anacardium occidentale L.) research

A. E. Croxford1* and E. E. Mneney2

1Adelaide University, Adelaide, Australia.2Cashew Biotechnology Unit, Mikocheni Agricultural Research Institute,

P.O. Box 6226, Dar es Salaam, Tanzania.


Abstract

Recent advances in DNA sequencing technologies over the past decade have revolutionised the way we conduct genetic research in agriculture. This so called ‘Next-Generation’ DNA sequencing (NGS) has allowed us to generate copious amounts of data, in a relatively short time, to inform about gene function and arrangement, to develop molecular markers for breeding and to characterise the genetic relatedness of accessions held in germplasm collections. Whilst the technology was initially exploited extensively in the major crops and model plant species, nowadays the cost and ease of use has opened up NGS technology for all plant species. In this article, we report the first use of NGS in cashew to demonstrate the power of the technology for paternity analysis and discuss the potential for its use in a wide range of research areas including plant breeding, reproductive biology and plant protection in cashew.

Key words: next-generation sequencing, cashew, paternity analysis, microsatellites

Introduction

The development of DNA sequencing strategies in 1977 (Sanger et al., 1977; Maxam and Gilbert, 1977) led to a dramatic change in the field of agriculture. Today, DNA sequencing is an essential tool in most agricultural research programmes enabling the characterisation and modification of specific genes, assessment of genetic variation of germplasm collections, diagnosis of pathogen infection in the field and providing markers for early selection in breeding lines (Adato et al., 2015, Tardivel et al., 2014; Li et al., 2014; Zalapa et al., 2012).

In the past decade, DNA sequencing technology has developed to be able to sequence DNA tem-plate on a mass-scale in what is termed ‘Next-Generation’ sequencing (NGS). NGS has generated a remarkable increase, by orders of magnitude, in sequence output throughout the world and with this a corresponding decline in cost per individual sequence. This has led to an exponential increase in the number of NGS-focused publications in the past decade (NCBI, 2015).



This drastic increase in sequencing capacity has transformed many aspects of crop breeding, genetics and plant biotechnology and has changed the manner in the way researchers address biological prob-lems in agriculture. Whilst the maximum throughput NGS system is most desirable, it is important that all sequencing systems must generate highly accurate base calls and preferably long sequence reads (Patel and Jain, 2012).

There are four major technical NGS platforms that have dominated research in agriculture over the past decade: Roche 454 Life Sciences, Illumia (HiSeq, NextSeq, MiSeq), Applied Biosystems SOLiD and Ion Torrent, with each having its own strengths and limitations. All four NGS technologies are massively parallel sequencing systems that rely on the immobilisation of millions to billions of indi-vidual DNA molecules attached to a solid surface. The major differences between the technologies are in the various chemistries that they use and in the means they detect and record the DNA sequences. The four platforms are defined in the sections that follow.

Roche 454 Life Sciences

The Roche 454 system was the first platform commercially released and is based on emulsion PCR of DNA that is fixed to between 1–2 million beads situated on a titanium plate (Green et al., 2010). This sequencing technology is based on pyrosequencing where the sulfurylase and luciferase enzymes are used to detect the sequence order of DNA fragments. A limitation of the 454-technology is that the accuracy of assigning bases, especially at regions of mononucleotide repeats, is low and for that reason it has become less popular in research programmes (Mardis, 2008).

IlluminaHiSeq, NextSeq and MiSeq

The Illumina platform is currently the most widely used NGS system in agricultural research and breeding (Liu et al., 2015). The technology operates by immobilising the DNA template onto a flow-cell and then each single DNA molecule is amplified in clusters using a ‘bridging PCR’ amplification reaction. The DNA sequence is then recorded by utilising different fluorescent labels and an optical camera captures the detection. The latest HiSeqsystem has the largest amount of output of all NGS platforms being able to sequence up to two billion sequences in a single run. This system can also exploit the use of ‘paired-end’ sequencing where sequence information can be generated from both directions of a DNA molecule and this can generate read lengths up to 600 bp on the latest MiSeq system (Illumina, 2015).

Ion Torrent Life Technologies

The Ion torrent-sequencing platform differs from other NGS systems in that its sequence identifica-tion is based on the electronic detection of changes in pH due to the release of a proton during nucle-otide incorporation. In this system, DNA is bound to an ion chip and relatively short DNA molecules are sequenced (up to 100bp in length) in parallel using a semiconductor-sensing device allowing up to 10 million reads to be sequenced simultaneously (de la Fuente et al., 2014).



SOLiD Applied Biosystems

In the SOLiD NGS sequencing system, DNA sequence is generated by utilising the ligase enzyme in a reaction called ‘Sequencing by ligation’. Here, fluorescently labelled probes hybridise to the com-plementary sequence on the DNA template strand and when matched fluorescence is released that is recorded. The output capacity of the SOLiD platform is similar to the Illumina system; however, the sequence length is significantly shorter (Pandey et al., 2008).

Applications in agricultural research

Over the past decade NGS has been used in agricultural research for numerous applications includ-ing whole genome sequencing for gene discovery and genome architecture studies, molecular marker development, genetic and physical mapping, quantitative trait analysis (QTL) and studying organism interactions through metagenomics and metabarcoding studies (Varshney and May, 2012). Some of the applications in which NGS has been used are elaborated below.

Whole genome sequencing

Whole genome sequencing facilitates the discovery of agronomically important genes and permits in depth analysis of genetic diversity and its exploitation for breeding. The rice (Oryza sativa) genome was the first plant species of economic importance to be completely sequenced (International Rice Genome Project, 2005). The genome was generated by Sanger-based sequencing technology, also known as 1st Generation sequencing, and required a large collaborative consortia, took several years and cost an estimate of US$70 million (Hossain et al., 2003). This project led to a plethora of knowl-edge about the rice genome and accelerated the discovery of agronomically important genes and enhanced breeding strategies in the species. Nowadays genome sequencing is relatively quick and cost effective and this has led to more than 200 plant genomes being sequenced to date (NCBI, 2015).

Genome mapping and molecular marker development

NGS has been used to accelerate genetic mapping efforts by identifying large numbers of se-quence-based markers (such as SNPs and microsatellites) and being able to order them along chro-mosomes. The most popular molecular markers being used for this purpose are Single Nucleotide Polymorphisms (SNPs) due to their abundance throughout plant genomes and microsatellite markers due to their highly polymorphic content. In agricultural research these sequence-based markers have been used to study various breeding systems, genotyping and verification and genetic analysis of di-verse material held in germplasm collections (Gupta et al., 2012).

Metagenomics and metabarcoding

Metagenomics and metabarcoding refer to the study of genetic material from mixed communities and may include samples from plants (using chloroplast DNA), animals (using mitochondrial DNA), fungi (mitochondrial DNA) and bacteria (16S gene). With the development of NGS technologies, metagenomics has become a very powerfull means to identify and quantify relative abundance of



specific individuals in a system (Yousuf et al., 2012). This is very important in agriculture for pest and disease monitoring such as in analysing soil and environmental samples to identify specific fungus strains and insect species. This has been simplified using metabarcoding approaches where conserved gene regions have been identified and specific, universal primers have been developed to analyse spe-cies diversity in samples.

DNA sequencing in cashew

Todate, there have been no reports of NGS being applied to cashew research where there is great potential for its use in accelerating plant breeding efforts and facilitating crop protection. In fact there have been very few publications utilising DNA sequence approaches in cashew: Pell (2004) used sequence of the 18S gene for phylogenic studies, Wang et al. (2002) sequenced specific allergen proteins in cashew and Croxford et al. (2006) sequenced cashew for microsatellite isolation, and only 51 sequences are available in the public database (Table 1).

Table 1: Species comparison of the number of nucleotide sequences held in the public database NCBI (2015)

Common name Species name Number of DNA sequences (NCBI)Maize Zea mays 4,800,895Wheat Triticum aestivum 2,275,874Apple Malus x domesticus 400,588Cassava Manihot esculenta 220,775Mango Mangifera indica 86,020Kiwi fruit Actinidia arguta 7,392Cashew Anacardium occidentale 51

In this study, we use the Illumina MiSeq system to demonstrate the power of NGS in cashew research by rapidly characterising nine elite genotypes held in the Tanzanian collection using 20 microsatellite markers. From this, the outbreeding behaviour of the accessions held in the polyclonal seed gardens were determined.

Material and methods

Plant material and DNA extraction

The nine clonal genotypes (AC10/220, AC10, AC14, AC28, AC4/285, AC4, AZA17/79, AZA17 and AZA2) held in the polyclonal seed gardens at Naliendele and Nanyanga were used in the geno-typing analysis. These nine genotypes are repeated numerous times within the two gardens and are arranged systematically so a comparative assessment could be achieved. For the outcrossing analysis, a total of 50 seeds were collected from each of the two AC10 and two AZA17 clones at both sites (i.e. total of 200 samples), germinated in 15 cm pots at the University of Reading, UK and DNA extracted from the new leaves using the DNeasy extraction protocol (Qiagen, UK).



PCR amplification and MiSeq sequencing

A two-step PCR amplification strategy using 20 specific cashew microsatellite markers developed by Croxford et al. (2006) was used to assess the DNA from the 9 clonal genotypes and the 200 seedlings (see Table 2 for primer details). The first PCR was conducted in 20 µl reaction volumes containing 2x BioMix (Bioline Australia), 0.4µl each of the forward and reverse primers (10µM) and 20ng of DNA. The cashew microsatellite primers were modified to include an additional Illumina adapter sequence (Illumina, 2015) making it compatible with the MiSeq NGS system. Samples were run on a 1% agarose gel to check for amplification before purification using the Agencourt AMPure XP PCR Purification system (Beckman Coulter, USA).

The second PCR reaction was set up using the Illumina Nextera Index Kit (96 Indices, 209 Samples) to add sample-specific indexes and Illumina adapters to the PCR products of the first PCR. A 12.5µl reaction was used containing MyFi Buffer, MyFi polymerase (0.5U), 1.25µl of each of the forward and reverse indexed primers (10µM), and 1.25µl of the purified PCR product. Representative samples of the indexed PCR products were run alongside non-indexed PCR products on a 1% agarose gel to confirm inclusion of the indexes.

Table 2: List of microsatellite markers used in the study

Primer Indent. Forward Primer (5’ – 3’) Reverse Primer (5’ – 3’) Annea l ing -Temp.(°C)

mAoR02 GGCCATGGGAAACAACAA GGAAGGGCATTATGGGTAAG 58.2mAoR03 CAGAACCGTCACTCCACTCC ATCCAGACGAAGAAGCGATG 60.3mAoR06 CAAAACTAGCCGGAATCTAGC CCCCATCAAACCCTTATGAC 58.2mAoR07 AACCTTCACTCCTCTGAAGC GTGAATCCAAAGCGTGTC 58.2mAoR11 ATCCAACAGCCACAATCCTC CTTACAGCCCCAAACTCTCG 60.3mAoR14 AATTGAAGAGTGATTTGGTTG AATAACATGCTACTTACTCAAAT 56.1mAoR16 GGAGAAAGCAGTGGAGTTGC CAAGTGAGTCCTCTCACTCTCA 60.3mAoR17 GCAATGTGCAGACATGGTTC GGTTTCGCATGGAAGAAGAG 56.1mAoR23 CATTCGTTCCAATGCTCCTC CATGTGACAGTTCGGCTGTT 58.2mAoR26 TCCACAAAATCAGCCTCCAC GAGCGCTCGTOTCCTGTACT 60.3mAoR29 GGAGAAGAAAAGTTAGGTAC CGTCTTCTTCCACATGCTTC 58.2mAoR41 GCTTAGCCGGCACGATATTA AGCTCACCTCGTTTCGTTTC 58.2mAoR42 ACTGTCACGTCAATGGCATC GCGAAGGTCAAAGAGCAGTC 60.3mAoR44 CACGTTCGCATCATCCAA CGTCAGAGATTACGCCATTG 58.2mAoR46 CGGCGTCGTTAAAGCAGT TCCTCCTCCGTCTCACTTTC 58.2mAoR47 AAGAGCTGCGACCAATGTTT CTTGAACTTGACACTTCATCCA 58.2mAoR48 CAGCGAGTGGCTTACGAAAT GACCATGGGCTTGATACGTC 58.2mAoR52 GCTATGACCCTTGGGAACTC GTGACACAACCAAAACCACA 58.2mAoR55 TGACTTTCAAATGCCACAAC CTCAAGCTFTCATOGGGATT 58.2mAoR59 TCCGCCCCTACTCCTATATT GAAAACCGAAACCAGAACC 51.8



DNA libraries were sequenced on a MiSeq sequencer (Illumina, USA) at the University of Adelaide, Australia using a MiSeq 300 cycle kit (Illumina, USA). The cashew library was loaded on the MiSeq-flowcell at 12pM with the inclusion of 5% PhiX reference standard (Illumina, USA).

Data analysis

The output data from the Illumina MiSeq was demultiplexed into different files representing the different cashew individuals using the MiSeq Reporter v2.0 software (Illumina, USA). In addition, adapter removal, quality trimming and merging of the reads was achieved using the MiSeq Reporter v2.8 software (Illumina, USA). Individual microsatellite markers were grouped together for each in-dividual using the TextWrarngler software (Bare Bones Software Ltd) and length of repeat units was determined using MS-Excel. Statistical analysis of the paternity was performed using CERVUS 2.0 software (Marshall et al., 1998).

Results and discussion

A total of 15 million DNA sequence reads were obtained from the single sequencing run with an average of 70,000 sequences per individual. This shows the power of the analysis system as all 209 samples could be bulked (i.e. multiplexed) and sequenced together in a single run (approximately 24 hours). Once the sequences were demultiplexed into individual cashew genotypes, each microsatel-lite was scored by identifying the most common alleles with two maximum being present (example shown in Figure 1 below).

Figure 1: Examples of microsatellite profiles for marker mAoR16 resulting from the MiSeq data where AC10 has the heterozygous genotype 160/164 and AZA17 has the genotype 162/166).



Microsatellite markers AoR07, AoR17, AoR23, AoR29, AoR42 and AoR48 could not be scored due to large amounts of stuttering in the PCR amplification (see example in Figure 2). Stuttering oc-curs due to DNA slippage during PCR amplification and is frequent in dinucleotide repeat markers (Shinde et al., 2003). Having a polymorphic set of tri- and tetra-nucleotide repeat markers for cashew would be ideal, as this would solve the problem of stutter and allow for more powerful analysis of the cashew genome.

Figure 2: Example of a marker (mAo29) that could not be scored due to over stuttering of its length

From the analysis of variance, significant differences (P < 0.01) were apparent between the success-fulness of the paternal parents. All candidate father genotypes were identified as contributing at least some of the outcrossed offsprings from both mother genotypes. This suggests that there is no repro-ductive barrier between any of the nine genotypes. There was also significant difference between the performance of different genotypes as paternal parents. The results indicate that AC10 and AC14 were the most successful at fertilising the AZA17 mother trees and AZA17 was most successful at fertilising the AC10 mothers when compared to the other paternal genotypes (Figure 3). Factors such as tree size, number of flowers produced, nectar production, flower production, scent and timing of flowering all may influence how successful a tree is as a paternal parent.



Figure 3: Comparison of the paternal success of candidate male parents between the combined AC10 and AZA17 mother tree test sites

Conclusion

Understanding the mating system of cashew trees is an important step to devise measures to enhance nut yield improvement in cashew. In this study we showed the power of NGS for genotyping and outcrossing analysis in cashew. NGS is used for many applications in agricultural research; and recent advances and associated decreases in cost of sequencing have opened up this technology to even minor crop species such as cashew. This same technology can be utilised for many other purposes in cashew agricultural research such as identifying genes or QTLs that control important agronomic traits such as disease resistance and yield, variety identification and cultivar protection, and monitoring and im-plementing an early measure to combat pest and disease problems on the farm.



References

Adato, A., Sharon, D., Lavi, U., Hillel, J., and S. Gazit (1995). Application of DNA fingerprints for identification and genetic analyses of mango (Mangifera indica) genotypes. Journal of the American Society for Horticultural Science, 120, 259-264.

Croxford, A. E., Robson, M., and M. J Wilkinson (2006). Characterisation and PCR multiplexing of polymorphic microsatellite loci in cashew (Anacardium occidentale L.) and their cross-species utilization. Molecular Ecology Notes, 6, 249-251.

de la Fuente, G., Belanche, A., Girwood, S. E., Pinloche, E., Wilkinson, T., and C. J. Newbold (2014). Pros and cons of ion-torrent next generation sequencing versus terminal restriction frag-ment length polymorphism T-RFLP for studying the rumen bacterial community. PLOS One. 129-141.

Green, R. E., Krause, J., Briggs, A. W., Maricic, T., Stenze, T., Kircher, M., and J. C. Mullikin (2010). A draft sequence of the Neandertal genome. Science, 328, 710-722.

Gupta, S., Kumari, K., Sahu, P. P., Vidapu, S., and M. Prasad (2012). Sequence-based novel genom-ic microsatellite markers for robust genotyping purposes in foxtail millet [Setariaitalica (L.) P. Beauv.]. Plant Cell Reports, 31, 323-337.

Hossain, M., Gollin, D., Cabanilla, D., Cabrera, D., Johnson, N., Khush, G. S., and G. McLaren (2003). International research and genetic improvement in rice: Evidence from Asia and Latin America. Crop Variety Improvement and its Effect on Productivity: Impact of International Agricul-tural Research, 21, 23-33.

Illumina website (2015). Illumina Products and Services, Scientific Content. Accessed 25 Auguest, 2015. http://www.illumina.com/

International Rice Genome Project, (2005)- http://rgp.dna.affrc.go.jp/IRGSP/

Li, F., Fan, G., Wang, K., Sun, F., Yuan, Y., Song, G., and S. YuS (2014). Genome sequence of the cultivated cotton Gossypium arboreum. Nature Genetics, 46, 567-572.

Liu, L., Li, Y., Li, S., Hu, S., He, Y., Pong, R., and M. Law (2015). Comparison of next-generation sequencing systems. BioMed Research International, 26, 67-72.

Mardis, E. R. (2008). Next-generation DNA sequencing methods. Annual Review Genomics and Hu-man Genetics, 9, 387-402.

Marshall, T. C., Slate, J. B., Kruuk, B., and J. M. Pemberton (1998). Statistical confidence for likeli-hood‐based paternity inference in natural populations. Molecular Ecology, 7, 639-655.

Maxam, A. M., and W. Gilbert (1977). A new method for sequencing DNA. Proceedings of the Na-tional Academy of Sciences, 74, 560-564.

NCBI website (2015). The National Centre for Biotechnology Information. Accessed 10 August 2015. http://www.ncbi.nlm.nih.gov/



Pandey, V., Nutter, R. C., and E. Prediger (2008). Applied biosystems solid™ system: Ligation‐based sequencing. Next Generation Genome Sequencing: Towards Personalized Medicine, 12, 29-42.

Patel, R. K and M. Jain (2012). NGS QC Toolkit: A toolkit for quality control of next generation sequencing data. PloS One, 7, e30619.

Pell, S. K. (2004). Molecular systematics of the cashew family (Anacardiaceae). Doctoral Disserta-tion, Faculty of the Louisiana State University and Agricultural and Mechanical College. Sanger, F., Nicklen, S., and A. R. Coulson (1977). DNA sequencing with chain-terminating inhibitors. Proceedings of the National Academy of Sciences, 74, 5463-5467.

Shinde, D., La, Y., Sun, F., and N. Arnheim (2003). Taq DNA polymerase slippage mutation rates measured by PCR and quasi‐likelihood analysis: (CA/GT) n and (A/T) n microsatellites. Nucleic Acids Research, 31, 974-980.

Tardivel, A., Sonah, H., Belzile, F., and L. S. O’Donoughue (2014). Rapid identification of alleles at the soybean maturity gene E3 using genotyping by sequencing and a haplotype-based approach. The Plant Genome, 7, 134-156.

Varshney, R. K., and G. D. May (2012). Next-generation sequencing technologies: Opportunities and obligations in plant genomics. Briefings in Functional Genomics, 11, 1-2.

Wang, F., Robotham, J. M., Teuber, S. S., Tawde, P., Sathe, S. K., and K. H. Roux (2002). Ana o 1, a cashew (Anacardium occidental) allergen of the vicilin seed storage protein family. Journal of Allergy and Clinical Immunology, 110, 160-166.

Yousuf, B., Keshri, J., Mishra, A., and B. Jha (2012). Application of targeted metagenomics to explore abundance and diversity of CO2-fixing bacterial community using cbbL gene from the rhizo-sphere of Arachishypogaea. Gene, 506, 18-24.

Zalapa, J. E., Cuevas, H., Zhu, H., Steffan, H., Senalik, D., Zeldin, E., and P. Simon (2012). Using next-generation sequencing approaches to isolate simple sequence repeat (SSR) loci in the plant sciences. American Journal of Botany, 99, 193-208.



Effects of Genotype, Growth Regulators and Salt Composition on Tissue Culture of Cashew (Anacardium occidentale L.) in Tanzania

E. E. Mneney

Cashew Biotechnology Unit, Mikocheni Agriculture Research Institute

P.O. Box 6226, Dar Es Salaam, Tanzania


Abstract

Cashew production in Tanzania is constrained by lack of a rapid and efficient method of producing quality planting materials. Tissue culture (TC) techniques have the potential to make a significant contribution by overcoming the limitation of conventional techniques particularly in the area of multiplication of elite cashew trees. Tissue culture studies conducted at Mikocheni Agricultural Research Institute over the past few years have produced some promising results, but many technical problems persist particularly with respect to shoot multiplication, rooting and explants viability. In this study, shoot tips and nodal cuttings of four cashew cultivars were cultured on different media supplemented with two growth regulators. The purpose of the study was to evaluate the effect of genotype, salt composition and growth regulators on growth of cashew shoots in vitro. Cashew shoot multiplication was found to be genotype-dependent and strongly influenced by the media and cytokinins used. The best performance in terms of shoot growth was recorded on AC 4 cashew explants raised on Wood Plant Medium (WPM) supplemented with Benzylamino Purine (BAP), while rooting was enhanced when Indole-3-Butyric Acid (IBA) delivered through pulsing. These results are promising but further studies to develop optimal cultural conditions for all stages of micropropagation of cashew are recommended.

Key words: genotype, cashew, tissue culture, in-vitro, clonal propagation.

Introduction

Cashew production in Tanzania is constrained by lack of a rapid and efficient method of producing quality planting materials. Tissue culture (TC) techniques have the potential to make a significant contribution to cashew breeding and multiplication efforts by overcoming the limitation of con-ventional techniques particularly in the areas of multiplication of elite cashew trees and in the safe exchange of vegetative cashew materials. To date, elite materials are multiplied by comparatively slow and expensive methods of grafting, budding and layering. Quantities supplied by these conventional methods very often are inadequate to meet the high demand for quality planting materials. In view of the technical problems associated with conventional propagation methods, Tissue Culture (TC) the newest technique of propagation available, is now a method with particular potential. TC is of



particular importance to vegetatively propagated crops and recalcitrant tree species such as cashew. Studies on TC conducted at Mikocheni Agricultural Research Institute (MARI) over the past few years have produced some promising results but technical problems still persist especially with re-spect to shoot proliferation, rootability and explants viability (Mneney, 2013).

Medium ionic composition and ionic strength are known to affect the shoot responses of many spe-cies. In general, lower rather than higher levels of salt are promotive (Haissig, 1986; George, 1996). Although MS media (Murashige and Skoog, 1962) is the most widely used for axillary shoot prolif-eration of plant species, other media formulations have been reported in some cases to be superior to MS (George, 1996). In view of these differences, this study was carried out to determine the effects of media type and media strength on proliferation of shoot explants.

Growth and morphorgenesis in vitro can be influenced by genotype to such an extent that even closely related varieties of plants can differ substantially in their individual cultural requirements (George, 1996; Boggetti et al., 1999; Mneney, 2013). Because of genotype specificity, an experiment was carried out to determine which of the best four Tanzanian clones would respond best to in vitro culture conditions.

Rooting responses to cashew explants following auxin treatments has been rather poor due to loss of rootability (Mneney and Mantel, 2002; Mneney, 2013). Placing explants on an auxin-contain-ing medium (often containing an abnormally high auxin concentration) for just a short interval followed by transfer to an auxin-free medium (sometimes termed as pre-culture technique (George, 1996; Mneney and Mantel, 2002) can be a more effective method of root induction than prolonged (chronic) auxin applications. The duration of the pre-treatment may be critical. Mridula et al. (1983) found that extending auxin treatment of Sapium from 48 to 72h reduced the percentage of rooted shoots from 70 to 0, while preliminary results by Mneney (1998) showed that rooting of cashew shoots was optimal at 36 to 48h. In view of the fact that adventitious rooting can be strongly influ-enced by the methods of auxin treatment, this study was conducted to determine the optimal IBA concentration and the best method of IBA treatment.


Cashew plant materials used in this study were obtained from explants harvested from in vitro-ger-minated seedlings (Figure 1). Although explants from seedlings are not genetically similar, we used seeds because if successful the TC protocol could be used in multiplying hybrids. To obtain such seedlings, seeds were harvested from field-grown, healthy AC4 and AZA2 mother trees at 6-7 weeks after fertilisation and thoroughly washed for 1h under running tap water. The washed nuts were then surface sterilised using 5% sodium hypochlorite bleach for a further 1h and rinsed in three washes (5 min each) of autoclaved distilled water. The nut was split opened and the kernel removed and washed in sterile distilled water three times to remove germination inhibitors. After washing, the kernel was surface sterilised for 30 min in 1% sodium hypochlorite solution containing 0.1% (v/v) Tween, followed by rinsing three times in autoclaved distilled water.



Figure 1: Sources of explants

Shoot tips and auxiliary shoots of in vitro germinated seedling (left); and auxiliary shoots growing from proximal end of a cotyledonary node (right).

All the materials required in sterile conditions, including culture medium, reagents, water, vessels and tools, were autoclaved at 121ºC under a pressure of 100 KPa for 20 min using an Astell auto-clave. The pH of all culture media was adjusted to 5.8. All aseptic operations were carried out in lam-inar flow hoods (sprayed with 80% ethanol before use). Cultures were incubated in a growth room at 25ºC under a 16-h photoperiod. The light source used was fluorescent lamps (Philips TLD, 50 W/84 HF) providing irradiance levels in the range 55–62 µmol/m2/s1. Germination of cashew nuts and adventitious root induction were carried out in darkness at 25ºC. To control browning, all the media preparations were supplemented with a combination of ascorbic acid (200mM) and Cystain (300 µM) unless otherwise stated.

Shoot nodes excised from one month old in vitro germinated seedlings of Cv AC4 (Figure 1) were cultured on different mineral salt formulations supplemented with 30g/l sucrose and 20µM BAP. The following three salt formulations were tested: WPM, MS and B5.

The best media optimised from the experiments described above (WPM) were subjected to further tests by varying their macroelement concentration to either 1/8, 1/4 or 1/2 strength. MS media (full strength) was used as a control. Other experimental conditions were kept similar to those described above. A total of 48 microshoots were tested for each treatment (4 replicates of 12 microshoots each).

Shoot nodal explants of the four genotypes (AC4, AC10, AZA 17 and AZA2) were cultured on MS media supplemented with 20µM BAP, 30gl-1 sucrose, 3gl-1 Phytagel and either with 1% (w/v)



activated charcoal (AC). A total of 36 microshoots were tested for each treatment (3 replicates of 12 microplants each).

To test the effect of sub-culturing time interval on shoot multiplication of Stage II cultures, axillary shoots (of Cvs AC4 and AZA2) induced by BAP (30 µM) were harvested, cut into single nodes and sub-cultured in fresh media containing 2iP (100 µM) at three different time intervals. The sub-cul-turing time intervals tested were 4, 5 and 6 weeks.

Pulsing treatment is a strategy employed to avoid prolonged exposure of explants to growth regu-lators (George 1996; Mneney, 2013). To evaluate the effect of pulsing on rooting, the shoots were harvested from rooting media and transferred to auxin-free medium at three different time intervals, i.e. 48, 60, 72 hrs. As a control treatment, some cashew explants were placed on the rooting media continuously (CO). A total of 36 cashew explants were tested for each treatment (3 replicates of 12 explants each).

Results and discussions

Effect of WPM on shoot growth and rooting of Stage I shoot cultures

Shoot growth

Results from our previous studies have shown that WPM can significantly influence shoot induction and growth of Stage I cashew cultures (Annon, 2013). In the study, the performance of WPM was evaluated on two other important tissue culture stages, i.e. Stage II (multiplication) and Stage III (rooting). Regarding Stage II shoot cultures, WPW was found to out-perform the standard media (MS) in all the parameters studied, i.e. percentage bud sprouted, shoot length and number of nodes (Figure 2a, b and c).



Figure 2. Effect of WPM on shoot growth of AC4 and AZA2 explants. (a) Number of nodes (ef-fects were significant at P≤0.001) (b), shoot length (effects significant at P≤0.05). (c) % bud sprout-ed (effect were significant at P≤0.01). Vertical bars represent SE. WPM1 = WPM at full strength; WPM2 = WPM at ½ strength and MS1 = MS at full strength.

Rooting

The results of the effect of WPM on rooting of cashew shoots are presented in Figure 3. As opposed to shoot growth, WPM did not show any comparative advantage over MS media on promoting rooting of cashew shoots (Figure 3a, b and c).



Figure 3: Effect of WPM on % rooting, number of roots >10mm and root length of AC4 and AZA2 cashew shoots.

Differences were not significant. Vertical bars represent SE. WPM1 = WPM at full strength; WPM2 = WPM at ½ strength and MS1 = MS at full strength.

Effect of sub-culturing time intervals on growth of Stage II shoot cultures of cashew

The results of the effect of sub-culturing time interval on shoot growth of Stage II cultures of AC4 and AZA 2 Cvs are presented in Table 1. Short (4-5 weeks) and long (8 weeks) time intervals resulted into significant reduction in the number of buds sprouted, shoot length, number of nodes/explant and explants vigour. The best subculture interval was found to be 6 weeks.



Table 1: Effect of sub-culturing time interval on multiplication of Stage II cashew shoot cul-tures

Clone

Subculture time interval

%bud sprouting

No of nodes Shoot length (mm)

Explant vigour Score 1-5

4 weeks 65 1.5c 18c 2.5bAC4 5 weeks 70 2.5b 25b 3.7a

6 weeks 85 3.1a 29a 3.7a8weeks 85 2.9a 22b 2cSE 0.32 4.1 0.18CV% 19 12 104 weeks 60 1.9c 16c 2.3c

AZA2 5 weeks 65 1.9c 19c 2.7b

6 weeks 80 3.3a 23b 4a

8weeks

SE

CV%

80 3.1a

0.41

18.8

23b

2.6

12.1

3b

0.22

9.7

Means with the same letter in a column are not significantly different using LSD

Effect of pulsing with auxin (short IBA treatment) on rooting of AC4 and AZA2 cashew shoots

Significant difference in rooting was observed for the different time periods of IBA pulsing. An op-timal condition for rooting of cashew shoots was dependent on both IBA concentration and pulsing time. Pulsing for 48 hrs – 60 hrs produced the best results in terms of % rooted shoots and root length for both AC4 and AZA2 clones (Figure 4). Cashew shoots sub-cultured after 60 hrs recorded the highest percentage (65-70%) of shoot rooted, had the highest number (3.6-4) of roots, and pro-duced the longest (23-26mm) roots (Figure 4a, b, c).



Figure 4: Effect of pulsing (short IBA treatment) on rooting of cashew microshoots. Effect of pulsing time, concentration and their interactions were significant at P≤0.001 for (a) % rooted ex-plants (b) root number per rooted explants and (c) root length. Vertical bars represent SE.

Effect of genotype on proliferation of Stage II cashew shoots

Genotypes differed significantly on their abilities to promote shoot development in vitro (Figure 5). Tanzanian genotypes AC10 showed the highest bud sprouting percentage while clone AC4 and AZA17 produced the longest shoots (Table 2).



Figure 5: In vitro micropropagation of cashew showing bud sprouting. Cashew shoots with axillary buds forming (left), cashew shoots with three well developing axillary buds (right)

Table 2: Effect of genotype on proliferation of Stage II cashew shoot cultures

Clone %bud sprouting No of nodes Shoot length (mm)

AC4

AZA2

AC10

65

70

85

1.8c

1.6c

2.4b

29a

20b

28a

AZA 17

SE

CV%

70 3.2a

0.45

18.6

17c

5.7

13.1

Means with the same letter in a column are not significantly different using LSD

As success of tissue culture of woody plants has been shown to be largely dependent on salt concen-tration of media used (Avilés et al., 2009; Mneney, 2013), two media formulations were evaluated in this study. WPM, a new wood-specific formulation was compared with MS media (Murashige and Skoog, 1962), a standard formulation used for most TC applications. WPM was first developed by Lloyd and McCown (1981) specifically for the shoot culture of trees and shrubs such as Betula, Lalmia, Rosa and Rhododendron. It has the same SO4 and Cl2 levels as MS media but higher levels of ammonium nitrate (Table 2). The formulation has now been modified for use with other woody



plants as well (Avilés et al., 2009; Ndakidemi et al., 2013; Mneney, 2013). The WMP has very low levels of KNO3 and no KH₂PO₄ because some woody plants are particularly susceptible to KH₂PO₄ and high levels of KNO3.

As noted in the results section, WPM out-performed MS media in all the parameters studied. Given these results, we can now confirm that WPM is the best media for shoot induction and multiplica-tion of cashew. Other stages of cashew tissue culture such as shoot elongation and rooting can be done using the standard MS as the two steps may not be sensitive to high concentration of KNO3 and no KH2PO4.

Table 2: Micronutrient composition of WPM and MS media

Micronutrient Media concentration in mgl-1

WPM MSKNO3 490 1900

NH4NO3 2000 1650CACL2.2H2O 440 440MgSO4.7H20 370 370NaH2PO4.H20 380 -KH2PO4 - 2041

Source: George (1993)

Results of the current study showed that response to in vitro culture condition is genotype-specific. This difference between the genotype responses might have been caused by the fact that some clones have higher concentration of secondary metabolites such as phenols. One of the problems faced in culturing such plants is oxidation of phenolic substances leached out from the cut surfaces of ex-plants which in turn cause browning of the medium and necrosis of the explant (D’Silva and D’Sou-za, 1993; Mneney, 2013). Analytical studies to characterise and determine the amount of phenol in different cashew cultivars is recommended. These types of studies will help establish if phenol is the chemical responsible for poor response of cashew to in vitro culture conditions.

Performance of Stage II culture is strongly influenced by the type of cytokinin used and the duration of exposure to hormone treatments. Results of the current study have demonstrated that short peri-ods and relatively long periods of exposure have negative effects on the growth of Stage II cultures. Short time intervals (< than 6 weeks) was found to be insufficient for optimal growth while over exposure (> 6 weeks) resulted in stunting or total necrosis of explants. These results are promising but further studies are necessary in order to get optimal culture conditions for all important stages of cashew micropropagation especially Stage II (shoot multiplication) stage.

As regards root induction, the results of this study have confirmed that IBA is the most effective hor-mone for promoting in vitro rooting in cashew. It was further established that placing explants on an auxin-containing medium just for a short interval followed by transfer to auxin-free media was more



effective in supporting root induction than prolonged exposure. Pulsing for 48-60 hrs produced the best results in terms of percentage rooted shoots for both AC4 and AZA2 clones. Given that rooting can be strongly influenced by ’pulsing’, studies to elucidate this further, using liquid culture, are sug-gested. It is also recommended that such studies should be extended to other cashew clones as tissue culture responses can be genotype-specific.

Acknowledgements

The author wishes to thank the Government of the United Republic of Tanzania through the Ministry of Agriculture Food Security and Cooperatives for financial assistance. The technical assistance provided by Ms Rose Kaguo and Justina Misungwi - laboratory technicians of Mikocheni Agricultural Research Institute - is highly appreciated.

References

Avilés, F., Ríos, D., González, R., and M. Sánchez-Olate (2009). Effect of culture medium in callogen-esis from adult walnut leaves. Chilean Journal of Agricultural Research, 69, 460-467.

Boggetti, B., Jasik, J., and S. Mantell (1999). In vitro multiplication of cashew (Anacardium occidentale L.) using shoot node explants of glasshouse-raised plants. Plant Cell Reports, 18, 456-61.

D’silva, I., and L. D’souza (1993). Controlling contamination and browning of in vitro culture of cashew. Journal of Plantation Crops, 21(1), 22-29.

George, E. F. (1996). Plant propagation by tissue culture (Part 2: Practice). Exegetics Limited.

Haissig, B. E. (1986). Metabolic processes in adventitious rooting of cuttings. In Jacksons, M. B. (Ed). New root formation in plants and cuttings (pp. 141-189), Martinus Nijhoff, Dordrecht.

Lloyd, G., and B. Mccown (1981). Commercially-feasible micropropagation of Mountain laurel, Kal-mia latifolia, by use of shoot tip culture. Combined Proceedings of International Plant Propaga-tors’ Society, 30, 421-427.

Mneney, E. E. (1998). Development of in vitro techniques for clonal propagation and genetic finger-printing of elite disease-free cashew (Anacardium occidentale L.). Thesis, Wye College, Univer-sity of London, UK.

Mneney, E. E. (2013). Advances in tissue culture of cashew (Anacardium occidentale L.) in Tanzania. In Masawe, P. A. L., Esegu, J. F. O., Kasuga, L. J. F., Mneney, E. E., and D. Mujuni (Eds). Proceed-ings of the Second Cashew International Conference (pp. 45-50), Kampala, Uganda, 26th-29th April, 2010. CABI International, Wallingford, UK.

Mneney, E. E., and S. H. Mantell (2002). Clonal propagation of cashew (Anacardium occidentale. L) by tissue culture. Journal of Horticultural Science and Biotechnology 77, 649-657.



Mridula, K. M., Gupta, P. K., and A. F. Mascarenhas (1983). Rapid multiplication of Sapium sebi-ferum Roxb. by tissue culture. Plant Cell, Tissue and Organ Culture, 2, 133-9.

Murashige, T., and F. Skoog (1962). A revised medium for rapid growth and bioassays with tobacco tissue cultures. Physiology of Plants, 15, 473-97.

Ndakidemi, C. F., Mneney, E., and P. A. Ndakidemi (2013). Development of embryogenic callus pro-tocol for Brachylaena huillensis (SILVER OAK). American Journal of Research Communication, 1, 206-219.



Overview of the application of molecular marker technologies in cashew (Anacardium occidentale L.): Past, current and future prospects

Emmarold E. Mneney1* and Adam E. Croxford2

1Cashew Biotechnology Unit, Mikocheni Agriculture Research InstituteP.O. Box 6226, Dar es Salaam, Tanzania. 2Adelaide University, Adelaide, Australia


Abstract

The use of molecular markers has revolutionised the genetic analysis of crop plants and offered the scientific community a wide range of valuable new tools for developing novel and improved varieties. Several research fields including breeding, pathology, entomology and variety protection have benefited from the application of these techniques. Historically, molecular markers have been extensively exploited for germplasm characterisation, cultivar protection, DNA fingerprinting, phylogenetic analyses and detection of loci controlling important agronomical traits. These technologies are especially desirable for improvement of tree species such as cashew, for which little molecular genetic information is available. The most common uses of markers in cashew are for analyses of genetic diversity, cultivar identification and genetic mapping. The objective of the review was to analyse the pace of development and utilisation of molecular marker technologies and to provide a brief outlook on the future use of these tools for increasing breeding efficiency and effectiveness in cashew.

Key words: molecular markers, cashew, genetic analysis, DNA fingerprinting

1.0 Introduction

Cashew (Anacardium occidentale L.) is extensively produced in many developing countries and holds a unique position in the world economy as an important source of revenue, food, animal feed and use in industrial products. Despite its importance, the productivity of the major cashew producing countries is still significantly hindered by the cultivation of inferior genetic material that is highly susceptible to various abiotic and biotic stresses. Whilst significant progress has been made in relation to cashew improvement, using conventional breeding methods (Anon, 2013), considerable scope still exists to further enhance cashew production and productivity (Mneney et al., 2001; Croxford et al., 2006). Modern molecular tools and techniques can complement traditional approaches to allow breeders to effectively address priority production challenges.

Recent developments in the field of molecular biology have revolutionised the way agriculture is researched and has provided the scientific community with a number of valuable tools for developing improved varieties and enhancing productivity. Nowadays, virtually all crop



improvement programmes including breeding, pathology, entomology and variety protection have benefited from the application of these molecular techniques. The application of these technologies for breeding perennial, live-lived tree crop species is especially desirable as it can dramatically reduce the time for cultivar development. Examples of this have been shown in almond (Joobeur et al., 2000), apple (Nybom et al., 2012) and peach (Chen et al., 2014). Breeding programmes have incorporated molecular markers into their plans for a wide range of purposes varying from simple fingerprint comparisons and diversity analysis (Lateef, 2015; Adato et al., 1995), to comprehensive genetic mapping and gene discovery to associated marker-assisted selection (Kumar et al., 2009; Prasanna and Haisington, 2003).

Molecular markers have the distinct advantage over phenotypic methods for identification, genealogic and genetic diversity studies because they can directly examine genomic compositions and genetic relationships. These analyses are not influenced by environmental factors thereby enabling accurate measures of diversity and heterozygosity levels and providing conclusive diagnosis of parentage (Jonah et al., 2011; Kumar et al., 2009).

Due to rapid developments in the field of molecular biology, there has emerged a large variety of different technologies during the last few decades. The DNA markers systems that are now being progressively developed have shifted from the first and second generation markers system including Restricted Fragment Length Polymorphisms (RFLPs), Random Amplified Polymorphic DNAs (RAPDs), Simple Sequence Repeats (SSRs) and Amplified Fragment Length Polymorphisms (AFLPs) to the third and fourth generation markers systems, which include Single Nucleotide Polymorphisms (SNPs), Diversity arrays technology (DArT) and genotyping-by-sequencing (GBS) (Lateef, 2015).

In this review, we discuss recent developments and utilisation of molecular marker technologies in cashew, and provide a brief outlook on the future use of these tools for increasing breeding efficiency and enhancing productivity.

2.0 Low-throughput marker systems

Restriction Fragment Length Polymorphisms (RFLPs)

RFLP markers were some of the earliest DNA analysis systems developed and were used extensively in the 1980s and 1990s in many plant breeding studies such as in tomato (Young and Tanksley, 1989), maize (Armstrong et al., 1992), and wheat (Siedler et al., 1994). The technique uses restriction enzymes to detect differences in the DNA sequence between individuals based on nucleotide sequences polymorphisms in the recognition sites of the enzymes or due to mutation events of several nucleotides. These differences could then be linked to traits of agronomic importance such as disease resistance (Michelmore et al., 1991) or to aid in the selection of diverse breeding material (Velasquez et al., 1994). The RFLP molecular system was highly popular due to its sensitivity of detection, its ability to discriminate between alleles at a single locus (i.e. is a co-dominant marker), it is highly reproducible, requires no knowledge of prior sequence information and it is highly locus-specific.



RFLP markers have been widely used in several crop species for various applications including development of genetic maps (Cho et al., 1998), as a finger printing tool (Fang et al., 1997), diversity studies (Debreuil et al., 1996) and for studies of hybridisation and introgression (Clausen and Spooner, 1998; Desplangue et al., 1999). However, since the last decade fewer direct uses of RFLP markers in genetic research and plant breeding have been stated. This is due to the fact that RFLP technology is very time-consuming, labour intensive and requires relatively large amounts of pure DNA. Despite these difficulties/limitations, researchers have in the past used RFLP technology in cashew for variety identification and for the characterisation of the Colletotrichum gloeosporioides pathogen that causes anthracnose disease in cashew (Sera, 2011). Despite these applications, the RFLP method has now been largely superseded by protocols based on PCR and advancements in DNA sequencing technologies.

3.0 Medium-throughput marker systems

The medium-throughput marker systems also called the second generation molecular markers (Jones, 2009) include RAPDS, AFLPs, SSR and Inter-Simple Sequence Repeat (ISSR).

3.1 Random amplified polymorphic DNAs (RAPDs)

RAPD is a marker technology that is based on the PCR amplification of random DNA segments with primers of random nucleotide sequences. RAPD markers have been widely used in diverse plant species for a variety of purposes including gene mapping especially to fill gaps covered by other markers (Williams et al., 1990, Hadrys et al., 1992) and for other applications such as gene tagging and identification of cultivars, genetic diversity and phylogenetic studies as reviewed by Lateef (2015) and Kumar et al. (2009).

The RAPD technology has proved useful for many crops as stated above, but in cashew, similar to RFLP, it has been put to limited use partly owing to the low level of polymorphism detected and the lack of reproducibility of results between laboratories. RAPDs have been successfully utilised by Samal et al. (2003) and Archak et al. (2003) to identify DNA markers suitable for fingerprinting and characterising the Indian cashew germplasm collection while Silva Neto et al. (1995) successfully applied the RAPD technology for fingerprinting of Brazilian cashew materials (Table 2). RAPD markers have also been used for diversity studies of Tanzanian materials (Mneney, 2001). Despite the successful examples of uses of RAPDs in cashew, there has been no reported case of the use of RAPD in quantitative trait loci (QTL) analysis or map-based applications. The main limitations of RAPDs are their poor reliability, low reproducibility and high sensitivity to experimental conditions (Mneney et al., 2001). Additionally, due to their random nature of amplification and their inability to distinguish between alleles at a locus (i.e. a dominant marker system), they have limited use in gene discovery applications.



3.2 Amplified fragment length polymorphism (AFLP)

The amplified fragment length polymorphism (AFLP) technique exploits the sensitivity of the RFLP marker system described above and combines it with the power of PCR to amplify from low amounts of DNA template. AFLP is based on selectively amplifying a subset of restriction fragments from a complex mixture of DNA fragments obtained after digestion of genomic DNA with restriction endonucleases (Vos et al., 1995). Polymorphisms are detected from differences in the length of the amplified fragments by polyacrylamide gel electrophoresis (Matthes et al., 1998) or by capillary electrophoresis (Croxford, 2005).

Although this marker system is technically difficult and expensive to set up, AFLPs have been applied to a number of crops in studies involving genetic identity, parentage and identification of cultivars and phylogenetic studies of closely related species because of the highly informative fingerprinting profiles generally obtained (Gupta et al., 1999). Their high genomic abundance and generally random distribution throughout the genome make AFLP a widely valued technology for gene mapping studies (Vos et al., 1995). AFLPs are also cost effective and require low to moderate quantities of DNA.

In cashew, a comparison between the different maker techniques of RAPD, ISSR and AFLP for their relative ability in detecting polymorphism demonstrated that AFLP is the most efficient (Archak et al., 2003a). Similar conclusions were made by Powel et al. (1996) and Lin et al. (1996) when assessing the AFLP technique in relation to the other systems. In India, AFLP analysis based on 354 polymorphic loci revealed Indian cashew to have low but relatively substantial genetic diversity (Archak et al., 2009). Likewise, a comprehensive genetic comparison of all materials in the Tanzanian germplasm collection was done using six AFLP primer combinations by Croxford et al. (2006) and these generated ample polymorphism to discriminate all 131 cashew accessions and provided an accurate measure of genetic relatedness (see Figure 1 for an example of an AFLP genetic profile).



Figure 1: AFLP genetic profile Example of AFLP genetic profiles of seven cashew accessions from the Tanzanian germplasm

collection (Nachingwea and Naliendele) showing multiple DNA differences (highlighted).

Although only a few studies have utilised the AFLP system in cashew (Table 2), the marker system is now widely used in developing polymorphic markers. The high frequency of identifiable AFLPs coupled with high reproducibility makes this technology an attractive tool for detecting polymorphism and for determining linkages by analysing individuals from segregating population. AFLP can also be useful in cashew to identify diagnostic molecular markers of different traits such as tolerance to powdery mildew, cashew leaf and nut blight disease among others.



3.3 Microsatellites or simple sequence repeats (SSRs)

During the 1990s, simple sequence repeats (SSRs) which are also known as microsatellites were established and provided a choice for many genetic researchers since they are amenable to low medium and high-throughput approaches (Lateef, 2015). Microsatellites markers are valuable for crop improvement programmes because of their ability to anchor linkage maps. They are also the most preferred marker systems for genetic studies for reasons of cost, simplicity and effectiveness (Powel et al., 1996).

In cashew, microsatellites have been studied only recently by a few scientists. The potential of microsatellite sequences as genetic markers in cashew was first investigated by Croxford et al. (2006) who used an automated, high-throughput system to isolate 60 cashew microsatellites (Table 1) from a non-enriched genomic library. Twenty proved polymorphic among a closely related seed garden population of 49 genotypes and twelve were suitable for multiplex PCR analysis by capillary electrophoresis. Another important application of this marker technology was done by scientists from Brazil who combined SSR and AFLP to provide the first anchored reference map for cashew (Cavalcanti and Wilkinson, 2007).

Table 1: Microsatellite markers developed, the left and right primer sequences designed and the annealing temperatures optimized for PCR.

Primer Indent.

Forward Primer (5’ – 3’) Reverse Primer (5’ – 3’) AnnealingTemp.(°C)

mAoR1 CCATTTGGAGAGAAACGTCGA TAAGAGATCAGGGGCCATCC 60.3

mAoR2 GGCCATGGGAAACAACAA GGAAGGGCATTATGGGTAAG 58.2

mAoR3 CAGAACCGTCACTCCACTCC ATCCAGACGAAGAAGCGATG 60,3

mAoR4 GCCTTAAGTGCGATTCGTC CGFTAACAGTACTGGGCGTTC 58.2

mAoR5 AACAATAACTTCTAGATGTGACC CCCAATCCCTTTCCATAG 53.9

mAoR6 CAAAACTAGCCGGAATCTAGC CCCCATCAAACCCTTATGAC 58.2

mAoR7 AACCTTCACTCCTCTGAAGC GTGAATCCAAAGCGTGTC 58.2

mAoR8 GCACACGCTTTGGATTCAC GGGCCACCCTAGTAACACAA 53.9

mAoR9 ACGTAGCTGCTCCACCAAAT GCCTCATCGTCAGGTCAAAT 58.2

mAoR10 TGGGTGGTCAAACTGTGGTA GGGGTGGCCCATCTATACTT No product

mAoR11 ATCCAACAGCCACAATCCTC CTTACAGCCCCAAACTCTCG 60.3

mAoR12 TCACCAAGATTGTGCTCCTG AAACTACGTCCGGTCACACA No product

mAoR13 TCTGCCATAAAGCAGTTGTT GAAACCACACAGAAAAAGAAG 58.2

mAoR14 AATTGAAGAGTGATTTGGTTG AATAACATGCTACTTACTCAAAT 56.1

mAoR15 GGGAGCTTTAAAGGGTTTGC GCAACTCCACTGCTTCTCC 60.3

mAoR16 GGAGAAAGCAGTGGAGTTGC CAAGTGAGTCCTCTCACTCTCA 60.3

mAoR17 GCAATGTGCAGACATGGTTC GGTTTCGCATGGAAGAAGAG 56.1

mAoR18 GATTTTGGTGCTTTCATGC GGGACAATAAGTTAAGCATCCA 56.1

mAoR19 CTCAGGCCCAAAATGTGATG GCCAGTCGCATTTATCATGG 62.3

mAoR20 CACCAGAATTTATACATC AATCTACAAAGACTTCATC 51.8



mAoR21 CCCTAGTCTGGAAGGCATTG CATAAATTCGGCCACTCCTG No product

mAoR22 ACTACCGTCAAGGAGTGGAT CTCTTAGGCTCTCATGCACA 60.3

mAoR23 CATTCGTTCCAATGCTCCTC CATGTGACAGTTCGGCTGTT 58.2

mAoR24 TGGTGCTTTTCATGCTTATG ATTCTCCTGGCAGAAAACCT 56.1

mAoR25 TGGGTAGAGAGTAGAAATGGAGTG GAATGTGTCAGTGGCAATGG No product

mAoR26 TCCACAAAATCAGCCTCCAC GAGCGCTCGTOTCCTGTACT 60.3

mAoR27 TCTCCAATTCATCCCGTCTC TTGTCGATGACTTGGTCGAG 56.1

mAoR28 CCTGTGAGTTCGCACACCTA ATTCTTGCTCTGTGGGTTGG 58.2

mAoR29 GGAGAAGAAAAGTTAGGTAC CGTCTTCTTCCACATGCTTC 58.2

mAoR30 CCACCCTGTCCTCTGTGTTT AGTGGAACACCTGGAACCTG 58.2

mAoR31 AGGGCTACAACTTTGAAGGACG GATGCCTGCCAATTTCACAC 58.2

mAoR32 CAGGAGTGGCCGAATTATG CAAGAAGCTGCTCCTGATCG 56.1

mAoR33 CATCCTTTTGCCAAAAACA CACGTGTATTGTGCTCACTCG 58.2

mAoR34 CTCCGATGACACACATGAGC ACGAACCCACCACTCTTCAT No product

mAoR35 GCAATGTGCAGACATGGTTC GGTTTCGCATGOAAGAAGAG 58.2

mAoR36 AAGCAGCTTGTTGCAAGACC GGAGGGAGACGAAGATTTCC 58.2

mAoR37 CATTCCATACCGGACCAGAC GATAAGGAAAGCAGGCACCA 46.4

mAoR38 GCCGAAAAAGAGCTAGCAGA ACGAGTGATCTTCCCCACTG 56.1

mAoR39 GGAGCGTATTTGGACCTCAA TCATCAATGGACTCCTGACG 56.1

mAoR40 CCTCAATCCACGGAAGACAT GTCGGGGAACGCATTAGATA No product

mAoR41 GCTTAGCCGGCACGATATTA AGCTCACCTCGTTTCGTTTC 58.2

mAoR42 ACTGTCACGTCAATGGCATC GCGAAGGTCAAAGAGCAGTC 60.3

mAoR43 TCCGGAGAGTGAAGAGAOGA GCTTCACGCTCTACCAGTCA 58.2

mAoR44 CACGTTCGCATCATCCAA CGTCAGAGATTACGCCATTG 58.2

mAoR45 AGTTCCTGGTGCTGGACTTG CTTTGGATACCCCCATTGGT 56.1

mAoR46 CGGCGTCGTTAAAGCAGT TCCTCCTCCGTCTCACTTTC 58.2

mAoR47 AAGAGCTGCGACCAATGTTT CTTGAACTTGACACTTCATCCA 58.2

mAoR48 CAGCGAGTGGCTTACGAAAT GACCATGGGCTTGATACGTC 58.2

mAoR49 GAACCTTTCCATCTGGGTTC TTCGGTTAGGGTGAAGGTTG No product

mAoR50 CGTTCTTTTGGGTCCCATC CCTTCAAAACCCACAACACC 56.1

mAoR51 TGCTCTTTGAGCAAGGTATGTC CCTGAGACCAAGCAGAGAAA 58.2

mAoR52 GCTATGACCCTTGGGAACTC GTGACACAACCAAAACCACA 58.2

mAoR53 GGCCAATATAGTGACCCTTGC GGTCATGGCTTGGCAATAGA 58.2

mAoR54 AGCTGCGTACGGTGTTACCT CAAGAACTGGAAGAAGCGTACC 53.9

mAoR55 TGACTTTCAAATGCCACAAC CTCAAGCTFTCATOGGGATT 58.2

mAoR56 CGAAAATGTGAGGAGAGTGG CTCATCGACCCTACTTAACACC 58.2

mAoR57 CTTCAATAATGAATGGATTTCAA CAGGCAAAGATTTTAGAGAATG 56.1

mAoR58 AGGGTGGATCAAAGAGTFCG TCAAAGAGTTGGCCAAAGAA No product

mAoR59 TCCGCCCCTACTCCTATATT GAAAACCGAAACCAGAACC 51.8

mAoR60 GTAATGCGTGGACCTAA TGGTGTCGACTGCTTCTGT 56.1

Source: Croxford (2005).



4.0 High-throughput marker systems

The high-throughput marker systems also called the third generation molecular markers (Jones, 2009) include single nucleotide polymorphisms (SNPs) and genotyping–by- sequencing (GBS).

4.1 Single nucleotide polymorphisms (SNPs)

SNPs are a novel class of DNA markers sometimes described as the “new generation of molecular marker” (Jones et al., 2009) that has recently become highly preferred in genomic studies. SNP markers are based on single nucleotide base differences between individuals or homologous chromosomes within an individual. SNPs provide the simplest and ultimate forms of molecular markers; as a single nucleotide base, they are the smallest units of inheritance, and therefore they provide the greatest sources of markers (Lateef, 2015). The major application of SNP markers has been limited to a few highly researched crops such as wheat, rice, maize and cassava but in the near future these markers will certainly be used extensively in many plant systems including tree crops. In cashew, SNP makers have been reported only recently in a genotyping study by Croxford and Mneney (2007). The Tanzanian research programme is also in the process of developing SNP markers for use in QTL mapping (Anon, 2014).

4.2 High resolution melt analysis (HRM)

Conventional SNP assay is highly sensitive and is potentially a high-throughput system, but for many minor crop species the methods are typically time consuming and expensive requiring several costly labelled reagents. This is particularly problematic in studies where large numbers of specific markers are required such as in linkage mapping. High-resolution melt (HRM) analysis is a highly powerful technology that is able to identify individual genotypes without the requirement of individually labelled primers. This technique uses sensitive fluorescent detection instrumentation to precisely monitor the change in fluorescence caused by the release of an intercalating dye from PCR products as they dissociate with increasing temperature. Differences between genotypes are revealed by melting temperature shifts representing sequence variations between amplicons. While this technology has been widely used in clinical science (Waku-Kouomouet al., 2006; Liew et al., 2005), relatively little attention has been given to plant breeding studies. The potential of HRM technology for cashew genotyping was first reported by Croxford and Mneney (2007), where the analysis of the SNP marker sAoR010 by HRM on the three genotypes of AC4, AZA2 and AC10 revealed a clear distinction between the replicates based on melt profile (Figure 2).



Figure 2: Melt curves of SNP marker sAoR010 amplicons

AC4, AZA2 and AC10 clones showing clear distinction between the replicates of each genotypes. Source: Croxford and Mneney (2007).

4.3 Pyrosequencing

Croxford and Mneney (2007) reported exploiting pyrosequencing technology to three Tanzanian cashew genotypes (AC4, AZA2, and AC10) based on a single nucleotide polymorphism (Figure 3). Pyrosequencing is a rapid, highly sensitive, real-time DNA sequencing technique that is based on the detection of released pyrophosphate (PPi) during DNA synthesis. Through a series of enzymatic reactions, visible light is generated that is proportional to the number of incorporated nucleotides. The great advantage of this technique is that 96 samples can be analysed simultaneously within minutes. The technique is ideal for high-throughput genotyping of well-characterised single nucleotide polymorphic (SNP) markers.



Figure 3: Pyrosequencing profiles of three genotypes AC4, AZA2 and AC10 clones analysed with the cashew SNP marker sAoR010

Source: Croxford and Mneney (2007).



Table 2: Published reports on application of marker technology in cashew

Marker Application No. of primers/markers

No. of accessions

Origin of Materials

Reference

RAPD Fingerprinting 10 19 India Archak et al. (2003a)Fingerprinting 6 3 Brazil Silva Neto et al. (1995)Genotyping 20 20 Tanzania Mneney et al. (2001)Diversity 10 20 India Samal et al. (2002)Fingerprinting 5 34 India Archak et al. (2003b)

ISSR Fingerprinting 12 19 India Archak et al. (2003a)Fingerprinting 4 34 India Archak et al. (2003b)

AFLP Fingerprinting 6 19 India Archak et al. (2003a)Diversity 6 131 Tanzania Croxford and Mneney

(2007); Croxford et al. (2006)

Diversity 11 91 India Archak et al. (2009)QTL mapping 194 85 Brazil Cavalcanti and Wilkinson

(2007); Cavalcanti et al. (2012)

SSR Diversity 10 187 Nigeria Aliyu (2012)Diversity 60 9 Tanzania Croxford and Mneney

(2007); Croxford et al. (2006)

QTL mapping 11 85 Brazil Cavalcanti and Wilkinson (2007); Cavalcanti et al. (2012)

SNPs Diversity 12 15 Tanzania Croxford and Mneney (2007); Croxford et al. (2006)

HRM Genotyping 12 3 Tanzania Croxford and Mneney (2007)

Pyrosequencing Genotyping 12 3 Tanzania Croxford and Mneney (2007)

4.4 Genotype-by-sequencing

Recently, a new method has been developed called Genotyping-by-Sequencing (GBS) that can also be used to analyse SNPs across individual genomes and across populations (Ma et al., 2012). The GBS system uses ‘Next-Generation’ sequencing technology to sequence certain regions of the genome and score large numbers of SNPs simultaneously. This technology has been used to construct saturated genetic maps of maize (Poland et al., 2012) and barley (Chutimanitsakun et al., 2010). There have been some studies that have simplified the GBS system and have developed highly multiplexed protocols which significantly reduce the cost and time involved (Pootakham et al., 2015). There have been no reports of GBS being adopted for cashew research where it would have great value for characterising diverse genotypes and constructing dense linkage maps for gene-discovery and associated marker-assisted selection (MAS) applications.



5.0 Conclusion

During the last few decades, the use of molecular markers to reveal polymorphism at the DNA level has played and is continuing to play a vital role in plant biotechnology and genetic studies. The vast selection of advanced technologies available today can be used to complement conventional cashew breeding systems. The techniques of RFLP, RAPD and AFLP have been highly popular in the recent past, but experience has shown that these are time consuming, unreliable and expensive. Development of high-throughput, reproducible molecular maker technologies such as SSRs and SNPs, coupled with advances in genomics research are now promising to offer powerful tools for cashew improvement. Furthermore, preliminary results of HRM and pyrosequencing technologies suggest that both are powerful tools that could be implemented in the future for low cost genotyping (HRM) or for high-throughput genetic assessment (pyrosequencing) in cashew. Despite the availability of a large number of markers, their integration and utilisation for MAS applications in plant breeding is still in its infancy. Only a few reports are available on the application of MAS in cashew (Cavalcanti and Wilkinson, 2007; Cavalcanti et al., 2012). Cashew breeding throughout the world is relatively underdeveloped but there is great potential available today especially with the development of robust marker systems such as SSRs and SNPs. We also hope that development of new markers such as Expressed Sequence Tag (EST) and availability of newer technologies such as DArT assays and genotyping by sequencing (GBS) will accelerate genome mapping and tagging of genes for effective and efficient cashew breeding.

References

Adato, A., Sharon, D., Lavi, U., Hillel, J., and S. Gazit (1995). Application of DNA fingerprints for identification and genetic analyses of mango (Mangifera indica) genotypes. Journal of the American Society for Horticultural Science, 120, 259-264.

Aliyu, O. M. (2012). Genetic diversity of Nigerian cashew germplasm. http://www.intechopen.com/books/genetic-diversity-in-plants/genetic-diversity-of-nigerian-cashew-germplasm.

Anonymous (2013). Annual cashew report for 2013. Ministry of Agriculture Food Security and Cooperatives, 76-89.

Anonymous (2014). Annual cashew report for 2014. Ministry of Agriculture Food Security and Cooperatives, 172 -191.

Archak, S., Gaikwad, A. B., Gautam, D., Rao, E. V., Swamy, K. R., and J. L. Karihaloo (2003a). Comparative assessment of DNA fingerprinting techniques (RAPD, ISSR and AFLP) for genetic analysis of cashew (Anacardium occidentale L.) accessions of India. Genome, 46, 362-369.

Archak, S., Gaikwad, A. B., Gautam, D., Rao, E. V., Swamy, K. R., and J. L. Karihaloo. (2003b). DNA fingerprinting of cashew varieties of India using RAPD and ISSR techniques. Euphytica, 230, 397-404.

Archak, S., Gaikwad, A., B., Swamy, K. R., and J. L. Karihaloo (2009). Genetic analysis and historical



perspective of cashew (Anacardium occidentale L.) introduction into India. Genome, 52, 222-230.

Armstrong, C. L., Romero-Severson, J., and T. K. Hodges (1992). Improved tissue culture response of an elite maize inbred through backcross breeding, and identification of chromosomal regions important for regeneration by RFLP analysis. Theoretical and Applied Genetics, 84(5-6), 755-762.

Cavalcanti, J. J. V., Costa dos Santos, F. H., Pereira da Silva, F. P., and C. R Pinheiro (2012). QTL detection of yield related traits of cashew. Crop Breeding and Applied Biotechnology, 12, 60-66.

Cavalcanti, J. J. V., and M. J. Wilkinson (2007). The first genetic maps of cashew (Anacardium occidentale L.). Euphytica, 157, 131- 143.

Chen, C., Bock, C. H., Okie, W. R., Gmitter Jr. F. G., Jung, S., Main, D., and B. W. Wood (2014). Genome-wide characterisation and selection of expressed sequence tag simple sequence repeat primers for optimized marker distribution and reliability in peach. Tree Genetics & Genomes, 10(5), 1271-1279.

Cho, Y.G., McCouch, S. R., Kuiper, M., Kang, M., Pot, J., Groenen, J. M., and M. Y. Eun (1998). Integrated map of AFLP, SSLP and RFLP markers using a recombinant inbred population of rice (Oryza sativa L.). Theoretical and Applied Genetics, 97, 370-380.

Croxford, A. E., Robson, M., and M. J. Wilkinson (2006). Characterisation and PCR multiplexing of polymorphic microsatellite loci in cashew (Anacardium occidentale L.) and their cross-species utilization. Molecular Ecology Notes, 6, 249-251.

Croxford, A. E., and E. E. Mneney (2007). A review of current and future use of molecular techniques for genetic improvement of cashew (Anacardium occidentale L.) in Tanzania. Proceedings of the Second Annual National Science and Technology Conference, Dar es Salaam, Tanzania, 23–25 May, 2007.

Dhanaraj, A. L., Rao, E. V. Swamy, K. R., Bhat, M. G., Theertha Prasad, D., and S. N. Sondur (2002). Using RAPDs to assess the diversity in Indian cashew (Anacardium occidentale L.) germplasm. Journal of Horticultural Science and Biotechnology, 77, 41-47.

Fang, D. Q., Roose, M., L., Krueger, R. R., and C. T. Federici (1997) Fingerprinting trifoliate orange germplasm accessions with isozymes, RFLPs, and inter-simple sequence repeat markers. Theoretical and Applied Genetics, 95, 211-219.

Gupta, P. K., Varshney, R. K., Sharma, P. C., and B. Ramesh (1999). Molecular markers and their application in wheat breeding. Plant Breeding, 118, 369-390.

Hadrys, H., Balick, M., and B. Schierwater (1992). Applications of random amplified polymorphic DNA (RAPD) in molecular ecology. Molecular Ecology, 1, 55-63.

Jonah, P. M., Bello, L. L., Lucky, O., Midauand, A., and S. M. Moruppa (2011). Review: The importance of molecular markers in plant breeding programmes. Global Journal of Science Frontier Research, 11, 1-12.

Jones, N., Ougham, H., Thomas, H., and I. Pašakinskienë (2009). Markers and mapping revisited:



Finding your gene. New Phytologist, 183, 935-966.

Joobeur, T., Periam, N., Vicente, M. D., King, G. J., and P. Arús (2000). Development of a second generation linkage map for almond using RAPD and SSR markers. Genome, 43(4), 649-655.

Kumar, P., Gupta, V. K., Misra, A. K., Modi, D. R., and B. K. Pandey (2009). Potential of molecular markers in plant biotechnology. Plant Omics Journal, 2, 141-162

Lateef (2015). DNA marker technology in plants and application in crop improvements. Journal of Biosciences and Medicines, 3, 7-18.

Liew M., Pryor, R., Palais, R., Meadows, C., Erali, C., Lyon, E., and C. Wittwer. (2004) Genotyping of single-nucleotide polymorphisms by high-resolution melting of small amplicons. Clinical Chemistry, 50, 1156-1164.

Ma, X. F., Jensen, E., Alexandrov, N., Troukhan, M., Zhang, L., Thomas-Jones, S., and R. Flavell (2012). High resolution genetic mapping by genome sequencing reveals genome duplication and tetraploid genetic structure of the diploid Miscanthussinensis. PloS one, 7(3), e33821.

Matthens, M. C., Dally, A., and K. J. Edwards (1998). Amplified fragment length polymorphism (AFLP). In Karp A., Isaac, P. G., and D. S. Ingram (Eds). Molecular tools for screening biodiversity (pp. 183-190), Cambridge: Chapman and Hall.

Michelmore, R. W., Paran, I., and R. V. Kesseli (1991). Identification of markers linked to disease-resistance genes by bulked segregant analysis: A rapid method to detect markers in specific genomic regions by using segregating populations. Proceedings of the National Academy of Sciences, 88(21), 9828-9832.

Mneney, E. E., Mantell, S. H., and M. Bennett (2001). Use of random amplified polymorphic DNA RAPD) markers to reveal genetic diversity within and between populations of cashew (Anacardium occidentale L.). Journal of Horticultural Science and Biotechnology, 76, 375-383.

Nybom, H., Mikiciński, A., Garkava-Gustavsson, L., Sehic, J., Lewandowski, M., and P. Sobiczewski (2012). Assessment of fire blight tolerance in apple based on plant inoculations with Erwinia amylovora and DNA markers. Trees, 26(1), 199-213.

Poland, J. A., Brown, P. J., Sorrells, M. E., and J. L. Jannink (2012). Development of high-density genetic maps for barley and wheat using a novel two-enzyme genotyping-by-sequencing approach. PloS one, 7(2), e32253.

Pootakham, W., Ruang-Areerate, P., Jomchai, N., Sonthirod, C., Sangsrakru, D., Yoocha, T., and S. Tangphatsornruang (2015). Construction of a high-density integrated genetic linkage map of rubber tree (Heveabrasiliensis) using genotyping-by-sequencing (GBS). Frontiers in Plant Science, 6, 367.

Powell, W., Morgante, M., and R. Andre (1996) The comparison of RFLP, RAPD, AFLP and SSR (microsallite) markers for germplams analysis. Molecular Breeding, 2, 225-238.

Prasanna, B. M., and D. Hoisington (2003). Molecular breeding for maize improvement: An overview. Indian Journal of Biotechnology, 2, 85-98.

Samal, S., Rout, G. R., and P. C. Lenka (2003). Analysis of genetic relationships between populations



of cashew by using morphological characterisation and RAPD markers, Orissa, India, Plant Soil and Environment, 49(4), 176-182.

Serra I., Meneze, M., Coelho, R., Ferra, R., Montarroyo, A., and L. Martins (2011). Molecular analysis in the differentiation of Colletotrichum gloeosporioides Isolates from the cashew and mango trees. Brazilian Archives of Biology and Technology, 54, 1099-1108.

Siedler, H., Messmer, M. M., Schachermayr, G. M., Winzeler, H., and B. Winzelerand Keller (1994). Genetic diversity in European wheat and spelt breeding material based on RFLP data. Theoretical and Applied Genetics, 88(8), 994-1003.

Tanksley, S. D., Young, N. D., Paterson, A. H., and M. W. Bonierbale (1989). RFLP mapping in plant breeding: New tools for an old science. Nature Biotechnology, 7, 257-264.

Velasquez, V. L. B. and P. Gepts (1994). RFLP diversity of common bean (Phaseolus vulgaris) in its centres of origin. Genome, 37(2), 256-263.

Vos, P., Hogers, R., Bleeker, M., Reijans, M., Lee van de, T., Hornes, T., Frijters, A., Pot, J., Peleman, J., Kuiper, M., and M. Zabeau (1995). AFLP: A new technique for DNA fingerprinting. Nuclear Acids Research, 23, 4407-4414.

Waku-Kouomou, D., Alla, B., Blanquier, A., Jeantet, D., Caidi, H., Rguig, A., Freymuth, F., and F. T. Wild (2006). Genotyping measles virus by real-time amplification refractory mutation system PCR represents a rapid approach for measles outbreak investigations. Journal of Clinical Microbiology, 44, 487-494.

Williams, J. G. K., Kubelik, A. R., Livak, K. J., Rafalski, J. A., and S. V. Tingey (1990). DNA polymorphisms amplified by arbitrary primers are useful as genetic markers. Nuclear Acids Research, 18, 6531-6535.

Young, N. D., and S. D. Tanksley (1989). RFLP analysis of the size of chromosomal segments retained around the Tm-2 locus of tomato during backcross breeding. Theoretical and Applied Genetics, 77(3), 353-359.



Colletotrichum Species Associated with Cashew Anthracnose in Mozambique

M.J. Comé1*, C.A. Almeida2, L.K. Turquete2, L.M. Abreu2, L.H. Pfenning2

1Cashew Promotion Institute (INCAJU). Provincial Delegation of Nampula Mozambique.2Federal University of Lavras. Department of Plant Pathology. Laboratory of Systematics and Ecology of

Fungi. Lavras, State of Minas Gerais, Brazil.


Abstract

The purpose of this study was to investigate the molecular phylogeny of a set of 31 single spore isolates of Colletotrichum obtained from symptomatic cashew leaves collected in southern Mozambique. Neighbor-Joining phylogenetic analysis based on GAPDH dataset was carried out for a total of 76 sequences, including 45 sequences from GenBank. A subset of 9 isolates was selected from phylogenetic inference for morphological characterisation and pathogenicity testing on cashew seedlings. Phylogenetic analysis provided great resolution in the delimitation of four lineages in the C. gloeosporioides complex, namely C. siamense sensu lato, C. fructicola, C. tropicale, as well as one undetermined specie. The C. siamense sensu lato, C. fructicola and C. tropicale are known from other tropical trees and different regions of the world in association with plant diseases in various agricultural important crops. All isolates selected for pathogenicity testing from the four lineages triggered typical symptoms of anthracnose on cashew seedlings. Colletotrichum gloeosporioides stricto sensu was not found in association with cashew anthracnose. In addition, we confirmed the hypothesis that there are various species in association with tropical fruits, such as cashew tree. Therefore, for consistent delimitation of species, multigene phylogenetic analyses will be performed based on at least six different gene regions.

Key-words: markers, pathogenicity testing, phylogenetic analyses.

Introduction

The cashew tree (Anacardium occidentale L.) is an important fruit tree in all producing countries worldwide (Santos et al., 2007). Originating from north-eastern Brazil, it is nowadays produced in tropical, sub-tropical and temperate regions, although it is commercially produced only in tropical areas, such as East Africa, north-east Brazil, south-east Asia, India and Australia (Paiva et al., 2009). Brazil is one of the leading producing countries; and Mozambique a historically important cashew producing country (Zheng and Luo, 2013), has cashew nut as an important component of its economy.

Benefits of the cashew sector in the economy of all cashew nut producing countries may decrease because of many reasons, including anthracnose, a disease caused by Colletotrichum species (Freire et



al., 2002; Menezes, 2005). Cashew anthracnose is characterised by formation of necrotic and irregular lesions on leaves and terminal branches, burning and falling flowers, deformation and atrophy of young fruits, necrotic lesions on mature fruits and post harvest fruit rot (Menezes, 2005; Medeiros et al., 2011; Uaciquete et al., 2013). Temperatures around 25oC and humidity over 80% are favourable conditions for the development of these symptoms.

The genus Colletotrichum has been reported as one of the most important genera of phytopathogenic fungi (Lima et al., 2013), and almost every cultivated plant is susceptible to one or more species of this genus (Dean et al., 2012), the causal agents of anthracnose. This disease causes losses in many important crops, especially in fruit plants, legumes, and ornamentals. These damages and the ability of Colletotrichum species to act as post harvest plant pathogens are a result of latent infections. These infections are initiated before harvest, and do not become active until after fruits have been stored or appeared on the market to be sold (Dean et al., 2012; Hyde et al., 2009a; Lima et al., 2013).

Because of the definition of C. gloeosporioides based on morphology, associations with anthracnose and the state of its taxonomy, Phoulivong et al. (2010), by analysing sequence data of five gene regions of Colletotrichum spp. have confirmed that C. gloeosporioides is not a common pathogen on tropical fruits. The authors concluded that Colletotrichum species in the gloeosporioides complex is distinct phylogenetic lineages with high statistical support. This finding was realised after phylogenetic studies based on DNA sequences of several gene markers, and has marked a new era on which multigene-based phylogeny analyses are required to delimitate species complexes, such as Colletotrichum gloeosporioides species complex, as recently highlighted in Weir et al. (2012).

The first step for these studies was the epi-typification of Colletotrichum gloeosporioides sensu stricto (Cannon et al., 2008), the causal agent of common anthracnose of tropical fruits (Phoulivong et al., 2010). This was followed by formal descriptions of dozens of new species of the C. gloesporioides species complex, based on multi-gene phylogenetic analyses. This state of affairs was summarised in a monograph of the complex in Weir et al. (2012) where 22 species plus one subspecies within the C. gloeosporioides complex were recognised.

Although considerable advances in research about species belonging to the C. gloeosporioides species complex have been achieved (Weir et al., 2012), taxonomy of this group is still in the state of flux, because there are a lot of remaining uncertainties about their phylogenetic position (Hyde et al., 2009a; Dean et al., 2012). Thus, because of their importance, unique intracelular hemibiotrophic lifestyle, and the ease with which they may be cultured and manipulated, species belonging to this complex have a long and distinguished history as model plant pathogens for fundamental future studies (Dean et al., 2012; Sharma et al., 2013).

Up to now, the etiological agents of cashew anthracnose have not been assessed using phylogenetic methods, despite the importance of the disease in cashew nut producing countries in the world. Therefore, this study was performed seeking for a response about the phylogenetic definition of Colletotrichum isolates associated with the cashew tree. These isolates were obtained from symptomatic leaves in producing regions of Mozambique. We performed morphological, pathogenic and molecular characterisation on these isolates, by means of phylogeny analyses involving glyceraldehyde-3-phosphate dehydrogenase (GAPDH gene region).




A total of 31 Colletotrichum isolates were obtained from cashew in southern Mozambique, specifically in Maputo and Gaza provinces. In Maputo, samples were collected from the Marracuene germplasm bank while in Gaza, we collected samples in districts of Xai-Xai, Bilene, Mandlakazi and Chókwe, both in commercial and family orchards. The isolation methods used were as outlined in Cai et al. (2009), in which MA2% Malt Extract Agar 2% medium, prepared in flasks, were plugged and placed in an autoclave. After that, a culture medium was poured into sterilised petri dishes to solidify. Every procedure was carried out in aseptic conditions, in a separate culture room free from drafts and dust. In either case, the work benches were wiped with 70% alcohol, hands were cleaned, and tools such as scalpels, forceps, and needles were dipped in alcohol and flamed to prevent introduction of contaminating micro-organisms.

Sample of leaves that represented a collection point were taken to an aseptic chamber using a scalpel previously flamed. Samples were cut into small square tissue sections from the margin of lesions, so that they contained both diseased and healthy looking tissues. These pieces were sterilised in 70% alcohol for about one minute; and then transferred to a disinfectant solution of 2% sodium hypochlorite, also for one minute. Using flamed forceps, leaf pieces were washed through two rinses with sterile distilled water (SDW) to remove excessive disinfectant, and placed on sterile filter paper to dry before being placed on three to five petri dishes containing a culture medium, for incubation in a growth chamber (BOD) under constant fluorescent light at 23±1oC. These plates were incubated for around 7 days and observed every day to keep up with development of fungal colonies. Fungal samples were left to germinate for 5 more days. Colonies of mycelium that appeared as a result of spores germination were isolated and transferred to separate plates, and cultivated under the same conditions, thus assuring that they would contain desired pathogen, in pure colony, free of contaminants.

After obtaining pure colonies, each Colletotrichum isolate was transferred to another petri dish containing a culture medium and cultivated for around 7 days until sporulation. From this sporulation, some spore mass was transferred using a needle to a 1.5ml sterile microtube containing 500µl of sterile distilled water. Samples were vortexed to obtain homogeneous suspension of fungal spore and then spotted around 50µL from that suspension onto a petri dish containing Synthetic Nutrient-poor Agar (SNA) medium, and spread using Drigalski handle. Twelve hours after incubation, with the aid of a stereoscopic microscope (binoculars), one spore was transferred to a new sterile petri dish containing MA2% and incubated in a BOD under constant fluorescent light at 23±1oC, to obtain a single spore culture for each one of all 31 isolates (Table 1). The single spore Colletotrichum isolates were stored in small discs into 1.5ml sterile microtubes under 10oC until required for further studies.

Single spore cultures of all 31 cashew Colletotrichum isolates were grown in a culture medium at 23±1oC, under constant fluorescent light for 7 days. Using a sterile 200µL pippete tip, a small amount of aerial mycelia was scraped from the colony and genomic DNA was extracted using Wizard Genomic DNA Purification Kit® (Promega, Madison, USA), according to manufacturer’s instructions. After extraction, DNA concentration for each sample was measured on NanoDrop 2000 (Thermo Fisher Scientific Inc., Waltham, USA) and all DNA samples were stored into 1.5 microtube for further PCR



amplifications. PCR reactions were carried out using Master Mix GoTaq® Incolour Kit (Promega) in a My CyclerTM thermocycler (Bio-Rad, Hercules, USA). DNA of all isolates were amplified and sequenced for Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) gene, according to Prihastuti et al. (2009), which permited selecting a subset of 9 isolates for pathogenicity testing (Table 1).

Table 1: Colletotrichum isolates obtained from lesions of infected cashew leaves

No. Colletion code Collection site Collection date

1 MT01 MZ, Xai-Xai, Chongoene April 20132 MT06 MZ, Xai-Xai, Maciene April 20133 MT07* MZ, Xai-Xai, Nhamavila April 20134 MT09* MZ, Xai-Xai, Nhamavila April 20135 MT11 MZ, Xai-Xai, Conjoene April 20136 MT14* MZ, Xai-Xai, Pomelene April 20137 MT15 MZ, Xai-Xai, Pomelene April 20138 MT20 MZ, Xai-Xai, Cavelene April 20139 MT23 MZ, Bilene, BMF1 March 201310 MT25* MZ, Bilene, BMCH1 March 201311 MT30 MZ, Mandlakazi, Chizavane April 201312 MT31* MZ, Mandlakazi, Chizavane April 201313 MT32 MZ, Mandlakazi, Chizavane April 201314 MT33 MZ, Mandlakazi, J. Clonal April 201315 MT34 MZ, Mandlakazi, J. Clonal April 201316 MT35 MZ, Mandlakazi, Nguzene April 201317 MT36 MZ, Mandlakazi, Mazucane April 201318 MT37 MZ, Mandlakazi, Mazucane April 201319 MT39 MZ, Mandlakazi, Mazucane April 201320 MT40 MZ, Mandlakazi, Mangunze April 201321 MT41* MZ, Mandlakazi, Mangunze April 201322 MT42 MZ, Chókwè, Chiaquelane March 201323 MT43 MZ, Chókwè, Chiaquelane March 201324 MT44 MZ, Chókwè, Chiaquelane March 201325 MT45 MZ, Chókwè, Mapapa March 201326 MT46* MZ, Chókwè, Mapapa March 201327 MT47* MZ, Chókwè, Hókwè March 201328 MT49 MZ, Chókwè, Inchovane March 201329 MT50 MZ, Chókwè, Inchovane March 201330 MT53* MZ, Maputo, BG-Ricatla April 201331 MT55 MZ, Maputo, BG-Ricatla April 2013

* Cashew Colletotrichum isolates also used to perform morphological and pathogenicity testing.

The primer-pair for carrying out PCR amplifications of partial GAPDH region was GDF and GDR



(Templeton et al., 1992). For a 25µL PCR reaction volume we included 12.5µL of GoTaq®Colourless Master Mix 2X, 0.7µL of each 10µM upstream and downstream primers, 1.0µL of DNA template and 10.1µL of Nuclease-Free water. The cycling parameters consisted of initial denaturation step at 94oC for 4 minutes, followed by 34 cycles at 94oC for 45 seconds (denaturation), 60oC for 45 seconds (anneling), 72oC for 1 minute (initial extension) and a final extension at 72oC for 10 minutes.

PCR amplification products were separated by electrophoresis in 1.5% agarose gels in 1.0×TAE buffer (which contains mixture of Tris base, acetic acid and EDTA) and photographed under Ultra Violet (UV) light. These PCR products were purified using Wizard®SV Gel and PCR Clean-Up System kit (Promega) following manufacturer’s instructions. All of amplified DNA samples were sent to Macrogen Corporation in United States of America (USA) for sequencing.

For phylogenetic analyses, sequences of isolates were edited to obtain consensus sequences in SeqAssem software (SequentiX, Klein Raden, Germany), and aligned in MEGA v6.0 software (Tamura et al., 2013) for each sequenced gene region. Thus, we searched for related sequences, or sequences that are sufficiently similar to sequences of interest that likely share a common ancestor, through the National Centre for Biotechnology Information’s BLAST (Basic Local Alignment Search Tool). Having chosen related sequences to include on the trees (Table 2), we downloaded each of those sequences to MEGA’s Alignment Explorer. Sequences in the Alignment Explorer were optimised manually to assure positional homology, and aligned with MUSCLE (Multiple Sequence Comparison by Log-Expectation) by being slightly more accurate and 2-3 times faster in typical-size data sets (Edgar, 2004; Nuin et al., 2006). Besides, we treated gaps as pairwise deletion data and when we encountered sequences that were much longer than the majority, after alignment, we removed the excess on MEGA v6.0.

A Neighbor-Joining tree based on GAPDH dataset was obtained from the alignment for all 76 sequences, i.e. 31 cashew Colletotrichum isolates and 45 members in the C. gloeosporioides species complex (Weir et al., 2012) collected from GenBank. Clade stability of the tree resulting from maximum composite likelihood model was assessed by bootstrap analysis with 1000 replicates, and bootstrap values over 50% were shown in each node. The resulting tree showed different groups from which we selected representatives - a subset of 9 samples - for morphological characterisation and pathogenicity testing.

A subset of 9 single spore cashew Colletotrichum isolates (Table 1), selected as previously described, was characterised by colony morphology and conidial characteristics. We used spores germinated in 90mm petri dishes containing Potato Dextrose Agar (PDA) medium for 7 days under constant fluorescent light at 23±1oC, in a biochemical oxygen demand (BOD). After 6 days we assessed the colonies colour, relative abundance of mycelium, and mycelial grow rate (mm day-1). Mycelial grow rate was obtained measuring colony diameter in two diametrically opposite directions. Sporulation in PDA medium and conidial size was also assessed. After 7 days, size and shape from 30 arbitrary conidia were measured under Olympus CX40 microscope for each isolate cultured on PDA under conditions previously described.



The experiment was performed in triplicate, in a completely randomised design with three replicates and each three plates represented the experimental unit. One-way analysis of variance (ANOVA) was conducted to determine significance of differences in conidia dimensions and growth rates (Banzatto and Kronka, 2006). The R statistical package fBasics was used (R Core Team, 2014), and means were compared by Tukey test at 5% significance level.

To establish whether isolates of Colletotrichum obtained from symptomatic tissues could cause anthracnose in cashew seedlings or were just endophyte isolates, pathogenicity tests were performed in a greenhouse using cashew seedlings approximately 45 days old. The experiment was performed in a completely randomised design with 5 treatments represented by selected cashew isolates, and the control. The experiment was performed in duplicate for each isolate, each treatment consisted in eight replicates and each seedling represented an experimental parcel.

To obtain fungal suspension, single spore cultures were placed on petri dishes containing PDA medium and grown under constant fluorescent light at 23±1oC. After about 7 growing days, when every isolate had already sporulated, we prepared fungal suspension according to Cai et al. (2009) protocols. Then, calibration of fungal suspension was carried out on the Neubauer haemocytometer, adjusting final concentration to about 1×106 spores/ml. Inoculation was performed by spraying fungal suspension on seedling leaves without injury, until we could observe fungal suspension almost run off. The control treatment consisted of seedlings sprayed with sterile distilled water. Inoculated seedlings underwent pre- and post-treatment in a moist chamber for 24 hours before and 48 hours after inoculation to allow conidia germination and penetration into plant tissues under suitable conditions. Plants were evaluated daily for 30 days and, seven days after inoculation, it was possible to see the first symptoms developing on the leaves. Then, 15 days after inoculation, we evaluated the disease incidence, which is defined here as percentage of plants with anthracnose symptoms for each treatment. The pathogen was re-isolated from lesions of cashew anthracnose 30 days after inoculation, thus completing Koch’s postulates.


Phylogenetic analyses

The phylogenetic analysis based on GAPDH gene region revealed a total of four lineages with bootstrap support over 50% (Figure 1), all belonging to the Colletotrichum gloeosporioides species complex, as outlined in Weir et al. (2012).



Figure 1: Phylogenetic analysis based on GAPDH gene region

Figure 1 shows a Neighbor-Joining phylogenetic tree for GAPDH gene region of 76 strains, from which 31 cashew Colletotrichum sequences and 45 sequences belonging to the C. gloeosporioides species complex obtained from GenBank. Bootstrap values over 50% are shown in each node. The scale bar indicates the number of expected changes per site.

According to Figure 1, clades containing representatives of cashew Colletotrichum isolates are five: (i) a clade comprising 14 C. siamense strains and 9 cashew Colletotrichum isolates; (ii) a clade comprising 17 cashew Colletotrichum isolates with no known Colletotrichum strains within the clade; (iii) a clade comprising 4 C. fructicola strains and two cashew Colletotrichum isolates; (iv) a clade comprising two C. tropicale strains and one cashew Colletotrichum isolate; and (v) a group of species comprising both C. alienum and C. fructicola species, and two cashew Colletotrichum isolates. These findings support what was previously referred in Phoulivong et al., (2010) that Colletotrichum gloeosporioides sensu stricto is not a common pathogen on tropical fruits; and suggest the need of using another gene-based sequences, seeking to improve inferences resolution.

Morphological study

Investigating morphological characteristics for a subset of 9 representative isolates previously selected by means of Neighbor-Joining inference phylogenetic for GAPDH gene region (Table 1), it was found that isolates could be grouped into four different morphotypes, according to Lacap et al. (2003), with some variation in colony colour, relative abundance of mycelium, mycelial growth rate and sporulation in PDA medium (Figure 2). The growing rate ranged from 4.98 mm day-1 to 7.92 mm day-1 and there was no statistical difference among taxa represented by C. fructicola, C. siamense sensu lato, C. tropicale and Colletotrichum sp. clades, when compared by Tukey test at 5% significance



level (Table 2). Conidial size, recorded after seven growing days, showed that cashew Colletotrichum taxa, in this study, have differences in conidial size when compared by Tukey test at 5% significance level. There were two different conidial shapes among studied taxa (Table 2).

Table 2: Morphological characteristics of cashew Colletotrichum isolates

Taxon*

Conidia characteristicsGrowth rate (mm day−1)

Length (µm)

Width (µm)

Shape

C. fructicola 15.27 a 4.52 a Cylindrical 6.98aC. siamense sensu lato 13.92 b 3.71 b Fusiform tocylindrical 7.35aC. tropicale 13.64 b 4.24 a Cylindrical 7.50a

Colletotrichum sp. 14.32 b 3.67 b Cylindrical 7.92a

* Taxa obtained from Neighbor-Joining tree based on GAPDH dataset analysis. Averages followed by the same letter in the column do not differ one another by Tukey test at 5% of significance level.

Morphological, cultural and host-preference criteria have been the primary basis for species identification and delimitation (Silva et al., 2012). Based on this knowledge, we could identify four morphological groups with variation in colony colour, relative abundance of mycelium, mycelial growth rate and sporulation on PDA.

Pathogenicity testing

Cashew seedlings inoculated with 1×106 conidial suspension of selected Colletotrichum isolates (Table 1) developed typical necrotic lesions, irregular, initially grayish and later reddish on seedling leaves. All Colletotrichum isolates were pathogenic towards cashew seedlings, and there was no significant difference in incidence among inoculated isolates (p>0.05). The control did not develop any symptoms during the experimental period. The pathogen was consistently re-isolated from infected cashew leaves on PDA medium, thus completing Koch’s postulates.

Although Colletotrichum species encompass endophytic, epiphytic, saprophytic, and plant pathogenic lifestyles (Hyde et al., 2009b), and all taxa belonging to the Colletotrichum gloeosporioides complex comprise species already described as pathogens associated with tropical fruits, and endophytes in many others (Prihastuti et al., 2009; Phoulivong et al., 2010; Weir et al., 2012; Lima et al., 2013; Sharma et al., 2013; Udayanga et al., 2013), we demonstrated that all Colletotrichum isolates used in this study are plant pathogenic and can trigger cashew anthracnose on leaves, with similar characteristics as those from which they were obtained.



Conclusion

According to the results obtained in this study, we can conclude that Colletotrichum isolates associated with the cashew tree belong to the Colletotrichum gloeosporioides species complex. However, cashew anthracnose is not caused by Colletotrichum gloeosporioides, but by at least four distinct species, namely, C. siamense sensu lato, C. tropicale, C. fructicola, and a still undesignated taxon (Colletotrichum sp.), which can be defined by multigene-based phylogeny analyses.

Acknowledgements

We are grateful to the Institute of Cashew Promotion (INCAJU) for the permission to collect cashew anthracnose samples from their orchards. We also thank Dr. Soares S. Banze, who sent us samples of cashew leaves containing symptoms of anthracnose, from which we obtained Colletotrichum isolates.

References

Banzatto, D. A., and S. de N. Kronka (2006). Experimentação agrícola. (4th ed.). Jaboticabal: Funep.

Cai, L., Hyde, K. D., Taylor, P. W. J., Weir, B. S., Waller, J. M., Abang, M. M., Zhang, J. Z., Yang, J. Z., Phoulivong, S., Liu, Z. Y., Prihastuti, H., Shivas, R. G., McKenzie, E. H. C., and P. R. Johnston (2009). A polyphasic approach for studying Colletotrichum. Fungal Diversity, 39, 183-204.

Cannon, P. F., Buddie, A. G., and P. D. Bridge (2008). The typification of Colletotrichum gloeosporioides. Mycotaxon, 104, 189-204.

Dean, R., Van Kan, J. A. L., Pretorius, Z. A., Hammond-Kosack, K. E., Pietro, A. D., Spanu, P. D., Rudd, P. D., Dickman, M., Kahmann, R., Ellis, J., and G. D. Foster (2012). The Top 10 fungal pathogens in molecular plant pathology. Molecular PlantPathology, 13(4), 414-430.

Edgar, R. C. (2004). Muscle: Multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Research, 32(5), 1792-1797.

Freire, F. O., Cardoso, J. E., Santos, A. A., and F. P. Viana (2002). Diseases of cashew nut plants (Anacardium occidentale L.) in Brazil. Crop Protection, 21(1), 489-494.

Hyde, K. D., Cai, L., Cannon, P. F., Crouch, J. A., Crous, P. W., Damm, U., Goodwin, P. H., Chen, H., Johnston, P. R., Jones, E. B. G., Liu, Z. Y., McKenzie, E. H. C., Moriwaki, J., Noireung, P., Pennycook, S. R., Pfenning, L. H., Prihastuti, H., Sato, T., Shivas, R. G., Tan, Y. P., Taylor, P. W. J., Weir, B. S., Yang, Y. L., and J. Z. Zhang (2009a). Colletotrichum: Names in current use. Fungal Diversity, 39, 147-182.

Hyde, K. D., Cai, L., McKenzie, E. H. C., Yang, Y. L., Zhang, J. Z., and H. Prihastuti (2009b). Colletotrichum: A catalogue of confusion. Fungal Diversity, 39, 1-17.

Lacap, D. C., Liew, E. C. Y., and K. D. Hyde (2003). An evaluation of the fungal ‘morphotype’ concept based on ribosomal DNA sequences. Fungal Diversity, 12, 53-66.



Lima, N. B., de Batista, M. V., de Morais, M. A., Jr., Barbosa, M. A. G., Michereff, S. J., Hyde, K. D., and M. P. S. Câmara (2013). Five Colletotrichum species are responsible for mango anthracnose in north-eastern Brazil. Fungal Diversity, 61, 75-88.

Medeiros, I. F., de Barreto, A. F., and E. C. B. dos S. Freire (2011). Etiologia e progresso da antracnose do cajueiro (Anacardium occidentale L.) em Pombal e Paulista, Paraíba. Revista Verde, 6(1), 107-115.

Menezes, M. (2005). Doenças do cajueiro (Anacardium occidentale). In Kimati, H., Amorim, H., Rezende, J. M., Bergamin Filho, A., and L. A. Camargo (Eds.). Manual de fitopatologia: Doenças das plantas cultivadas, Volume 2. São Paulo: Agronómica Ceres, 181-184.

Nuin, P. A. S., Wang, Z., and E. R. M. Tillier (2006). The accuracy of several multiple sequence alignment programmes for proteins. BMC Bioinformatics, 7, 471.

Paiva, J. R., de Barros, L. M., and J. J. V. Cavalcanti (2009). Cashew (Anacardium occidentale L.) breeding: A global perspective. In Jain, S. M., and P. M. Priyadarshan (Eds.). Breeding plantation tree crops: Tropical species. Amsterdam: Springer (Chapter 9), 287-324.

Phoulivong, S., Cai, L., Chen, H, McKenzie, E. H. C., Abdelsalam, K., Chukeatirotea, E., and K. D. Hyde (2010). Colletotrichum gloeosporioides is not a common pathogen on tropical fruits. Fungal Diversity, 44, 33-43.

Prihastuti, H., Cai, L., Chen, H., McKenzie, E. C., and K. D. Hyde (2009). Characterisation of Colletotrichum species associated with coffee berries in northern Thailand. Fungal Diversity, 39, 89-109.

R Core Team (2014). R: A language and environment for statistical computing. Vienna: R Foundation for Statistical Computing.

Santos, R. P., Santiago, A. A. X., Gadelha, C. A. A., Cajazeiras, J. B., Cavada, B. S., Martins, B. S., Oliveira, T. M., Bezerra, G. A., Santos, R. P., and V. N. Freire (2007). Production and characterisation of the cashew (Anacardium occidentale L.) peduncle bagasse ashes. Journal of Food Engineering, 79, 1432-1437.

Sharma, G., Kumar, N., Weir, B. S., Hyde, K. D., and B. D. Shenoy (2013). The ApMat marker can resolve Colletotrichum species: A case study with Mangifera indica. Fungal Diversity, 61, 117-138.

Silva, D. N., Talhinas, P., Várzea, P., Cai, L., Paulo, O. S., and D. Batista (2012). Application of the Apn2/MAT locus to improve the systematics of the Colletotrichum gloeosporioides complex: An example from coffee (Coffea spp.) hosts. Mycologia, 104(2), 396-409.

Tamura, K., Stecher, G., Peterson, D., Filipski, A., and S. Kumar (2013). MEGA6: Molecular Evolutionary Genetics Analysis Version 6.0. Molecular Biology and Evolution, 30(12), 2725-2729.



Templeton, M. D., Rikkerink, E. H., Solon, S. L., and R. N. Crowhurst (1992). Cloning and molecular characterisation of the glyceraldehyde-3-phosphate dehydrogenase-encoding gene and cDNA from the plant pathogenic fungus Glomerella cingulata. Gene, 122, 225-230.

Uaciquete, A., Korsten, L., and J. E. Van Der Waals (2013). Epidemiology of cashew anthracnose (Colletotrichum gloeosporioides Penz.) in Mozambique. Crop Protection, 49, 66-72.

Udayanga, D., Manamgoda, D. S., Liu, X., Chukeatirote, E., and K. D. Hyde (2013). What are the common anthracnose pathogens of tropical fruits? Fungal Diversity, 61, 165-179.

Weir, B. S., Johnston, P. R., and U. Damm (2012). The Colletotrichum gloeosporioides species complex. Studies in Mycology, 73, 115-180.

Zheng, S., and J. Luo (2013). The overview and prospects for production and marketing of cashew nut in the world. Asian Agricultural Research, 5(8), 1-4.


BreedingAdvances in Biotechnology Advances in Biotechnology

SOIL AND PLANT NUTRITION



Preliminary study on the variations of cashew leaf nutrient contents from initial flowering to fruiting period

J. H. Wang, H. J. Huang, W. J. Huang and Z. R. Zhang*Tropical Crops Genetic Resources Institute, Chinese Academy of Tropical Agricultural Sciences / Key Lab-oratory of Tropical Crops Germplasm Resources Utilization, Ministry of Agriculture, Danzhou 571737,

Hainan Province, China

*Corresponding author’s e-mail: [email protected]

Abstract

Two cashew clones HL2-21 and GA63 were chosen as test objects, to study the variations of cashew leaf nutrient contents from initial flowering to fruiting period. The results indicated that, from initial flowering to fruit maturity, leaf N contents decreased by 29.9% and 27.3% respectively whereas P contents decreased by 31.8% and 40.3% respectively. K contents increased from initial flowering to peak flowering and fruit setting period by 57.3% and 30.3% respectively, and then decreased or changed little at fruit maturity period. Ca contents increased from initial flowering to peak flowering period, decreased to fruit growth period. Mg contents changed not too much. Fe contents increased from initial flowering to peak flowering period, decreased until after fruit maturity. Mn contents had a waving trend. Cu contents increased from initial flowering to peak flowering and fruit setting or fruit growth period, then decreased until after fruit maturity. Zn contents increased at peak flowering and fruit setting period, then decreased until after fruit maturity. B contents also had a waving trend. This study indicated generally, from initial flowering period to fruit maturity, most of the leaf nutrient contents decreased, or increased at peak flowering and fruit setting and then decreased.

Keywords: cashew; leaf; nutrient content; variation

Introduction

Leaf is the main organ of plant for photosynthesis and nutrient manufacturing, and also is the most sensitive organ to nutrient lack of tree. It is the bank of nutrient transporting from root, and is also the source of nutrient for fruit growth (Yin, Wang and Liu, 2009). The leaf nutrient content shows the nutrient status of the tree (Wu et al., 2011). Using leaf nutrient analysis combining with fruit and soil analysis to guide fertilization is an important way for fruit trees (Lin et al., 2005). Due to the change of nutrient status and requirements in the tree along with the change of growing stage, the leaf nutrient content will also change along with growing stage (Jing et al., 2011).

About the nutrient content and variation of cashew leaf, there have been some reports, including the distribution of N, P, K, Ca and Na in mature leaf, petiole, bark, trunk and root (Kumar, 1981, Reddy and Reddy, 1988), the contents of N, P, K, Ca, Mg, Fe, Mn, Cu, Zn in cashew leaf from different areas and varieties (Aikpokpodion et al., 2009, Rupa, et al., 2014); the distribution of N, P, K, Ca,



Mg, Fe, Mn, Cu, Zn, B in leaf, branch and root, and the annual variation of N, P and K in cashew leaf (Wang et al., 2013a, Wang et al., 2013b). But it seems no one has studied the variation of N, P, K, Ca, Mg, Fe, Mn, Cu, Zn and B in cashew leaf at the same time. In this experiment, we studied the variation of N, P, K, Ca, Mg, Fe, Mn, Cu, Zn and B in cashew leaf from initial flowering period to fruit maturity in order to understand the nutrient characteristics and requirements of cashew at different growing stages, and provide a scientific basis for nutrient diagnosis and fertilization. We used cashew clones HL2-21 and GA63 as test objects.

Materials and Methods

Experiment field status

The experimental field is located in Ledong County of Hainan Province, China at 18° 31’ N latitude and 108° 52’ E longitude. The mean annual temperature is 25.0 to 26.0 °C. January is the coldest month with mean temperature from 20.0 to 22.0 °C. Mean annual precipitation is from 1000 to 1300 mm while annual evaporation is from 1800 to 2300 mm. Mean annual wind speed is 3.9 m/s. It is one of the most suitable areas for cashew cultivation in Hainan Province (Liang et al., 2007). The area of this experiment field is about 3.3 hm2. The soil is dry red. The test trees were 10 years old cashew clones HL2-21 and GA63, planted in June of 2003 and grafted in May of 2004. The growth period of HL2-21 and GA63 in this area is generally as follows: initial flowering period is usually in January whereas peak flowering and fruit setting is from February to March, April is fruit growth period , and from May to early June is fruit maturity.

Sample collection and analysis

We chose and marked five well-grown and uniform cashew trees for each clone in the experimental field as test objects. At the end of each month from January to June 2014, twenty mature leaves from east, west, north and south of each tree were collected. The samples were washed with tap water fol-lowed by distilled water, and then dried and milled for chemical analysis. N content was determined by indophenol blue colorimetry, P by Mo-Sb colorimetric method, K by flame photometry (410 flame photometer). The content of Ca, Mg, Fe, Mn, Cu and Zn were determined by dry ashing-flame atomic absorption spectrophotometry (AA6650flame atomic absorption spectrophotometer). B con-tent was determined by azomethine-h colorimetric method (PerkinElmer Lambda 25 uv-vis spectro-photometer) (Lu, 1999).

Results

The contents and variations of major and middle elements in cashew leaves

From initial flowering period to fruit maturity, leaf N contents of clone HL2-21 decreased from 2.537% to 1.778% and from 2.370% to 1.724% for clone GA63. The decrease in amplitude was 29.9% and 27.3% for clone HL 2-21 and GA63 respectively. Leaf N content of HL2-21 was higher than that of GA63 in these periods. After fruit maturity, leaf N contents increased slightly and were similar for the two clones. From initial flowering period to fruit maturity, leaf P contents of clone



HL2-21 decreased from 0.174% to 0.119% and from 0.178% to 0.106% for clone GA63. The decrease in amplitude was 31.8% and 40.3% for clone HL2-21 and GA63 respectively. Then they increased obviously after fruit mature, up to 0.158% and 0.131% respectively. From initial flowering period to peak flowering and fruit set period, leaf K contents of clone HL2-21 increased from 0.802% to 1.261% and from 0.886% to 1.155% for clone GA63. The increase in amplitude was 57.3% and 30.3% for clone HL2-21 and GA63 respectively. From peak flowering and fruit setting period to fruit maturity, leaf K content of HL2-21 decreased by 21.5% whereas that of GA63 changed slightly.

Fig. 1 The variations of NPK contents in cashew leaves

From initial flowering to peak flowering period, leaf Ca contents of clone HL2-21increased from 0.366% to 0.417% and from 0.363% to 0.482% for clone GA63. From peak flowering period to fruit growth period, leaf Ca contents decreased by 57.9% and 56.1% respectively, then increased slightly at fruit maturity period and decreased thereafter. There was some difference between the changing trends of leaf Mg contents of HL2-21 and GA63. From initial flowering period to peak flowering and fruit setting, leaf Mg content of HL2-21 increased first and then decreased. Then it increased slowly until after fruit maturity. Leaf Mg content of GA63 decreased slowly from initial flowering period to fruit growth, and then increased until after fruit maturity.



Fig. 2 The variations of Ca and Mg contents in cashew leaves

The contents and variations of microelements in cashew leaves

Leaf Fe contents increased from initial flowering period to peak flowering by 7.7% and 48.4% for clone HL2-21 and GA63 respectively. Then they decreased until after fruit maturity, decrease in amplitudes was 63.0% and 70.4% respectively. Leaf Mn contents were much higher than other mi-croelements. They were 660.60 and 753.97 mg/kg at initial flowering period respectively for HL2-21 and GA63, and increased up to 882.95 and 1100.84 mg/kg at peak flowering period. Then they de-creased until fruit growth period by 51.2% and 48.5% respectively; increased at fruit maturity period and decreased thereafter. There was some difference between the changing trends of leaf Cu contents of HL2-21 and GA63. From initial flowering period to peak flowering and fruit setting, leaf Cu con-tent of HL2-21 decreased slightly and then increased. Then it decreased until after fruit maturity by 58.7%. Leaf Cu content of GA63 increased from initial flowering period to fruit growth period; from 2.936 up to 9.443 mg/kg, the increase in amplitude was 221.6% dropping thereafter to 2.009 mg/kg after fruit maturity and the decrease in amplitude was 78.7%.



Fig. 3 The variations of Fe, Mn and Cu contents in cashew leaves

There was some difference between the changing in trends of leaf Zn contents of HL2-21 and GA63. From initial flowering to peak flowering period and fruit setting, leaf Zn content of GA63 increased, that of HL2-21 increased slightly and then decreased. Then leaf Zn contents of the two clones de-creased until after fruit maturity by 47.6% and 45.2% respectively. From initial flowering to peak flowering period and fruit setting, leaf B contents increased first and then decreased from 20.152 and 20.474 mg/kg down to10.412 and 8.735 mg/kg respectively, decrease amplitudes were 48.3% and 57.3 respectively. They rose to 13.949 and 14.465 mg/kg respectively at fruit growth period, and then decreased until after fruit maturity, down to 6.399 and 6.831 mg/kg.

Fig. 4 The variation of Zn and B contents in cashew leaves



Discussions

According to the research results in Kogi State of Nigeria (Aikpokpodion et al., 2009), leaf N con-tent ranged from 0.97% to 1.43% with a mean value of 1.16%, K content ranged from 0.31% to 0.62% with a mean value of 0.418%, Mn content ranged from 12.86 to 33.95 mg/kg with a mean value of 23.11 mg/kg. According to Rupa et al. (2014), leaf N content of different varieties ranged from 1.02% to 1.70% with a mean value of 1.496%, K content ranged from 0.36% to 0.62% with a mean value of 0.468%, Mn content ranged from 40 to 210 mg/kg with a mean value of 143 mg/kg. The results of this study indicated that leaf N content from January to June ranged from 1.724% to 2.537% with a mean value of 2.102%, K content ranged from 0.802% to 1.261% with a mean value of 1.046%, Mn content ranged from 443.84 to 1100.84 mg/kg with a mean value of 698.63 mg/kg. The contents of N, P and Mn in this study were much higher than that of Aikpokpodion and Rupa (Aikpokpodion et al., 2009, Rupa et al., 2014). It related to the soil condition, fertilization and vari-ety. There were also some differences of other elements, but they were not so obvious as N, P and Mn.

From this study, cashew leaf N content changed little from January to February, P content changed slightly from February to March, and K content increased from January to March. February is the peak flowering period. According to Jiang et al. (1989) and Liang et al. (2009), the cashew nut yield had significant positive correlation with leaf N content during flowering period. So February can be a suitable time of collecting leaf sample for chemical analysis and nutrient diagnosis in this area.

The variation of cashew leaf nutrient along with growth period is a sign of nutrient requirements in cashew at different growth stages. From initial flowering period to fruit maturity, most of the leaf nutrient contents decreased, or increased at peak flowering and fruit setting and then decreased. One of the reasons could be that cashew tree changed from vegetative growth to reproductive growth. At these stages, cashew tree need a lot of nutrients for flowering and fruiting, the nutrients in leaves are transferred to flowers and fruits as such leaf nutrient contents decreased in these stages. But the changing trends of different elements were different. It related to the functions of the elements. And the concrete reasons need further studies.

Acknowledgements

The authors would like to acknowledge Dr. Peter A. L. Masawe and E. M. Kafiriti for editing this article. Financial support was provided by National Natural Science Foundation of China (No. 31301672), Hainan Provincial Natural Science Fund (No. 20153104, 314126), National Nonprofit Institute Research Grant of TCGRI-CATAS (No. 1630032014033, 1630032015033) and introduc-tion of international advanced agricultural science and technology (No. 2011-G13(5)).



References

Aikpokpodion, P. E., Uloko, B and G. Edibo (2009). Nutrient dynamics in soil and cashew (Anac-ardium occidentale L.) leaf and kernel in Kogi State, Nigeria. Journal of Applied Biosciences, 25, 1573-1578.

Jang, S. B., Pan, X. L., Deng, S. S., Liang, L. H., Hong L. E., Wu, Y. M and Z. C. Lin (1989). Study on transformation of low yield cashew orchard. Research of Tropical Crops, 3, 53-581.

Jing, M., Zhai, M. P., Gao, X. L., Li, N., Xiong, J and D. W. Li (2011). Study on the dynamic vari-ation of the content of mineral nutritious elements in “mugua” almond-apricot leaves. Chinese Agricultural Science Bulletin, 27, 199-203.

Kumar, P. H (1981). Nutrient distribution in cashew (Anacardium occidentalie). Indian Cashew Jour-nal, 14, 13-17.

Liang, L. H., Mei, X., Huang, W. J and Z. R. Zhang (2007). Analysis of economic properties for forty-one cashew germplasm. Chinese Journal of Tropical Agriculture, 27, 21-25.

Liang, L. H., Wang, J. H., Huang, W. J., Zhang Z. R., Huang, H. J and F.Y. Xing (2009). Effects of fertilization on growth and fruiting of young cashew. Soil and Fertilizer Sciences in China, 5, 43-48.

Lin, M. J., Xu, J. Z., Chen, H. J., Wang, Z. L and Y. F. Han (2005). Seasonal changes of mineral elements in leaves and fruits of Whangkeumbae. Journal of Agricultural University of Hebei, 28, 23-27.

Lu, R. K (1999). Analytical methods for soil and agrochemistry. Beijing: China Agricultural Science and Technology Press, (Chapter 13-17).

Reddy, S. E and K. S. Reddy (1988). Partitioning of nitrogen, phosphorus and potassium in cashew (Anacardium occidentale L.) trees. Indian Cashew Journal, 18, 17-21.

Rupa, T. R., Kalaivanan, Reshma, D and P. Rashmi (2014). Nutrient content in the leaves of cashew (Anacardium occidentale L.) in relation to variety. Journal of Plantation Crops, 42, 145-150

Wang, J. H., Huang, H. J., Huang, W. J., Zhang, Z. R and L. H. Liang (2013). Annual variation and resorption characteristic of leaf N, P and K of cashew. Chinese Journal of Tropical Crops, 34, 1045-1049.

Wang, J. H., Liang, L. H., Huang, W. J., Zhang, Z. R and H. J. Huang (2013). Spatial distribution and resorption efficiencies of nutrient elements in cashew (Anacardium occidentale L.) tree. Soil and Fertilizer Sciences in China, 4, 88-93.

Wu, X. L., Ye, G. F., Zhang, S. J., Lin, Y. M and L. H. Zhang (2011). Contents of some mineral elements and their resorption efficiencies in Casuarina equisetifolia branchlets across a coastal gradient. Chinese Journal of Applied & Environmental Biology, 17, 645-650.

Yin, L. M., Wang, L. H and B. Liu (2009). Dynamic variation and resorption of nutrient elements in the leaves of Xanthoceras sorbifolia Bunge. Bulletin of Botanical Research, 29, 685-691.



Effects of Nitrogen, Phosphorous and Potassium Fertilization on the Infestation of Cashew Apple and Nut Borer, Nephopteryx sp.

Z. R. Zhanga*, Y. Gaob, J. H. Wanga, W. J. Huanga, H. J. Huanga

a Tropical Crops Genetic Resources Institute, Chinese Academy of Tropical Agricultural Sciences/Key Laboratory of Crop Gene Resources and Germplasm Enhancement in Southern China, Ministry of

Agriculture, Danzhou, Hainan 571737, China

b Guangdong Provincial Key Laboratory of High Technology for Plant Protection, Plant Protection Research Institute, Guangdong Academy of Agricultural Sciences, Guangzhou 510640, China


Abstract

To determine the effects of nitrogen (N), phosphorous (P) and potassium (K) fertilizers on the infestation of CANB, different levels were applied to cashew clone H2-21 in the field for two consecutive years. Prior to exposure to natural infestation of CANB, representative cashew trees were chosen and rated for cashew apple and nut borer (CANB) damage at initial fruit setting stage (IFSS), full fruit setting stage (FFSS) and terminal fruit setting stage (TFSS). The leaves and apples were analyzed for N, P and K nutrients. The effect of fertilizer levels on the CANB infestation was significant at FFSS but not at IFSS and TFSS. Levels of N fertilization affected significantly the CANB infestation, while levels of P and K fertilization did not have any influence in both experimental years. The effect of N was more significant in the second year of fertilization than in the first. CANB infestation significantly increased with increasing N fertilization levels in both years, and with increasing apple’s N concentrations in the second year. Thus, consecutive and gradual N fertilization appeared to benefit CANB infestation. Information gained in this study will be utilized to develop more efficient fertilization strategies as components of improved CANB management programs.

Keywords: Nephopteryx sp., Anacardium occidentale, NPK fertilizer, plant nutrition, agricultural control



Introduction

Cashew (Anacardium occidentale L.) is a perennial evergreen tree, native to the lower Amazon and northeast coast of Brazil (Mitchell and Mori, 1987). China introduced cashew for commercial planting in 1958, and has since continued planting the crop for more than 50 years. It has been commercially cultivated in Hainan province since 1973, mainly in the south and the southwest coast, including Danzhou, Changjiang, Dongfang, Ledong, Sanya and Lingshui counties (Jiang et al., 1989).

The cashew apple and nut borer (CANB), Nephopteryx sp. (Lepidoptera: Pyralidae), is one of the serious and regular cashew apple and nut feeding pests found widely in almost all cashew growing areas of Hainan. The caterpillars cause considerable damage by mainly boring into the junction of apple and nut, and feeding on developing and mature apples, and sometimes the young nuts (Luo and Jin, 1986; Pan and Xing, 1987; Liang and Zhang, 2007). As a result, the infested apples and nuts are totally useless for marketing. During the 1980s and 2010s, infestations of CANB resulted in major decrease in cashew nut production in Hainan, and this problem has continued to the present (Luo and Jin, 1986; Pan and Xing, 1987; Zhang et al., 2011, 2012). Damage due to this pest to the extent of 20-60% in some serious infested cashew plantations has been reported by a number of authors (Dharmaraju et al., 1976; Pan and Xing, 1987; Luo and Jin, 1986).

Currently, cashew growers use pesticides such as beta-cypermethrin, deltamethrin, dichlorvos, fenitrothion, etc. to control CANB (Pan and Xing, 1987; Tokare and Godase, 2006; Luo and Jin, 1986). This treatment provides good and rapid control; however, frequent use of highly effective chemicals and the lack of a viable alternative have contributed to a series of problems such as pest resistance, chemical residues and decrease in population of natural enemies in Hainan. Also, there has been an increasing demand, by cashew consumers, for products that are grown in a sustainable manner and are free from insecticide residues. Cultural practices such as removing the infested fruits from the cashew trees, picking up the fallen infested fruits and treating by pesticides, were also used for CANB control in the 1980s when the labour cost was low (Pan and Xing, 1987; Luo and Jin, 1986). However, current cultural and chemical controls are not completely effective and CANB remains a persistent problem.

Fertilization for increasing cashew nut production is one of the usual cashew plantation management strategies in China (Liang et al., 2007, 2008, 2009; Jiang et al., 1987, 1989). This strategy may also change the acceptability of cashew as a food source to pest populations as well as increasing the cashew nut production (Altieri and Nicholls, 2003). Macro-elements including nitrogen, phosphorous and potassium are important nutrients for cashew growth and may also affect the infestation of insect pests which take cashew as host plant.

Three mechanisms of host plant resistance are generally recognized (Painter, 1951; Smith, 1989): antixenosis or non-preference; antibiosis, which reduces insect survival and reproduction; and tolerance, where the plant compensates for insect feeding. In an earlier study (Zhang et al., 2008), it was found that cashews which received different levels of N, P and K differed in response to red-banded thrips, Selenothrips rubrocinctus (Giard) damage, based on tolerance.



Little is known about the effects of N, P and K fertilization on the susceptibility of cashew to CANB damage. If tolerance was a mechanism of resistance to CANB, then we expected that adding N, P and K fertilizer could increase cashew plant vigor and further increase resistance. The main objectives of our work were to evaluate the effects of levels of nitrogen, phosphorous and potassium fertilization on the damage of CANB at the initial fruit setting stage (IFSS), full fruit setting stage (FFSS), and terminal fruit setting stage (TFSS).


The same rates of N, P and K fertilizer were applied in a 2 ha experimental cashew orchard (18°31’N, 108°52’E) at the Hainan Cashew Research Centre, Liguo Town, Ledong County, Hainan Province in September, 2009 and September, 2010. The study block consisted of cashew clone HL2-21 planted in 2003, and the spacing was 6.0 m×6.0 m. Normal agronomic practices recommended for cashew, which included application of herbicides after harvest, proper pruning of overlapped branches between trees, and cleaning of the orchard, were adopted. No insecticides were applied during the study.

The experiment followed a randomized complete block design with nine treatments by orthogonal table L9 (3

4) (Table 1). Each treatment included twelve cashew trees which were planted in two rows and each row had six trees. Each cashew tree was treated as one replicate. The isolated rows were made between treatments and around the experimental block. Cashew trees were applied with N, P and K fertilizers in a combination of three N levels as N (250, 400 and 550 g/tree), three P levels as P2O5 (100, 150 and 200 g/tree), and three K levels as K2O (150, 200 and 250 g/tree).

Table 1: Nitrogen, Phosphorus and Potassium fertilizer rate applied in the cashew orchard in 2009 and 2010

Treatment Nitrogen (N) Phosphorus (P2O5) Potassium (K2O)

Level Application rate (g/tree)



N1P1K1 1 250 1 100 1 150N1P2K2 1 250 2 150 2 200N1P3K3 1 250 3 200 3 250N2P1K2 2 400 1 100 2 200N2P2K3 2 400 2 150 3 250N2P3K1 2 400 3 200 1 150N3P1K3 3 550 1 100 3 250N3P2K1 3 550 2 150 1 150N3P3K2 3 550 3 200 2 200

During the fruit setting stage in 2010 and 2011, five vigorous cashew trees were randomly selected from each treatment. All the fruits on the cashew tree were observed for CANB damage. A total of 4231, 3718 and 1709 cashew fruits were observed during IFSS, FFSS and TFSS in 2010, and 2606, 5514 and 1302 in 2011, respectively. Fruits with typical damage symptoms caused by CANB or the existence of CANB larva after dissection were considered damaged by CANB. The number of damaged and undamaged cashew fruits was recorded.



In terms of sampling, mature leaves of the current season’s growth and without any damage from insect pests or diseases were sampled during the survey of CANB infestation at IFSS, FFSS and TFSS of 2010 and 2011. Eight leaves were sampled per tree, one per shoot and from two shoots randomly selected at each of the four cardinal points around the canopy. In each treatment, leaves from five randomly selected trees were mixed as one sample and three samples were taken.

In sampling apples, swollen apples without any damage of insect pests or diseases were sampled in the 11th phase of cashew phonological stage during the survey of CANB infestation only at FFSS of 2010 and 2011 (Conticini, 1982). Four apples were sampled per tree and one per shoot, from four shoots randomly selected at each of the four cardinal points around the canopy. In each treatment, apples from five trees randomly selected were mixed as one sample and three samples were taken.

The sampled leaves and apples were sent to the laboratory for analysis of plant nutrients. Samples were analyzed through the processes of deactivation of enzymes, dry, mill and digestion with H2SO4-H2O2. N, P and K concentration were determined by the Continuous Flow Analysis with indophenol blue colorimetric method, Mo-Sb colorimetric method and flame photometry, respectively. Concentrations were calculated on a dry weight basis.

All statistical analyses were performed using SPSS for Windows (Version 16). Percentages of fruit damage and larval instar were arcsine transformed prior to analyses to stabilize the variance. The significance of differences between the treatment or level means was judged by Duncan’s Multiple Range Test (DMRT) at P≤0.05. The relationship between percentages of fruit damage and N, P and K fertilizer application rate or concentration were analyzed by linear regression.

Results

CANB infestation between treatments

The results indicated that fertilization application had various effects on the fruit damage caused by CANB larvae between treatments at different fruit setting stages and experimental years (Table 2). At IFSS and TFSS, fertilization application did not affect the fruit damage between treatments (P>0.05). At FFSS, fertilization application did not affect the fruit damage between treatments (F = 1.693, df = 8, 36, P = 0.134) in the establishment year (2010) but affected the fruit damage in the following year (2011) (F = 4.444, df = 8, 36, P = 0.0008). This indicated that the effect of fertilization on the CANB infestation became more significant under consecutive fertilization. Fruit damage on treatments N3P1K3, N3P2K1 and N3P3K2 was greater than other treatments in both years, but lowest on treatments N2P3K1 in 2010 and N1P1K1 in 2011.



Table 2: Effects of treatments of nitrogen, phosphorus and potassium on the infestation of Nephopteryx sp.

Treat-ment

Percentage of fruit damage (%) in 2010 Percentage of fruit damage (%) in 2011

IFSS FFSS TFSS IFSS FFSS TFSS

N1P1K1 2.72±0.56a 34.28±3.85bc 83.96±9.69ab 13.28±2.09a 31.47±1.66c 93.04±3.20a

N1P2K2 5.02±1.63a 39.73±3.00abc 74.21±6.90b 10.57±2.23a 41.11±4.52cb 92.78±2.28a

N1P3K3 4.62±2.12a 37.28±2.53abc 81.18±9.98ab 15.20±1.94a 51.49±0.33ab 89.69±1.81a

N2P1K2 2.47±0.70a 44.72±7.65abc 95.32±2.66a 11.04±0.73a 49.38±1.41ab 91.90±1.70a

N2P2K3 5.44±1.26a 41.24±4.66abc 87.33±4.35ab 16.21±1.86a 48.72±0.98ab 89.33±1.86a

N2P3K1 6.81±2.19a 31.01±3.25c 87.59±3.83ab 9.64±0.99a 49.81±3.31ab 94.46±1.36a

N3P1K3 4.65±1.60a 48.18±6.65ab 82.18±5.03ab 15.56±1.05a 58.83±2.34a 97.38±0.98a

N3P2K1 4.22±0.88a 46.10±6.74abc 88.75±3.34ab 16.02±2.00a 55.06±1.97a 93.16±2.43a

N3P3K2 6.12±1.42a 52.06±5.85a 76.47±2.67b 7.22±1.75a 57.47±1.52a 97.79±0.82a

Means (±SE) within a column of treatments or levels followed by the same letter do not differ significantly (Duncan, P>0.05). IFSS= Initial fruit setting stage, FFSS= Full fruit setting stage, TFSS= Terminal fruit setting stage.

The results indicated that fertilization application had various effects on the fruit damage between levels (Figures1 and 2). N fertilization level affected the fruit damage at FFSS of both 2010 (F = 4.384, df = 2, 42, P = 0.019) and 2011 (F = 9.786, df = 2, 42, P = 0.0003), and the fruit damage was always highest on level 3, intermediate on level 2, and lowest on level 1. No significant differences on fruit damage were found in different N fertilization levels at IFSS and TFSS in both years. P and K fertilization did not affect the fruit damage at any fruit setting stages of both years, except for K fertilization level at IFSS of 2011 (F = 3.712, df = 2, 42, P = 0.033).



Fig.1 Fruit damage rate response to different levels of nitrogen (N), phosphorous (P) and potassium (K) fertilization in 2010. Bars on the graph within a nutrient and fruit setting stage with the same letter are not significantly different according to Duncan’s Multiple Range Test at P≤0.05. IFSS=initial fruit setting stage, FFSS=full fruit setting stage, TFSS=terminal fruit setting stage.

Fig.2 Fruit damage rate response to different levels of nitrogen (N), phosphorous (P) and potassium (K) fertilization in 2011. Bars on the graph within a nutrient and fruit setting stage with the same letter are not significantly different according to Duncan’s Multiple Range Test at P≤0.05. IFSS=initial fruit setting stage, FFSS=full fruit setting stage, TFSS=terminal fruit setting stage.

Correlation of fruit damage and fertilizer rate

At IFSS and TFSS, the regression analysis on fruit damage versus the N, P and K fertilizer rate showed non-significant relationship in both years (Table 3). At FFSS, the regression analysis on fruit damage versus the N, P and K fertilizer rate showed significant relationship in both 2010 and 2011 (Table 3). T test for the regression equations showed that at the significant level a = 0.05, fruit damage was found to have a highly significant positive relationship with N fertilizer rate in both years (2010: P = 0.009; 2011: P = 0.00002); no significant relationship was found for fruit damage and K fertilizer rate in 2010, but in 2011 their relationship was found to be significantly positive (P = 0.025). No significant relationship was observed between fruit damage and P fertilizer rate in both years.



Table 3: Correlation of fruit damage (Y) with N(X1), P(X2) and K(X3) fertilizer rate

Stage 2010 2011

Regression equation R F P Regression equation R F P

IFSS Y=0.005X1+0.035X2-0.002X3+4.779

0.320 1.554 0.215 Y=X1-0.031X2+0.026X3+19.561 0.239 0.826 0.487

FFSS Y =0.023X1-0.013X2+0.031X3+26.707

0.430 3.106 0.037 Y=0.012X1+0.093X2+0.045X3+16.703

0.666 10.875 0.00002

TFSS Y =X1-0.065X2-0.031X3+84.355

0.260 0.994 0.405 Y =0.019X1-0.01X2-0.033X3+79.412 0.258 0.974 0.414

Note: IFSS= Initial fruit setting stage, FFSS= Full fruit setting stage, TFSS= Terminal fruit setting stage.

Nutrient concentrations in leaves and apples

Different fertilization levels did not affect the cashew plant nutrient during the fruit setting stages (Figs 3 and 4). Foliar N and P concentration did not vary significantly between N and P fertilization levels at any stages of both years, and they fluctuated through the fruit setting stages. Foliar K concentration was found to vary significantly between different K fertilization levels at TFSS of 2011 (F=4.536, df=2, 24, P=0.021), but no difference was found at other stages of both years, and it usually declined with increasing K fertilizer levels during the fruit setting stages.



Fig.3 Cashew leaf nutrient concentration response to different levels of nitrogen (N), phosphorous (P) and potassium (K) fertilization in 2010. Bars on the graph within a nutrient and fruit setting stage with the same letter are not significantly different according to Duncan’s Multiple Range Test at P≤0.05. IFSS=initial fruit setting stage, FFSS=full fruit setting stage, TFSS=terminal fruit setting stage.

Fig.4 Cashew leaf nutrient concentration response to different levels of nitrogen (N), phosphorous (P) and potassium (K) fertilization in 2011. Bars on the graph within a nutrient and fruit setting stage with the same letter are not significantly different according to Duncan’s Multiple Range Test at P≤0.05. IFSS=initial fruit setting stage, FFSS=full fruit setting stage, TFSS=terminal fruit setting stage.

At FFSS, different fertilization levels also did not affect the apple’s nutrient (Figs 5 and 6), while increasing N fertilization levels generally led to the increase of apple’s N concentration. When compared between apple’s P and K concentrations, no unique trends were observed.

Fig.5 Cashew apple nutrient concentration response to different levels of nitrogen (N), phosphorous (P) and potassium (K) fertilization in 2010. Bars on the graph within a nutrient with the same letter are not significantly different according to Duncan’s Multiple Range Test at P≤0.05.

Fig.6 Cashew apple nutrient concentration response to different levels of nitrogen (N), phosphorous (P) and potassium (K) fertilization in 2011. Bars on the graph within a nutrient with the same letter are not significantly different according to Duncan’s Multiple Range Test at P≤0.05.

Correlation of fruit damage and apple’s N, P and K concentration

Individual concentration of apple’s N, P and K is significantly correlated with the fruit damage in 2011 while non-significant correlation was observed in 2010 (Table 4), indicated that the effect of fertilization on the CANB infestation becomes more significant under consecutive fertilization situation.



Table 4: Correlation of fruit damage with cashew apple’s N, P and K concentration

Damage rate (Y) versus

2010 2011

Regression equation R F P Regression equation R F P

N concentration (X) Y=7.119X+27.288 0.238 0.420 0.538 Y=14.269X+17.971 0.759 9.489 0.018

P concentration (X) Y=41.739X+27.613 0.355 1.012 0.348 Y=111.221X+11.431 0.881 24.247 0.002

K concentration (X) Y=-6.485X+49.968 0.317 0.779 0.407 Y=-23.402X+77.443 0.660 5.400 0.053

Discussion

Over the two growing seasons of different levels of fertilizer application, differences of CANB infestation were observed between different levels of N, P and K treatments. The effects of N, P and K fertilization levels on CANB infestation and apple’s N and K concentration were more significant in year 2011 than year 2010. This indicates that consecutive fertilization appeared to benefit the establishment of different CANB larval population in different fertilization levels of cashew plants. The effects of N, P and K fertilization levels on CANB infestation were significant at FFSS with medium CANB infestation, but not significant at IFSS and TFSS, maybe because CANB infestation was too low at IFSS or too high at TFSS, which had covered the effects of N, P and K fertilization levels.

We expected that adding N, P and K fertilizer would increase the resistance of cashew plant to CANB. On the contrary, the results indicated that N fertilizer was the main factor which affected CANB infestation, and that an increase in the N fertilizer supply led to a significant increase in CANB damage in the cashew orchard at FFSS. Thus, while N fertilizer is widely applied by farmers in cashew plantations, their effects on the infestation of CANB should be considered. Although cashew responds to fertilization, N is possibly the most important nutrient because of its impact on growth and yield (O’Farrell et al., 2010). Previous studies showed that foliar N concentration increased with increasing N fertilizer in cashew orchards (Liang et al., 2007, 2008; O’Farrell et al., 2010). However, in our study we found that the plant nutrients did not significantly change in different fertilization levels during the fruit setting stage, maybe due to different sampling time.

We found that in the second fertilization year, increasing N application significantly increased total N concentration of cashew apples which were the main feeding site of CANB (Zhang et al., 2012), and the infestation of CANB increased with increasing total N in the cashew apples. Similarly, Atkinson



and Nuss (1989) found that whether in the field or in insectary trials, increased infestation levels of Lepidopteran sugarcane borer Eldana saccharina Walker (Lepidoptera: Pyralidae) were associated with increased stalk total N. Chen et al. (2004) also found that cabbage foliar nitrogen contents increased with increased nutrient availability, and the cabbage butterflies Pieris rapae crucivora Boisduval and P. canidia canidia (Linnaeus) (Lepidoptera: Pieridae) performed well on the fertilized cabbages which contained high foliar nitrogen. Probably, increasing levels of N relative nutrients such as total sugar, protein and amino acids, which are rich in cashew apples (Nagaraja and Nampoothiri, 1986; Akinwale, 2000) and important for development of Lepidopteran borer larva (Strong et al., 1984; Mcneill and Southwood, 1978; Mattson, 1980), lead to the increasing infestation.

Thus, adding N may benefit Lepidopteran borer larva feeding on products of fertilized crops. Singer et al. (2000) found that European corn borer, Ostrinia nubilalis (Hübner) (Lepidoptera: Crambidae) damage was greater in manure (organic fertilizer containing nitrogen and other plant nutrients) applied plots, and Bt corn with manure treatment yielded 19% more in the outbreak year 1997. Similarly, Alma et al. (2005) found that occasionally corn plots which received more nitrogen were subject to higher plant injury by second-generation larvae of O. nubilalis. In South Africa, where sugarcane borer E. saccharina is a problem, a reduction in nitrogen-fertilization rate from 50 kg to 30 kg N per hectare is recommended to reduce the infestation of E. saccharina (Sasa, 1994). To avoid high infestation of millet stem borer Coniesta ignefusalis (Hampson) (Lepidoptera: Pyralidae) caused by nitrogen supplied, Ajayi (1990) suggested that the manipulation of time of nitrogen application may achieve a compromise between using low levels of nitrogen for low stem borer infestation and using high levels for better yields.

In addition, adding N has been found to increase ovipositional preference of Lepidopteran borer on the fertilized crops. Phelan et al. (1995) found that O. nubilalis preferred corn amended with 164 kg/ha NH4NO3 to unamended corn for oviposition. In South Africa, sorghum plants without fertilizer (contained nitrogen) were less preferred for oviposition by spotted stalk borer Chilo partellus (Swinhoe) (Lepidoptera: Crambidae) (Van den Berg and Van Rensburg, 1991). Similarly, Chen et al. (2004) and Hsu et al. (2009) found that cabbage butterflies Pieris rapae crucivora Boisduval and P. canidia canidia (Linnaeus) (Lepidoptera: Pieridae) preferred to lay eggs on the foliage of fertilized cabbages (contained nitrogen).

Adding N also proved to lead to increased reproduction of Lepidopteran borer larvae on fertilized crops. An increase in the survival of pink stem borer, Sesamia calamistis Hampson (Lepidoptera: Noctuidae) larvae and acceleration in larval development with increased nitrogen content of maize was observed, and this might have resulted in an increase in the number of generations per year (Sétamou et al., 1993). Sétamou et al. (1995) also found that nitrogen fertilization enhanced development of S. calamistis, although it also increased the plant’s tolerance to borer attack. Certainly, feeding damage to cashew fruits by CANB significantly increased with increasing N application in our study. Such increased damage could be due to one or all of the following factors: (a) feeding preference, (b) ovipositional preference to cashew grown at high N, and (c) increased reproduction on cashew with high foliar and apple’s N.



In our study, although a positive relationship was observed between fruit damage and P and K fertilizer rate at FFSS of 2011, no significant effect of P fertilization between levels was found on the CANB infestation at any fruit setting stages of both years. Similar results were observed on K fertilization, except at IFSS of 2011, indicating that influence of P and K fertilization on the CANB infestation was little. Similarly, no significant effect of P or K fertilization levels was found on the infestation of red-banded thrips Selenothrips rubrocinctus (Giard) (Zhang et al., 2008). Perhaps compared with N, the impact of P and K was much less on the growth of cashew trees (Liang et al., 2008). Consequently, the physiological change of cashew trees caused by P and K fertilizer was minor and could not affect the CANB infestation.

Future studies need to focus on the mechanisms involved in greater damage by CANB to cashew fruits due to increasing N fertilization, perhaps by analyzing cashew fruits for total sugar, protein, amino acids which CANB larvae prefer, as well as measuring changes in CANB larval population. Based on these research results, it is recommended that in cashew orchards with high N fertilization, proper measures should be taken to avoid serious infestation of CANB.

Acknowledgements

We would like to express our appreciation to Professor S. J. B. A. Jayasekera for his critical review of the manuscript. Financial support was provided by the National Natural Science Foundation of China (No.31301672), Natural Science Foundation of Hainan Province (No. 314126, 20153104), National Nonprofit Institute Research Grant of CATAS-TCGRI (No. 1630032014032, 1630032014033, 1630032015033) and Sub-platform of National Crop Germplasm Resources Infrastructure in China.

References

Ajayi, O. (1990). Possibilities for integrated control of the millet stem borer, Acigona ignefusalis Hampson (Lepidoptera: Pyralidae), in Nigeria. International Journal of Tropical Insect Science, 11, 109-117.

Akinwale, T. O. (2000). Cashew apple juice: Its use in fortifying the nutritional quality of some tropical fruits. European Food Research and Technology, 211, 205-207.

Alma, A., Lessio, F., Reyneri, A., and M. Blandino (2005). Relationships between Ostrinia nubilalis (Lepidoptera: Crambidae) feeding activity, crop technique and mycotoxin contamination of corn kernel in northwestern Italy. International Journal of Pest Management, 51, 165-173.

Altieri, M. A., and C. I. Nicholls (2003). Soil fertility management and insect pests: Harmonizing soil and plant health in agroecosystems. Soil & Tillage Research, 72, 203-211.

Atkinson, P. R., and K. J. Nuss (1989). Associations between host-plant nitrogen and infestations of the sugarcane borer, Eldana saccharina Walker (Lepidoptera: Pyralidae). Bulletin of Entomological Research, 79, 489-506.

Chen, Y. Z., Lin, L., Wang, C. W., Yeh, C. C., and S. Y. Hwang (2004). Response of two Pieris



(Lepidoptera: Pieridae) species to fertilization of a host plant. Zoological Studies, 43, 778-786.

Conticini, L. (1982). Cashew phonological guide. Rivista di Agricoltura Subtropicale e Tropicale, 76, 221-242.

Dharmaraju, E., Ayyanna, T., and C. Sreeramalu (1976). Nephopteryx sp. (Lepidoptera: Pyralidae), a serious pest on cashew. Indian Cashew Journal, 10, 9-11.

Hsu, Y. T., Shen, T. C., and S. Y. Hwang (2009). Soil fertility management and pest responses: A comparison of organic and synthetic fertilization. Journal of Economic Entomology, 102, 160-169.

Jiang, S. B., Deng, S. S., Hong, L. E., Xing, F. Y., and R. Y. Chen (1987). Fertilizer effects on the cashew in Hainan. Tropical Crops Research, 7, 36-40.

Jiang, S. B., Pan, X. L., Deng, S. S., Liang, L. H., Hong, L. E., Wu, Y. M., and Z. C. Lin (1989). Research on the strategies of renovation of low yield cashew orchard. Tropical Crops Research, 9, 53-58.

Liang, L. H., Huang, W. J., Mei, X., Zhang, Z. R., Liang, L. Z., and J. H. Wang (2008). Effect of fertilizer application on growth and production of cashew without management. Chinese Journal of Tropical Crops, 29, 164-168.

Liang, L. H., Liang, L. Z., Mei, X., Huang, W. J., and Z. R. Zhang (2007). Effect of application of NPK upon increasing production of cashew clone FL30. Journal of South China University of Tropical Agriculture, 13, 6-10.

Liang, L. H., Wang, J. H., Huang, W. J., Zhang, W. J., Huang, H. J., and F. Y. Xing (2009). Effects of fertilization on growth and fruiting of young cashew. Soil and Fertilizer Sciences in China, 5, 43-48.

Liang, L. H., and Z. R. Zhang (2007). Diseases and insect pests of cashew. Beijing: China Agriculture Press, 98-100.

Luo, Y. M., and Q. A. Jin (1986). Primary study of cashew apple and nut borer. Chinese Journal of Tropical Crops, 7, 99-105.

Mattson, W. J. (1980). Herbivory in relation to plant nitrogen content. Annual Review of Ecology, Evolution, and Systematics, 11, 119-161.

McNeill, S., and T. R. E. Southwood (1978). Role of nitrogen in the development of insect plant relationships. In J. B. Harborne (Eds.). Biochemical aspects of plant and animal convolution, (pp. 77-98). New York: Academic Press.

Mitchell, J. D., and S. A. Mori (1987). The cashew and its relatives (Anacardium: Anarcardiaceae). Memoirs of the New York Botanical Garden, 42, 1-48.

Nagaraja, K. V., and V. M. K. Nampoothiri (1986). Chemical characterization of high-yielding varieties of cashew (Anacardium occidentale). Plant Foods for Human Nutrition, 36, 201-206.



O’Farrell, P. J., Armour, J. D., and D. J. Reid (2010). Nitrogen use for high productivity and sustainability in cashew. Scientia Horticulturae, 124, 19-28.

Painter, R. H. (1951). Insect resistance in crop plants. Kansas: University Press.

Pan, X. L., and F. Y. Xing (1987). Infestation and control of cashew apple and nut borer. Chinese Journal of Tropical Crops, 8, 109-116.

Phelan, P. L., Mason, J. F., and B. R. Stinner (1995). Soil fertility management and host preference by European corn borer, Ostrinia nubilalis (Hubner), on Zea mays L.: A comparison of organic and conventional chemical farming. Agriculture, Ecosystems & Environment, 56, 1-8.

Sasa (1994). Eldana borer control measures. Experiment Station Information Sheet: SASA. Mount Edgecombe, Natal: South Africa Sugar Association.

Sétamou, M., Schulthess, F., Bosque-Pérez, N. A., and A. Thomas-Odjo (1993). Effect of plant nitrogen and silica on the bionomics of Sesamia calamistis Hampson (Lepidoptera: Noctuidae). Bulletin of Entomological Research, 83, 405-411.

Sétamou, M., Schulthess, F., Bosque-Pérez, N. A., and A. Thomas-Odjo (1995). The effect of stem and cob borers on maize subjected to different nitrogen and silica treatments, with special reference to Sesamia calamistis Hampson (Lepidoptera: Noctuidae). Entomologia Experimentalis et Applicata, l77, 205-210.

Singer, J. W., Heckman, J. R., Ingerson-Mahar, J., and M. L. Westendorf (2000). Hybrid and nitrogen source affect yield and European corn borer damage. Journal of Sustainable Agriculture, 16, 5-15.

Smith, C. M. (1989). Plant resistance to insects -A fundamental approach. New York: John Wiley& Sons.

Strong, D. R., Lawton, J. H., and T. R. E. Southwood (1984). Insects on plants: Community patterns and mechanisms. Oxford: Blackwell Scientific Publications.

Tokase, J. S., and S. K. Godase (2006). Efficacy of some insecticides against the cashew apple and nut borer Nephopteryx sp. (Lepidoptera: Pyralidae). Pestology, 30, 40-41.

Van den Berg, J., and J. B. J. Van Rensburg (1991). Infestation and injury levels of stem borers in relation to yield potential of grain sorghum. South African Journal of Plant and Soil, 8, 127-31.

Zhang, Z. R., Liang, L. H., Huang, W. J., Mei, X., and J. H. Wang (2008). Effects of fertilizers with different ratios of nitrogen, phosphorus and potassium on the infestation of cashew red-banded thrip Selenothrips rubrocinctus. Chinese Bulletin of Entomology, 45, 559-561.

Zhang, Z. R., Wang, J. H., Huang, W. J., Huang, H. J., and L. H. Liang (2011). Population dynamics and spatial distribution patterns of cashew apple and nut borer Nephopteryx sp. larvae. Chinese Journal of Tropical Crops, 32, 1153-1157.

Zhang, Z. R., Wang, J. H., Huang, W. J., Huang, H. J., and L. H. Liang (2012). Study on the occurrence and damage characteristics of apple and nut borer (Nephopteryx sp.) in Hainan. Plant Protection, 38, 158-161.



Integrated Soil Management Practices for Improving Soil Fertility in Cashew Growing Areas of the Southern Zone of Tanzania

A.K. Kabanza*, J.J. Tenga, M.M. Kwikima, and R. Msoka


P.O. Box 509, Mtwara Tanzania.


Abstract

The effect of intercropping cashew with legumes on soil fertility improvement in five landscape units in southern Tanzania was evaluated. A cashew-legume intercropping experiment was established using a Randomised Complete Block Design with three replications. There were seven treatments: mucuna, mucuna cultivated under, green gram, green gram cultivated under, cowpeas, cowpeas cultivated under and control (without legume). Legume-cashew interaction had significant (p < 0.05) effect on soil fertility improvement. Across sites, significant (p < 0.05) differences in growth of the legumes under cashew canopy were observed. Mucuna had the highest biomass (8.5t/ha) and grain yield (453 kg/ha) followed by cowpeas (380 kg/ha) and green gram (61 kg/ha). Two-year results revealed more benefit from cashew – mucuna intercropping followed by cashew cowpeas and the least was cashew – green gram. Mucuna has high economic returns when compared with green gram and cowpeas. Intercropping with mucuna in cashew fields has a potential of improving soil fertility for sustainable cashew nut production.

Key words: cashew, intercropping, legumes, soil fertility, southern Tanzania

Introduction

Cashew nut (Anacardium occidentale L.) is one of the major cash crops grown in Tanzania. It is grown along the coast, particularly in the southern coastal areas (Majule & Omollo, 2008). Other areas where the crop is grown include Tanga, Coast, Ruvuma and Singida regions. In the southern zone, cashew productivity is limited because of declining soil fertility and disease incidence such as powdery mildew, cashew nut leaf and nut blight disease and cashew wilting disease. Most of the soils in the southern zone are highly weathered with very low levels of plant nutrients, leading to low crop yields (Bennett et al., 1979). The major disease limiting cashew production is powdery mildew (PMD) caused by a fungus known as Oidium anacardii (Martin et al., 1997). For some time now, sulphur has been recommended and used for controlling powdery mildew (Smith et al., 1995). Although sulphur application has proved to be effective in controlling the disease, data generated from long-term field experiments (12 years) on soil properties indicates that its prolonged use leads to decline in soil pH, hence soil acidification as a result of sulphur oxidation to sulphuric acid (H2SO4) (Majule, 1999; Ngatunga and Deckers, 2003).



Soil acidification has been reported to reduce phosphorus availability through fixation of micronutrients (Cu and Zn), which impair soil microbial activity. Consequently, there is reduction of decomposition of organic matter, and increased amounts of iron and aluminium to toxic levels. All these contribute to decline in soil fertility especially in nitrogen and phosphorus, and fall in productivity of annual food crops. In the southern zone, Ngatunga et al. (2001) reported that soil acidification contributes to yield reduction of crops like sorghum, millet and maize when intercropped with cashew. Increased soil acidification is further amplified by poor soil management including clean weeding, inadequate fertiliser application, removal and burning of crop residues, and shortening and elimination of fallow periods. These practices contribute to continuous mining of nutrients from the soil and reduction of soil organic matter content which further intensifies soil fertility degradation (Ngatunga et al., 2001).

Long-term research data has shown that one of the potential measures of ameliorating soil acidity is application of organic residues. Low organic matter content of the soil has negative influence on the soil’s fertility which is reflected by low productivity. Regular application of organic residues and fertilisers normally replenishes the lost nutrients like nitrogen, improves the soil physical properties like water holding capacity, and increases the distribution and stability of soil aggregates and water infiltration (McRae and Mehuys, 1988; Aikpokpodion et al., 2010).

The soils in the cashew growing areas have inherent low soil fertility. The use of green manure plants has a potential for soil fertility replenishment in these areas. The potential of this co-application has not been adequately tested in the cashew farming system of the southern zone of Tanzania and therefore findings reported elsewhere cannot be applied with certainty. In view of the above, we conducted an experiment to assess the effectiveness of green manure plants in combination with Minjingu Rock Phosphate (MRP) for improving and maintaining soil fertility in cashew growing areas. The fertiliser is locally available in the country. Also, we assessed the economic benefits of applying MRP and the edible green manure plants (mucuna, green gram and cowpeas) in cashew fields/farms.

Objectives

The objectives of applying integrated soil management practices were to:

• assess the effectiveness of green manure plants for improving and maintaining soil fertility; and

• evaluate the benefits of applying green manure in cashew growing areas.


Trial was established in different agro-ecological zones of the southern zone that have different soil types/landscape units. The sites included Naliendele Agricultural Research Institute (NARI) (Mtwara District) located in Makonde Dissected Plateau, Nanyanga Cashew Development Centre (Tandahimba District) and Mtopwa Experimental Station (Newala District) found in Makonde High Plateau; and Mkumba Research Sub-Station (Nachingwea District) located in the Inland Plains and Nakayaya Cashew Development Centre (Tunduru District) located in the Tunduru-Masasi Plains (Figure 1).



Figure 1: Location of trial sites (areas with green squares)

The trial had seven treatments (see Figure 2): i) Velvet beans (Mucuna pruriens) (left in the field up to harvest, ii) Velvet beans (cultivated under at flowering), iii) Green gram beans (Vigna radiata) (left in the field up to harvest), iv) Green gram beans (cultivated under at flowering), v) Cowpeas (Vigna unguiculata) (left in the field up to harvest), vi) Cowpeas (cultivated under at flowering), and vii) Control (treatment without green manure). The plots were ploughed by tractor, and around the cashew tree a hand hoe was used. Plot size of 10 m x 10 m was measured around the cashew tree in a randomised complete block design with three replicates. In the plot grain yield data for the green manure plants were collected.

To monitor the changes of soil physical and chemical characteristics, composite soil samples were collected before and after harvest of green manure plants at a depth of 0-20 cm and 20-40 cm from each plot. The samples were analysed for soil pH, organic carbon, total nitrogen, available P and CEC using standard laboratory procedures (NSS, 1990). Monitoring of plant parameters (determination of grain yield) and benefit of green manure in cashew fields was done during the rainy season (January - June 2014 and January - June 2015). The data collected was analysed using Genstat statistical package Version 4, of 2012. Means among treatments were separated using Duncan Multiple Range Test at 5% level of significance.




Green manure plants germination was over 95%. Whereas Mucuna and cowpeas grew vigorously, green gram was weak probably due to the effect of shade from cashew trees.

Rainfall data for the studied season (January - June 2014 and 2015)The southern zone of Tanzania experiences a uni-modal type of rainfall starting from late November to late May. Therefore, green manure crops were planted in January and harvested in June. Rainfall distribution from different trial sites for the two seasons are presented in Figure 2a and 2b below.

Figure 2: Sketch map of green manure experiment field layout



a) Season 2014 b) Season 2015

Figures 2a and 2b: Rainfall distribution recorded from the trial sites during the study period

Soil and plants sampling and analysis from the sitesSoil analysis data at the beginning of the trial showed that all the sites had pH values ranging from 4.7 to 5.2 classified as very strong acidic to strong acidic. Soil organic carbon value ranged from 0.47 to 1.59 (Table 1). These values are categorised as being very low to medium (London, 1991). Most of the agricultural activities in the study area involve clearing and burning of all crop residues in the field which lead to low soil N and OM status in the area. Total nitrogen values range from 0.03 to 0.13%; in literature this is classified as very low level of total N (London, 1991). This indicates nitrogen deficiency for most crops including cashew and other crops normally intercropped with cashew (cowpeas, cassava, sorghum, bambara groundnut). The available P (Bray 1) in the soil ranges from 2.39 to 9.37 mg/kg (Table 1). London (1991) reported that when Bray 1 extractable P is less than 15 mg/kg soil, response of most of the crops to use P is likely to occur. Based on this categorisation the sites had very low level of soil available P for growth of most crops. Exchangeable K in the soil ranged from 0.08 to 0.29 me/kg soil (Table 1). Most of the crops are likely to respond to K fertiliser when exchangeable K in clay soils is less than 0.2 to 0.4 me/kg soil, and response is medium when K ranges from 0.41 to 1.2 me/kg soil (London, 1991). London reports further that exchangeable K in loam soils is low when K is less than 0.13 to 0.25 me/kg soil, and is medium when K ranges from 0.26 to 0.8 me/kg soil. Also, exchangeable K in sandy soils is low when it is less than 0.05 to 0.1 me/kg soil, and is medium when K ranges from 0.11 to 0.4 me/kg soil. Other exchangeable bases like calcium, magnesium and sodium were classified as very low to low, medium, and low, respectively across the trial sites. This forms the basis for monitoring soil fertility in cashew growing areas.



Table 1: Initial soil characteristics of green manure trial sites

Characteristic measured

ARI Naliendele

Nanyanga CDC

Mtopwa CDC Mkumba Nakayaya CDC

Depth (cm) 0-20 0-20 0-20 0-20 0-20 Physical Properties

Sand (> 50 µm) 83 69 73 57 85Silt (20-50 µm) 6 7 6 6 5Clay (< 2 µm) 11 23 21 37 10Soil texture class (USDA)

LS SCL SCL SC LS

Chemical properties

pH-H2O 5.1a 5.1a 4.9a 5.2a 5.8aOrganic Carbon (%) 0.87ab 1.59a 1.48bc 0.94ab 0.47aTotal Nitrogen (%) 0.05ab 0.1bc 0.13d 0.08bc 0.03aAvail. P (mg/kg) (Bray-1)

7.79a 5.4a 5.22a 6.45a 5.02a

K+ (me/100g) 0.16ab 0.2b 0.13ab 0.29b 0.06aCa2+ (me/100g) 0.51a 0.41a 0.68a 0.61a 0.47aMg2+ (me/100g) 0.25a 0.8b 0.29a 0.79b 0.2aNa+ (me/100g) 0.25b 0.28b 0.2a 0.24b 0.17aCEC (me/100g) 1.89a 4.34b 2.3ab 3.18b 1.37aBS (%) 62b 63ab 57a 61ab 66b

KEY:LS = Loamy Sand, SL = Sandy Loam, SCL = Sandy Clay Loam, SC = Sandy Clay, C = ClayUSDA = United States Department of AgricultureP = Phosphorus, Ca = Calcium, Mg = Magnesium, Na = SodiumCEC = Cation Exchange Capacity, BS = Base SaturationMeans with the same letter(s) in the same column are not significantly different following Duncan’s Multiple Range Test at 5% level.



Table 2: Plant leaves analysis results from green manure trial sites during season 2014

Characteristic mea-sured

ARI Nalien-dele

Nanyanga CDC

Mtopwa CDC

Mkumba Nakayaya CDC

MUCUNA

Total Nitrogen (%) 1.16a 1.54a 1.5a 1.28a 1.2aAvail. P (%) 0.29a 0.33ab 0.45b 0.36b 0.32abK+ (%) 3.52ab 4.66b 4.9b 2.75a 2.26a

GREEN GRAM

Total Nitrogen (%) 1.28a 1.6a 1.74a 1.35a 1.37aAvail. P (%) 0.28a 0.32a 0.37a 0.42a 0.36aK (%) 5.21b 3.71ab 7.17b 2.86a 3.48a

COWPEAS

Total Nitrogen (%) 1.21a 1.7a 1.73b 1.15a 1.33aAvail. P (%) 0.27a 0.38b 0.47b 0.36b 0.32abK (%) 4.7b 4.42b 4.43b 2.47a 3.71ab

Means with the same letter(s) in the same column are not significantly different following Duncan’s Multiple Range Test at 5% level.

Table 2 presents mean values of nutrients added in the soil across sites at 50% flowering. The results show that green gram produced highest total nitrogen followed by cowpeas and mucuna. Cowpeas leaves recorded higher available P than green gram and mucuna. It was observed that in the overall leguminous crop across the site, Mtopwa produced the highest total nitrogen (%) across leguminous crops, followed by Nanyanga Cashew Development Centre station, Nakayaya Cashew Development Centre, Mkumba sub-station and lastly Naliendele Agricultural Research Institute. The differences across sites could be attributed to differences in germination, rainfall availability and soil properties. It was noted that Mucuna grew vigorously compared with cowpeas and green gram (Figure 3). Mucuna has a potential of growing well under cashew canopy as it tolerates shade and it provides high grain yield.



Soil analysis from the trial sites for the second season (Year 2015)

Table 3 presents the effect of green manuring on soil fertility in the trial sites for the second season (Year 2015). The pH of the trial sites ranged from very strongly to strongly acid. In general the nutrients status ratings of the sites are still low. Looking at the means and ranks of the selected soil characteristics (Table 4), there is highly significant difference in pH among the trial sites. According to London (1991) ratings, Mkumba has extremely acidic soils, Nakayaya has medium acid soils, while the other sites have strongly acid soils. The strongly acid soils may inhibit the absorption of other nutrients from the soils by the plants. Also organic carbon (OC) differs significantly among sites and Nakayaya site has very low OC content. The other sites (Naliendele, Nanyanga, Mtopwa and Mkumba) have low OC content. This may be due to removal of organic matter under cashew canopy during ring weeding to prepare fields for nut picking. All the sites have low P and K content except Mkumba that has medium K content. The soils at Mkumba are clayey compared to soils of other trial sites. The comparison of soil nutrients before and after incorporation of the green manure is difficult to observe as the trial is in the second year. We still need some time to measure the change; however, the change is noted on flowering of cashew in which early flushing was observed in plots with green manure incorporated compared with those without green manuring.



Table 3: Effect of green manure on soil fertility status across sites

Characteristics Cashew + M

Cashew + M (CU)

Cashew + GG

Cashew + GG (CU)

Cashew + CP

Cashew + CP (CU)

Cashwe + Control

ARI Naliendele

pH-H2O 5.1 4.8 5.0 5.1 5.3 5.0 5.0

Organic Carbon (%) 0.53 0.57 0.55 0.46 0.43 1.00 0.43

Total Nitrogen (%) 0.05 0.04 0.06 0.05 0.06 0.05 0.04

Avail. P (mg/kg) (Bray-1) 2.08 2.24 1.28 2.45 4.26 2.28 1.71

K+ (me/100g) 0.14 0.14 0.12 0.17 0.07 0.10 0.11

Nanyanga

pH-H2O 4.8 4.8 4.9 4.8 4.8 4.7 4.8

Organic Carbon (%) 1.28 1.17 1.23 1.22 1.20 1.20 1.09

Total Nitrogen (%) 0.11 0.07 0.10 0.075 0.11 0.10 0.10

Avail. P (mg/kg) (Bray-1) 1.55 1.22 3.59 1.39 0.58 3.34 1.12

K+ (me/100g) 0.15 0.13 0.12 0.12 0.13 0.13 0.09

Mtopwa

pH-H2O 4.6 4.5 4.6 4.9 4.6 4.6 4.5

Organic Carbon (%) 0.05 0.07 1.06 1.12 0.94 1.10 1.12

Total Nitrogen (%) 0.10 0.09 0.10 0.09 0.08 0.10 0.09

Avail. P (mg/kg) (Bray-1) 1.06 1.28 0.9 1.13 1.15 1.2 1.04

K+ (me/100g) 0.07 0.06 0.06 0.06 0.12 0.09 0.06

Nakayaya

pH-H2O 5.8 5.7 5.9 5.7 5.7 5.7 5.9

Organic Carbon (%) 0.53 0.74 0.41 0.41 0.48 0.46 0.35

Total Nitrogen (%) 0.05 0.05 0.03 0.04 0.05 0.05 0.04

Avail. P (mg/kg) (Bray-1) 1.29 1.37 1.96 3.62 1.6 1.21 1.43

K+ (me/100g) 0.06 0.07 0.07 0.08 0.12 0.09 0.06

Mkumba

pH-H2O 4.2 4.4 4.4 4.4 4.3 4.3 4.8

Organic Carbon (%) 0.83 0.87 0.85 0.95 0.96 0.82 1.07

Total Nitrogen (%) 0.07 0.07 0.07 0.07 0.06 0.07 0.08

Avail. P (mg/kg) (Bray-1) 0.7 0.81 0.9 1.32 1.42 1.14 0.46

K+ (me/100g) 0.21 0.26 0.24 0.32 0.24 0.27 0.38

Key:Depth = 20 cmM = Mucuna, M (CU) = Mucuna Cultivated under at flowering, GG = Green gram, GG (CU) = Green gram cultivated under at flowering, CP = Cow peas, CP (CU) = Cow peas cultivated under at flowering, Control = Cashew without green manure



Table 4: Means and ranks for the selected soil characteristics

Site/Character-istics

pH (water) Organic Car-bon (%)

Total Nitro-gen (%)

Phosphorous (P) (mg/kg)

Potassium (K) (me/100g)

ARI Naliendele 5d(2) 0.60b(4) 0.05a(4) 1.88a(1) 0.12b(3)Nanyanga 4.8c(3) 1.20e(1) 0.09c(2) 1.83a(2) 0.13b(2)Mtopwa 4.6b(4) 1.07d(2) 0.09c(1) 1.11a(4) 0.06a(5)Mkumba 4.4a(5) 0.91c(3) 0.07b(3) 0.96a(5) 0.27c(1)Nakayaya 5.8e(1) 0.48a(5) 0.04a(5) 1.78a(3) 0.08a(4)Mean 4.9 0.85 0.07 1.51 0.13F test < 0.001 < 0.001 < 0.001 0.2 0.2CV (%) 4.9 18.6 23.9 101.9 49.4

Means with the same letter(s) in the same column are not significantly different following Duncan’s Multiple Range Test at 5% level.Numbers within parentheses following the letter(s) stand for ranks.

Figure 3: Average green manure grain yield for the studied period

The benefits of applying green manure in cashew fieldsThe green manure grain yield records from the sites (Fig. 3) were multiplied by the prices of the grains per kg per ha and the results are presented in Table 5.



Table 5: Revenue (Tshs) from green manure

Site

Green ma-nure type

ARI Nalien-dele

Nanyanga CDC

Mtopwa CDC

Mkumba Nakayaya CDC

Mucuna 343,300 Nd 630,000 171,000 666,700

Green gram 170,100 24,000 30,000 18,000 Nd

Cowpeas 384,000 300,000 890,100 52,000 275,100

Note: Price of green manure grain yield of mucuna -Tshs. 1000, green gram -Tshs. 3000, cowpeas -Tshs. 3000 Exchange rate at harvest in May 2015, 1 US $= Tshs. 2,000

Nd = Grain yield not determined (at Nanyanga destroyed by squirels and at Nakayaya crop failure)

Results on the revenue that could be collected in the sites indicate that Mtopwa had highest revenue in cowpeas and least at Mkumba. Green gram showed high revenue at NARI followed by Mtopwa Cashew Development Centre, Nanyanga Cashew Development Centre and lastly Mkumba sub-station. Mucuna at Nakayaya Cashew Development Centre had high revenue compared to Mkumba sub-station. The overall high revenue across the sites was observed in Mtopwa for cowpeas, NARI for green gram and Nakayaya Cashew Development Centre for mucuna. The differences in revenue across the sites could be attributed to crop value and price in the locality. These preliminary findings show that apart from cashew revenue, there is additional revenue from green manure grains harvested from cashew farms.

Furthermore, in the second season of the experiment, we observed that in all sites the cashew trees were the first to flush compared to other blocks where no experiment was conducted. This could be attributed to tilling and low weed infestation, as the experimental plots were free of weeds.

Conclusion

Monitoring of soil fertility in the field is an important aspect for sustainable crop production. When crops are harvested, they go with some plant nutrients from the soil that are not replenished resulting into nutrient mining in fields. The same situation occurs in cashew fields where plant remains are cleared and burned during ring weeding and there is no fertiliser application in the fields. We recommend the application of green manure in cashew fields, as this would add some plant nutrients, reduce weeding cost, and eventually ensure good harvest to the farmers.

Acknowledgements

This work has been possible, thanks to sponsorship from the Cashew Research Programme. The authors would also like to thank the Cashew Development Centre (CDC) managers at Nanyanga, Mtopwa and Nakayaya, and Mkumba Officer In-Charge for supervising and maintaining the trial sites.



References

Aikpokpodion, P. E., Uloko, B., and G. Edibo (2010). Nutrient dynamics in soil and cashew (Anacardium occidentale L.) leaf and kernel in Kogi State, Nigeria. Journal of Applied Biosciences, 25, 1573-1578.

Bennett, J. G., Brown, L. C., Geddes, A. M. W., Hendy, C. R. C., Lavelle, A. M., Sewell, L. G., and R. R. Innes (1979). Mtwara/Lindi Regional Integrated Development Progamme. Report of the zonal survey in phase 2, volume 1. The Physical environment.

Landon, J. R. (1991). Booker tropical soil manual. A handbook for soil survey and agricultural land evaluation in the tropic and subtropics. New York: Longman.

Majule, A. E. (1999). The effects of organic residue and elemental sulphur additions to soils of southern Tanzania. Ph.D. Thesis, Reading University, U.K.

Majule, A. E., and J. Omollo (2008). The performance of maize crop during acidic amelioration with organic residues in soils of Mtwara, Tanzania. Tanzania Journal of Science 34, 21-28.

Martin, P. J., Topper, R. A., Boma, F., De waal, D., Haries, H., Kasuga, L. J., Katinila, N., Kikoka, L. P., Lamboll, R., Madison, A., Majule, A. E., Massawe, P. A., Millanzi, K. J., Nathaniels, N. Q., Shomari, S. H., Sijaona, M. E., and T. Stathers (1997). Cashew nut production in Tanzania: Constrains and progress through integrated crop management. Crop Protection, 16, 6-14.

McRae, R. J., and G. R. Mehuys (1988). The effect of green manuring on the physical properties of temperate-area soils. Advanced Soil Science, 3, 71-94.

NSS (1990). Laboratory procedures for routine soil analysis (3rd Edition). Miscellaneous reports No. 13, National Soil Service, ARI Mlingano, Tanga, Tanzania.

Ngatunga, E. L., Cools, N., Dondeyne, S., Deckers, J. A., and R. Merckx (2001). Buffering capacity of cashew soils in South-Eastern Tanzania. Soil Use and Management, 17, 155-162.

Ngatunga, E. L., and J. A. Deckers (2003). Is sulphur acidifying cashew soils of south-eastern Tanzania? Agriculture, Ecosystems & Environment, 95(1), 179-184.

Smith, D. N., King, W. J., Topper, C. P., Boma, F., and J. F. Copper (1995). Alternative techniques for the application of sulphur dust to cashew trees for the control of powdery mildew caused by the fungus Oidium anacardii in Tanzania. Crop Protection, 14(7), 550-560.


Crop Protection

CROP PROTECTION


Crop Protection

Determining the Current Abundances and Distributions of the African Weaver Ant, Oecophyl-la longinoda Latreille (Hymenoptera: Formicidae) in Cashew Growing Areas in Tanzania

W. Nene* and S. H. ShomariCashew Research Programme, Naliendele Agricultural Research Institute

P. O. Box 509, Mtwara, Tanzania


Abstract

Weaver ants (Oecophylla spp.) are potential biological agents that protect crops against insect pests. The crop is adequately protected when the ant colonies are stable and abundant. Therefore, deter-mining ant abundances and their distributions is essential. Such information can be useful for rec-ommendations on the incorporation of weaver ants in Integrated Pest Management Programmes. Weaver ant abundances and distributions using field surveys in cashew growing areas in Tanzania were determined, and ant ecology based on cashew tree age was also assessed. The results indicated that the ant abundances per cashew tree in all of the surveyed areas was less than 50 %. Cashew trees which were five or more than five years old were more colonised (85.4%) compared to those which were less than five years old (14.6%). Weaver ant competitors were recorded and are discussed in this study. The likely cause of low weaver ant abundances is also discussed. The conclusion from this study is that in order to optimise the use of weaver ant as a bio-agent against insect pests of cashew, management practices to boost their population is needed.

Key words: weaver ant, abundance, biological control, cashew, insect pest, synthetic insecticides

Introduction

Two species of weaver ants, Oecophylla longinoda (found in Africa) and Oecophylla smaragdina (found in Asia, Australia and Western Pacific) have been reported to be potential biological agents for the control of insect pests in multiple crops including cashew (Van Mele and Cuc, 2000; Peng et al, 2008). In Tanzania, production of cashew is to a great extent constrained by insect pests particularly Helopeltis spp and Pseudotheraptus wayi (Sijaona, 2013). Principally, the majority of cashew growers in Tanzania control these insects by using synthetic insecticides mainly Lambda cyhalothrin (Sijaona, 2013). Depending entirely on synthetic insecticides can cause adverse effects to public health and the environment (De Bon et al., 2014). Therefore, if O. longinoda is maintained at optimum populations, it can be a better option for protection of cashew from insect attacks.

A high and stable weaver ant population is required for adequate protection. The ants provide ade-quate protection if more than 50 % of tree’s main branches are occupied by weaver ant trails (Peng et al., 2008). However, knowledge on weaver ant abundances and their distributions in cashew crop in Tanzania is not well known.


Crop Protection

Correspondingly, the presence of weaver ant competitors such as the big headed ants, Pheidole megacephalla and crazy ants, Anoplolepis spp negatively affect weaver ant populations (Van Mele, 2008; Seguni et al., 2011). Determining the abundances and distributions of weaver ants and their compet-itors could enable right decision making regarding the use of weaver ants as key element in Integrated Pest Management (IPM). Therefore, the objective of this study was to examine ant abundances and distributions, and to explore their potential in controlling cashew insect pests.


Field surveys were conducted between October 2012 and January 2013 covering Mtwara Rural, Ma-sasi, Newala and Tandahimba districts in Mtwara Region; Lindi Rural and Nachingwea districts in Lindi Region; Mkuranga, Mlandizi and Bagamoyo districts in Coastal Region; and Tanga Municipal, Mkinga and Korogwe districts in Tanga Region. Mtwara and Lindi are the main growers of cashew, producing more than 80 % of the country’s total.

Fields to be studied had to be at least 1 acre to allow random sampling of 10 high yielding cashew trees. Survey was carried out in collaboration with the District Subject Matter Specialist (DSMS-Ca-shew) from the office of the District Agricultural and Irrigation Cooperative Officer (DAICO) in each respective district. A total of 60 cashew fields from each district were selected for assessing the abundances and distributions of ants. Coordinates of the fields were recorded with the use of GPS.

The population of ants, O. longinoda, Pheidole spp and Anoplolepis spp were assessed by using two approaches: (i) score classes developed by Stathers (1995) [0=No ants, 1=Few; 1-20 ants observed, 2=Some; 21-50, 3=many; 51-200, 4=Abundant; 201-500 and 5=Very abundant (>500), with some modifications] (Seguni et al., 2011), and (ii) counting all visible leaf nests on the canopy of the trees. Weaver ant distribution in the study areas was determined by number of cashew farms with weaver ants divided by total number of farms×100. Cashew trees colonised by weaver ants were also grouped by age (getting assistance from farm owner): putting into one group colonized cashew trees older than five years, and putting those estimated to have equal or less than five years in the other group.

Data collected was analysed by using Genstat Statistical Software (Version 3). The data for weaver ant distribution and nest counting was not normally distributed even after transformation, therefore it was analysed by either Non-Parametric Mann-Whitney (for two groups) or Kruskal-Wallis (for three groups) tests.

Results

Figure 1 shows the surveyed areas for the abundances and distributions of weaver ants and their com-petitors.


Crop Protection

Figure 1: Map of Tanzania showing surveyed areas for ant distributions and abundances

Figures 1a - c show the distribution of weaver ants in the surveyed areas. Results indicate insignifi-cant weaver ant distribution in the tested locations of Bagamoyo, Mkuranga and Mlandizi (p=0.57); Korogwe and Mkinga (p=0.317); and Hinterland, Coast and Makonde Plateau (p=0.248). Based on zones, the northern zone recorded the highest number (averaging 53.8%) whereas the eastern and southern zones recorded 39% and 31.3%, respectively. Generally, 41.3% of the surveyed cashew trees from all zones were populated by weaver ants.

20

0

Bagamoyo

100

60

80

40

MlandiziMkuranga Location

Per

cent

age

Wea

ver A

nt D

istrib

utio

n

70

100

60

50

40

30

20

Korogwe

90

80

Mkinga Location

Per

cent

age

Wea

ver A

nt D

istri

butio

n

a bFigure 1a and b: Box plots showing weaver ant distribution in the eastern zone (Kruskal-Wallis H value = 1.120, df;2, p=0.57) and northern zone (Mann-Whitney U value = 64.5, p=0.317)


Crop Protection

Coast

60

Hinterland

40

20

Makonde_Plateau

80

100

Location

Per

cent

age

Wea

ver A

nt D

istrib

utio

n

Figure 1c: Weaver ant distribution in the southern zone (Kruskal-Wallis H value = 2.782, df;2, p=0.248)

Regarding the number of weaver ant nests (Figure 2) results show no significant differences (p=0.099) among the surveyed areas. An average of 9 nests per tree was recorded in the northern zone and 6 nests for the eastern and southern zones.

8

6

4

2

Eastern

16

12

14

10

SouthernNorthern

Location

Avw

erag

e nu

mbe

r of n

ests

/tree

Figure 2: Mean number of weaver ant nests per cashew tree in the eastern, northern and southern zones (Kruskal-Wallis H value = 4.55, df;2, p=0.099)

Table 2 shows population levels of O. longinoda, big headed ants, Pheidole megacephalla and crazy ants, Anoplolepis spp. A low population of weaver ants was recorded compared to other ant species. High weaver ant population was recorded from the hinterland (Masasi and Nachingwea) in the south-ern zone, and Korogwe in the northern zone. A high population of P. megacephalla was recorded in all surveyed areas. The northern zone recorded a low population of Anoplolepis spp.


Crop Protection

Table 2: Average population levels of ant species from survey areas

Ant species

Location O. longinoda Pheidolespp Anoplolepis spp

Coast 1 (1-20) 3 (51-100) 3 (51-100)

Hinterland 2 (21-50) 3 (51-100) 3 (51-100)

Makonde 1 (1-20) 3 (51-100) 3(21-50)

Mkuranga 1 (1-20) 3 (51-100) 1 (1-20)

Mlandizi 1(1-20) 3 (51-100) 2 (21-50)

Bagamoyo 1 (1-20) 3 (51-100) 2 (21-50)

Mkinga 1 (1-20) 3 (51-100) 1(1-20)

Korogwe 2 (21-50) 3 (51-100) 1(1-20)

Field observation also showed that weaver ants were more colonised on cashew trees older than five years (85.4%) compared to those younger than five years (14.6%).

Discussion

The results show that weaver ants are present in all the surveyed zones, with different distribution levels. The number of nests recorded ranged between 6 and 9. Weaver ant abundances with at least 10 nests per cashew canopy is required for adequate protection of cashew against insect pest attack (Stathers, 1995). Based on previous studies, it is also suggested that at least 50% of the main branches should be occupied by weaver ant trail for adequate crop protection against insect pests (Peng et al., 2008). The low level of weaver ant population and low percentage distribution recorded from the surveyed areas indicate that crop protection by this bio-agent is inadequate.

More weaver ants were observed on cashew trees over five years old. This could be associated with suit-ability of the hosts including minimum disturbance. Based on field observation, the low population of weaver ants could be attributed to fighting between different colonies due to canopy overlapping between trees. The presence of weaver ant competitors such as Pheidole spp and Anoplolepis spp also negatively affected weaver ant population and expansion in the fields. Controlling weaver ant compet-itors such as Pheidole spp would ensure an increase of the weaver ant population. Work by Seguni et al. (2011) showed that the use of Amdro bait and weeding regimes reduces Pheidole population where in turn increases weaver ant population.

This study has revealed that the population of weaver ants is low in all surveyed areas. This suggests that efforts need to be made to enhance their population for successful utilisation of this bio-agent as a key element in integrated insect pest management. Temporal and spatial distribution of weaver ants and their competitors needs to be investigated.


Crop Protection

Acknowledgements

We are grateful to Mr. Barnabas Betram for his assistance in data collection. Cashew farm owners are acknowledged for volunteering their fields for this study. We thank the Cashew District Subject Matter Specialists for their assistance in site selection during the survey. This study was funded by the Cashew Research Programme.

References

De Bon, H., Huat, J., Parrot, L., Sinzogan, A., Martin, T., Malézieux, E., and J-F. Vayssières (2014). Pesticide risks from fruit and vegetable pest management by small farmers in Sub-Saharan Afri-ca. A review. Agronomy for Sustainable Development, DOI 10.1007/s13593-014-0216-7.

Peng, R. K., Christian, K., Lan, K. L. P., and N. T. Binh (2008). Integrated cashew improvement pro-gramme using weaver ants as a major component. Manual for ICI programme trainers and extension officers in Vietnam. Charles Darwin University and Institute of Agricultural Science for South Vietnam, 90 pp.

Seguni, Z. S. K., Way, M. J., and P. Van Mele (2011). The effect of ground vegetation management on competition between the ants Oecophyllalonginoda and Pheidolemegacephalla and implications for conservation biological control. Crop Protection Journal, 30, 713-717.

Sijaona, M. E. R. (2013). Important diseases and insect pests of cashew in Tanzania. Naliendele Agricul-tural Research Institute, Tanzania.

Stathers T. E. (1995). Studies on the Role of Oecophylla longinoda (Hymenoptera: Formicidae) in cashew trees in southern Tanzania. Naliendele Agricultural Research Institute, Mtwara, Tanzania. 59pp.

Van Mele, P. (2008). A historical review of research on the weaver ant Oecophylla in biological control. Agricultural and Forest Entomology, 10, 13-22.

Van Mele, P., and N.T.T. Cuc (2000). Evolution and status of Oecophylla smaragdina (Fabricius) as a pest control agent in citrus in the Mekong Delta, Vietnam. International Journal of Pest Man-agement, 46, 295-301.


Crop Protection

Prospective Study of the Insect Fauna Associated with Anacardium occidentale L. (Salpindales: Anacardiaceae) in Five Producing Areas of Côte d’Ivoire

E. N. Akessé 1*, S-W.M. Ouali-N’goran1, O.R. N’Dépo2, T. Koné 3 and D. Koné1

1 Laboratoire de Zoologie et de Biologie Animale, Université Félix Houphouët-Boigny,

BP 582 Abidjan 22, Côte d’Ivoire.2 Université Jean Lorougnon Guédé, BP 150 Daloa, Côte d’Ivoire.

3 Université Nangui Abrogoua, 02 BP 801 Abidjan 02, Côte d’Ivoire.

* Email of the corresponding author: [email protected]

Abstract

Cashew nut (Anacardium occidentale L.) is considered a cash crop, like coffee and cocoa, in the northern, north-western, central and north-eastern areas of Côte d’Ivoire. It has become the most important source of monetary income in rural cashew producing areas. Unfortunately, the crop is subjected to many insect pest attacks, thus reducing productivity of orchards. The objective of this study was to make an inventory of insect pests affecting cashew in the producing regions. A survey was conducted in October 2015 in 42 orchards in the northern, north-western, central and north-eastern areas of Côte d’Ivoire. Field observations on cashew organs such as leaves, branches and stems were conducted. Pyrethroid insecticide was applied to kill the insects for ease collection. Three insect species were identified as major pests that were able to reduce nut yield from 30% to 50%. Those species were Analeptes trifasciata (Coleoptera: Cerambycidae), Apate terebrans (Coleoptera: Bostrichidae) and Plocaederus ferrugineus (Coleoptera: Cerambycidae). The waver ant Oecophylla longinoda (Hymenoptera: Formicidae), considered as an auxiliary predator was also observed in all surveyed orchards. The leaf miners Gracillariidea (Lepidoptera) was found to cause minor damage. Population dynamics and bio-ecology of these pests should be studied in order to determine specific periods for intervention, and to develop methods for effective control.

Keywords: Anacardium occidentale, Côte d’Ivoire, insect fauna, cashew,


Crop Protection

Introduction

The cashew tree originated from Brazil, and was introduced in Mozambique by settlers in 1578. The tree later spread to other parts of Africa and Asia (Anonymous, 2008). In Cote d’Ivoire, the cashew tree was introduced in 1960s as part of the reforestation policy initiated by the State (Diabaté, 2007). At present, cashew is considered as one of the cash crops in the country (FIRCA, 2010; Lebailly et al., 2012).

In recent years, Ivorian cashew production has experienced a significant change in liaison with the increasing demand of the world market. From 2003 to 2013, cashew production in Cote d’Ivoire went up from 452,600 to 480,000 tones taking second position among the large producers in West Africa (Pacir, 2013). Basically, cashew farming is a secondary source of income to many small scale farmers in Cote d’Ivoire (Lebailly et al., 2012; Ricau, 2013). In general, there are several uses of cashew including its by-products. The cashew apple, with its high concentration of vitamin C can be consumed fresh. It is also consumed in all its derivative forms, among others, juice, jam, appetizer, roasted and salted nuts. Cashew oil is used in cosmetics and pharmaceuticals for its richness in vitamin E and unsaturated fatty acids. The cashew nut shell liquid contained in the shell is a resin used in the manufacturing of ink, varnish, and insecticides (Pacir, 2013).

However, cashew in Cote d’Ivoire is confronted with several production constraints including insect pest infestation. The insect pests attack cashew trees at different stages of development (Dwomoh et al., 2008). Scientific data on these pests in Cote d’Ivoire is almost non-existent. Therefore, this study was initiated in order to understand these pests better so as to come up with appropriate strategies for their control.


This study took place from 9th to 22nd October 2014 in five areas of (Gbeke, Iffou, N’Zi, Belier, and Hambol) belonging to the antenna of the Cotton and Cashew nut Council (CCC) of Bouake. About 42 cashew orchards of 27 communities were visited (Figure 1). Different orchards were selected on the basis of the concerns of producers responsible for the CCC. The first four areas belong to the Sudano-Guinean zone marking a transition from the rainforest to the south and the savannah in the north (FAO, 2005). This is characterised by four seasons: a long dry season from November to February, a long rainy season from March-June, a short dry season from July to August, and a short rainy season from September to October. Rains are usually erratic and vary between 1200 and 1500 mm. The Hambol area is in the savanna zone with a tropical climate of Sudanese type with a single rainy season. Annual rainfall is between 900 and 1200 mm (FAO, 2005).


Crop Protection

Figure 1: Surveyed areas

The biological components of the study included cashew trees and the observed insects. The equipment used included insect collection and conservation kits such as sweep netting, white muslin, plastic bottles for larval rearing, and 70% alcohol. Two binocular loupes were used for insect identification. A GARMIN GPS device 60c and a photographic camera NIKON COOLPIX S2600 Version 1.0 were used for recording geographical coordinates of each orchard and taking pictures.

Survey was conducted in mature orchards between 8 and 16 hrs. Visual examination and pyrethroid-knockdown techniques were used for sampling. Visual examination consisted of recording the presence and extent of damage done by insects on various tree tissues. The presence of Analeptes trifasciata or its damage on newly and/or formerly girdled stems or twigs, belted suspended or fallen branches were noted. For borers, the method used was to carefully inspect the main stem and branches of every tree for the presence of supply port or other damage and their physical presence inside the tree (Agboton et al., 2014). Two types of attack orifices were observed for Apate terebrans. These were dead orifices or marks representing points of previous attacks and live orifices where sawdust was


Crop Protection

still actively being produced. Some branches had to be opened to confirm the identity of the species. The pyrethroid-knockdown insecticide was sprayed to kill the insects (Dwomoh et al., 2008). Later the sprayed branches (two feet above the ground) were shaken to allow the dead insects to fall. Two white muslin canvas sheets of 2 m² each were spread out under the tree to collect the dead insects. The collected dead insects were kept in pill dispensers containing 70% alcohol. Some insects were captured directly by hand, others using a sweep net. The larvae were kept in breeding jars until adults were formed. The distribution map of the areas surveyed was drawn using Arc View GIS 3.2 software and MapInfo Professional 6.0. Identification of the collected insects was made under a binocular microscope Euromex (Holland) Model BMK 31162, using an identification guide.

Results

A total of 38 species (including pests and beneficial insects) were recorded (Table I). The major pests categorised by the extent of damage caused were found to belong to the order Coleoptera. These were Analeptes trifasciata, Apate terebrans and Plocaederus ferrugineus.

Table 1: Insect species observed in surveyed areas of Cote d’Ivoire in October 2014

Orders Families Species Status/ Parts attackedColeoptera Bostrychidae Apate terebrans (Pallas, 1772) Harmful/Borer

Cerambycidae Ploceaderus ferrugineus (Linnaeus, 1792) Harmful/Borer

Analeptes trifasciata (Fabricius, 1775) Harmful/Girdle tree trunks and branches

Tenebrionidae Lagria sp. Harmful/ Phytophagous

Coccinellidae Cheilomenes lunata (Fabricius 1775) Auxiliary/Predator

Cheilomenes sulphurea (Olivier, 1791) Auxiliary/PredatorHeteroptera Coreidae Pseudotheraptus devastans (Distant, 1917) Harmful/leaves and fruits

Homoeocerus pallens (Fabricius, 1781) Harmful/leaves and Fruits

Pentatomidae Nezara viridula (Linnaeus, 1758) Polyphagous/leaves and fruits

Miridae Helopelthis sp. Harmful/diseases vector/sap suckers

Pyrrhocoridae Dysdercus sp. Harmful/diseases vector/ sap suckers

Lepidoptera Gracillariidae Eteoryctis gemoniella (Stainton, 1862) Harmful/Leaf miner

Psychidae Cephora sp. Harmful/Phytophagous at the larval stage

Orthoptera Pyrgomorphidae Zonocerus variegatus (Linnaeus, 1758) Harmful/Phytophagous

Tettigoniidae Conocephalus longipennis (Redtenbacher, 1891) Harmful/Phytophagous

Acrididae Anacridium sp. Harmful/Phytophagous

Acrida turrita (Linnaeus, 1758) Harmful/Phytophagous

Gryllidae Gryllus lucens (Walker, F., 1869) Harmful/Auxiliary/ Polyphageous

Gryllus bimaculatus (Thunberg, 1815) Harmful/Auxiliary/ Polyphageous

Libellulidae Unidentified 1 and Unidentified 2 UnidentifiedIsoptera Termitidae Macrotermes sp. Harmful

Odontotermes sp. Harmful

Ancistrotermes sp . Harmful

Pseudacanthotermes sp. Harmful

Trinervitermes sp. Harmful


Crop Protection

Microcerotermes sp. Harmful/Xylophagous

Cubitermes sp. Harmful Hymenoptera Formicidae Oecophylla longinoda (Latreille, 1802) Auxiliary/Predator

Crematogaster africana (Mayr, 1895) Auxiliary/Predators and Scavengers

Camponotus olivieri (Forel, 1886) Auxiliary/Predators and Scavengers

Formica rufa (Linnaeus, 1761) Auxiliary/Predator

Apidae Apis mellifera (Linnaeus, 1758) Auxiliary/PollinisatorDictyoptera Mantidae Mantis religiosa (Linné, 1758) Auxiliary/Predator

Homoptera Aphrophoridae Aphrophora alni (Fallén, 1805) Harmful/Phytophagous at the larval stage

Aphididae Toxoptera aurantii (Boyer de Fonscolombe, 1841) Harmful/Sap suckers

Aphis gossypii (Glover, 1877) Harmful/Sap suckers

Aleyrodidae Bemisia tabaci (Gennadius, 1889) Harmful/Disease vectorDiptera Muscidae Musca sp. Harmful/Pollen, apple juice

A. trifasciata causes serious damage by sawing branches and young stems with 3-8 cm diameter over the entire circumference (Figure 2). This incision can cause the branch to fall off. This action of the pest causes loss of several branches and many fruits, consequently a drop in production. Considering stems and branches formerly and newly girdled by this pest, more serious attacks were observed in Iffou (39.5%), followed by Gbeke (23.5%), Belier (17%), N’Zi (15.5%) and Hambol (4.5%). Regarding latest attacks, Gbeke area was leading (38%), followed by Iffou (34%), N’Zi (15%), Belier (8%) and Hambol (5%). Thus, Gbeke and Iffou were the most severely attacked areas (Figure 3).

Figure 2: A. trifasciata and damage trifasciata Figure 3: Rate attacks A. trifasciata in 5 areas

A. terebrans was observed in the five visited regions. It punches the trunks and branches finally making several internal galleries (Figures 4 and 5). This type of attack causes weakening and rotting of trunks therefore may cause tree death. Data analysis revealed that the most attacked area by this borer was N’Zi, with 25%. This was followed by Belier (22%), Hambol (20%), Gbeke (17.5%) and Iffou (15.5%). Considering recent attacks (living orifices), N’Zi Region was still leading with 28% (Figure 6) followed by Hambol (23%), Belier (23%), Gbeke (18%) and Iffou (8%).


Crop Protection

The larvae of P. ferrugineus L. which is yellowish white with a massive body, can cause a lot of damage (Figure 7). The symptoms are small holes in the bark at the base of the trunks, causing exudation of gum and wood debris in these orifices (Figure 8 A, B, C). This type of attack may cause yellowing and shading of leaves, followed by death of branches and eventually death of the whole tree.

6

The larvae of P. ferrugineus L. which is yellowish white with a massive body, can

cause a lot of damage (Figure 7). The symptoms are small holes in the bark at the base of the

trunks, causing exudation of gum and wood debris in these orifices (Figure 8 A, B, C). This

type of attack may cause yellowing and shading of leaves, followed by death of branches and

eventually death of the whole tree.

The leaf miners are represented by the larvae Eteoryctis gemoniella Stainton

a(Lepidoptera: Gracillariidae). They feed on leaf parenchyma by digging tortuous galleries or

consuming a portion of the lamina. Even if these actions cause weakening of plants, they do

not really constitute a danger for fruit production. In addition to those pests, auxiliary species

in the Order Hymenoptera such as the weaver ants Oecophylla longinoda, Crematogaster

Africana, Camponotus olivieri, Formica rufa, Apis mellifera, and Orthoptera Mantis religiosa

were also observed (Table 1).

Discussion

This study of the insect fauna of the cashew tree in four producing areas of Cote d'Ivoire

made it possible to identify 38 species of insects. They belong to nine orders (Homoptera,

Heteroptera, Hymenoptera, Dictyoptera, Isoptera, Orthoptera, Lepidoptera, Coleoptera and

Diptera). Earlier work by Dwomoh et al. (2008) and Agboton et al. (2014), listed 170 and 262

species respectively. The difference could be explained by the fact that these authors had

worked over a period of one to two years including all phenological stages of cashew tree

A C Figure 7: Larva of P. ferrugineus Figure 8: A, B, C) Damage of P. ferrugineus

B

The leaf miners are represented by the larvae Eteoryctis gemoniella Stainton (Lepidoptera: Gracillariidae). They feed on leaf parenchyma by digging tortuous galleries or consuming a portion of the lamina. Even if these actions cause weakening of plants, they do not really constitute a danger for fruit production. In addition to those pests, auxiliary species in the Order Hymenoptera such as the weaver ants Oecophylla longinoda, Crematogaster Africana, Camponotus olivieri, Formica rufa, Apis mellifera, and Orthoptera Mantis religiosa were also observed (Table 1).

Discussion

This study of the insect fauna of the cashew tree in four producing areas of Cote d’Ivoire made it possible to identify 38 species of insects. They belong to nine orders (Homoptera, Heteroptera, Hymenoptera, Dictyoptera, Isoptera, Orthoptera, Lepidoptera, Coleoptera and Diptera). Earlier work by Dwomoh et al. (2008) and Agboton et al. (2014), listed 170 and 262 species respectively. The difference could be explained by the fact that these authors had worked over a period of one to two years including all phenological stages of cashew tree growth. This specific richness reveals the importance of the insect fauna of the cashew tree. A. trifasciata was observed in all surveyed


Crop Protection

orchards. It was registered for the first time in Bouaké (Côte d’Ivoire) in Kokondekro forest stations before appearing in the cashew orchard in 1964 (Brunck and Fabre, 1970). It was further reported by Benin Research Institute that A. trifasciata is also a devastating insect pest to forest and cashew trees (Tchibozo and Braet, 2004). Others reported the damage of this species taking place between November and March (Dwomoh et al., 2008). Comparison between areas revealed that Iffou had recorded the highest levels of attack. This could be due to climatic differences between localities. Again, areas with more attacks were pre-forest and forest while Hambol which had mild attacks was a savannah area. Apart from Côte d’Ivoire, this species has been observed in Nigeria, Ghana, Guinea Bissau and Guinea (Agboton et al., 2014). A. terebrans was recorded in the four areas surveyed during the month of October. This fact corroborates findings of previous work (Agboton et al., 2014) which established that the borer of the trunks is present in cashew orchards in the last quarter of the year. A. terebrans continues to be present until the first quarter of the following year. It was also observed from September to January in cashew orchards in Ghana (Dwomoh et al., 2008). However no serious damage was observed on some of the trees. Most likely, effective treatment and younger age of these trees might have attributed to the observed mild attacks.

P. ferrugineus L. was observed mainly in the orchards north of Hambol in the savannah. Its distribution could be explained by the ecological requirements of the species. This pest was also observed in Nigeria exhibiting similar damage (Asogwa et al., 2009). P. ferrugineus is a dangerous pest of A. Western, which completely kills the tree within few weeks of infestation. The adult female lays her eggs in crevices of the loose bark of the trunk or the exposed roots. The white larvae bore fresh tissue from the bark of the trunk, roots and subsequent sub-epidermal tissue, making tunnels in irregular directions. Their feeding method damages the vascular tissues, stops the flow of sap and weakens the stem. This feeding mechanism may cause yellowing and shading of the leaves, drying of twigs and tree death (Asogwa et al., 2009).

Concerning the leaf miner E. gemoniella, the highest attack was observed in the N’Zi and the Belier. This may probably be explained by the fact that in these areas, flowering cashew trees produced large quantities of tender leaves mostly preferred by the species. On the other hand, the rate was lower in other regions like Iffou where few trees had flower buds (pre-flowering stage). In areas of Gbeke and Hambol no signs of flowering were observed.

The weaver ant, O. longinoda (Hymenoptera: Formicidae) was observed in all areas surveyed and was also reported in cashew orchards in Ghana and Benin. It acts as a biological control agent, although observation made in the orchards of cashew makes us to think that their actions could be detrimental to production. The leaves used by O. longinoda to build their nests usually cover new shoots and buds causing death to the tissues. This hinders photosynthesis and therefore decreases productivity of cashew trees (Agboton et al., 2014). These ants are sometimes in combination with Homoptera. This association would essentially alter food order due to honeydew secreted by the Homoptera.


Crop Protection

Conclusion

In conclusion, 38 species belonging to 23 families and 9 orders were recorded. Among these species were few auxiliary pests. We learnt that those which attack cashew tree organs belong to the order Coleoptera. These results, although important, only provide an overview of the insect fauna of the cashew tree areas surveyed during the two weeks of study. Given the importance of cashew farming in the country and producers in particular, it is appropriate to formulate effective control measures against pests. It would be desirable to conduct further research covering all the phenological stages of the plant so as establish appropriate periods for intervention.

Acknowledgements

The authors would like to thank the Cotton and Cashew Council (CCC), cashew producers and village communities for their close collaboration and availability.

References

Agboton, C., Onzo, A., Ouessou, F. I., Goergen, G., Vida, S. L., and M. Tamo (2014). Insect fauna associated with Anacardium occidentale (Sapindales: Anacardiaceae) in Benin, West Africa. Journal of Insect Science, 14.

Anonymous, (2008). Malian Ministry of Agriculture: Competitiveness plan of the cashew sector in Mali. Report, Malian Ministry of Agriculture.

Asogwa, E. U., Anikwe, J. C., Ndubuaku, T. C. N., and F. A. Okelana (2009). Distribution and damage characteristics of an emerging insect pest of cashew, Plocaederus ferrugineus L. (Coleoptera: Cerambycidae). African Journal of Biotechnology, 8, 053-058.

Brunck, F., and J. P. Fabre (1970). Note on Analeptes trifasciata Fabricius, Beetle cerambycid, Anacardium occidentale serious pest in Ivory Coast. Journal of Tropical Woods and Forests, 134, 15-19.

Diabaté, G. (2007). The cashew sector, from ecology to economics: Cashew nuts into gold. The sector of progress in Except Series: Perspectives on 50 years of farming in Côte d’Ivoire. FIRCA, 34-39.

Dwomoh, E. A., Ackonor, J. B., and J. V. K. Afun (2008). Survey of insect species associated with cashew (Anacardium occidentale Linn.) and their distribution in Ghana. African Journal of Agricultural Research, 3, 205–214.

FAO (Food and Agricultural Organisation) (2005). Côte d’Ivoire - Irrigation in Africa in figures - AQUASTAT Survey.

FIRCA (Interprofessional Fund for Agricultural Research and the Council) (2010). To the discovery of the cashew sector. The sector of progress, 6, 56 p.

Lebailly, P., S. Lynn and H. Seri (2012). Study for the preparation of a strategy for the development of the cashew sector in Côte d’Ivoire, proposed a strategy for the development of the cashew sector, final report. Report Diagnostic Consortium AGRER. 92 p.


Crop Protection

Pacir (Programme of Support for Trade and Regional Integration) (2013). Evaluation of export potential of cashew, cashew export plugs Ivory Coast.

Ricau, P. (2013). Know and understand the international market for cashew. Report RONGEAD www.rongead.org..

Tchibozo, S., and Y. Braet (2004). Pests of forest tree species of the central core of the classified forest of Lama (Republic of Benin) and preliminary estimate note of the impact of the cerambycid Analeptes trifasciata (Fabricius, 1775), pest Prunier mombin (Spondias mombin Linnaeus, 1753)

(Anacardiaceae). Bulletin S.R.B.E / K.B.V.E., 140, 151-156.


Crop Protection

Investigations on Major Cashew Diseases in Côte d’Ivoire

S. Soro 1*, N. Silué 2, G.M. Ouattara 3,4, M. Chérif2, I. Camara2,F. Sorho2, N.M. Ouali2,K. Abo5, M. Koné6, D. Koné 2

*1University Jean Lorougnon Guédé, BP 150 Daloa, Côte d’Ivoire2University Félix Houphouët-Boigny, 22 BP 582 Abidjan, Côte d’Ivoire

3University Alassane Ouattara, BP V 18 Bouaké 01, Côte d’Ivoire4The Council of Cotton and Cashew, 27 BP 604 Abidjan 27, Côte d’Ivoire.

5 Institut National Félix Houphouët-Boigny, BP 1313 Yamoussoukro, Côte d’Ivoire6 University Nangui Abrogoua, 02 BP 801 Abidjan, Côte d’Ivoire


Abstract

Cashew nut (Anacardium occidentale L.) is one of the major sources of cash income in the cashew producing areas in the northern part of Côte d’Ivoire. Nevertheless, the crop is susceptible to several diseases and insect pests, which can cause substantial losses in yield. Studies were conducted in the main cashew producing areas in Côte d’Ivoire in order to identify major cashew diseases and establish their importance. Disease incidences were assessed on the basis of percentages of infected trees in the fields and severity assessment was based on percentage of infected leaves in one-meter quadrant on two opposite sides of each tree canopy. It was observed that cashew trees were mostly attacked by Colletotrichum, Pestalotia, Phomopsis, Alternaria, Verticillium, Cephaleuros and leaf mosaic virus. The symptoms varied from limb necrosis or brownish spots followed by infection on twigs, leaves, nuts and few spots along leaf secondary veins. The software Arc View GIS 3.2 and MapInfo Professional 6.0 were used to draw the distribution map. Data was analysed using the statistical analysis package Statistical 7.1 software. Anthracnose, red rust and nut necrosis had the highest incidence, 90.0%, 60.25% and 50.50%, respectively. The highest severity values recorded were 1.90% for anthracnose and 3.21% for red rust. This study allows the development of strategies to control those pathogens in order to increase cashew nut production and improve nut quality, which will eventually lead to improved livelihoods of farmers.

Keywords: cashew, fungi, virus, cashew nut, Côte d’Ivoire


Crop Protection

Introduction

Cashew (Anacardium occidentale L.), a native of Brazil, was introduced in Côte d’Ivoire during the second half of the sixteenth century for the purpose of soil conservation. From its humble beginning as a crop intended to control soil erosion, cashew emerged as a major foreign exchange earner next to cocoa and coffee. Cashew nut is one of the important nuts grown in the world. Cashew is a major crop for millions of small-scale farmers. Worldwide, the annual production is about 2.1 million tones of raw nuts (RCN) with an estimated value of US$ 1.5-2 billion. The major cashew producing countries in the world are Côte d’Ivoire, Tanzania, Benin, Nigeria, Mozambique, Ghana, Burkina Faso, India, Vietnam and Brazil.

Cashew is a tree that can grow to a height of more than 15 m high. The diameter of the trunk varies between 8 cm and 25 cm. The cashew tree possesses a central tap root and several horizontal roots. The fruits consist of a nut and an apple. The nut has edible kernels, traded in the international market (Kehe et al., 1997) and a shell. The shell has cashew nut shell liquid (CNSL), which is toxic (Anacardic acid).

The cashew nut is a farm product and its export is important in Africa with approximately 39% of the world production (587,000 metric tones) coming from the continent. Western Africa is the second biggest producer of raw nuts in the world after Vietnam. In Côte d’Ivoire, the cashew orchard occupies more than half of the area in the northern part of the country and constitutes one of the main farm products exported since 2001 (Kehe et al., 1997; Topper, 2002).

Cashew is cultivated mainly by smallholder farmers who are organised in cooperative societies. On average, the area under cashew for a smallholder farmer is about 3-4 ha with production of lower than 500 kg/ha against 1.5 to 2 t/ha in Tanzania or in India. The low production per unit area in Côte d’Ivoire is due to a number of factors including lack of improved planting materials and poor agronomic practices. The implementation of the cashew development programme was funded by the Council of Cotton and Cashew (CCC) from 2013. The results of this study have lead into identification of the pathogenic flora associated with the crop loss in cashew nut as described by Soro et al. (2013). The main objective of this study was therefore to investigate the main cashew diseases in Côte d’Ivoire.


The study was undertaken in the main cashew growing areas, which are Bouaké, Bondoukou, Korhogo, Odienné and Séguéla. Figure 1 shows the location and areas where cashew orchards were visited during the study.


Crop Protection

Figure 1: Location and areas visited during the study

Fifty farmers were interviewed in each of the five selected areas (Bouaké, Bondoukou, Korhogo, Odienné and Séguéla) producing cashew nut in Côte d’Ivoire. Farmers were interviewed, using a prepared questionnaire, about what they considered to be the main cashew diseases in their respective areas. Diseases were identified through descriptions and symptoms given by farmers and through observations made together by researchers and farmers in the field (Kiwuso et al., 2010). Diseases that could not be identified in the field were noted for further identification.

A sample plot of 10 trees per plantation was selected for inspection, taking into account a minimal distance of 100 m. A one-meter quadrant placed on the tree canopy was used for scoring diseases on leaves, flowers, fruits and twigs. Within a row, the diseases were assessed starting from the 1st to 3rd and of 4th to 5th leaves. The disease incidence on a particular tree was calculated by the number of infected tree organs to the total number of organs counted in the quadrant area. The index of severity (Is) was calculated from the level of infection on tree organs that was noted for every tree canopy. The index of severity was calculated using the following formula developed by Groth et al. (1999), and Cardoso et al. (2004):


Crop Protection

0 Absence of symptom No disease1 1 – 5% infection Mild3 6 – 10% infection Moderate5 11 – 25% infection Moderately severe7 26 – 50% infection Severe9 >50% infection Highly severe

These notations were used as a basis to calculate the index of severity (Is) of the disease, which corresponds to the average of the values allotted to the ten trees by combination.

Is = ∑(xi*ni)/5N Where

xi = number of trees having the same mark

ni = mark allocated to the tree

N = total number of trees in the frame

The distribution map of the diseases in the cashew producing areas was developed by software Arc View GIS 3.2 and MapInfo Professional 6.0. The statistical analyses were carried out using the statistical analysis package Statistical 7.1.


Incidence and index of severity

Table 1 illustrates the incidence of the key diseases that were listed in different cashew producing areas in Côte d’Ivoire. The incidence varied from one area to another and the type of disease. The highest incidences were recorded in Korhogo for all four major diseases. The dieback shows the highest attack with an average incidence higher than 45%. It was followed by anthracnose, which had the highest incidence levels at Korhogo (90%) and Odienné (52%) areas.

Table 1: Incidence of main diseases in Côte d’Ivoire

Main diseaseRegions

Bouaké Bondoukou Korhogo Odienné Séguéla

Anthracnose 18.65±0.02 26.66±1.66 90.0±1.03 52.13±0.90 25.01±1.87

Red rust 40.01±0.01 68.94±1.48 15.06±3.47 17.67±1.10 25.01±3.34

Dieback 26.01±0.02 75.02±1.86 66.47±1.17 24.26±0.16 50.0±0.65

Canker necrosis 0.30±0.01 28.45±1.54 46.24±3.80 57.24±0.57 25.01±1.08

Table 2 illustrates the index of severity of the main diseases that were listed in the different cashew


Crop Protection

producing areas in Côte d’Ivoire. The index varied from one area to another and from one disease to another. The highest indexes were recorded at 3.21% for red rust (Korhogo), 2.43% for dieback (Odienné), 1.90% for anthracnose (Korhogo) and 1.85% for canker necrosis (Séguéla). Korhogo represents the region with the highest index severity. The difference between the incidences of the diseases would be related to the various agro-ecological conditions between the areas or the difference in virulence between the pathogenic agents responsible for these diseases (Mc Roberts et al., 2003; Kiwuso et al., 2010; Soro et al., 2013).

Table 2: Index of severity of key diseases in Côte d’Ivoire

Main diseasesRegions

Bouaké Bondoukou Korhogo Odienné Séguéla

Anthracnose 1.06±0.01 0.6±0.06 1.90±0.03 0.65±0.13 1.79±0.94

Red rust 0.58±0.01 0.46±0.62 3.21±0.08 0.11±0.25 1.78±0.86

Dieback 0.35±0.02 0.83±0.02 1.47±0.03 2.43±0.02 1.57±0.90

Canker necrosis 1.42±0.02 0.94±0.05 0.79±0.16 0.06±0.01 1.85±0.88

Distribution of main cashew diseases

The distribution of the severity of the main cashew diseases varied in different agro-ecological areas

that produce cashew nut in Côte d’Ivoire. The anthracnose disease was found to have disease severities varying from 0% to more than 50% at Korhogo. All the other regions had severities significantly lower than that of Korhogo (Figure 2). The red rust was found to have severities higher than 50% in three localities at Bouaflé (Bouaké), Bonon (Korhogo) and Koro (Odienné) (Figure 3). The severity of

dieback was higher in Korhogo and Bouaké regions. The low severities were observed in Bondoukou and Odienné regions (Figure 4). The canker necrosis causes by Xanthomonas axonopodis pv anacardii was observed in all cashew producing regions in Côte d’Ivoire. The severity of the canker necrosis was higher in Odienné area. Lowest severity was recorded in Bondoukou area (Figure 5).

The distribution of the diseases is strongly related to the agro-ecological zones in cashew growing areas

in Côte d’Ivoire. It is likely that the variation in microclimate plays a role in the development and the evolution of the diseases in zones. The severity of the diseases caused by Colletotrichum gloeosporioïdes and Phomopsis anacardii was thus associated with the types of cashew genotypes, the location and the

phenology of the trees (Lopez, 2008; Suffert et al., 2011; Soro et al., 2013).


Crop Protection

Figure 2: Distribution of anthracnose (Colletotrichum gloeosporioïdes)

Figu

re 2: Distribution of anthracnose (Colletotrichum gloeosporioïdes)

Figure 3: Distribution of red rust (Cephaleuros virescens)


Crop Protection

Figure 3: Distribution of red rust (Cephaleuros virescens)

Figure 4: Distribution of dieback (Phomopsis anacardii)

Figure 5: Distribution of canker necrosis (Xanthomonas axonopodis pv anacardii)


Crop Protection

Conclusion

The cashew trees in Côte d’Ivoire are likely to be infected by diseases therefore it is necessary to put control measures in place. The damages caused by these pathogenic agents range from 5% to 90%. The diseases that cause more damages were caused by Colletotrichum gloeosporioïdes (anthracnose), Phomopsis anacardii (necrosis of the foliar buds) and Xanthomonas axonopodis pv anacardii (canker necrosis).

Cashew farmers in Côte d’Ivoire do not have appropriate agricultural extension services for dissemination of good agronomic practices. They lack efficient agricultural extension services and have inadequate knowledge and technology in cashew. There is no knowledge in cultural control of cashew diseases like sanitation. The only possible way to tackle the diseases is by chemical control, which is not environmentally friendly, and also it is costly for poor-resourced farmers. This implies that there is therefore a need to formulate integrated pest management strategies against the cashew diseases in Côte d’Ivoire.

Acknowledgements

This work was within the framework of a research project known as Improve crop management and sustainable control of cashew pest and diseases management in Côte d’Ivoire. The project was co-financed by ACi-GIZ (African Cashew initiative-Deutsche Gesellschaft für Internationale Zusammenarbeit) and the Council of Cotton and Cashew of Côte d’Ivoire.

References

Cardoso, J. E., Santos, A. A., Rossetti, A. G., and J. C. Vidal (2004). Relationship between incidence and severity of cashew gummosis in semiarid north-eastern Brazil. Plant Pathology, 53(3), 363-367.

Groth, J. V., Ozmon, E. A., and R. H. Busch (1999). Repeatability and relationship of incidence and severity measures of scab of wheat caused by Fusarium graminearum in inoculated nurseries. Plant Disease, 83, 1033-8.

Kehe, M., N’da Adopo, A., Rey, J. Y., Koffi, E., and K. Nguetta (1997). L’anacardier, place de l’Afrique de l’Ouest et de la côte d’Ivoire dans la production mondiale: Diagnostic du verger ivoirien. In Symposium Anacarde, Promexa, PPDEA, CECI 12-14 juin 1997, Yamoussoukro, Côte d’Ivoire.

Kiwuso, P., Esegu, J., F., O., Mujuni, D., and J. Epila-Otara (2010). Key diseases and insect pests of cashew nut (Anacardium occidentale L.) in the Teso and Lango farming systems of Uganda. In Masawe, P. A. L., Esegu, J. F. O., Kasuga, L. J. F., Mneney, E. E., and Mujuni, D. (Eds) (2013). Proceedings of the second international cashew conference. Kampala, Uganda, 26–29 April 2010. CAB International, Wallingford, UK.

Lopez, M., Bannenberg, G., and C. Castresana (2008). Controlling hormone signaling is a plant and pathogen challenge for growth and survival. Cur Op Plant Biol., 11, 420-7.

Mc Roberts, N., Hughes, G., and L. V. Madden (2003). The theoretical basis and practical application


Crop Protection

of relationships between different disease intensity measurements in plants. Annals of Applied Biology, 142, 191-211.

Soro, S., N’da Adopo, A., and D. Koné (2013). Behaviour of the genotypes of cashews (Anacardium occidentale L.) at anthracnose (Colletotrichum gloeosporioïdes) in the North of Côte d’Ivoire. First International Conference on African Research in Agriculture, in Food and Nutrition (AGRAR) 04–06 juin 2013, Yamoussoukro, Côte d’Ivoire.

Suffert, F., Sache, I., and C. Lannou (2011). Early stages of Septoria tritici blotch epidemics of winter wheat: Build-up, over seasoning, and release of primary inoculum. Plant Pathology, 60, 166-177.

Topper, C. P. (2002). Issues and constraints related to the development of cashew nuts from five selected African countries (Côte d’Ivoire, Ghana, Guinea, Guinea Bissau and Nigeria). In Réunion régionale sur le développement des exportations de noix de cajou d’Afrique organisée par le Centre de Commerce Internationale / CNUCED / OMC (CCI) et le Fond Commun de Produits de Base (CFC), en collaboration avec le Conseil National pour l’Exportation (CNEX). Projet N° INT/W3/69 « Développement des exportations des noix de cajou d’Afrique »23–26 juillet 2002, Cotonou, Bénin.


Crop Protection

Assessing Factors Limiting the Adoption of Pesticide Use Technologies in Cashew Production. A Case Study in Mtwara District, Tanzania

S. F. Magani*, W. Nene and S. H. Shomari




Abstract

The economy of Tanzania, particularly in the South Zone regions, heavily depends on cashew nut production. Research findings have indicated that failure to control insect pests and diseases might cause a yield loss from 70% to 100% of cashew production. Although more than 10 types of pesti-cides have been recommended, insect pests and diseases continue to be major constraints in cashew production. A survey was conducted to identify and develop strategies that could address the existing problem of low adoption of pesticide use technologies in cashew production. A total of 200 small-holder farmers in 14 villages were interviewed in aspects of cashew production. Major findings indi-cated that although 89.8% of respondents were aware about strategies employed in controlling insect pests and cashew diseases, only 37% used pesticides. Other problems included low dosage of pesticide applications (70%), and untimely spraying (85%). Recommendations have been given based on the identified production constraints such as untimely and inadequate availability of inputs. There is a need for capacity building to key players through regular workshops and training.

Keywords: cashew, agricultural inputs, fungal diseases, insect pests.

Introduction

In Tanzania, cashew is an important export crop in terms of foreign exchange earnings (Masawe and Kapinga, 2010). Despite its importance, cashew production has been constrained by several factors that often result into yield fluctuation. Biotic factors such as insect pests and diseases are among the factors largely contributing to yield fluctuation. For instance, failure to control powdery mildew disease might cause a yield loss of 70 to 100% (Sijaona, 2013). Therefore, research efforts for pest control have been strengthened by Naliendele Agricultural Research Institute (NARI). These include improving management strategies such as use of chemical fungicides and insecticides for the control of major fungal diseases (Powdery Mildew and Blight) and insect pests (Helopeltis bugs and Coconut bugs), use of botanicals, biological control such as weaver ants for the control of Helopeltis and Coco-nut bugs and cultural practices including orchard sanitation to reduce pathogens’ inoculums. NARI has recommended several fungicides (with a.i. Triadimenol, Hexaconazole and Penconazole), for the control of Powdery Mildew and 5 insecticides (with Lambda-cyhalothrin) for the control of Helopeltis and coconut bugs among others.

Despite intense research by NARI that addressed solutions for the control of insect pests and diseases of cashew, there has been very little success. These biotic constraints are still causing significant losses


Crop Protection

in cashew quality and quantity. Therefore, the aim of this study was to identify the causes of low suc-cess to control insect pests and diseases of cashew, and recommend measures that could be taken to enhance adoption of insect pest and disease control in cashew.

Materials and method

The study was conducted in Mtwara District, one of the six districts engaged in cashewnut produc-tion in Mtwara Region. South-eastern Tanzania has two main seasons: a humid and hotter wet season (November to May) and a cooler, less humid dry season (June to October) with an average tempera-ture of 280 C. Mean annual rainfall ranges from 800 mm inland and central areas to 1,200 mm in the hills and plateau near the coast, with 85% of this falling between December and April, interrupted by a dry spell of one or two weeks often at the end of January or at the beginning of February (Farming System Research, 1992).

Purposive and simple random sampling techniques were used to draw samples for interview. Out of 118 registered villages, only 14 villages (12%) were randomly selected in Mtwara District (Figure 2). At village level, a cross-sectional study for sampling was used (Bailey, 1998). A total of 200 household farmers were interviewed following a transect walk technique (Kothari, 2009).

A cross-sectional research design was adopted whereby both qualitative and quantitative household data was collected using questionnaires. Heads of household were interviewed on various aspects such as socio-demographic and family/household characteristics, cashew nut management production constraints, and institutional support services. Prior to the actual survey, the interview questionnaire was piloted in the nearby village and was refined based on feedback from interviewees.

Data from the primary source was analysed using Statistical Package for Social Sciences (SPSS 16.0 for windows) computer software. Descriptive statistics such as means, standard deviation, graphs, frequency distribution and pie charts were used to describe the data. Secondary information was col-lected from various sources including NARI annual reports, proceedings, review of published papers and official reports, and online information.


The socio-economic characteristics of respondents showed that the mean age was 48 years with the majority aged between 30 and 50 years. This implied that the youth exhibited a lower risk aversion and were likely to adopt new innovation compared to old farmers (Mazvimavi et al., 2010). The majority of the respondents had attended primary education, a good proportion had no formal edu-cation and very few had secondary education (Table 1). This implies the majority of the people in the study area were literate and could therefore follow simple agricultural instructions and technical rec-ommendations (Matata et al., 2008). This is consistent with results by Benor et al. (1997) who admit that education is important in creating positive mental attitude towards adoption of modern farming.


Crop Protection

The average household size was 6 people of which on average 3 contributed to labour. Family labour was the most important source of labour for cashew related activities and every member of the house-hold was allocated specific roles and responsibilities. Where possible, contract labour was employed for pesticide application to control insect pests and cashew diseases. The findings show that the major-ity of respondents used family labour during peak periods and few were able to hire labour and very few used all of the alternatives mentioned. Many respondents were experiencing labour shortage to undertake various farm activities. This is because pest control coincides with annual crop harvesting and processing while cashew harvesting coincides with land preparation for annual crops. To cope with labour shortage, some farmers reduced the area under crop cultivation or applied pesticides to fewer trees (Table 1).

Table 1: Social-economic characteristics of the respondents (n=200)

Socio-economic variables Frequency n Percent

Age20 – 30 16 830 – 40 55 27.540 – 50 49 2550 – 60 38 1960 – 70 26 1370 – 80 10 4≥ 80 6 3Level of EducationSecondary education 33 16.5Primary education 160 80Informal education 7 3.5Coping strategies with labour peaksFarmers’ own labour 8 5Family 89 56Hire external laborers 22 14All of the above 11 7Reduce crop area 29 18

Farming experiences and land size ownership of respondents

The findings indicate that the majority of the respondents had experience in cashew farming for more than 16 years while a few had experience of between 6 and 15 years. Very few respondents had less than 5 years experience in cashew farming (Table 2).

As for land ownership, many respondents were operating on small-scale, owning 0.2 – 2.5 ha of ca-shew farm and a good proportion were operating on medium-scale, with farm size ranging from 2.6


Crop Protection

– 5 ha. A few were operating on large-scale, owning more than 5.1 ha of cashew farm (Table 2). The average farm size was 2.9 ha, the smallest being 0.3 ha and the largest 18 ha. Apparently, the majority of resource-poor farmers survive on small parcels of land and this limits their ability to adopt cashew innovations; this leads to low productivity. On the other hand, over the years of experience in cashew farming, farmers might have adopted bad agricultural practices and have been naive to changes in adopting recommended practices as noted from respondents in the study area.

Table 2: Farming experiences and land size ownership (n=200)

Variables Frequency(n) Percentage (%)Farming experience in cashewLow ≤ 5years 24 12Medium 6 - 15 Years 48 24High ≥ 16 Years 128 64Agricultural land size owned (ha)Small scale 0.1 - 2.5 96 46.5Medium scale 2.6 - 5 63 33.5Large scale ≥ 5.1 41 20

Awareness in improved cashew materials and pest control strategies

Figure 1 shows the level of farmers’ awareness on improved cashew technologies and knowledge about insect pests of cashew. It was found that the majority of respondents were aware of the presence of improved planting materials of cashew and strategies employed in controlling insect pests and cashew diseases. It is clear that the use of improved planting materials and control of insect pests and diseases in cashew are the most important determinants of cashew yield in Tanzania, assuming other agro-nomical and management practices are constant.

Farmers’ awareness of important cashew insect pests

Figure 1 further shows the percentage of respondents with knowledge on important cashew insect pests. Apparently, the majority had higher knowledge on sucking insect pests (Helopeltis and coconut bug), while others had relative knowledge on Mealy-bug, Mecocorynus and Thrips. These five types of insect pests are the most destructive and failure to control them in time may result to substantial re-duction of cashew yields. As for insect control, many respondents used insecticides to control Helopel-tis, a good proportion of the respondents controlled Mecocorynus, and very few percent controlled cashew Mealy bug (Figure 1).


Crop Protection

Figure 1: Farmers awareness about improved cashew technologies and insect pest control

The low level of awareness expressed by respondents was due to limited contact with the Village Ag-ricultural Extension Officer (VAEO) 42%, while limited exposure and opportunities accounted for 28%. Other factors were low priority given to cashew farming 18%, and poor interaction with other farmers 12%.

Use of fungicides to control important cashew diseases

Results indicate that the majority of the respondents used different types of fungicides to control Leaf and Nut Blight and Powdery Mildew Disease and very few controlled die-back diseases (Table 3). A small percentage of the respondents owned motorised spraying machines while the majority hired the services at a cost ranging from TShs. 70.00 - 300.00 (USD 0.046 - 0.2) per tree for a single application. Motorised spraying machines cost between TShs. 500,000.00 and 1,500,000.00 (USD 333 – 1,000), and this high price was cited as the major factor preventing cashew farmers from own-ing such facilities. As a result, the number of cashew trees that were sprayed with pesticides to control the diseases was limited. Moreover, the respondents were dissatisfied with the services provided by the blower operators. Apart from long queues of farmers waiting for the blower service, spraying was also inefficient particularly for huge cashew trees (Table 3). Cumulatively, these implied that farmers were not able to follow the recommendations for fungicides and insecticides application; this led to substantial reduction in cashew yields at household and district levels.


Crop Protection

Table 3: Control of cashew diseases (n=100)

Control of cashew diseases Frequency PercentImportant cashew diseases controlledLeaf and Nut Blight 194 97.3PMD 166 83Die-back 15 7.5Ownership of motorised spraying machineOwn motorised spraying machine 38 19Do not own motorised spraying machine 162 81Sources of spraying servicesHire blower team for spraying service 159 98.7Use local methods 2 1.3Whether satisfied with hired blower servicesSatisfied 56 35Not satisfied 103 65Reasons for dissatisfactionUntimely application due to long queues 88 85Inefficient spraying/poor canopy coverage 15 15

Challenges experienced by farmers in controlling cashew insect pests and diseases

Cashew farmers face a lot of challenges while adopting improved cashew production technologies particularly use of pesticides. According to a report from DAICO Mtwara, at the time of the study, the district had 3,182,020 cashew trees while the number of spraying machines operating was 62 giving a ratio of 51,323:1. This implies that the few machines that were operating were overworked. According to research, for better performance and long economic life, a spraying machine should cov-er around 1,500 cashew trees per season (ARIN, 2007-10). Lack of proper servicing and maintenance resulted to frequent breakdown of the machines and eventually reduced their efficiency and durabil-ity. Consequently, farmers were not able to follow proper spraying regimes recommended by NARI. The recommended application rounds are 3 and 5 for water-based and dust fungicides, respectively, per season.

Figure 2 shows the most popular pesticides and the percentage of spraying rounds managed by re-spondents. Sulphur dust was used by the majority of respondents compared to other types of fun-gicides. The average application rate for sulphur dust was 200g per tree per round; the mimimum was 60g and the maximum was 735g (the recommended rate is 250g/tree/round for sulphur dust and 15mls/tree/round for liquid fungicides). Similarly, the most common insecticide used by many respondents was Karate, which was applied at an average rate of 3mls/tree/round which is lower than the recommended rate of 5mls/tree/round. For insecticides, the recommended application is three rounds at 21-day interval per season, but it may change depending on the type of insect pest (Figure 2). However, application rounds for chemical control may vary from year to year and also among agricultural zones depending on the pressure of insect pests and diseases. Further, by performing tree sanitation, farmers may delay the onset of diseases and may end up having fewer application rounds of insecticides and fungicides (Sijaona and Mansfield, 2001).


Crop Protection

Figure 2: Common pesticides used and their application rounds

Table 4: Major challenges in order of their importance

Challenges on use of pesticides Percent Rank

Untimely and inadequate procurement of subsidised pesticides 16 1

Poor knowledge on insect pests and disease ecology 15 2

Limited number of motorised blower machines 14 3

Inadequate capital/ funds 12 4Failure to meet recommended application (incomplete rounds & dilu-tion rates) 11 5

Presence of below-standard, fake and expired pesticides in the market 10 6

Poor knowledge on time to begin pesticide application 9 7

Inadequate information about cashew inputs and cashew marketing 7 8

Risks and health hazards due to lack of protective gear 6 9

Total 100

Farmers’ perceptions and understanding on pesticides

The general understanding on pesticides varied among respondents and this affected their appropriate use (Table 5). Generally, farmers showed to have little knowledge regarding pesticides and pesticides use, for example, the differences between pesticides and fertilisers, different sulphur brands and the mode of application.


Crop Protection

Table 5: Farmers’ perceptions and understanding on pesticides

Farmers understanding on pesticides Percent RankPesticides are poison applied to cashew trees to retard growth of insect pests and diseases 40 1Pesticides (sulphur dust) reduces soil fertility 24 2Pesticides work better only with im-proved cashew materials and not local types 15 3Pesticides are materials similar to fer-tilisers applied to boost production 12 4Once a type is used, it should be maintained 5 5Rainfall that occurs after pesticide application (sulphur) kills flowers 4 6Total 100

Conclusions and recommendations

This study has established that the majority of farmers are aware of the major types of cashew in-sect pests and diseases. However, untimely and inadequate availability of subsidised pesticides, poor knowledge on pesticides and cost of inputs such as motorised blowers are major factors that con-strain adoption of recommended technologies in Mtwara District and other cashew growing areas in Tanzania. It is therefore recommended that policy-makers should take steps to streamline and strengthen the linkages between cashew farmers and service providers and purchasers of agricultural produce through telecommunication facilities. This will create a win-win situation and enable farmers to receive timely market information. Capacity building of key stakeholders through workshops and seminars should be enhanced; and lastly subsidies on inputs particularly motorised blowers would be necessary.

Acknowledgements

Our profound gratitude goes to Mtwara District Agricultural, Irrigation and Cooperative Officer, Village Agricultural Extension Officers and all respondents in the study area for their honest and valuable information that has enabled successful production of this article. This work was funded by the Cashew Research Programme.


Crop Protection

References

ARIN (2007-2010). Annual Cashew nut Research Reports. Ministry of Agriculture and Food Securi-ty of Tanzania, Agricultural Research Institute Naliendele. Mtwara, Tanzania.

Bailey, D. K. (1998). Methods of social research. (4th Edition). New York: The Free Press.

Benor D., Harrison, I. Q., and Barter, M. (1997). Agricultural extension; training and visiting system. Washington, D.C: the World Bank.

Farming System Research (1992). Diagnostic survey report of farming system Zone 8. Mtwara, Tan-zania.

Kothari, C. R. (2009). Research methodology: Methods and Techniques. (2nd Edition). New Delhi: New Age International Publishers Limited.

Masawe, P. A. L., and F. K. Kapinga (2010). Preliminary observations on the performance of selected elite cashew hybrids at Nachingwea, Southern Tanzania. In Masawe, P. A. L., Esegu, J. F. O., Kasuga, L. J. F., Mneney, E. E., and Mujuni, M. D. (Eds) (2013). Proceedings of the Second International Cashew Conference, Kampala, Uganda, 26–29 April 2010. CAB International, Wallingford, UK, 56 60.

Matata, P. Z., Ajayi, O. C., O’Doul, P. A., and A. Agumya (2008). Socio-economic factors influenc-ing adoption of improved fallow practices among smallholder farmers in western Tanzania. International NGO Journal, 3(4), 068-073.

Mazvimavi, K., Ndlovu, P. V., Nyathi, P., and J. I. Minde (2010). Conservation agriculture practices and adoption by smallholder farmers in Zimbabwe. Poster presented at the Third Joint African Association of Agricultural Economists (AAAE) and 48th Agricultural Economists Association of South Africa (AEASA) Conference, Cape Town, South Africa, September 19-23, 2010.

Sijaona, M. E. R., and J. W. Mansfield (2001). Variation in the response of cashew genotypes to the targeted application of fungicides flower panicles for control of powdery mildew diseases. Plant Pathology, 50, 244-248.

Sijaona, M. E. R. (2013). Important diseases and insect pests of cashew in Tanzania. Naliendele Ag-ricultural Research Institute, Tanzania.


Crop Protection

Major Insect Pests of Cashew (Anacardium occidentale L.) and their Control in China

Z. R. Zhanga, b*, Y. Gaob, J. H. Wanga, W. J. Huanga, H. J. Huanga

a Tropical Crops Genetic Resources Institute, Chinese Academy of Tropical Agricultural Sciences/Key Laboratory of Crop Gene Resources and Germplasm Enhancement in Southern China, Ministry of

Agriculture, Danzhou, Hainan 571737, Chinab Guangdong Provincial Key Laboratory of High Technology for Plant Protection, Plant Protection

Research Institute, Guangdong Academy of Agricultural Sciences, Guangzhou 510640, China


Abstract

Field survey was conducted from 2004 to 2014, to identify the insect pest status on cashew. Major insect pests encountered in the cashew plantations were tea mosquito bug (Helopeltis theivora Waterhouse), yellow-spotted ridge borer (Rhytidodera bowringii White), red cocoon-making longhorn (Plocaederus obesus Gahan), cashew apple and nut borer (Nephopteryx sp.), cashew miner (Acrocercops syngramma Meyrick), red-banded thrips [Selenothrips rubrocinctus (Giard)] and tea bagworm (Clania minuscula Butler). Their infestation, morphology characters and control are described in this article.

Key words: Cashew, major insect pests, severity, survey.

Introduction

Cashew (Anacardium occidentale Linn.) belongs to the family of Anacardiaceae. It is a native of tropical Central and South America (Paul, 1936). Cashew cultivation was introduced to China in 1930 (Jiang and Deng, 1984), and it was mainly cultivated in the coastal areas of Hainan Province including Ledong, Dongfang, Changjiang, Lingshui and Danzhou; and in Yunnan Province including Xishuangbanna, Chuxiong and Baoshan. The Government of Hainan Province, China has recently identified cashew as a local special tropical crop and started a large area planting scheme to increase the cashew growing areas in Ledong and Lingshui for tourism purposes.

Cashew was once considered to be free from insect pests and diseases and also a crop which required minimum attention regarding insect pest control. Currently, there is evidence that insect pests and diseases can severely cause crop losses in cashew (Ohler, 1979). In China, more than 50 species of insect pests are known to be attaching cashew (Pan and Geest, 1990; Luo, 1991); most of them damaging the crop by attacking roots, trunk, branches/twigs, leaves, panicles and fruits. The damage occurs in different levels.

Knowledge on major cashew insect pests is essential in developing pest control strategies for the crop. While much of the survey and identification of major cashew insect pests in China was done in 1980s (Pan and Xing, 1987; Pan and Geest, 1990; Luo, 1991), the findings cannot be used to provide effective guidance for the cashew growers nowadays. In this article, studies were undertaken on the


Crop Protection

occurrence and ratio of major insect pests at 16 cashew plantations in Hainan province, to identify the major insect pests on cashew.


The time of occurrence, parts attacked and damage severity of insect pests of cashew were determined by surveying 16 cashew orchards during the shoot opening, flowering and fruit setting stages from 2004 to 2014. The 16 cashew orchards are located in Ledong, Lingshui, Dongfang, Changjiang, Danzhou and Sanya.

Table 1: Sites surveyed for cashew insect pests

No. Location Longitude Latitude Altitude/m Agro type1 Liguo town, Ledong County* 108°52’41.3” 18°31’31.4” 32.2 Coastal sandy

soil2 Liguo town, Ledong County 108°52’22.28” 18°31’28.32” 33.0 Coastal sandy

soil3 Jianfeng town, Ledong

County108°44’36.5” 18°40’02.4” 43.9 Coastal sandy

soil4 Jianfeng town, Ledong


soil5 Yingzhou town, Lingshui


soil6 Yingzhou town, Lingshui


soil7 Yue village, Dongfang City 108°40’43.6” 19°01’29.1” 7.4 Coastal sandy

soil8 Luodai village, Dongfang

City108°40’44.7” 19°04’28.6” 23.7 Coastal sandy

soil9 Xinlong town, Dongfang

City*108°40’52.5” 19°01’09.6” 8.6 Coastal sandy

soil10 Nanluo town, Changjiang

County*108°54’15.3” 19°28’18.4” 16.0 Coastal sandy

soil11 Haiwei town, Changjiang








soil15 Baodaoxincun, Danzhou

City*109°30’7.77” 19°30’55.7” 120.0 Inland clay

soil16 Fenghuang Road, Sanya City 109°25’37.1” 18°18’31.2” 37.0 Coastal sandy

soil

*Main inspection cashew orchards


Crop Protection

Results

Major insect pests of cashew

According to the severity of damage, the most devastating species belonged to the Order Hemiptera and included one Miridae, tea mosquito bug, Helopeltis theivora Waterhouse; two Cerambycidae, yellow-spotted ridge borer Rhytidodera bowringii white and red cocoon-making longhorn Plocaederus obesus Gahan. They also inclued one each of Pyralidae, cashew apple and nut borer Nephopteryx sp., Gracillariidae, cashew miner Acrocercops syngramma Meyrick, Thripidae, Red-banded Thrips Selenothrips rubrocinctus (Giard) and Psychidae, and tea bagworm Clania minuscula Butler.

Table 2: Major insect pest species associated with cashew, time of occurrence, parts attacked and damage severity in China

Insect pest Distribution Parts attacked Period of incidenceHelopeltis theivora Waterhouse (Hemiptera: Miridae)

LD, LS, DZ, SYtender leaf, inflorescence, tender shoot, tender fruit

January-December

Rhytidodera bowringii White (Coleoptera: Cerambycidae)

LD, LS, DZ, SY branch January-December

Plocaederus obesus Gahan (Coleoptera: Cerambycidae)

LD, LS, DZ, CJ, SY

stem January-December

Nephopteryx sp. (Lepidoptera: Pyralidae)

LD, LS, DZ, CJ, DF, SY

fruit December-July

Acrocercops syngramma Meyrick (Lepidoptera: Gracillariidae)


tender leaf January-December

Selenothrips rubrocinctus (Giard) (Thysanoptera: Thripidae)


Leaf April-September

Clania minuscula Butler (Lepidoptera: Psychidae)


leaf, shoot March-July

Note: LD = Ledong county, LS = Lingshui county, DZ = Danzhou city, CJ = Changjiang county, DF = Dongfang city, SY = Sanya city.

Tea mosquito bug (H. theivora Waterhouse)

Adults and nymphs of the tea mosquito bug feed on tender shoots, tender leaves, panicles, and nuts and apples under growth by piercing and sucking. The infested tissues show black spots and wither, directly resulting in yield loss (Figure 1-6). Survey shows that cashew plantations can lose 80% to 100% of yield if infested with the tea mosquito bug, without control.

The adult male body is 5.6 - 6.0 mm long, while the female is 6.5 - 7.2 mm long, and both measure 1.2 - 1.5 mm wide. The tea mosquito is yellowish brown or light yellowish brown, and occasionally yellow with a black-brown or brown head. Eggs are nearly cylindrical, white, 0.39 mm long. The egg


Crop Protection

cap has two white filamentous appendages on both sides; the longer is 0.62 mm while the shorter is 0.25 mm long. The fifth instar nymph is 5.3 mm long, 1.3 mm wide, and its body is earth-yellow tinged with reddish color (Luo and Jin, 1991).

The tea mosquito bug undergoes 12 generations a year. The egg stage lasts between 5 - 15 days. Nymphs have 5 instars: first instar nymphs take 2 -3 days, second instar 1 - 6 days, third instar 1 - 7 days, fourth instar 2 - 8 days, and fifth instar 3 - 6 days. Damage caused to cashew by nymphs increase with larval instars. Adults have a life of between 11 - 25 days, and one generation takes between 26 - 52 days. A single female lays between 52 - 242 eggs. Adults and nymphs favour shade and infest cashew continuously (day and night) by sucking sap from the tissues. Infested tender shoots and floral branches show polygonal water-soaked lesions, and infested young fruit and apples show round depressed water-soaked lesions. These water-soaked lesions turn black after 24 hours, and finally dry up.

The tea mosquito bug is controlled mainly at the nymphal and adult stages. Application of 80% dichlorvos (1:1000 - 1500), or 4.5% beta-cypermethrin (1:2500 - 3000) can effectively control nymphs and adults of the tea mosquito bug. It is effective to spray thrice at the flushing, flowering and fruiting stages in cashew plantations infested with the tea mosquito bug

Figure 1: Nymph Figure 2: Adult female Figure 3: Adult male

Figure 4: Infested tender shoot Figure 5: Infested fruit Figure 6: Infested tree

Yellow-spotted ridge borer (R. bowringii White)

Larvae of this borer bore into cashew branches and cause the branches to die or break off, which weakens and even kills the whole tree in serious cases (Figures 7-9). The adult body is 30 - 38 mm long


Crop Protection

and 6 - 8 mm wide, narrowly long, parallel on both sides, and chestnut-coloured to chestnut black. Eggs are elongate cylindrical, about 1 mm long, yellowish brown, coarse and without shininess on the surface. Fully-grown larval body is 58 - 77 mm long, with thorax 8 - 11 mm wide, creamy yellow, cylindrical, covered with sparse brown setae. The head is dorsally pitch black at the anterior tip. The pupae are yellowish white, 36 - 39 mm long and about 11 mm wide, flat in body, pupae is nuda (Luo et al., 1990; Luo and Jin, 1992).

The yellow-spotted ridge borer produces 1 generation a year in South China, which is completed the following year, and some may have 1 generation in two years. Occurrence of adults slightly varies with location. Adults occur from March to July and their peak emergence takes place from April to June in cashew plantations in Hainan, China, but in June to August in Yunnan, China. Adult females deposit eggs on twigs, leaves and broken twigs or crevices of the bark. Eggs are scattered, mostly 1 egg each site, although up to 6 - 8 eggs are grouped into a mass. The egg stage lasts for about 10 days, the larval stage lasts for 260 - 310 days, and the pupal stage lasts for 30 - 50 days. Each female deposits 6 - 25 eggs in its life time, and sdult life takes 13 - 36 days.

Infested trees are sprayed with 80% dichlorvos or cypermethrin-malathion 38% EC with a syringe into the last opening of tunnels to kill larvae in these tunnels in large branches. In heavily infested trees heavy pruning is recommended after harvest to maintain only main branches in the tree by sawing off all infested, diseased, and weak twigs and branches. Meanwhile the affected trees should be carefully tended and applied with fertilizer to promote formation of a new crown.

Figure 7: Larvae Figure 8: Adult Figure 9: Infested branch

Red cocoon-making longhorn (P. obesus Gahan)

Larvae bore into the cashew trunk, resulting in withering of the trunk and even killing of the whole tree (Figure 10-12). The adult body is 28 - 43 mm long and 11 - 14 mm wide, and reddish brown. Elytra are often black at the sutural margin. Eggs are elliptical, creamy yellow, spinulate on surface, 4.1 mm long and 1.4 mm wide. Larvae are yellowish white, with a reddish brown head at the anterior portion, and the body is over 75 mm long. Pupae are yellowish white, obese, pupal cocoon flat oval, 25 mm in major axi and 15 mm in minor axi (Qian, 1982).

In China, adults fly out of its cocoon in mid May and mate, and females oviposit. Eggs are mostly deposited in the cracks of barks within 1 m above the ground and newly hatched larvae infest the part under the bark and the sapwood, and then bore into the heartwood with tunnels crisscrossed. The


Crop Protection

cashew stem borer produces 1 generation a year in Hainan, China and complete it the following year. Adults mostly emerge in April to July. Larvae of different instars can be found in the field throughout the year. Usually, numerous larvae of the same instar or different instars can be found in an infested tree. Cashew trees can record incidences of this stem borer as high as 10% - 15% in extensively cultivated cashew plantations with poor management.

Survey on insect pests should be carried out to cashew individual trees at least once a year, with 2 checks: one check in June to July after harvest, and the other check in August to September. When infested trees are found, the bark of the infested part are cut open to remove larvae, and the openings are stuffed with cotton wool soaked in trichlorfon or dichlorvos. Lastly, the opening is then sealed with wet mud.

Figure 10: Larvae Figure 11: Adult Figure 12: Infested stem

Cashew apple and nut borer (Nephopteryx sp.)

The cashew apple and nut borer feeds as larvae on developing cashew nut, apple and mature apple, causing them rot and dry up (Figure. 13-17). Adults are dark grey with a wing span of 18 - 25 mm. Eggs are flat elliptical, about 0.7 mm long and about 0.5 mm wide, and purplish red. Larvae have 5 instars. Fully-grown larval body is 13 - 16 mm long, purplish red with greyish green tinge. Pupae are elongate-oval, 10 mm long and 3 mm wide (Luo and Jin, 1986).

The cashew apple and nut borer passes through about 10 generations, and one generation takes 30 - 34 days. A single female can produce a maximum of 125 eggs. Eggs laid on the nut hatch into larvae which immediately attack the nut, while larvae hatched from eggs deposited on other parts shift to find and feed on nuts or apples. The opening of the entry boring hole is rounded, covered with stripes or piles of frass.

The best time for chemical control is at the early stage of full fruiting. Effective pesticides include 4.5% beta-cypermethrin (1: 2500 - 3000), 1.8% abamectin (1: 2000 - 2500), 2.5% deltamethrin (1: 2000 - 2500), 20% disosultap (1: 1000 - 1500), 80% dichlorvos or 50% fenitrothion (1: 2000).


Crop Protection

Figure 13: Larvae Figure 14: Adult female Figure 15: Adult male

Figure 16: Pupae Figure 17: Infested fruit

Cashew miner (A. syngramma Meyrick)

Adult females produce eggs on the upper epidermis of tender leaves; larvae hatched from the eggs bore immediately into leaf flesh for feeding, and the infested tender leaves show twisted and curved markings (Figure 18-22). Generally, each leaf has 2 - 8 water soaked markings and is infested by many larvae. In some years, more than 90% of tender leaves are infested in some cashew plantations, and the tender leaves are persistently injured, seriously reducing leaf photosynthesis in cashew plants.

Larval body is light white and turns reddish brown when mature; it is cylindrical, tapering from the anterior to the posterior part, with distinct segmentation; the head is yellowish brown; and its alimentary canal is clearly visible, like a black line. Mature larval body is about 5 mm long. Adults are silvery grey, and minute in body shape (Athalye and Patil, 1998). Larval stage lasts for 9 - 15 days, pupal stage 7 - 9 days, and the entire life cycle takes 20 - 25 days.

Spraying pesticides at the flushing stage (in October to November in Hainan, China) can effectively control the cashew miner. When heavy infestations occur, the cashew trees are sprayed with 40% dimethoate (1:1000 - 1500), 50% fenitrothion (1:1000 - 1500), 2% abamectin (1:3000 - 4000) or 2.5% deltamethrin (1:2000 - 2500), to control the cashew miner.


Crop Protection

Figure 18: Larvae Figure 19: Pre-pupae Figure 20: Adult female

Figure 21: Adult male Figure 22: Infested leaf

Red-banded thrips [S. rubrocinctus (Giard)]

Adults and nymphs initially infest mainly the lower side of cashew leaves. Infested parts gradually turn yellowish brown (Figure 23-25). When infested, the tender leaves are curled and deformed. Adults and nymphs exude liquid substances on the leaves, giving an appearance of rusty brown or black bright spots after the substances have become dry, reducing photosynthesis and resulting in yellowing and shedding of all foliage in the tree in serious cases.

The female adult body is dark brown black, 1.0 - 1.4 mm long; while the male body resembles the female body in colour and morphological aspects, but this one is smaller. The egg is reniform, yellowish white, about 0.25 mm long. Nymphs are oblong, hyaline when just hatched, and transparent; the head and terminal abdominal end turn light yellow later, with bright red bands on the base of the abdomen. Last instar nymphs are about 1 mm long. Pupae are long, about 1 mm long, similar to nymphs in morphological aspects, but with completely developed wing buds (Luo and Li, 1998).

The red-banded thrips have about 10 generations a year. The egg stage lasts about 10 days. When nymphs are newly hatched, they feed on the underside of the leaves. The nymph stage lasts 12 - 13 days. Nymphs feed for 10 days after which they become feeding or non-feeding prepupal nymphs - a stage which takes 2 - 3 days. The nymphs develop into the pupae stage which lasts 6 days. Adults and nymphs live on depressions or small furrows near main veins, and often raise the terminal abdominal end with a drop of excrementous liquid at the top of the abdomen. At the flushing stage and initial


Crop Protection

flowering stage, cashew trees are applied with 3% acetamiprid (1:1500-2500), 5% imidacloprid (1:1000 – 2000), 2.5% spinetoram (1:1000 –1500) or 24% spirotetramat (1:4000 –5000) to control the thrips.

Figure 23: Nymph Figure 24: Adult Figure 25: Infested leaf

Tea bagworm (C. minuscula Butler)

The tea bagworm larvae feed on leaves, as well as on twigs which are used for making bags (Figure 26-28). Its population is partially large, which often causes serious damage to cashew plants. Larvae feed within their bags on leaves and tender twigs by biting, or on barks of branches and stems and fruit, and prefer to aggregate together for feeding.

The adult male body is 10 - 15 mm long with a wing span of 22 - 30 mm; the body and wings are dark brown. Adult females are 10 - 16 mm long, unwinged, with degenerate legs, grublike, and are creamy white. The thorax has conspicuous yellowish brown patches, the head is small and brown, the abdomen is obese, and the body wall is thin. Eggs within abdomen are visible. Eggs are elliptical, about 0.8 mm long and 0.3 mm wide, and light yellow in color. The body of the larva is 25 - 35 mm long. Its head is light brown to dark brown, with dark brown spots parallel on both sides. The thorax and abdomen are yellow, darker on dorsal median portion tinged with purplish brown color. While the male pupal body is about 15 mm long, and dark brown, the female pupal body is 14 - 20 mm long, fusiform, and dark brown. Worm bags are fusiform, brown. Female bags are 30 - 50 mm long, while male bags 20 - 30 mm long. Worm bags are silken, decorated outside with bits of leaves and bark when larvae are young (Zhao and Lu, 2008).

The tea bagworm passes through 3 generations a year. The egg stage lasts 12 - 17 days, larval stage 50 - 60 days, female pupal stage 10 - 22 days, male pupal stage 8 - 14 days, male moth 2 - 3 days, and female moth 12 -15 days. Larvae pass through 6-7 instars. A single female produces 676 eggs by average, although some can produce as many as 2,000 – 3,000 eggs. Adult males are very active and


Crop Protection

show response to light. Larvae carry their bags and are hence not very active; therefore, larvae occur in groups, and several hundred larvae often aggregate together to form an infestation centre.

At the early instar larval stage, larvae occur partially with a distinct infestation centre, and are less tolerant to pesticides. Chemical control should be conducted at this stage. Effective pesticides inlcude 90% crystal trichlorfon (1:1500), phoxim 40% EC (1:1000 - 2000), dichlorvos 80% EC (1:1000 - 1500), 50% fenitrothion (1:1500 - 2000), and deltamethrin 2.5% EC (1:4000).

Figure 26: Nymph Figure 27: Infested leaf Figure 28: Infested tree

Discussion

Pan and Geest (1990) have shown that 4 insect pests, mainly stem and branch borers (Ceramgycidae), including yellow-spotted ridge borer R. bowringii and red cocoon-making longhorn P. obesus, tea mosquito bug Helopeltis sp. and apple and nut borer Nephopteryx sp. play an important role in cashew infestation. Luo (1991) also confirmed the important pest status of those 4 insect pests. In the present survey, we found that cashew in Hainan is attacked by a wide range of insect pest species, but only a few, including tea mosquito bug H. theivora, yellow-spotted ridge borer R. bowringii, red cocoon-making longhorn P. obesus, cashew apple and nut borer Nephopteryx sp., cashew miner A. syngramma, Red-banded thrips S. rubrocinctus and tea bagworm C. minuscula, reach the pest status. Cashew miner A. syngramma, Red-banded thrips S. rubrocinctus and tea bagworm C. minusculawere have newly been identified as major insect pests in China, while the other 4 major insect pests have kept their pest status since 1980s.

Management of these major insect pest species is in many instances necessary to safeguard the quality and yield of cashew nut. Among them, two pests including the yellow-spotted ridge borer R. bowringii and red cocoon-making longhorn P. obesus are usually controlled by manual removal of the larvae at the damage sites of cashew tree (Luo et al., 1990; Liang and Zhang, 2007), althought in many cases, cashew growers gave up controlling because some damage sites, especaily those caused by yellow-spotted ridge borer R. bowringiion on old cashew trees, were too high and hard to reach to implement the recomended control methods.

Since 1980s, the main control method for all the other major insect pests has been chemical control (Pan et al., 1991; Luo and Jin, 1986; Pan and Xing, 1987; Satapathy et al., 1990; Ganeshkumar and Palaniswamy, 1983). However, toxicity, environmental pollution, the extermination of natural


Crop Protection

enemies and eventually, build-up of insecticides resistance in the pests, make chemical control a risky and unsatisfactory pest management strategy. To diminish using chemical pesticides in cashew orchards in China, attempts have been made to determine the efficacy of biological control agents including Bacillus thuringiensis and entomopathogenic nematodes against cashew apple and nut borer Nephopteryx sp. and cashew miner A. syngramma. Some clones of cashew also have shown certain resistance to cashew miner A. syngramma, tea mosquito bug H. theivoraand yellow-spotted ridge borer R. Bowringii attacks; hence, careful selection of clones may result in cashew variaties which are less susceptible to major insect pests in China (Zhang, et al., 2008, 2010, 2011).

Information abtained in the present study is useful for a better understanding of major insect pests of cashew, and helpful for enhancing pest management strategies in cashew growing areas in China.

Acknowledgements

Financial support was provided by the National Natural Science Foundation of China (No. 31301672), Natural Science Foundation of Hainan Province (No. 314126), Science and Technology Project of Guangdong Province (No. 2014B030301053) and National Nonprofit Institute Research Grant of TCGRI-CATAS (1630032014032, 1630032015033).

References

Athalye, S. S., and R. S. Patil (1998). Bionomics, seasonal incidence and chemical control of cashew leaf miner. Journal of Maharashtra Agricultural Universities, 23, 29-31.

Ganeshkumar, M., and K. P. Palaniswamy (1983). A study on the chemical control of the cashew leaf miner (Acrocercops syngramma M.) and the foliage thrips (Scelenothrips rubrocinctus Giard, Rhipiphorothrips cruentatus Hood and Retithrips syriacus M.). Cashew Causerie, 5, 11-13.

Jiang, S. B., and S. S. Deng (1984). Reason analysis of low yield cashew in Hainan Island and its prospect. Tropical Crops Research, 3, 43-50.

Liang, L. H., and Z. R. Zhang (2007). Diseases and insect pests of cashew. Beijing: China Agriculture Press.

Luo, Y. M., and Q. A. Jin (1986). Primary study of cashew apple and nut borer. Chinese Journal of Tropical Crops, 7, 99-105.

Luo, Y. M., and Q. A. Jin (1991). A study on the mosquito bug infesting cashew in Hainan Island. Acta Entomologica Sinica, 34, 60-67.

Luo, Y. M., Cai, S. M., and Q. A. Jin (1990). Rhytidodera bowringii White in Hainan Island. Chinese Journal of Tropical Crops, 11, 107-112.

Luo, Y. M., and Q. A. Jin (1992). Bionomics of Rhytidodera bowringii White in Hainan Island. Chinese Journal of Tropical Crops, 13, 59-61.

Luo, Y. M., and Z. S. Li (1998). Insect pests of Chinese tropical crops and their control. Haikou: Hainan Press.


Crop Protection

Ohler, J. G. (1979). Cashew. Koninklijk instituut voor de tropen, Amsterdam, Netherlands.

Pan, X. L., and F. Y. Xing (1987). Infestation and control of cashew apple and nut borer. Chinese Journal of Tropical Crops, 8, 109-116.

Pan, X. L., and L. P. S. Geest (1990). Insect pests of cashew in Hainan, China, and their control. Journal of Applied Entomology, 110, 370-377.

Pan, X. L., Qiu, J. D., Xing, F. Y., and Y. Y. Huang (1991). Studies on spatial distribution of infestation by Helopeltis fasciaticollis in cashew plantations and its controls. Chinese Journal of Tropical Crops, 12, 109-116.

Paul, W. R. C. (1936). The cashew nut industry of South India. Tropical Agriculturist, 87, 166-173.

Qian, T. Y. (1982). Records of the larva stage of longhorns injurious to mango stems. Chinese Journal of Tropical Crops, 3, 95-100.

Satapathy, C. R., Sen, S. R., and K. Bohidar (1990). Evaluation of relative toxicity of some insecticides against the larvae of the cashew leaf miner, Acocercops syngramma M. The Cashew, 4, 12-13.

Zhao, D. X., and F. P. Lu (2008). Colour atlas of non-pollution control for the mango insect pests in Hainan Island. Beijing: China Agriculture Press.

Zhang, Z. R., Liang, L. H., Huang, W. J., and J. H. Wang (2008) Evaluation of the resistance of five cashew germplasms to the cashew miner. Plant Protection, 34, 113-115.

Zhang, Z. R., Liang, L. H., Huang, W. J., Wang, J. H., and H. J. Huang (2010) Evaluation of the resistance of five cashew clones to tea mosquito bug (Helopeltis theivora Waterhouse). Chinese Journal of Tropical Crops, 31, 122-125.

Zhang, Z. R., Liang, L. H., Huang, W. J., Wang, J. H., and H. J. Huang (2011) Evaluation of the resistance of five cashew clones to the cashew long-horned beetle. Plant Protection, 37, 82-86.


Crop Protection

The Role of Environmental Factors on the Growth and Development of Cryptosporiopsis sp fungus: The Pathogen of Leaf and Nut Blight Disease on Cashew

D. Menge1*, S. H. Shomari2 and W. Nene2

1Masai Mara University, P. O. Box 861, Narok, Kenya.2Naliendele Agricultural Research Institute

P. O. Box 509, Mtwara Tanzania.


Abstract

The role of temperature, incubation period, wetness duration, pH and light on the development of cashew blight disease Cryptosporiosis sp and existence of alternative hosts were investigated at Naliendele Agricultural Research Institute, Mtwara, Tanzania. Petri dishes with Potato Dextrose Agar (PDA) growth media were inoculated with fifteen-day old cultures of blight fungus and incubated at different temperatures, pH and light regimes for different days. Similarly, nine months old cashew plants with tender leaves were inoculated with conidial suspension of the fungus and exposed to wetness durations of 4, 8, 12, 16 and 20 hours. After four days, daily observations were made for blight symptoms, for a period of 10 days. Eight plant species were studied for the possibility of existence of alternative hosts. Optimum mycelial growth was recorded at a temperature range of 250C to 300C, maximum mycelial growth diameter was recorded at pH 6.0 and 7.0, and the longest mycelial growth was observed in 12 hours photoperiod. The disease appeared to develop rapidly when exposed to continuous wet periods of more than 12 hours. Manihot esculenta, Sorghum bicolour, Ipomoea batatas, Vigna radiate and Eucalpytus camaldulensis served as alternative hosts.

Key words: Cryptosporiopsis sp, temperature, pH, wetness duration, light

Introduction

Cashew leaf and nut blight disease, caused by Cryptosporiopsis sp, has been observed in the southern part of Tanzania since 2002, but was officially reported for the first time in 2006 (Sijaona et al., 2006). The disease is characterised by angular lesions, dark tan with a dark reddish brown margin formed on leaves, often vein limited and containing conidiomata. Lesions subsequently enlarge and coalesce causing large necrotic lesions and finally defoliation. Older lesions become papery, silver/grey, and develop shot-holes. During fruit setting, infection of young nuts causes rapid blackening and abscission, resulting in significant yield losses. Usually infections on older nuts result in sunken, ‘tar spot’-like lesions that frequently extend onto the apples (Sijaona et al., 2006).

In 2012, epidemiological studies were initiated at Naliendele Agricultural Research Institute, Mtwara, Tanzania to follow up on the role of various environmental factors on the growth and development


Crop Protection

of this cashew blight fungus. The knowledge on these areas is fundamental for formulating strategic mitigation measures of the disease. This article presents the role of various environmental factors on the growth of this fungus and the subsequent development of leaf and nut blight disease on cashew.


Most of the work on environmental factors was conducted in the laboratory. The blight infected leaf samples used were collected from farmers’ fields, on commercially cultivated clones at 11 locations, under different agro-ecological zones in, southern Tanzania. These samples were placed in paper bags, which were properly labelled and brought to the laboratory at Naliendele Agricultural Research Institute for isolation of the disease causing fungus. The pathogen was isolated by a direct conidial transfer method on Potato Dextrose Agar (PDA). Cashew leaves showing leaf blight symptoms were cut into small pieces of 1.2cm, surface sterilised by Sodium Hypochloride for one minute, and washed in sterilised distilled water three times. The leaf bits were placed in Petri dishes containing moist filter paper and incubated for 4 days at 25±2°C. The sporulated leaf bits were shaken onto new PDA to release spores, thereafter the dishes were incubated for 4 days at 25±2°C. The fungus was purified by using hyphal tip isolation technique and maintained on PDA slants. These were used in all subsequent experiments.

Temperature tolerance by cultivation of the isolated fungi was determined. Petri dishes containing 20 ml of PDA were inoculated with a nine millimetre mycelia disc from ten days old leaf cultures. The leaf disks were cut with a flamed cork-borer. These dishes in triplicate were incubated at 5, 10, 15, 25, 30, 35 and 40°C for 10 days. The diameter of the growing colony was measured crosswise in two directions in 10 days old cultures. The average of these two readings was taken as the diameter of the colony.

The germination of macroconidia of Cryptosporisis sp was microscopically examined to understand the timing of key events. Fifteen days old culture of Cryptosporiopsis sp spore suspension (106 spore/ml) was prepared in sterilised water. A drop of the conidial suspension collected from a fifteen days old culture of the fungus was placed on clean sterilised slides. These slides were kept in a moist chamber at room temperature (27±2°C). Observations on spore germination (x400) were recorded at 2, 4, 6, 8, 10, 12, 14 and 16 hours after incubation for conidial germination. Germination was considered to take place if the length of the germ tube was longer than the spore. Three replications were maintained for each treatment. From each slide, 100 spore counts were taken to calculate the percentage of germination.

Twenty five, three months old cashew plants, with tender leaves were inoculated with blight conidial suspension using a hand sprayer. The plants remained enclosed in wet plastic bags for 24 hours to maintain high humidity. Each set of five plants was subjected to five (4, 8, 12, 16 and 20 hours) wetness durations. At the end of each respective period, the plants were gently dried by using a table fan. The temperatures during the experiment were fluctuating between 270C to 310C and 200C to 240C during day and during the night, respectively. After 24 hours, the plastic bags were removed and the plants were observed for blight symptoms for 10 days.

After preparation of the PDA broth, their suitable volumes were adjusted at different pH 4, 5, 5,6,7,8 and 9 using 1N hydrochloric acid or IN sodium hydroxide. The sterilised media of different pH levels


Crop Protection

were poured onto the sterilised petri dishes in about 20 ml quantities and allowed to solidify. Nine millimetre discs from the actively growing ten-day old leaf cultures were placed at the centre of the petri dishes. The dishes were incubated at 25±2°C for six days then the mycelia growth diameter was measured.

Effects of light on mycelia extension were determined by measuring the radial growth of the colony. PDA medium was autoclaved at 121°C for 15 minutes, and 20 ml of it was poured into petri dishes. Leaf culture discs of nine mm were used to inoculate the petri dishes. After cooling, the dishes were incubated at 25±2°C for six days in three different light conditions in the incubator (fluorescent light). Carbon paper was used to wrap the petri dishes for darkness, and a fluorescent lamp was used for light exposure. The first group was incubated in total darkness, the second group was in complete light, and the third group was in 12 hour alternating shifts of total darkness and light. The colony diameter was recorded after 10 days of incubation.

The possibility of existence of alternative hosts was studied. The plants included in the study were Mango (Mangifera indica L), Cassava (Manihot esculenta Crantz), Sorghum (Sorghum bicolour Moench), Pigeon Pea (Cajanas cajan (L.) Sweet Potato (Ipomea batatas (L.) Lam), Lemon (Citrus lemonum Risso), Mung bean (Vigna radiate L.) and Eucacalyptus sp.

In determining the host range of the leaf and nut blight (Cryptosporisis sp), sterile soil samples were packed in polythene bags. Soil sterilisation was achieved by fumigation with a soil drench chemical. Seeds of the test plants were sown in polythene bags, two seeds per bag. Four polythene bags (8 stands) were planted for each test plant. Two polythene bags per test plant were inoculated while two polythene bags were used as controls. Seedlings were inoculated eight weeks after germination by drenching the soil with spores’ suspension of Cryptosporisis sp. The inoculated plants were sprayed with water to maintain high relative humidity, to achieve favourable conditions for disease expression. All the polythene bags, both for inoculated plants and controls, were covered with polythene sheets to maintain a humid environment. Regular monitoring was done and observations recorded four days after inoculation for the development of symptoms. The pathogens from infected hosts were re-isolated on PDA and observed under a microscope for morphological characters.

The data were statistically analysed according to Gomez and Gomez 1984). The package used for analysis was statistical analysis package SAS Version 9.2, developed by SAS Institute (1999). “SAS/Stat user’s Guide”. SAS Institute Inc. Cary, N.C.

Results and Discussion

Effect of temperature on mycelial growth

The blight fungus mycelia grew well at temperatures of 30°C (88.83mm) followed by 25°C (82.40mm) and 35°C (72.04mm) as shown on Table 1. The temperature better suited for mycelial growth ranged from 25-30°C. As the temperature was increasing, the mycelial growth also increased. However, at 35°C the growth started to decline. This could be attributed to increase in enzymatic activity of Cryptosporiopsis sp. The least growth was produced at 5°C (9.19mm).The fungus failed to grow at 40°C probably due to the inactivation of enzymes with a resulting effect on metabolism that


Crop Protection

affects growth. There were significant differences in mycelial growth (Table 1) in different ranges of temperature, F (76, 233) = 2664.7, P<0001.

Table 1: Effect of temperature on mycelial growth

Blight isolates

Mean mycelial growth (mm)

5°C 10°C 15°C 20°C 25°C 30°C 35°C

1 9.43t 17.23s 37.57q 63.45k 79.37e 88.50ab 67.53j

2 9.87t 17.53s 43.43no 67.73j 83.57d 89.37a 75.93f

3 8.55t 19.03rs 44.43mn 70.13i 87.50ab 90.00a 75.50fg

4 9.00t 20.10r 47.37l 73.50gh 87.67ab 89.33a 74.33fgh

5 8.53t 19.20rs 45.43m 76.07f 87.90ab 89.33a 68.13ij

6 9.23t 17.53s 38.20pq 63.63k 76.40f 88.10ab 69.10ij

7 10.47t 18.23rs 40.27p 72.47fgh 85.33c 89.33a 70.13i

8 9.00t 17.43s 37.63q 64.67k 78.43e 87.67ab 68.37ij

9 8.60t 18.37rs 39.17pq 67.13j 76.37f 86.33bc 75.77fg

10 9.17t 18.17rs 42.33o 64.43k 82.10d 89.67a 73.47gh

11 9.27t 17.57s 38.30pq 65.40k 81.77d 89.47a 74.13fgh

Grand mean 9.19 18.21 41.28 68.06 82.40 88.83 72.04

*Means separated using Least Significant Difference Test (LSD) by the same letter are not significantly different (P<0.05) from each other.

Conidial germination at various incubation periods

To understand developmental stages of the cashew blight pathogen, conidial germination was observed. The spore germination at various incubation periods was found to differ significantly. Within 2 hours of incubation, germination was less than 5% though approximately 60% of macroconidia had swollen (Figure 1.). Germ tubes first appeared in spores after 4 hours. After 10 hours, over 40% macroconidia had at least one germ tube. Hyphal branching was observed in germ tubes at 12 hours where 94% of macroconidia had already germinated. Maximum germination (99%) was observed after 16 hours of incubation where most spores had produced only a single germ tube.


Crop Protection

Fig 1: Percentage spore germination at an interval of 2 hours

Plate 1: (a) Conidia of Cryptosporiopsis sp causing leaf and nut blight (b) Germinating Conidia

(c) Cryptosporiopsis sp hyphae (d) Cryptosporiopsis sp conidiophores


Crop Protection

Wetness durations

Observations made four days after inoculation show that cashew plants which were wet for 12 and 16 hours had more leaves, with blight lesions as shown in Table 2. Disease severity on those leaves appeared to increase with increased wetness periods as exhibited on Plate 2. Plants exposed to wet periods of less than 12 hours showed least disease symptoms. The young and tender leaves were more susceptible to disease infections than older ones.

Table 2: Number of leaves with blight symptoms and levels of severity observed four days after inoculation

Hours of wetness Leaves with blight symptoms per plant Severity level

4 4 18 5 112 5 116 11 220 17 2

4 h

16 h

8 h

20 h

12 h

Plate 2: Blight symptoms as observed on cashew leaves four days after inoculation after exposure to different hours of wetness

Effect of pH on mycelial growth

Figure 2 shows that there were significant differences in mycelial growth at different pH, F (5, 197) = 3372.7, P<0.0001. pH 7 was found to be ideal and produced the maximum mycelial growth of 67.79mm followed by pH 6.0 (62.94mm) and pH 8.0 (30.09mm). There was a decrease in growth when pH increased from 7.0 to 9.0. pH 4.0 recorded the lowest mean mycelial growth of 22.24mm. pH below 6.0 and above 7.0 produced inhibitory mycelial growth. The Cryptosporiopsis sp. isolates


Crop Protection

prefer pH range of 6.0-7.0 indicating that the fungus prefers slightly acidic pH for the growth. There were no significant differences in mycelial growth between pH 4.0 and 5.0.

9

between pH 4.0 and 5.0.

Figure2: Effect of different pH levels on the mycelial growth of Cryptosporiopsis sp

Effect of light on mycelial growth

Photoperiod showed significant effect (F (29, 89) = 750.5, P<0.0001) on the growth of fungal

mycelium (Table 3). The highest mean mycelial growth (57.43mm) was observed in 12 hours

photoperiod, followed by 24h photoperiod (31.91mm). The lowest mean mycelial growth

(24.70mm) was found in complete darkness. This indicates that the fungus isolates require a

period of dark followed by a light period for conidiophore formation and sporogenesis. The

fungus probably uses light to trigger the development of fruiting bodies and phototropic

responses of reproductive structures. Phycomes and Pilobolus have been shown to use light in

the formation of reproductive structures (Alexopoulus et al., 1996). Most light sensitive fungi

sporulate when exposed to continuous light, but some called diurnal sporulators, require a period

of dark followed by a light period. Mycelial colony was relatively dense when it was incubated

in alternating shifts of dark/light conditions; which showed that light is also an important factor

in the growth of this fungus. The effects of light and darkness on mycelial growth of

Cryptosporiopsis sp were significantly different (P<0.0001). Isolates 7 (63.67mm) and 8

0

10

20

30

40

50

60

70

80

4 5 6 7 8 9

Myc

elia

l gro

wth

(mm

)

Hydrogen ion concentration Hydrogen ion concentration

Figure2: Effect of different pH levels on the mycelial growth of Cryptosporiopsis sp.

Effect of light on mycelial growth

Photoperiod showed significant effect (F (29, 89) = 750.5, P<0.0001) on the growth of fungal mycelium (Table 3). The highest mean mycelial growth (57.43mm) was observed in 12 hours photoperiod, followed by 24h photoperiod (31.91mm). The lowest mean mycelial growth (24.70mm) was found in complete darkness. This indicates that the fungus isolates require a period of dark followed by a light period for conidiophore formation and sporogenesis. The fungus probably uses light to trigger the development of fruiting bodies and phototropic responses of reproductive structures. Phycomes and Pilobolus have been shown to use light in the formation of reproductive structures (Alexopoulus et al., 1996). Most light sensitive fungi sporulate when exposed to continuous light, but some called diurnal sporulators, require a period of dark followed by a light period. Mycelial colony was relatively dense when it was incubated in alternating shifts of dark/light conditions; which showed that light is also an important factor in the growth of this fungus. The effects of light and darkness on mycelial growth of Cryptosporiopsis sp were significantly different (P<0.0001). Isolates 7 (63.67mm) and 8 (63.67mm) had the highest mean mycelial growth in 12 hours alternate light and dark conditions (Table 3). The lowest mean mycelial growth was recorded in complete darkness by isolates 7 (17.67mm) and 5 (17.33mm). Adeniyi et al. (2011) reported that light was found to be suitable for maximum growth of Pestalotia species which causes leaf spots in cashew.


Crop Protection

Table 3: Effect of light intensities on mycelial growth of Cryptosporiopsis sp

Blight isolatesMean mycelial growth (mm) of the isolates

12 hour photoperiod Complete darkness 24 h photoperiod

1 *58.00±0.5d 24.67±0.3n 34.67±0.8hi

2 52.00±0.5f 25.33±0.3n 32.00±0.5j

3 48.00±0.5g 29.00±0.5k 31.00±0.5j

4 52.33±0.3f 27.67±0.3klm 35.67±0.3h

5 58.67±0.3cd 17.33±0.3o 27.00±0.5m

6 54.00±0.5e 31.00±1.0j 31.00±0.5j

7 63.67±0.3a 17.67±0.3o 35.67±0.3h

8 63.67±0.3a 27.33±0.6lm 34.00±0.5i

9 60.67±0.8b 28.67±0.3kl 34.67±0.3hi

10 60.00±0.5bc 18.67±0.3o 28.33±0.6klm

11 60.67±0.8b 25.33±0.3n 27.00±0.5m

Grand mean 57.43 24.70 31.91

*Means separated using Duncan’s Multiple Range Test (DMRT) by the same letter are not significantly different (P<0.05) from each other.

Hosts of Cryptosporisis sp. fungus

The host range study was conducted to determine the ability of Cryptosporisis sp to survive on different hosts in the absence of cashew. The results of disease reaction on different test hosts are presented in Table 4 and it was found that out of the eight hosts, five hosts, viz., Manihot esculenta, Sorghum bicolour, Ipomea batatas, Vigna radiate and Eucalpytus camaldulensis, were infected by Cryptosporisis sp. The pathogen Cryptosporisis sp was re-isolated from these infected hosts and cross inoculated to cashew plants. Similarly, cashew isolates were found to infect the hosts mentioned above.

The present study showed that five hosts, viz., Manihot esculenta, Sorghum bicolour, Ipomea batatas, Vigna radiate and Eucalpytus camaldulensis, served as alternative hosts of Cryptosporisis sp. The pathogen could perpetuate during off-season on these alternative hosts and serve as source of secondary infection. The pathogen was re-isolated and found alike with mother culture upon microscopy. Older tissues were more resistant to penetration by Cryptosporisis sp infections while young tissues were more susceptible. Few lesions were observed on Manihot esculenta compared to other plants. Lesions observed on Vigna radiate were initially brown in colour. These often increased in size rapidly, causing most of the plant shoot/stem to wither, and sometime resulting in death of plants.

In Ipomea batatas, lesions appeared as large yellow patches that were accompanied by leaf chlorosis. There were light brown lesions on Manihot esculenta curled leaves. Brown spots developed quickly within two days in Eucalpytus sp extending in both the lamina and midrib. Disease symptoms begin as small brown spots on leaves. Infection begins with the appearance of irregular shaped small spots. In addition to causing leaf spots and defoliation, stem lesions were associated with Cryptosporisis sp. Symptoms of Cryptosporisis sp infection developed on sorghum bicolour leaves. Brown leaf spots occur


Crop Protection

on both sides of the glasslike and flat leaves. The studies revealed that the plants of Mangifera indica, Cajanus cajan, Citrus limonum were non-host to Cryptosporisis sp.

Results of artificial inoculation showed that different plants in the test reacted differently to Cryptosporisis sp. In addition, the cashew blight pathogen may vary considerably in pathogenecity. When penetration of Cryptosporisis sp occurred, a series of host defence responses have been elicited in Manihot esculenta Crantz (Cassava). After the initial penetration into sub-stomatal cavity, adjacent cell walls thicken. Although haustoria were produced in some species such as Cajanuscajan and Mangifera indica, a host defence response might have isolated them and prevented further development. This study established that Manihot esculenta, Sorghum bicolour, Ipomea batatas, Vigna radiata and Eucalyptus camaldulensis are potential alternative hosts of Cryptosporisis sp and may play a role in the epidemiology of cashew blight disease.

Table 4: Status of crops as hosts of Cryptosporisissp other than cashew

S/N Scientific name Family Status1 Mangiferaindica L. (Mango) Anacardiaceae -2 Manihot esculenta Crantz (Cassava) Euphorbiaceae +3 Sorghum bicolor (L.) Moench (Sorghum) Poaceae +4 Cajanas cajan (L.) Millsp (Pigeon pea) Fabaceae -5 Ipomea batatas (L.) Lam (Sweet potato) Convolvulaceae +6 Citrus limonumRisso (Lemon) Lamiaceae -7 Vigna radiata (L.) Wilzek (Green gram) Fabaceae +8 Eucalyptus camaldulensis Myrtaceae +

Key: (+) sign refers to infected plant species and (-) indicates plants species not affected

Conclusions

The present study clearly indicates that the pathogen Cryptosporiopsis sp, causing blight disease on cashew (Anacardium occidentale Linn) grows well and spreads fast in environments that are within the temperature range of 250C–300C. Basically, these are the temperature conditions prevailing throughout the year in Tanzania where cashew is mostly grown. The presence of abundant blight inoculum in the environment suggests the possibility of having continuous blight disease epidemics throughout the year in most parts of Tanzania where cashew is widely grown. However, usually that is not the case. Experience has revealed that absence of the required wetness and lack of susceptible cashew tissues during certain periods of the year, limit continuous occurrence of the cashew blight epidemics. These present findings indicate that cashew blight disease grows rapidly when exposed to continuous wet periods of more than 12 hours. However, when subjected between 6 and 12 hours, necrotic lesions were also visible, though of smaller sizes. The disease severity showed to increase with increased wet durations, which suggests that increased wetness duration of cashew tissues accelerates infection and trigger occurrence of blight epidemics.


Crop Protection

The cryptosporiopsis sp fungus prefers pH range of 6.0-7.0 indicating that the fungus favours slightly acidic pH coupled with alternating light regimes of 24 hours photoperiod for growth.

This study established that Manihot esculenta, Sorghum bicolour, Ipomea batatas, Vigna radiate and Eucalyptus camaldulensis are potential alternative hosts of Cryptosporisis sp and may play a role in the epidemiology of cashew blight disease. These alternative hosts may serve as secondary foci of inoculum, thus establishing their role in epidemiology of the disease. The study further revealed that Mangiferaindica, Cajanus cajan and Citrus limonum were non-hosts of Cryptosporisis sp. This knowledge on host selectivity is important to understand the epidemic development of the blight disease.

Acknowledgements

This work was supported by Cashew Research Programme and grant funds from the University of Gottingen, Germany.

References

Adeniyi, D.vO, Orisajo, S. B., Fademi, O. A., Adenuga, O. O., and L .N. Dongo (2011). Physiological studies of fungi complexes associated with cashew diseases. ARPN Journal of Agricultural and Biological Science, 6(4).

Alexopoulus, C. J., Mims, C. W., and M. Blackwell (1996). Introductory mycology (4th Ed.). New York: John Wiley.

Gomez, K. A., and Gomez, A. A. (1984). Statistical procedures for agricultural research with emphasis on rice. The International Rice Research Institute, Los Banos, Phillipines.

Sijaona, M. E. R., Reeder, R. H., and J. M. Waller (2006). Cashew leaf and nut blight – A new disease of cashew (Anacardiumoccidentale L) in Tanzania caused by Cryptosporiopsis sp. http://www.bsapp.org.uk/ndr/jan2006/2005-75.asp)


Crop Protection

Evaluation of Five Selected Potential Botanicals against Cashew Powdery Mildew Disease

S. H. Shomari 1*, D. Menge 2 and W. Nene 1

1Cashew Research Programme, Naliendele Agricultural Research InstituteP. O. Box 509, Mtwara Tanzania.

2 Masai Mara University, P. O. Box 861, Narok, Kenya.


Abstract

Plant extracts of Brimstone tree (Morinda morindoides), Firestick plant (Senna occidentalis), Neem plant (Azidarachta indica), Pricky pears (Opuntia cactus) and Dorai kalli (Opuntia vulgaris) were evaluated in vitro and in the field against cashew powdery mildew disease caused by the fungus Oidium anacardii, at Naliendele Agricultural Research Institute Mtwara, Tanzania, for three seasons. In vitro work involved mixing mildew suspension and botanical extracts. The mixture was placed on slides curvatures and kept in Petri dishes for incubation at (27±1oC). After 24 hours, microscopic observations were made on a number of germinated spores and percentage germination was calculated. In the field, each extract solution was sprayed to eighty cashew panicles at fortnight intervals and assessed for mildew infection. In vitro results revealed that all tested plant extracts had significantly inhibited (p<0.05) spore germination and mycelia growth of the mildew fungus. Mean of field data on disease assessment in three seasons, for both sites, showed that panicles sprayed with Opuntia cactus extracts attained the least mildew infection (27.7%), followed by Opuntia vulgaris (29.6%), Senna occidentalis (35.4%) and Azidarachta indica (39.6%). The results show that these four botanicals significantly (p<0.05) restricted growth and development of cashew powdery mildew disease. However, Morinda morindoides extracts reached the highest mildew infection (49.9%).

Key words: Cashew, botanicals, powdery mildew, spore germination, mycelia growth

Introduction

Cashew powdery mildew disease in Tanzania is controlled by sulphur dust and water-based fungicides. Generally, all these products are very expensive to the extent that farmers most times are not able to acquire them. They are known to pollute the environment besides their continuous use. Due to these environmental and economic considerations, scientists are currently involved in finding cheaper and more environmentally-friendly bio-compounds for the control of plant diseases using different types of botanicals (Mothana and Lindequist, 2005). In the past, several higher plants have proved their usefulness against a number of fungi (Dixit et al., 1983; Sigh et al. 1983).

The systematic search of higher plants for antifungal activity has shown that plant extracts have the ability to inhibit spore germination and mycelia growth in many fungal species (Guerin and


Crop Protection

Reveille, 1984; Natarajan and Lalithakumari, 1987; Sigh and Dwivedi, 1987). Many plant extracts are reported to specifically inhibit the germination of fungal spores (Babu et al., 2001). Use of plant extracts in recent years, particularly neem derivatives, is gaining importance for their antifungal and antibacterial properties (Yin and Cheng, 1998).

Currently, the use of synthetic insecticides in crop protection programmes around the world has resulted in disturbances of the environment, pest resurgences, pest resistance to pesticides and lethal effect to non-target organisms in the agro-ecosystems in addition to direct toxicity to users. Concern about these has led to a surge of research into alternative pest control technologies. Therefore, it has now become necessary to search for alternative means of pest control, which could minimise the use of synthetic pesticides. Botanical pesticides are important alternatives to minimise or replace the use of synthetic pesticides. Botanical pesticides, which contain plant extracts as active components, are safer as well as environmentally-friendlier than synthetic pesticides. Use of these chemicals of plant origin, has attracted particular attention because of their specificity to target pests, their biodegradable nature, and their potential for commercial application.

Bioactivity of plant-based compounds is well documented in literature and is a subject of increasing importance. Knowledge of the toxic plants, their toxic principles and their biological activity is of paramount importance, not only to enable them be utilised as natural pest control agents and replace the commercial synthetic pesticides, but also to enable us understand the nature of their toxicity.

This article reports on work done at Naliendele Agricultural Research Institute (NARI) for three cashew seasons on five selected plant species to evaluate their potential in retarding the growth and development of Oidium anacardii fungus, the pathogen of cashew powdery mildew disease.


Survey to search for potential botanicals was first conducted in Mtwara Rural, Tandahimba, Newala, Masasi and Nanyumbu districts, in Mtwara Region in 2009. The work was extended to Lindi Rural, Ruangwa, Nachingwea and Kilwa districts in Lindi Region in 2010. Further survey was carried out in 2012 in Rufiji and Mkuranga districts in the Coast Region. During the survey group discussions with farmers including influential people with botanical knowledge were conducted. A number of plant species believed to have medicinal properties were presented by farmers. About 100 plants species claimed to be detrimental to insects and types of fungi were picked. These were collected in the form of seeds and cuttings and established at NARI, Mtwara.

In 2012, a potential botanical garden of about one acre was established at NARI and planted with 100 materials collected during the survey conducted in the previous two years. All plant materials used in subsequent experiments were harvested from this garden.


Crop Protection

Five plant species indicated by most farmers during the survey as having antifungal effects were selected for testing against cashew powdery mildew disease, as shown in Table 1.

Table 1: Five tested plant species against cashew powdery mildew disease

S/N Common name (Plant species) Scientific name Family

1 Dorai kalli Morinda morindoides Rubianceae2 Firestick plant Senna occidentalis (L.) Leguminosae3 Neem Plant Azidarachta indica (A.) Meliaceae4 Pricky pears Opuntia cactus Cactaceae5 Brimstone tree Opuntia vulgaris Cactaceae6 Mupafidan (standard chemical fungicide) Triadimenol -

7 Untreated - -

In vitro experiments were conducted in a pathology laboratory at NARI from 3rd September to 17th October 2012. Leaf materials were collected from the botanical garden and surface sterilised with 0.1% sodium hypochlorite and washed to remove sand, dust and chemical contaminants, shade-dried for 5-6 days on a clean concrete platform and then powdered using a wooden pestle and mortar. The extracts were prepared following the method of Rezaul Karim et al. (1992). Each of the five plant extracts was prepared at a concentration of 10% w/v. The resulting solution was stirred continuously for 10 minutes using a clean metal bar and left to stand for 12 hours. Filtration of the plant extracts was done using muslin cloth.

Cashew leaves with natural mildew infection were selected 24 hours before the inoculation date and shaken to dislodge old spores and encourage production of fresh spores overnight. To determine the effect of the plant extracts on conidial germination, conidia of powdery mildew harvested were mixed with sterile water amended with the various plant extracts. The technique of inhibition of spore germination was adopted. A single drop of conidial suspension of O. anacardii was added to sterilised slides, to which a single drop of double the concentration of different plant extracts was added to get the required concentration. Later, a cover slip was placed on the cavity slide. Each control treatment was maintained with distilled water. These sterilised slides were kept in the Petri dishes lined with moist blotting paper and were incubated at room temperature (27±1oC). After 24 hours, ten microscopic fields for each slide were observed and the total number of spores germinated in each microscopic field was recorded. The percentage germination was calculated using a formula given by Vincent (1947).

I = 100(C-T)/C, Where, I = Inhibition percentageC = Growth in control (check)T = Growth in treatment


Crop Protection

Site selection in 2012/2013 season

During 2012/2013 season the experiment was conducted on selected flower panicles on six trees from one of the vegetative propagated cashew blocks at Naliendele Agricultural Institute, Mtwara, Tanzania. The panicles were later labelled for future identification, showing treatment numbers together with the name of the treatment.

Site selection in 2013/2014 and 2014/2015

In these two seasons, botanical trials were conducted at Naliendele Agricultural Research Institute in Mtwara and Mkumba Sub-Station in Nachingwea. At each site, for both seasons, four replications were applied to each of the five botanicals with two trees considered as net plots.

About 500 g of leaf material of the plant botanicals were collected and surface sterilised with 0.1% sodium hypochlorite and washed to remove sand, dust and chemical contaminants. These were later ground and sieved separately. The fine powder obtained from each lot was mixed with 1 litre of water and left for 24 hours to allow the pesticide extraction to take place. After 24 hours, about 500 ml were collected from each of the extract solutions and used for spraying.

At a growth stage 4/5 (panicle emergence stage) of the cashew trees, five panicles from the northern side (with more than 8 hours of sunlight) and southern side (with less than 8 hours of sunlight) of each test tree canopy were tagged with numbered plastic labels from 1 to 10. Numbers 1 to 5 were tagged on the northern side and numbers 6 to 10 on the southern side. A sisal cord of about 1m long was left hanging down a branch with a label for easy spotting of the tagged panicles.

In the first year of the experiment (2012/2013), extract solutions were sprayed on the ten panicles of the respective cashew trees with water sprayed on the control panicles. This exercise was repeated once in a week for seven weeks. During the second and third years of the experiment (2013/2014 and 2014/2015) selected panicles were sprayed at two-week intervals for five rounds. A one litre hand sprayer was used for spraying.

Each tagged panicle was assessed for mildew infection at two-week intervals. During disease assessment, the percent of flowers and flower buds affected by mildew was estimated using the 0 – 6 disease severity key (Nathaniels, 1996). Scoring was done on the four lower most laterals of a panicle.

Mildew data for each day was compiled in a frequency table of scores occurring in each class. For each class, the percent range midpoint was multiplied by the frequency of the observation units scored in that class. The sum of the products from each class was then divided by the total number of observation units scored in a sample to obtain the mean percent mildew infection per unit of observation (Anonymous, 1998).

Mildew progress curves were constructed for each treatment for comparisons between treatments and the control. Data was subjected to one-way analysis of variance (ANOVA) while differences in treatment means were separated by Student Newman Keul’s (SNK) test at 5% level of significance. All statistical analyses were done by SPSS Version 17.0 for Windows.


Crop Protection


In vitro

In vitro results indicated that all plant extracts had significantly inhibited spore germination of Oidium anacardii (Figure 1).

Figure 1: Percentage spore germination inhibited by different plant extracts

Key: Mwarobaini (Aziradachta indica), Kimbinga (Morinda morindoides), Lipangati (Opuntia cactus), Kibamba (Opuntia vulgaris), Mnyaa (Senna occidentalis)

The results indicated that the five plant extracts significantly (p<0.05) inhibited spore germination of O. anacardii. The tested botanical extracts showed varied degrees of inhibition over control in spore germination of the fungus pathogen. The maximum inhibition of Oidium spore germination was recorded for Azidarachta indica with 64% germination. This was followed by Opuntia vulgaris with 56%, Opuntia cactus (50%), Senna occidentalis (46%) and Morinda morindoides (15%).

Plates 1a to 1c compare mildew growth on (a) control slides and (b) & (c) slides treated with plant extracts. As noted, most of the O. anacardii spores on the untreated slides germinated and formed a number of primary and secondary hyphae. For the slides treated with Azidarachta indica and Opuntia vulgaris extracts, few spores germinated and few germ tubes with reduced primary hyphal formed.


Crop Protection

a b c

Plate 1: Germination of spores. (a) Germinating spores with primary and secondary hyphal growth as observed on control slides; (b) Restricted spore germination as observed on a slide treated with Azidarachta indica extracts; (c) Restricted spore germination and poor hyphal growth as observed on a slide treated with Opuntia vulgaris extracts.

The study showed that extracts from different plants varied in their effect on the germination of O. anarcadii. The most promising plant extract against O. anarcadii spore germination were from Azidarachta indica. Azidarachta indica inhibiting growth of A. alternate, Bipolaries sorokiniana and several other fungi have been reported (Singh and Dwivedi, 1987).

The present in vitro studies conducted on five potential botanicals showed inhibition of spore germination of O. anacardii. Possibly, the inhibitory effect of the plant extracts on spore germination of O. anacardii might be attributed to the presence of some partially effective antifungal ingredients. The inhibitory effect of the plant extracts has been clearly illustrated in Plate 1(b) for Azidarachta indica and Plate 1(c) for Morinda morindoides, compared to Plate 1(a) the control. In Plate 1(a) where no extract solution was applied, most spores had germinated producing an aggregate of hyphal strands. Usually the fungal mycelia produce appressoria, which get attached to the host surface. From the appresorium, haustorium (a hyphal branch) is produced which penetrates the host cells of the plant to obtain nutrients. Most spores (Plate 1 [b]) on slides to which Azidarachta indica extract was applied were inhibited from germination, except very few formed germ tubes. For slides that Opuntia vulgaris extract was used (Plate 1c), some mildew spores had germinated with less secondary hyphae formation compared to the control (Plate 1[a]).

The results of the present in vitro investigation show that spores germination of Oidium anacardii were restricted by extract solution of Azidarachta indica, suggesting the presence of antifungal substances in the plant tissue. Similar results were reported by other scientists on different pathogens and plants (Qasem et al., 1996; Amadioha, 2003). The results obtained were in conformity with the results obtained by Rettinassababady et al, (2000) who had reported that the leaf extract of Azidarachta indica (neem) was effective against the control of powdery mildew of black gram.


Crop Protection

Field studies in 2012/2013

Field results on mildew assessment for 2012/2013 season are presented in Figure 2. The results show that all tested plant extracts suppressed the development of the disease. It was further observed that panicles sprayed with Neem plant (Azidarachta indica) extracts had the least mildew infection level (31.5%), followed by Dorai kalli (Opuntia vulgaris) (35.5%), Firestick plant (Senna occidentalis) (36.5%) and Pricky pears (Opuntia cactus) (41.8%). Brimstone tree (Morinda morindoides) attained the highest mildew infection (80.8%).

Figure 2: Powdery mildew progress curves as observed on panicles treated with different plant extracts during 2012/2013 season

Field studies in 2013/2014 and 2014/2015

Figures 3(a) to 3(d) present mildew progress curves on panicles treated with the tested botanicals for Naliendele and Mkumba, in 2013/2014 and 2014/2015 seasons. Results indicate that for both seasons, mildew pressure was very high and quite appropriate for screening botanicals. Mildew progress curves were sigmoid, typical of normal mildew development on test plots, signifying that optimum conditions for mildew development were attained. There were clear variations in mildew infection in both seasons across the two sites. In general, the results show that all plant extracts suppressed growth and development of the mildew fungus.

During 2013/2014, it was observed that panicles sprayed with Opuntia vulgaris extracts had the least mildew infection levels of 17.5% at Naliendele, and 19.7% at Mkumba (Figure 3a and 3b). This was followed by Opuntia cactus and Senna occidentalis, which had scored less than 30% while Azidarachta indica and Morinda morindoides scored above 30% infection levels across the two sites.

Infection levels of powdery mildew scored in the final round of 2014/2015 were higher compared to the previous seasons. The least infection levels were 44.4% and 50.2% recorded on panicles treated with Opuntia cactus at Naliendele and Mkumba sites, respectively. Again,


Crop Protection

extracts of Morinda morindoides attained the highest mildew infection level of 65.8% at Naliendele site in the final round of mildew assessment. Scores for other tested botanicals ranged from 46.1% to 56.1% for Naliendele, and from 58.4% to 71.6% for Mkumba sites.

a

c

b

d

Figure 3: Powdery mildew progress curves as observed on panicles treated with different plant extracts at the two site. (a) Naliendele in 2013/2014, (b) Mkumba in 2013/14, (c) Naliendele 2014/15, and (d) Mkumba 2014/15.

Table 2: Percent mildew infection and nut counts recorded from different plots treated with botanical extracts against cashew powdery mildew disease 2013/14 and 2014/15

Treatments

% Mildew infection 2013/14

% Mildew infection 2014/15

Nut counts Gs 8/9 2014/15

Mean rank

Overall rank

Nal Mk Nal Mk Nal MkMupafidan 2.6a1 9.8a1 0.3a1 4.9a1 122.8a1 94.0a1 1 1Opuntia cactus 16.0ab2 27.1ab4 3.4b2 36.8b2 85.5ab2 60.5ab2 2.7 2

Opuntia vulgaris 17.5ab3 19.7ab2 4.3b3 51.3b5 19.0c6 21.8cd6 3.1 3

Senna occidentalis 24.6abc4 20.8ab3 23.6b4 52.8b6 46.5bc5 34.3d4 4.1 4

Azidarachta indica 30.9bc5 50.6b6 35.6b5 48.9b3 46.0bc3 30.3bcd5 4.5 5

Morinda morindoides 47.2c6 45.1b5 42.0b6 49.9b4 47.8bc3 46.0bc3 4.5 5

Untreated (Control) 81.8d7 95.9c7 99.6c7 100.0c7 18.0c7 8.8d7 7 6

Mean 31.5 38.4 38.2 49.2 55.1 42.2CV% 46.7 52.2 35.1 38.6 56.6 54.0

*Means with the same letter down the column are not significantly different (p<0.05).


Crop Protection

Table 2 presents ANOVA results from data collected during the peak of mildew infections for 2013/2014 and 2014/2015 seasons at both sites. The results show that there were clear and significant differences (P <0.05) between plots treated with botanical extracts and untreated ones. This indicates the high potential of these botanicals in suppressing mildew growth. However, the results revealed that there were no significant differences (P<0.05) in infection levels among the treatments of botanical extracts across both sites.

Mupafidan fungicide (triadimenol) used in this experiment as a ‘standard or check’ against mildew ranked the highest across the sites. Considering the tested botanical extracts on their performance in mildew control, Opuntia vulgaris, ranked second after Mupafidan. This was followed by Opuntia cactus and Senna occidentalis. Morinda morindoides and Azidaracthta indica took the fifth position at both sites.

Conclusion

This work on botanicals has shown that extracts from all five tested plant species were able to suppress growth and development of Oidium anacardii, the pathogen of powdery mildew disease on cashew. However, it was found that the ability to retard the growth and development of the fungus varied among the extracts. The overall ranking on the efficacy performance of the extracts indicated that Opuntia cactus took the first position followed by Opuntia vulgaris, Senna occidentalis and Azidarachta indica. Morinda morindoides appeared to have the least potential in restricting powdery mildew growth on cashew tissues.

It can be concluded from the investigation that these plant extracts appear to be potential substitutes to the management of pathogenic fungi compared to fungicides that are not environmentally friendly. Further work to establish the active ingredients contained in these potential botanicals is to be undertaken in the near future.

Acknowledgements

We thank the Cashew Research Programme for the financial support. We wish to thank farmers we visited in Mtwara and Lindi regions, who helped us to identify the potential botanicals and provide the planting materials. We also record our appreciation to Betram Barnabas, Mahmoud Ponera, Abilahi Warambo and the late Beatus James for the collection, establishment and maintenance of the materials.

References

Amadioha, A. C. (2003). Fungitoxic effects of extracts of Azadirachta indica against Cochliobolus miyabeanus causing Brown Spot Disease of Rice. Acta. Phytopath. Pflanz. (Taylor & Francis), 35: 37- 42.

Anonymous, (1997/98, 2000/01, 2002/03). Cashew research programme annual reports. Naliendele Agricultural Research Institute, Mtwara, Tanzania.


Crop Protection

Babu, B. H., Shylesh, B. S., and J. Padikkala, (2001). Antioxidant and hepatoprotective effect of Acanthus iliciofilus. Fitoterapia, 72, 272-277.

Dixit, S. N., Dubey, N. K., and, N. N. Tripathi (1983). Fungicidal spectrum of the leaf extract of Allium sativum. Indian Phytopath, 29, 448-449.

Guerin, J. C., and H. P. Reveille (1984). Antifungal activity of plant extracts used in therapy .I. Study of 41 plant extracts against 9 fungi species. Annales Pharmaceutiques Francaises 42, 553-59.

Mothana, R. A. A., and U. Lindequist (2005). Antimicrobial activity of some medicinal plants of the island Soqotra. J. Ethnopharmacol, 96, 177-181.

Natarajan, M. R., and D. Lalithakumari (1987). Antifungal activity of the leaf extracts of Lawsonia inermis on Drechslera oryzae. Indian Phytopathology, 40, 390-95.

Nathaniels, N. Q. R. (1996). Methods including visual keys for cashew powdery mildew (Oidium anacardii Noack) severity. International Journal for Pest Management, 42(3), 199-205.

Qasem, J. R., and H. A. Abu-Blam (1996). Fungicidal activity of some common weed extracts against different plant pathogenic fungi. Journal of Phytopathology, 144, 157-161.

Rettinassababady, C., Ramadoss, N., and S. Thirwneni (2000). Effect of plant extract in the control of powdery mildew of blackgram. Agric. Sci. Digest, 20(3), 193-194.

Rezaul, K., Chowdhury, A. N. M., and M. Hoque (1992). Current research on neem in rice in Bangladesh. In Asian Development Bank (1992) Botanical pest control project phase. Proceedings of the IRRI ADB final workshop on Botanical Pest Control. Asian Development Bank IRRI.

Singh Y, Tripathi RD, Tripathi NN and Dixit SN. (1983). The isolation and properties of fungi toxic principle from Zingiber officinale. Indian J. Plant. Pathol. 1: 89-96.

Singh, R. K., and R. S. Dwivedi (1987). Effect of oils on Sclerotium rolfsii causing foot-rot of barley. Indian Phytopathology, 40, 531-33.

Vincent, J. H. (1947). Distortion of fungal hyphae in the presence of certain inhibitors. Nature 15: 850.

Yin, M. C., and W. S. Cheng (1998). Inhibition of Aspergillus niger and Aspergillus flavus by some herbs and spices. Journal of food Protection, 1998; 61:123-125.


Crop Protection

VALUE ADDITION AND POST HARVEST

TECHNOLOGIES



Technological and Commercial Options for the Economic Utilisation of the Cashew Apple

J. Mathew1*, A. Sobhana2 and C. Mini3

1 Kerala Agricultural University (KAU) Rtd, Madona, Mannuthy 680 651, Kerala, India,2Cashew Research Station, KAU, Madakkathara 680651, India

3Dept of Processing Technology, College of Agriculture, KAU, Thiruvananthapuram 695522, India


Abstract

Research studies as well as experiences in running India’s first commercial cashew apple processing unit have convincingly demonstrated that the cashew apple, which weighs eight to ten times that of the nut, is a very valuable produce. Despite this fact, the cashew apple is almost totally wasted now globally, without significant commercial exploitation leading to huge economic loss to the farmers and the concerned nations. Technological advancements have succeeded in making the fruits amenable for processing by overcoming several constraints associated with the processing. This makes possible the production of several value-added food products from the cashew apple including beverages (fresh and fermented), pulp, culinary and canned products, confectioneries, neutraceuticals and other agricultural and industrial products. To facilitate commercialisation, the technologies developed by our research team at the Cashew Research Station, Madakkathara under Kerala Agricultural University have been employed for the production of eight products on a commercial scale at the station, with good consumer acceptability. Economics of the commercial venture indicated significant enhancement in income to the cashew farmers. An overview of the technological and commercial possibilities for the economic utilisation of the cashew apple including its offseason storage, production of value-added products, and attempts for commercialisation and technology transfer, are presented in this article.

Key words: Cashew apple processing, technological options, commercialisation

Introduction

Cashew is primarily cultivated for its valuable nut, fetching high income to farmers. However, another valuable produce from cashew, i.e. cashew apple, is totally neglected without any economic utilisation, may be due to the more attractive value for the nut. The scenario is the same in most of the cashew growing countries, except for a few cases. The production of cashew apples in India alone is estimated to be around six million tons per annum, considering that the cashew apple weighs 8-10 times that of the nut, which is almost completely wasted now, without any commercial exploitation, leading to huge economic loss to the farmers and the nation. By effective utilisation of the cashew apple in a commercial scale, the farmers can be assured of increased income, in addition to the income from the nut, which definitely will encourage them to take up cashew cultivation with renewed interest.



The cashew apple has some innate disadvantages posing serious restrictions in its processing. The utility of the cashew apple is limited because of its high susceptibility to physical injury, as they have very thin skin. This leads to very poor storability of the fruit and complete spoilage can occur within hours after harvest. The presence of astringent and acrid principles in the cashew apple is another major drawback of the fruit for commercial processing and utilisation. They produce a rough, unpleasant and biting sensation on the tongue and throat. Removal of tannin is therefore a must before the product is processed. The seasonal production of cashew apple is one of the greatest handicaps for the processing industry. The fragmented and scattered nature of cashew plantations also creates problems in collection and utilisation of cashew apples. Since they are soft and delicate, when cashew apples are stacked in thick layers, the lower ones burst because of weight and lose juice, causing problems in transportation.

With this background, the Cashew Research Station, Madakkathara, under the Kerala Agricultural University (KAU), India has done pioneering work on the development of technologies for cashew apple processing and its commercialisation. The commercial possibilities for the economic utilisation of the cashew apple including the techniques for overcoming the limitations associated with the fruit, its offseason storage, development of value-added products and attempts for its commercialisation were carried out by the research station. This article mainly presents the highlights of these studies as well as the outcome of the attempts for commercialisation of the developed technologies. The review of works conducted on cashew apple processing elsewhere in India has also been included in this article.


Research efforts were taken up by the Cashew Research Station, Madakkathara, India under the following four projects to develop technologies for the economic utilisation of cashew apple;

i) Establishment of cashew apple processing unit at Madakkathara (Rashtriya Krishi Vikas Yojana (RKVY) Project);

ii) Transfer, demonstration and refinement technologies for cashew apple processing (National Horticulture Mission Project);

iii) Refinement, commercialisation and promotion of value added products from cashew apple (RKVY Project); and

iv) Revolving Fund Project (KAU) on cashew apple processing.

Our research work succeeded in making the cashew apple amenable for processing by overcoming several constraints associated with the processing of the fruit. Subsequent studies have succeeded in developing technologies for the production of several value-added food products from the apple.

The centre has commercially employed the technologies developed by it under the above research projects for the manufacturing of various products to demonstrate the techno-economic feasibility of the newly developed cashew apple processing technologies and to assess the market response. The centre runs the first and only cashew apple processing unit in India, profitably run by a public organisation,



which also serves as a model frontline demonstration unit for entrepreneurs, demonstrating the infrastructural requirements for starting a cashew apple processing unit and convincing the new entrepreneurs regarding the profitability and marketability of the products.


Development of technologies for overcoming the limitations in cashew apple processing

Concerted research efforts at different research institutions have now led to the development of several effective technologies for the storage of juice and pulp for off-season processing and removal of astringency. The Cashew Research Station, Madakkathara under Kerala Agricultural University have developed the following technologies for the off season storage of juice, pulp and green pieces of cashew apple.

Off-season storage of cashew apple

Studies conducted at Madakkathara have led to the development of very effective technologies for the storage of cashew apple juice and pulp for off-season processing. Juice, after clarification with 2.5 g KMS, 5.0 g citric acid and 5.0 g sago per litre, can be stored in well sterilised, air tight, food grade plastic barrels even up to one year. In respect of pulp, steam de-tanned cashew apple, is made into pulp, mixed with 2.5 g KMS and 5 g citric acid with every kg of pulp and stored in air tight glass bottles. The de-tanned green mature fruit pieces can be stored in glass bottles for pickle preparation after adding 200 g salt per kg of piece in alternate layers.

Removal of astringency

The presence of tannin interferes with the taste of the apple and the processed products from it. Removal of tannin is a must before preparation of products. Clarification (removal of tannin) can be done by using gelatin, calcium hydroxide, pectin and polyinyl pyrrolidone (PVP), but excess gelatin imparts a disagreeable odour and high dose of calcium hydroxide turns the cashew apple juice reddish-black, giving a bitter taste. Steaming of the cashew apple for 5 to 15 minutes and subsequent washing or treatment of the fruit for four to five minutes in a boiling solution of common salt (2%) or sulphuric acid (0.2 N), followed by washing in water can to remove the undesirable tannin. Madakkathara station has developed the following effective, low cost and organic technologies for the removal of tannin from juice and ripe and mature apples (Mathew et al., 2010) and it is being employed commercially.

i) Clarification of juice: Add powdered and cooked sago @ 5g/ litre of juice, keep for 12 hours and decant the upper layer of clear juice.

ii) De-tanning of whole ripe cashew apple: Dipping in 5 % salt solution for 3 days, changing water every day.

iii) De-tanning from green mature cashew apple pieces: Immersing the cut pieces in 8 % salt solution for three days, with the change of the salt solution daily.



Development of technologies for the value addition of cashew apple

Economic and effective technologies have been developed for the production of several value-added products from the cashew apple with high consumer acceptance, which broadly include fresh apple beverages (including blended beverages), fermented beverages, pulp products, confectioneries, culinary products and products for agricultural uses.

Consumption as fresh fruit

In several countries, the cashew apple is consumed raw as fresh fruit. A study was conducted at Madakkathara, India to identify the best varieties for fresh consumption. Based on the organoleptic and quality analysis of 16 varieties, it was found that Dhana, MDK 1, VRI 3, Amrutha and KGN-1 were the best varieties to use as table fruit (Sobhana et al., 2011a). Poduval and Tarai (2007) reported that V6, V4, M-33/3, Dhana, Kanaka and Madakkathara, are the best varieties for their cashew apple qualities in the red and laterite zone of West Bengal. A niche market for the cashew apple for direct consumption can be located at least in major towns. We have attempted selling fresh cashew apples, along with nuts, in pouches through university sales counter at Mannuthy, Kerala and there was good response.

Production of fresh beverages

Fresh beverages produced from unfermented cashew apple juice include clarified and cloudy juice, juice concentrate, syrup, squash and ready- to-serve. These beverages are made in countries like Brazil and India by adding varying concentrations of sugar, citric acid and preservative. The Kerala Agricultural University, India has standardised the technique for the preparation of juice, syrup and ready to serve drink. Sobhana et al. (2011 b, c) reported that cashew apple juice blended with suitable vegetables (gooseberry, carrot) and fruit juices (pineapple, passion fruit) has better acceptability and nutrient quality.

Production of fermented beverages

Wine, vinegar, liquor and alcohol are products prepared from cashew apple juice after fermentation. Kerala Agricultural University has developed methods for producing four grades of wine such as soft, medium, hard and sweet, based on the alcohol percentage and sweetness. Wine is made by subjecting de-tanned cashew apple juice to fermentation, filtration and ageing. Wine preparation, except for soft wine, involves one more step of adding sugar. The cashew apple, mixed with sugar and lukewarm water in 1:1:1 ratio along with a starter solution, spices and preservatives, produced quality wine which was comparable with grape wine (Mini et al., 2012).

Cashew apple vinegar can be prepared by alcoholic and subsequent acetic fermentation of juice, which is perhaps the oldest known fermentation product. The Cashew Research Station, Madakkathara has standardised the technique for the preparation of vinegar from cashew apple and is manufacturing it on a commercial scale.



Pure cashew apple juice is exclusively distilled without addition of any extraneous matter to make cashew liquor. Kerala Agricultural University has standardised the method of producing four different grades of liquor from the cashew apple. In Goa, large quantities of cashew apples are utilised for the preparation of liquor called feni. Feni is primarily considered country liquor, and it has a strong fruity flavour, peculiar taste, strong aroma and astringent smell. It is prepared by distillation mostly through crude methods. It has been registered as the first Geographical Indication (GI) product from cashew (Elsy et al., 2009). The production of feni enables farmers to fetch substantial income from the cashew apple, even equal to that from the nuts.

Value addition of cashew apple pulp

Jam, fruit bar, leather and fruit wafers are value-added pulp products from the cashew apple. Cashew apple jam or mixed fruit jam are made by boiling cashew fruit pulp alone or mixed with equal quantity of banana pulp or pineapple pulp with sufficient quantity of sugar and a pinch of citric acid, to a reasonably thick consistency. Mini et al. (2007) reported that the cashew apple can be mixed with pineapple, mango or a combination of mango, pineapple and apple in 50:50 ratios for preparation of jam, for increased acceptability.

Other food products

Candied fruit, tutty fruity and toffee are some of the confectionary products that can be prepared from the cashew apple. Cashew apple juice can be used for preparing frozen deserts and dairy confectionery items by optimisation of juice concentration and spray drying. Dehydrated powder is used to prepare dehydrated cashew apple products. 10 to 30% dehydrated cashew apple powder can be used in various value added products like wheat laddu, masala biscuits, sweet and masala doughnuts, sponge cake, steamed kabadu, tomato cashew apple powder soup, powder koftas, chocolates, sweet and hot bread products and cashew apple blended chocolates. The recipe for cashew apple chocolate with improved appearance, flavour, taste, sweetness and overall acceptability was reported by Sobhana et al. (2011d). Mini et al. (2015) developed a value added product from the cashew apple using an osmotic dehydration technology.

Both unripe and ripe cashew apples have traditionally been used for culinary purposes. Madakkathara Centre has developed the recipe for the preparation of pickle and chutney using sliced raw green fruit and various ingredients. Canned cashew apple and canned curried vegetables from raw green fruit of cashew have also been reported.

Uses in integrated farming system

Cashew apple/cashew apple residue can be used for various purposes in an integrated farming system since it contains (on dry weight basis) nutrients such as total ash 1.6%, total tannin 5.2%, ether extractives 4.6%, calcium 20.6 mg/100g, phosphorous 152.7 mg/100g, proteins 8.8%, crude fibre 8.4% and iron 35.0 mg/100g in appreciable amounts. The cashew apple waste can be successfully used to produce vermicompost, using Eudrilus euginae, with nutrient content of 1.69% N, 0.44% P and 0.58% K.



Animal feeds such as cattle feed, pig feed and poultry feed can be prepared using ripened cashew apples or their residue. Cashew apple pomace, which is available after extracting juice from cashew apples is rich in fibre, and could be blended with cereals (ragi, rice and wheat) and pulses (green gram) up to 10% without affecting the quality in terms of in vitro digestibility of both proteins and carbohydrates. Cashew apple pomace-based blends could be stored up to one year without affecting quality (Bhat et al, 2009). Cashew apple residue after fermentation could be blended up to 20% to prepare animal or poultry feed, without any adverse effect on milk yield. Swain et al. (2007) reported that cashew apple waste could replace up to 20% maize on w/w basis in the diet of Vanaraja growing chicks for better economics without affecting the overall economics.

Production of bio fuel

Utilisation of non-food crops such as the cashew apple as a source for bio-fuel production has great significance in today’s world where we are facing huge energy crisis. Use of the cashew apple particularly avoids food security problems instead of using food crops for bio-fuel production. In addition to varying quantities of fats, minerals and vitamins, a fresh cashew apple contains 9.5 to 10 % carbohydrates. It is estimated that the cashew apple can yield 8 to 10 % of ethanol. Apples obtained from the harvest of every kilo gram of raw nut can produce 500 to 600 ml of ethanol of about 70% purity pointing out the immense scope of producing ethanol from cashew apple.. If the cashew apple can be productively used, it will not only provide a rich source of environmentally friendly bio-fuel, but also revolutionise the economics of the cashew producing industry. The technology for extracting ethanol from the cashew apple has been standardised by CEPC Laboratory, Kollam, India and the same can be utilised for bio-ethanol production. However, further research is needed to evolve efficient technology for getting a better recovery of ethanol from the cashew apple.

Commercialisation of cashew apple processing technologies

The technologies developed at the Cashew Research Station, Madakkathara has been employed for commercial production of eight promising value-added products from cashew apple. The products are cashew apple syrup, cashew apple drink, cashew apple soda, mixed cashew apple - mango jam, cashew apple pickle, cashew apple candy, cashew apple chocolate and cashew apple vinegar. This is specifically done to demonstrate the commercial viability of the newly developed technologies and consumer acceptance of the new products; all the products were well received by the consumers.

Cashew apple processing technologies – economics and popularization

The production of cashew nut in the India is estimated at 0.61 Mt. On an average, the cashew apple weighs 8 to 10 times that of cashew nut. At that rate, the total production of cashew apples in the country is estimated to be around 6.0 Mt. At least a minimum of 30% of the total quantity can be economically utilised for production of value-added products, working out to 1.8 Mt. Based on our study, a net profit of $160 can be obtained by the processing of one tone of cashew apple (Mini et al., 2006). Thus the total national income that can be obtained through cashew apple processing is



estimated to be around $ 288 m. This is a significant contribution to the national economy. Thus, cashew apple processing can promote considerable economic activity in cashew growing countries, leading to substantial employment generation and added income to farmers, making cashew cultivation more attractive.

The production of the newly developed value-added products from the cashew apple has been commercially undertaken at the processing unit at Madakkathara which functions as a model processing unit for demonstrating the infrastructural requirements for starting a new cashew apple processing unit, and convincing the new entrepreneurs regarding the profitability and marketability of the products. This has promoted the establishment of new cashew apple processing units under public and private sectors.

Conclusions, recommendations and implications

Commercial exploitation of the cashew apple has not progressed to the desired level in spiteof excellent qualities of cashew apple and the availability of technologies for its processing to various value-added products. The successful running of the commercial cashew apple processing unit for several years at Madakkathara, India under Kerala Agricultural University has clearly demonstrated the economic viability of cashew apple processing. Additional income from cashew apple processing will make cashew cultivation more attractive to farmers.

Processing of the cashew apple is an economically viable enterprise in cashew growing tracts. Women self-help groups can very well take up this enterprise, thereby effectively contributing to the cause of women empowerment. If legal permission is available for production of fermented products like liquor and wine, it can substantially enhance income from cashew apple processing many folds. T h e increasing preferences for natural products over synthetics are to be given emphasis while marketing cashew apple products. High content of vitamin C and medicinal properties of the cashew apple are added advantages to be popularised for the marketing of cashew apple products.

Considering the vast potential of cashew apple processing, it is being suggested that a multi-country network project should be started to take up intensive research on various aspects of cashew apple processing, including development of novel products, extending storage life of developed products, packaging studies, exploitation of neutraceutical and medicinal properties and bio fuel potential, utilisation as livestock/poultry feed. The activities of the network project should also include the establishment of commercial units on cashew apple processing to serve as front line demonstration units and to conduct intensive transfer of technology programmes and promotional campaigns, including market promotion.

Acknowledgements

The authors are grateful to the Kerala Agricultural University, Rashtriya Krishi Vikas Yojana (RKVY) and the National Horticulture Mission (NHM), for funding the programme and providing facilities.



References

Bhat, M. G., Yadukumar, N., Nagaraj, K. V., and M. G. Nayak (2009). Current status of cashew research and technology in India. Proceedings of the 7th National Seminar on Cashew Development in India- Enhancement of Production and Productivity, Bhubaneswar, 2-3 Nov. 2009, 12.

Elsy, C. R., Jose Mathew and S. Arun (2009). Protection of geographical indication of cashew products for enhancing market potential. Proceedings of the 7th National Seminar on Cashew Development in India - Enhancement of Production and Productivity, Bhubaneswar, 2-3, Nov. 2009, 79-81.

Mathew, J., Mini, C., and A. Sobhana (2010). Development and dissemination of technologies for cashew apple processing. Abstracts, 19th Biennial Symposium on plantation crops, 7-10 December 2011, RRII, Kottayam, 198-199.

Mini, C., Archana, A. S., and P. R. Geethalaxmi (2015). Osmo dehydration - A new technology for value addition of cashew apple. Kalpadhenu 35(1), 45-48..

Mini, C., and Jose Mathew (2007). Multi-uses of the cashew apple. Proceedings of the 6th National Seminar on Indian Cashew in the Next Decade - Challenges and Opportunities, 18- 19 May 2007, Raipur, 45-52.

Mini, C., Jose Mathew, Augustine, A., and M. S. Sheeba (2012). Home scale preparation of wine from cashew apple. The cashew and cocoa journal 1(1), 34-36

Mini, C., Jose Mathew, and K. J. Thomas (2006). Economic potential of cashew apple processing. Cashew Bulletin XLIV(6), 5-8

Poduval, V., and R. K. Tarai (2007). Cashew varieties suitable for the cashew apple industry. Souvenir and extended summaries, National Seminar on Research, development and marketing of cashew, 20-21 Nov. 2007, Goa,102-103

Sobhana, A., Jose Mathew, Ambily Appukkuttan, and C. Mridhula Raghavan (2011a). Varietal influence on the organoleptic and nutritional properties of cashew apple for fresh consumption. Book of Abstracts, 21st Swadeshi Science Congress, 7 – 9 November 2011, Kollam, 85.

Sobhana, A., Jose Mathew, Ambily Appukkuttan, and C. Mridhula Raghavan (2011b). Blending of cashew apple juice with vegetables and spices for improving palatability and quality. Book of Abstracts, 21st Swadeshi Science Congress, 7 – 9 November 2011, Kollam, 91.

Sobhana, A., Jose Mathew, Ambily Appukuttan, A., and C. Mridula Raghavan (2011c). Blending of cashew apple juice with fruit juices and spices for improving nutritional quality and palatability. Proceedings of the First International Symposium on Cashew nut, AC & RI, Madurai, 9-12 December 2011, 128.

Sobhana, A., Jose Mathew, Ambily Appukuttan, A., and C. Mridulla Raghavan (2011d). Development of value added products from cashew apple powder. Proceedings of the First International Symposium on Cashew nut, AC & RI, Madurai, 9 -12 December 2011, 125

Swain, B. K., Barbuddha, S. B., and E. B. Chakukar (2007). Replacement of maize with cashew apple waste on the performance of Vanaraja growing chicks. Souvenir and Extended summaries, National seminar on Research development and marketing of cashew, 20-21 Nov.2007, Goa, 102.



The Role of Warehouse Receipt System in Cashew nut Marketing in Tanzania

M. MalegesiCashewnut Board of Tanzania


E-mail of the corresponding author: [email protected]

Abstract

The Warehouse Receipt System (WRS) in Tanzania was introduced as a direct outcome of farmers’ problems. It was started in September 2000 as a pilot project to two main cash crops - cotton and coffee. In 2007/08, the government introduced WRS for cashew nut marketing where cashew nut farmers were mandated to sell through primary cooperatives. The key players of WRS in Tanzania include farmers, primary societies, banks, unions, licensed warehouse operators, regulatory bodies and buyers (exporter or processor). The importance of WRS include the following: farmers sell their raw cashew nut at competitive prices, establishment of a good method for cashewnut data collection, expansion of cashewnut growing districts, and access to funds and stable market infrastructure. Apart from the benefits and achievements brought by the WRS to the cashew industry in Tanzania, there are some challenges facing the sub-sector, e.g. unfamiliarity with the functions of WRS to some of the stakeholders, poor flow of marketing information to farmers, and lack of understanding of indicative prices.

Key words: warehouse receipt system, cashew, primary societies

Introduction

The Warehouse Receipt System (WRS) in Tanzania was introduced as a direct outcome of cashew farmers’ problems. The system started in September 2000 as a pilot project to two main cash crops (cotton and coffee). The project was funded by the Common Fund for Commodities (CFC) and the Government of Tanzania. The Natural Resource Institute (NRI) of the United Kingdom provided technical support to the local management of the project. The project was governed by the National Advisory Committee (NAC) composed of representatives from the government, and coffee and cotton sub-sectors. The NAC has a mandate to look at all matters related to the development of the WRS in Tanzania to ensure that the developed model conforms to the government policy of poverty reduction strategies (MAFSC, 2008).

In 2007/08, the Government of Tanzania introduced WRS for cashew nut marketing whereby cashew nut farmers were mandated to sell through primary cooperatives. The WRS started in phases. In 2007/08, the system started in Mtwara Region and in Lindi in 2008/2009. In the Coast Region the WRS was introduced in 2009/2010 after good achievements attained in Mtwara and Lindi Regions.

Prior to the introduction of WRS, cashew nuts were sold through open markets. Under the open market, traders purchased cashew nut directly from farmers by using indicative prices, which were



announced by the government. Under open markets, farmers were paid either the indicative price or less. Usually, traders were using wrong measurements such as “kangomba” through which farmers were giving more nuts than the recorded weights. During the open market system there were several problems facing the cashew nut sub sector till 2007 when the government decided to introduce WRS. WRS is a system that puts a legal mechanism in place that enables farmers to pool their produce together for the purpose of selling the produce at both local and international markets. Under this system, farmers can use their produce as collateral for taking loans from financial institutions such as banks instead of using fixed collateral such as houses and farms in order to apply for loans. The loans can be used by farmers to solve their family problems while waiting for their produce to be sold. WRS is established under Act No. 10 of 2005 and its regulations of 2006.

Model of WRS in Tanzania

A Warehouse Receipt (WR) is a document in hard or soft form issued by warehouse operators as evidence that specified commodities of stated quantity and quality have been deposited at a particular location by a named depositor (TWLB, 2013). The receipt may be transferable, allowing transfer to a new holder or a lender or a trade counter-party which entitles the holder to take delivery of the commodity upon presentation of the WR at the warehouse.

The WR contains information about the location of the warehouse where goods are stored; the date of issue of the receipt; the serial number of the receipt; a statement whether the goods received will be delivered to the bearer or to a specified person’s order; a short description of the goods or of the packages containing them; the registered signature of the authorised warehouse operator; the nature and fact of ownership of the goods, whether solely or jointly or commonly owned with others; and a statement as to the amount of advances made and of liabilities incurred (URT, 2005). According to Mark (2000) there are four types of WR namely negotiable WR, non-negotiable WR, collateral WR, and trust WR.

Tanzania’s model has been derived from the models that exist in the World in order to suite the country’s business environment. The considerations during modification include availability of warehouses which are adequately licensed; depositors who have tradable commodities which meet standards; and their being agricultural financiers (banks) and buyers of the deposited commodities (MAFSC, 2008).

In short the key players of WRS in Tanzania include farmers, primary societies, banks, unions, licensed warehouse operators, regulatory bodies and buyers (exporter or processor). The operations and responsibilities of each are indicated below.

Farmer

Farmers harvest the raw cashew nuts, dry and send them to the primary society located at their village or street. At this point a farmer is paid either 60% of the final indicative price, and given a receipt indicating the quantity of cashew nuts delivered to his/her society.



Primary society

The main functions of the primary society include to:

· open an account at the bank that operates under the Warehouse Receipt System;

· deposit cashew nuts at the licensed warehouse and in turn get issued with a WR (these receipts are the warrants for the loan); and

· borrow against the deposited cashew nuts and pay that money to the farmers.

Warehouse operator

The duties of the warehouse operator are to:

· receive cashew nuts from the primary society while in grades and store it without loss in quality and quantity in bags and weights;

· verify the quality and quantity of cashew nuts received from the primary society in his/her presence and record the results;

· submit the data of cashew nuts received to the regulatory body and cooperative union, on a daily and weekly basis.

Cooperative Union

The responsibilities of the cooperative union are to:

· prepare sales catalogue with the help of the warehouse operator;

· link primary societies to regulatory bodies; and

· prepare an invoice and issue the same to the buyer.

Buyers

The buyers are mandated to:

· buy the cashew nuts based on the sales catalogue;

· pay the money to the bank according to the agreed price and quantity; and

· collect cashew nuts from the warehouse operator after the submission of a release warrant from the bank.

Banks

Banks have the duty to:

· receive the money from the buyer according to the commercial invoice from the cooperative union;

· provide the WR and release warrant to the buyer upon confirmation that payment was done accordingly; and

· deduct the loan plus interest rate and pay the remaining amount to the primary society.



Regulatory body

The regulatory bodies that control the WRS in Tanzania include the Cashew nut Board of Tanzania (CBT), Tanzania Warehouse Licensing Board (TWLB), Regional Administration Secretariat (RAS) and Local Government Authority. The buyer takes the original copy of the receipt which implies a certificate of title (CT) to the bank and pays for the proceeds in turn, then he/she obtains the duplicate which implies a certificate of pledge (CP). The bank deducts the loan plus the interest rate and pays the remaining amount to the primary society. The buyer receives cashew nuts from the warehouse after presenting a releasing warrant issued by the bank to the warehouse operator.

Local Government Authorities (LGAs) issue guidelines to ensure that all actors in the system operate according to the act, regulation and guidelines that govern the cashew nut sub-sector within the country. Such guidelines include Marketing Guideline issued by the Cashew nut Board of Tanzania and Warehouse Receipt System guidelines issued by Tanzania Warehouse Licensing Board.

Figure 1: Conceptual Framework of WRS (Source UNIDO, 2011)

Importance of WRS

Since the introduction of WRS in the cashew nut sub-sector, several achievements have been made. These are listed in the following sections.



Farmers sell their raw cashew nuts at competitive prices

The introduction of WRS has enabled farmers to sell their raw cashew nuts using the market price. The market price was determined by the buyers while competing among themselves. For example from 2005 to 2006 the indicative price was Tshs. 600.00 per kg and buyers were purchasing the cashew nut at the same price or less. But from 2007 to 2014 the market price ranged from Tshs. 750.00 per kg in 2007 to Tshs. 2,200 per kg in 2014. Seasonal price variations are moderated to the benefit of producers and consumers. Producers are able to mitigate price risks and participate in a modern and more efficient agricultural trade with a certified warehouse guaranteeing contract performance. The WRS is an important contribution to improved agricultural commodity trade, reducing market instability and political risks. Through encouraging a strong and efficient private trade, it reduces the role of the government in agricultural markets.

Table 1: Price of raw cashew nut before and after WRS

WRS Open marketSeason Price (Tshs.) Season Price (Tshs.)

2007/08 750 to 1,100 2005/06 6002008/09 700 to 990 2006/07 6002009/10 900 to 1,428 2005/06 6002010/11 1,501 to 2,182 2004/05 7002011/12 1,300 to 2,130 2003/04 4622012/13 1,120 to 1,572 2002/03 6502013/14 1,402 to 1,723 2001/02 2852014/15 1,000 to 2,200 2000/01 285

Good method for cashew nut data collection

Introduction of WRS has facilitated the collection of data on raw cashew nut, as shown by the maximum figure of 197,929.500 Mt in 2014/2015 crop season. Prior the introduction of WRS, the highest record was 145,080 Mt in 1973/1974 crop season (CBT, 2015).



Table 2: Raw cashew nut collection and sales before and after WRS

WRS Open MarketSeason Production (MT) Season Production (MT)

2007/08 99,106.720 2006/07 92,573.1882008/09 79,068.794 2005/06 77,446.3752009/10 75,366.604 2004/05 71,918.3262010/11 121,134.973 2003/04 78,566.9272011/12 158,718.371 2002/03 92,153.3022012/13 127,947.490 2001/02 67,369.0442013/14 130,051.576 2000/01 122,289.778

2014/2015 197,929.500 2001/00 122,284.000

Expansion of cashew nut growing districts

Before the introduction of the WRS cashew nut was being grown in 33 districts but now the crop is grown in 43 districts including traditional and non-traditional growing areas.

Selling of raw cashew nut using legal measuring instruments

The WRS curtails cheating on weights and measures from which disadvantaged smallholders suffer, and reduces storage losses.

Access to funds

The WRS facilitates access to finance at all levels in the marketing chain and encourages the injection of much needed funds.

Stable market infrastructure

WRS in the cashew nut sub-sector is used as a pre-requisite for the introduction of Commodity Exchange Market System. This is because the WRS enabled investment in necessary infrastructure such as warehouses and technical background.

Challenge to WRS

Apart from the benefits and achievements brought by the WRS to the cashew industry in Tanzania, there are some challenges facing the sub-sector. Such challenges are described in the following sections.

Lack of understanding of WRS to some of the stakeholders

Though the WRS has been used in the cashew nut industry for eight years consecutively, it is now well known only to some of the stakeholders including farmers. Some farmers think that the major aim of the WRS is to make them get paid in instalments instead of being paid once. Due to such an assumption, primary societies are forced to apply for loans from banks in order to advance payment to farmers. In fact raw cashew nuts are sold when they reach licensed warehouses during auctions and not at the primary society level.



Poor flow of marketing information to farmers

The WRS requires smooth flow of correct and accurate marketing information to each actor in the value chain, especially to farmers. It is expected that those who represent others in the auctions would inform their members about the market price of the auction conducted but they don’t. This situation has caused some resentment by some farmers towards the WRS. Since there are several actors who attend the auctions, the Board urges them to send the information to farmers.

Lack of understanding of indicative prices

There is some misunderstanding among farmers that indicative prices are fixed by the government and that this is a contract between farmers and the government. Some farmers believe that the government should pay them if the prices fall below the price expected for the season.

An indicative price is used to set some legal charges within the cashew nut sub-sector and it is not the market price; it is not contract price between famers and buyers. Therefore, famers should understand that they are supposed to be paid the market price after deductions of the agreed operational and legal charges.

Conclusion

The challenges facing WRS should not discourage stakeholders from implementing the system. These should be used as lessons. Those who distort the system do so because they benefit from the open market. All efforts should be taken to solve these challenges in order to enable farmers and other stakeholders to benefit from the system.

References

CBT (2014). Cashew nut Board of Tanzania Procurement Records 2014.

CBT (2015). Cashew nut Board of Tanzania Procurement Records 2015. Presented at Stakeholders Meeting 28-29 August, 2015, Cashew nut Board of Tanzania, Lindi.

Mark, D. L. (2002). Feasibility Study for a Regional Warehouse Receipts Program for Mali, Senegal, and Guinea. Abt Associates Inc. 4800 Mongomery Lane, Suite 600 Bethesda, MD 20814MAFSC (2008). Pilot cashew nut marketing system introduced in 2007/08. Ministry of Agriculture Food Security and Cooperatives. Dar es Salaam: Government Printers.

MAFSC, (2008). Pilot Cashewnut Marketing System Introduced in 2007/08. Ministry of Agriculture Food Security and Cooperatives, Government printing press. Dar es salaam, Tanzania.

TWLB (2013). The Warehouse Receipts System Operational manual, Made under section 6 of

Warehouse Receipts Act No 10 of 2005, Version two, Dar es Salaam.

UNIDO (2011). Tanzania’s Cashew Value Chain: Diagnostic United Nations Industrial Development Organisation. Vienna Austria

URT (2005). The Warehouse Receipt Act No. 10 of 2005. Parliament of the United Republic of Tanzania.



EXTENSION AND TECHNOLOGY

TRANSFER



Adoption of Cashew Production Technologies by Farmers in North-Eastern Tanzania

B. R. Kidunda* and L. J. Kasuga


P.O. Box 509 Mtwara, Tanzania

*Email of the corresponding author: [email protected], [email protected]

Abstract

Cashew (Anacardium occidentale L.) is among the most important cash crops grown by majority of farmers in Tanzania. Efforts have been made by Naliendele Agricultural Research Institute (NARI) and other stakeholders like the Cashew nut Board of Tanzania to promote the production of cashew nut in Tanzania through developing and disseminating improved technologies to farmers. This study aimed at assessing the level of adoption of improved cashew production technologies by farmers in the eastern Tanzania. In this zone the survey was conducted in eight selected villages from Rufiji, Kisarawe, Pangani and Mkinga districts. The findings revealed that most of the respondents were cashew farmers with an average of 14 years experience. Also 77% were aware of the presence of improved cashew materials. However, the findings revealed that only 21% of the total cashew trees planted by respondents were improved materials. Binary logistic regression model revealed that the most important factors influencing adoption of improved technologies by farmers were numbers of years in cashew farming and frequent access to extension services.

Key words: adoption, cashew, farmers, production technologies, eastern Tanzania.

Introduction

Cashew nut (Anacardium occidentale L.) is an important cash crop in Tanzania as it brings foreign currency for the government and it is also a source of income to cashew farmers. More than 300,000 farmers in Tanzania grow cashew nut (Kasuga, 2013). The major cashew growing areas in Tanzania are Mtwara, Lindi and Ruvuma regions in the south-eastern part, and Tanga and Coast regions in the eastern part of the country. Cashew is among the major cash crops in eastern Tanzania; other crops include maize, coconut, mangoes, citrus, pineapples, sesame, rice and cassava. Eastern Tanzania produces between 8 and 20% of the total cashew nut produced in the country. In the 2014/15 season, total country production was 197,929.500 metric tons (CBT, 2015). In eastern Tanzania, on average, farmers have one hectare of cashew trees and often intercropped with annual crops such as maize, cassava, green grams, cowpeas, and groundnuts and also perennial crops like mangoes, citrus and coconuts (own survey, 2015). The yields vary between the trees and also from one farmer to another,



but the average yield per tree is recorded at 6 kg for trees at an age of over 12 years, while the potential yield is over 20 kg under farmers’ environment. These variations on yield are mainly attributed to several factors including management practices, environment and incidence of pests and diseases.

Various steps have been taken by the government through Naliendele Agricultural Research Institute (NARI) and other stakeholders in improving cashew yield in Tanzania including eastern Tanzania. This has been through developing and distributing improved technologies (improved planting materials and management practices) to farmers. NARI has developed various technologies such as improved cashew planting materials; pests and diseases control strategies as well as agronomic packages. In 2000’s NARI in collaboration with district agricultural offices namely Rufiji, Kisarawe, Bagamoyo, Mlandizi in the Coast Region; and Korogwe, Muheza, Pangani and Mkinga in Tanga Region established cashew trial farms-cum-demo plots in selected villages. In these villages Integrated Cashew Management (ICM) approach was also used. ICM was established to provide farmers with a basket of technology options. The major objectives of these demo plots were to assess the performance of improved materials in different agro-ecological zones and also create awareness of these materials and management practices by farmers and hence influence adoption. Therefore, this study investigated the factors influencing the adoption of cashew technologies in eastern Tanzania.

The main objective of the study was to assess the level of adoption of improved cashew nut production technologies by farmers in eastern Tanzania. Specific objectives were to determine the extent and intensity of adoption of cashew production technologies by farmers, and to investigate factors influencing adoption of cashew production technologies by farmers.


In this study eastern Tanzania included Coast and Tanga regions (Figure 1). The Coast Region lies on the eastern part of Tanzania Mainland along the Indian Ocean coastal belt. The region has an area of 33,539 sq km. According to the 2012 National Census, the region has a population of 1,098,668 people. Tanga Region is situated at the extreme east corner of Tanzania. The region occupies an area of 27,348 sq km and according to the 2012 National Census, the region has a population of 2,045205 people.



Figure 1: Map of Tanzania showing major cashew growing areas and study area

Purposive and random sampling techniques were used to draw samples for interview. Purposive sampling was used to select districts and villages for the survey. The selected villages were mainly those, which had cashew demo plots planted in the past ten to fifteen years. Two districts were selected from each region namely Rufiji and Kisarawe in the Coast Region, and Pangani and Mkinga in Tanga Region. The villages selected were Mpima, Mparange, Mchukwi B, Mwanerumango and Cholesamvula in the Coast Region; and Pangani, Stakishari and Mbuyuni in Tanga Region. At village level, random sampling was used to draw respondents for interview. In each village, at least nine cashew farmers were randomly selected for interview depending on their availability. Hence, in each region, 45 cashew farmers were drawn for interview, making a total sample size of 90 respondents. A structured questionnaire was used for collecting information from sampled cashew farmers.

Binary logistic regression was used to investigate the important factors influencing adoption of improved cashew nut production technologies by farmers in the eastern Tanzania. The model has been widely used by different authors particularly in investigating the factors influencing adoption of different technologies in different locations (Chaves and Riley, 2004; Adesina et al., 2000; Bekele and Holden, 1998; Ayuk, 1997). Since the dependent variable has only two outcomes, (Adoption and non-adoption of improved cashew materials), a Binary Logistic Regression Model was used. In this study, it was conceptualized that a farmer who had planted at least 3 improved cashew trees qualified to be an adopter and thus ranked 1 and ranked 0 if one had not planted any improved cashew tree (non-adoption). The logit (Y) was given by the natural log of odd i.e. Y=P(Y=1) / 1-P(Y=1) which was expanded using the following equation:



Log (P/1-n) = β0 + β1X1 + β2X2 + β3X3 + β4X4 +……………… βnXn + βi.

Where

Log (P/1-n) = the logit, which is the positive logarithm of the odd ratio of a farmer adopting a technology against non-adopter (dependent variable indicated by Y= 1 and Y=0) and

β0 = Y – intercept; β1…βn = (Coefficients of independent variables); X1 – Xn = (Independent variable under observation); X1 = Age of respondent (years); X2 = Years of schooling; X3 = Marital status of respondents (1 = married, 0 = otherwise); X4 = number of years in cashew farming X5 = number of active labour in the household; X6 = total farm land cultivated by the respondent (acres); = ; X7 = access to extension services (1 = access to extension services, 0 = no access to extension services); X8 = total annual income earned by the respondent.

Descriptive statistics such as means, standard deviation, graphs, frequency distributions and cross tabulations were used to describe the data. The information obtained from these statistics provided information to support the results from Binary Logistic Regression. SPSS computer software was used for analysis.


Socio-economic characteristics of respondents

Results showed that the average age of respondents was 48 years; the minimum was 23, while the maximum was 75 years. The average number of years on cashew farming experience was 14, of which the minimum was 2 and the maximum 30. The average number of people in the household was 6 and the dependency ratio was 50%. Table 1 presents sex, marital status and education level of respondents. The results show that 72% of the respondents were male and the rest were female. About 86% of the respondents were married, 10% widowed and 4% single. Education level of respondents also varied; however, the majority (70%) had primary education, others had secondary education (10%), (2%) had tertiary education, and 18% had no formal education.

Table 1: Sex, marital status and education level of respondents

Characteristics

Region

Overall (N=90)Tanga (N=45) Coast (N = 45)

Sex of respondents Tally % Tally % Tally %

Male 35 30 35 78 65 72

Female 10 15 10 22 25 28

Marital status

Single 2 4 2 4 4 4

Married 36 80 41 92 77 86

Widowed 7 16 2 4 9 10

Education levels

None 7 15 9 20 16 18

Primary 35 78 28 62 63 70

Secondary 3 7 6 13 9 10

Tertiary 0 0 2 5 2 2



Extent and intensity of adoption of cashew production technologies

Awareness and extent of adoption of improved materials

The findings have revealed that most of the respondents (77%) were aware of the presence of improved cashew materials and 23% were not aware at all. Unawareness was mainly due to lack of information (71%), inadequate extension services and also unavailability of materials (43%) within or nearby villages. However, the findings reveal that 48% of the respondents planted improved cashew materials; 44% in Tanga and 51% in the Coast Region. Sources of planting materials varied from one respondent to another. These include neighbour farmers (50%), Naliendele Agricultural Research Institute (39%) [this was mainly in the Coast Region where several interventions from research had been done], extension officers (42%) in Tanga Region, and (17%) in the Coast Region.

Intensity of adoption and type of cashew materials planted

The results show that the average number of cashew trees owned by the household was 76; the minimum was 6, and the maximum was 550. Among the total cashew trees owned by the respondents, only 21% consisted of improved materials. In Tanga Region 95% of the respondents planted polyclonal seed and the rest planted grafted seedlings. This was probably due to availability of polyclonal seed. While in the Coast Region 35% of the respondents planted grafted seedlings and 43% planted polyclonal seed, the rest planted both polyclonal and grafted seedlings. A large number of these improved materials were planted between 2005 and 2014. This might be attributed to intervention from NARI way back in 2000’s, and a recent COSTECH cashew project in Mkinga District in Tanga Region.

Spacing and cropping system used

It was found that over 95% of the cashew farms with local materials had been planted at random. Most of these farms (> 70%) were inherited from relatives, and they are more than 30 years old. For cashew farms with improved materials, about 80% were planted in rows although the spacing used varied from 12 x 12 m, 14 x 14 m, and 12 x 18 m. It was reported that inadequate knowledge (83%), cost involved (3%), labour shortage (2%), inherited farm (8%) and economic importance of the crop (8%) compared with other cash crops were some of the important reasons for non-use of appropriate spacing.

Cashew diseases and pests and their control strategies

Generally, all the respondents had insufficient knowledge on cashew diseases. However, about 53% were able to identify some of the diseases through their symptoms such as Powdery Mildew Disease (PMD), Leaf and Nut Blight Disease (LNBD) and Anthracnose. Lack of knowledge has been attributed to low awareness (29%) and also inadequate extension services (74%). Despite inadequate knowledge on diseases, about 41% of the respondents were using fungicides for disease control, although nearly three-quarters were from the Coast Region 71% unlike in Tanga Region where only 11% were using fungicides. Little use of fungicides was due to several factors including inadequate knowledge, high prices of inputs, unavailability and untimely supply of inputs, low selling price of raw nuts and also lack of common selling points in most of the districts. The most common



fungicides used by farmers for the control of cashew diseases were Sulphur dust (80%), Bayfidan (26%), Mupavin (6%), Mupafidan (3%), Kumulus (3%), Falmeno (3%) and Defender (3%). In Tanga Region, all the respondents were using Sulphur dust unlike in the Coast Region where other fungicides were also being used. Spraying intervals were 14 days, 21 days, less than 14 days and also more than 21 days depending on disease intensity. These findings imply that at least the majority of respondents had knowledge on fungicides spraying intervals.

Also the findings have revealed that 56% of the respondents were aware of some of the insect pests attacking cashew. The common pests identified were Hellopeltis bugs (68%), Meccocorynus loripes (53%) and Coconut bugs (16%). About 30% of the respondents were applying insecticides for pests control although not as recommended in terms of timing, rate and frequency of application. This was probably due to inadequate knowledge on the insecticides and their uses, low purchasing power, unavailability of such insecticides, and low selling price of raw nuts. The most widely used insecticide was Karate (29%) followed by Selecron (2%); others were Ninja (1%) and Duduall (1%).

It was found that only 9 respondents (10% of the total respondents) owned motorised blower machines - 3 respondents in Tanga Region and 6 in the Coast Region. This number of machines is inadequate, taking into account the importance and number of the cashew trees owned. More effort is required by cashew stakeholders to improve the situation, since the motorised blower is a very important device in controlling pests and diseases on cashew. The majority of respondents (54%) used to hire these spraying machines although they were not satisfied with the services provided by the operators. This was due to four major reasons: untimely spraying due to long queue of other clients waiting for the same service (91%), inadequate knowledge of blower operators (86%), lack of royalty of the operators (60%), and sometimes cheating on quantity of insecticides used. High prices and inadequate supply of motorised blowers were the major limiting factors to ownership.

Factors influenced adoption of cashew production technologies

Binary Logistic Regression Model was used to investigate the important factors influencing adoption of improved cashew materials in the study area (Table 2). The -2 log likelihood was 89.359. The Chi-square was 17.373 and significant at 5% level. The factors predicted in the model were age of respondents, number of years in school, marital status, total farm land cultivated, number of active labour in the household, number of years in cashew farming, access to extension services and total annual income earned by respondent. Logistic regression results showed that the number of years in cashew farming and frequent access to extension services were important factors influencing adoption of cashew production technologies (P < 0.005). The findings revealed that every one-unit increase in access to extension services led to a 1.333 (33%) increase in the log-odds of adoption of improved cashew materials holding other factors constant (ceteris paribus). This implied that the probability of adoption of improved cashew materials increased with increased access to extension services. This is supported by the fact that agricultural extension service is expected to promote adoption of new technologies by farmers (Magani, 2013). Also for every one unit increase in the number of years in cashew farming led to a 0.070 (7%) decrease in the log-odds of adoption of improved cashew



materials. This implied that the probability of adoption was lower to those farmers with more years in cashew farming. This was contrary to other studies which had indicated that the more the years of farming experience the farmer had, the higher the probability of adopting new technologies (Magani, 2013; Ajayi and Okunlola, 2006; Batz et al., 1999). This might be attributed to various factors including low selling price, high price of inputs and planting materials, unavailability of inputs and also inadequate market information.

Table 2: Logistic regression results on adoption of improved cashew materials

Variable β SE β Exp (β) df Sig.Constant -1.518 1.917 0.219 1 0.428Age of respondents (years) 0.026 0.03 1.027 1 0.382Years of schooling 0.098 0.136 1.103 1 0.471Marital status (1,0) -0.619 0.944 0.538 1 0.512Number of years in cashew farming -0.07 0.035 0.933 1 0.049*Number of active labour in the household 0.171 0.187 1.187 1 0.359Total farm land cultivated (acres) -0.052 0.049 0.949 1 0.288

Frequent access to extension services (1,0) 1.333 0.54 3.792 1 0.014*Total annual income earned 0.00 0.000 1.000 1 0.263

-2log likelihood = 89.359; significant at 0.05; 20% of cases predicted the model; Chi – square = 17.373 significant at 0.05. Dependent variable = (Adoption of improved cashew materials (1 was if adopted and 0 was if not adopted)

Conclusion, recommendations and implications

Substantial effort has been made by the government of Tanzania through NARI and other stakeholders, for the past ten years, to develop and disseminate improved cashew technologies in north-eastern Tanzania. Currently, at least 48% of the respondents have planted improved material, and also 21% of the total cashew trees planted by respondents are improved materials. About 41% and 30% of the respondents apply fungicides and insecticides respectively to control diseases and pests on their cashew farms. Experience in cashew farming and access to extension services, were important factors that influenced adoption of cashew technologies. However, the study has established that the level of adoption of cashew technologies is still low. Several challenges are mentioned as being major limiting factors. These include low selling price of raw nuts, unavailability of inputs particularly motorized blowers and pesticides, inadequate market information and inadequate extension services. Basing on these findings the following recommendations are made:

• District councils should establish cashew nurseries at ward or village level for easy access of planting materials and at affordable prices for the farmers.

The government should find more market opportunities of cashew for increased demand and competition among traders and hence benefit farmers through price incentives.

• There is a need for capacity building of extension officers on cashew management practices because most of them are new and have little experience on cashew technologies.



Acknowledgements

We wish to acknowledge the Government of Tanzania through the Cashew Research Programme (CRP) at Naliendele Agricultural Research Institute (NARI) for the financial support, without which this work could not been done. Also, we acknowledge the Director of NARI and Cashew Lead Scientist for their facilitation during this study. We would also like to express our sincere thanks to Juma Mfaume, Mullowelah A. Mtendah, and Salum Kafuku for their support during data collection. We wish to extend our gratitude to District Agricultural Officers from Mkuranga, Kisarawe, Mkinga, and Pangani for their support during data collection. Our acknowledgements would not be complete without mentioning all farmers who participated during the survey. May God bless you.

References

Ajayi, M. T. and Okunlola J. O. (2006). Farmers perceived agricultural input factors influencing adoption and production of food crops in Akere area of Ondo state, Nigeria. Global Approach to Extension Practices, 2(1), 1 – 8.

Adesina, A. A., Mbila, D., Nkamleu, G. B., and D. Endaman (2000). Economic analysis of the determinants of adoption of alley farming by farmers in the forest zone of South West Cameroon. Agriculture, Ecosystems and Environment 80:255-265 and Cooperative, Dar-es-Salaam, Tanzania.

Ayuk, E. T. (1997). Adoption of agro forestry technology. The case of live hedges in the Central Plateau of Burkina Faso. Agricultural Systems 54:189-206 and Environmental Science, 6(5), 616 - 624.

Batz, F. J., Peters, K. J., and Janssen (1999). The influence of technology characteristics on the rate and speed of adoption. Agricultural Economics, 21(2), 121 -30.

Bekele, S., and S. Holden. (1998). Resource degradation and adoption of land conservation technologies in the Ethiopian Highlands. A case study in Andit Tid, North Shewa. Agricultural Economics, 18, 233-147.

CBT 2015: Cashewnut Board of Tanzania procurement records 2015/16 season

Chaves, B., and J. Riley. (2004). Determination of factors influencing integrated pest management adoption in coffee berry borer in Colombian farms. Agriculture, Ecosystems and Environment, 87, 159-177.

Kasuga, L. J. (2013). Status of the cashew nut industry in Tanzania. In Proceedings of the Second Cashew International Conference, Kampala, Uganda, 26-29April 2010. CAB International, Wallingford, UK.

Magani, S. F. (2013). Adoption of improved cashew nut production technologies by small-holder farmers in Mtwara District, Tanzania. M.Sc. Thesis, Sokoine University of Agriculture Morogoro, Tanzania.



Assessing Farmers’ Awareness on the Utilisation of the Weaver Ant, Oecophylla longinoda Latreille for the Control of Cashew Insect Pests in the Eastern Zone of Tanzania

W. Nene*, D. F. Mwakanyamale, S. H. Shomari and B. Kidunda


P. O. Box 509, Mtwara Tanzania


Abstract

In Tanzania cashew is an important commodity to the national economy. Despite its economic im-portance, its productivity has been severely constrained by damages due to insect pests. The majority of cashew growers in Tanzania control insect pests by using synthetic insecticides. However, synthetic insecticides can have negative effects on human health and the environment. In view of this, research-ers are considering the use of alternative methods such as biological control. Weaver ants have been used as a bio-agent for the control of insect pests. Understanding farmers’ knowledge on weaver ants will help to establish the basis for intervention regarding their use in controlling cashew insect pests. A survey was conducted in the eastern zone of Tanzania to assess farmers’ knowledge regarding the use of weaver ants as predators. A total of 110 cashew farmers were interviewed. Results indicated that 95% of the respondents were aware of the weaver ants and 51% admitted that the ants were useful in controlling cashew pests. However, only 38% were using the ants in their fields. Limitations and challenges in using ants to control pests are discussed. This study recommends that awareness partic-ularly on weaver ant husbandry is essential.

Key words: insecticides, human health, biological control, cashew, weaver ants

Introduction

Cashew is the main cash crop and the leading source of income in the southern zone of Tanzania (Nene, 2011). Despite its importance, cashew productivity has been hampered by several constraints including biotic factors particularly insect pests. The application of synthetic insecticides such as Lambda cyhalothrin has been the main approach in controlling key cashew insect pests namely Core-id bugs. However, weaver ants (O. longinoda) have been reported as potential bio-agents that could control a wide range of insect pests in multiple crops (Way and Khoo, 1992; Van Mele and Vays-sieres, 2007). Such control includes the control of pests in mango and cashew in Australia (Peng and Christian, 2005; Peng et al., 2008); cocoa in Malaysia (Way and Khoo, 1991) and citrus in Vietnam (Van Mele and Cuc, 2000). Therefore, the use of synthetic insecticides, which are environmentally unfriendly, could be reduced by an Integrated Insect Pest Management approach, with the use of the weaver ant as a key element.



Weaver ant husbandry is needed in order to maintain a high population for successful protection of crops against insect pest attack. For instance, citrus farmers in China use bamboo trees to connect between trees of the same colony for colony expansion (Van Mele, 2008) while farmers in Vietnam reduce pesticide application regimes or use pesticides which are less harmful to the weaver ant (Van Mele, 2008). The population of O. longinoda increases with the control of the big headed ant, Pheidole megacephalla (Seguni et al., 2011). Although this knowledge is related to pest management behaviour (Price, 2001), information on farmers’ awareness and perceptions on distributions and abundances of weaver ants and their potential in controlling cashew insect pests for cashew growers in the eastern zone is lacking. The aim of the study therefore was to fill this information gap so as to establish the basis for intervention regarding the use of weaver ants in controlling cashew insect pests.


Tanga Region is located in the eastern zone of Tanzania. The region lies between latitudes 4o and 6o south of the Equator, and between longitudes 37o and 39o east of Greenwich. The study used a cross sectional research design, which provides room for observing many subjects (such as individuals, firms, or countries/regions) at a time, or without regard to differences in time. Primary data were collected from randomly selected cashew farmers in eastern zone of Tanzania.

The study was conducted in three selected districts of Tanga Region, namely Korogwe, Mkinga and Tanga Rural. The districts were selected based on their potential in cashew production. Seven villag-es were also selected due to the presence of cashew fields. These villages were Kwangena, Horohoro and Mwangumba in Mkinga District; Bagamoyo, Kwamngumi and Mgila in Korogwe District; and Mabokweni in Tanga District. At village level, simple random sampling was used to draw respondents from among cashew farmers. A sample size of 110 cashew farmers was drawn and a structured ques-tionnaire was used to collect information from the respondents.

Descriptive statistics such as means, standard deviation, graphs, frequency distributions and cross tabulations were used to describe the data. Statistical Package for Social Sciences (SPSS) software was used in data analysis.

Results

Table 1 presents demographic characteristics of the respondents. Results revealed that males headed 78% of the households while 22% were headed by females. The mean age of respondents was 48 years while the minimum and maximum were 19 and 78 years, respectively.

Table 1: Demographic characteristics



Characteristics Frequency PercentGenderMale 86 78.2Female 24 21.8Marital StatusSingle 7 6.4Married 88 80.0Divorced 6 5.5Widowed 9 8.2Education LevelNever attended school 12 10.9Primary 88 80.0Secondary 9 8.2Post-secondary 1 0.9

The results show that 80% of the respondents were married. Only 6% of the interviewees were single while the widowed stood at 8%. However, there were also reports of 6% cases of divorce. All the same, the experience in cashew farming of the respondents averaged at 16 years (Table 2).

As presented in Table 1, 80% of respondents had attained primary education while 8% had second-ary school education. The mean age of the household heads was 48 years while the minimum and maximum was 19 and 78 years, respectively. The average number of household members was 6 while that of active labour was 3 implying a 50% dependency ratio. On the other hand, respondents had experience in cashew farming averaging 16 years, with 1 and 55 years as minimum and maximum, respectively (Table 2).

Table 2: Age, number of household members, active labour and experience in farming

Minimum Maximum Mean Std. DeviationAge of respondent 19 78 47.76 13.366Number of household members 1 38 6.43 4.239

Number of active labour 1 10 3.13 1.959

Experience in cashew farming 1 55 16.30 12.107

The study established that the average number of cashew trees owned by respondents was 111. The trees were planted in different patterns including even distribution (62%) and random distribution (27.3). Other patterns were overcrowding (8%) and fencing (3%). Most of the cashew trees owned by respondents were middle aged (45%) followed by young trees (34%) and old ones (21%).

Cashew insect pests mentioned by respondents as being a problem in the study area include Helopeltis spp, Mecocorynus loripes, Pseudotheraptus wayi and Pseudococcus longispinus (Figure 1).



Figure 1: Major insect pests in the study area

The study also revealed that respondents controlled these pests mainly through the application of insecticides (43%). Other methods of pest control used included biological (4%), burning (4%), and mechanical control (3%). However, Figure 2 indicates that a substantial proportion of the inter-viewed farmers (46%) said they did nothing to control the pests.

Figure 2: Pest control methods used in the study area

Farmers’ knowledge on weaver ants

Awareness is very important in the adoption process; this means adopters should be aware of the technology before thinking of taking it up. The survey therefore sought to find out, in the first place, whether farmers were aware of the presence of weaver ants. Results showed that 95% of respondents



were aware, and had ever seen the weaver ants. Eighty percent (80%) of respondents reported to have seen the weaver ants in their own cashew fields while 18% had seen them in other farmers’ fields. About 2% had seen the insects in the nearby village (Figure 3). On the other hand, the study also revealed farmers’ knowledge of weaver ants’ nests, whereby 92% of respondents said they knew about such nests.

Figure 3: Sites where respondents had seen weaver ants

Distribution and abundances of weaver ants

Apart from cashew trees, respondents mentioned other trees, which are colonised by weaver ants. These include jackfruit, guava, coconut, mango and citrus trees. Similarly, it was also learnt that weav-er ants prefer colonising certain tree species to others. According to findings, the order of preference in which weaver ants colonise trees is: cashew (60%), citrus (37.3%), mango (31.8%), coconut (5.5%), jackfruit (1.8%) and guava (1.8%) (Figure 4).

Figure 4: Trees colonised by weaver ants in order of preference



Some farmers went even further to estimate the number of ants per tree in their fields. For instance, 37% of the respondents estimated the presence of more than 500 weaver ants per tree which, accord-ing to the score classes developed by Stathers (1995) this is very abundant. The average of 201-500 (abundant) weaver ants per tree was estimated by 5.6% of the respondents, while 12% reported the number between 51-200 (many) weaver ants per tree. Also, the presence of the average of 21-50 (some) weaver ants per tree was reported by 14% of the interviewed farmers. Likewise, 23% reported 1-20 (few) weaver ants per tree, while 8% said there were no weaver ants at all in their trees (Table 3). Generally, Mkinga District recorded the highest average number of weaver ants per tree as reported by 46% of respondents, followed by Korogwe (42%).

Table 3: Average number of weaver ants per tree, by district

District Average number of weaver ants Mkinga Korogwe Tanga TotalNo ants Frequency 7 2 0 9

% of Total 6.5 1.9 0 8.4Few (1 - 20) Frequency 9 12 4 25

% of Total 8.4 11.2 3.7 23.4Some (21 - 50) Frequency 9 5 0 14

% of Total 8.4 4.7 0 13.1Many (51 - 200) Frequency 4 4 5 13

% of Total 3.7 3.7 4.7 12.1Abundant (201 - 500) Frequency 1 4 1 6

% of Total 0.9 3.7 0.9 5.6Very abundant > 500 Frequency 19 18 3 40

% of Total 17.8 16.8 2.8 37.4Frequency 49 45 13 107

% of Total 45.8 42.1 12.1 100

The study also inquired about farmers’ opinion on the use of weaver ants. About 51% of respondents were of the opinion that weaver ants were useful particularly in predating cashew insect pests. Other respondents said that weaver ants prevented snakes from inhabiting the fields. Although a great pro-portion of the respondents knew weaver ants were good predators of cashew insect pests, only 38% were using the ants in their fields to control insect pests. About 22% of the respondents reported that they did not use weaver ants technology because of their biting habit, while 30% said they were not aware of their benefits.

Survey results show that some farm activities such as application of insecticides and burning as a method for weed control reduce the number of weaver ants. Similarly, it was indicated that weaver ant population is also negatively affected by the existence of other ants such as Pheidole and Anoplelipes sp as reported by 14.5% and 10.9% of respondents, respectively.



The presence of low population of weaver ants was mentioned as one of the challenges to adoption of this technology in controlling cashew insect pests (30.2%). Another challenge reported was the application of pesticides (30.8%), which affects weaver ant population. The biting habit of weaver ants also posed a challenge to farmers in adopting weaver ant technology in controlling insect pests as reported by 28.1% of respondents. Likewise, some respondents (10.8%) reported limited knowledge as a hindrance to the full use of weaver ants in controlling cashew insect pests (Table 4).

Table 4: Challenges in adopting weaver ants for the control of cashew insect pests

ChallengesResponses

N PercentLimited knowledge about the use of weaver ants 36 10.8Difficulty in handling weaver ants (their biting habit) 94 28.1Application of pesticides 103 30.8Inadequate number of weaver ants 101 30.2Total 334 100.0

Discussion

The survey revealed the presence of weaver ants in the study area, which is a good starting point if their use in controlling cashew insect pests is to be promoted. Most farmers were aware of the pres-ence of weaver ants (95%) and about a half (51%) revealed that weaver ants were useful, particularly in predating insect pests in cashew fields although only 38% of the interviewed farmers were using weaver ants’ technology for the control of insect pests in their fields.

The survey revealed that only 10.9 % of respondents never attended school. This implies a relatively high level of literacy, which is important for agricultural transformation because many farmers in the study area could read and understand technologies related to agriculture. This is in concurrence with the contention by Benor et al. (1997) that education is important in creating positive mental attitude towards adoption of modern farming.

Management practices such as burning as a method for weed control and application of insecticides negatively affects weaver ant population. These practices directly kill the individual ant or even the whole colony. Likewise, improper spacing and overcrowding of trees could lead to fighting between different weaver ant colonies. Furthermore, it was reported that other ant species negatively affected the growth of weaver ant’s population. This is in consensus with the work done by Seguni et al. (2011) who found that the presence of weaver ant competitors, Pheidole and Anoplelipes species in particular, negatively affects weaver ant abundances.

One of the challenges that hinder the use of weaver ants in the surveyed areas is inadequate (low) pop-ulation. This is in agreement with available literature, which proposes that for adequate protection, there should be a stable and adequate weaver ant population (Way, 1953; Stather, 1995). Another challenge reported was the application of pesticides (30.8%) which affects weaver ant population. This was also reported by Van Mele and Vayssières (2007) who were of the opinion that the use of pesticides endangers the sustainability of weaver ant.



This study found that 95 % of the respondents were aware of the weaver ants and 51 % revealed that the ants were useful in controlling cashew pests. Low population of weaver ants in the study area is likely caused by the presence of weaver ant competitors, unfavourable field management practices such as weeding by burning, insecticide application and improper pruning. Therefore awareness par-ticularly on issues related to weaver ant husbandry is essential.

Acknowledgements

We are grateful to Mr. Mtenda, M., Barnabas B., Bobnoel A., Grace M. and Ester, S. for their help in data collection during the survey. We wish to acknowledge all farmers who participated during the survey. This study was funded by the Cashew Research Programme.

References

Benor, D., Harrison, I. Q., and M. Barter (1997). Agricultural extension; training and visiting system. Washington, D.C: the World Bank”

Nene, H. (2011). Effect of insecticide application regimes on abundances and predation efficiency of Oecophyllalonginoda (Latreille) (Hymenoptera: Formicidae) on cashew insect pests. MSc. Dissertation, Sokoine University of Agriculture.

Peng, R. K., and K. Christian (2005). The control efficacy of the weaver ant, Oecophylla smaragdina (Hymenoptera: Formiciidae) on the mango leafhopper, Idioscopus nitidulus (Hemiptera: Cicadellidea) in mango orchards in the northern territory of Australia. International Journal of Pest Management, 5(4), 297-304

Peng, R. K., Christian, K., Lan, L. P., and N. T. Binh (2008). Integrated cashew improvement programme using weaver ants as a major component. Manual for ICI programme trainers and extension officers in Vietnam. Charles Darwin University and Institute of Agricultural Science for South Vietnam.

Price, L. L. (2001). Demystifying farmers’ entomological and pest management knowledge: A methodology for assessing the impacts on knowledge from IPM-FFS and NES interventions. Agriculture and Human Values, 18, 153-176.

Seguni, Z. S. K., Way, M. J., and P. Van Mele (2011). The effect of ground vegetation management on competition between the ants Oecophyllalonginoda and Pheidolemegacephalla and implications for conservation biological control. Crop Protection Journal, 30, 713-717.

Stathers, T. E. (1995). Studies on the role of Oecophylla longinoda (Hymenoptera: Formicidae) in cashew trees in southern Tanzania. Naliendele Agricultural Research Institute, Mtwara, Tanzania.

Van Mele, P. (2008). A historical review of research on the weaver ant Oecophylla in biological control. Agricultural and Forest Entomology, 10, 13-22.

Van Mele, P., and N. T. T. Cuc (2000). Evolution and status of Oecophylla smaragdina (Fabricius) as a pest control agent in citrus in the Mekong Delta, Vietnam. International Journal of Pest Management, 46(4), 295-301.



Van Mele, P., and J. F. Vayssières (2007). Weaver ants help farmers to capture organic markets. Appropriate Technology. ABI/INFORM Global.

Way, M. J., and K. C. Khoo (1991). Colony dispersion and nesting habitats of the ants, Dolichoderus thoracicus and Oecophylla smaragdina (Hymenoptera: Formicidae), in relation to their success as biological control agents on cocoa. Bulletin of Entomological Research, 81, 341-350.

Way, M. J., and K. C. Khoo (1992). Role of ants in pest management. Annual Review of Entomology, 37, 479-503.

Way, M. J. (1953). The relationship between certain ant species with particular reference to the biological control of the coreid, Theraptus sp. Bulletin of Entomological Research, 44, 669-691.



Capacity Development through Master Training Programme for Cashew Value Chains Promo-tion in West-Africa

A. Tandjiekpon, R. Weidinger, A. Agyepong, C. Benon, *M. Salifou

African Cashew initiative (ACi)

32, Nortei Ababio Street Airport Residential Area

Accra Ghana


Introduction

The ACi constitutes a new type of broad-based multi‐stakeholder partnership in development coope-ration. GIZ, the Deutsche Gesellschaft für Internationale Zusammenarbeit GmbH (German Interna-tional Cooperation), has been commissioned with the management of the project and the facilitation of cooperation among competitive private partners. Its implementing partners (Technoserve and Fair-Match Support) provide consultation on technical issues, as well as business advice to processors and facilitate linkages between farmers and processors. European, Asian, US and African companies, all members of the African Cashew Alliance (ACA), contribute their resources and expertise as partners. Their contributions are supplemented by the Bill & Melinda Gates Foundation, the German Federal Ministry for Economic Cooperation and Development (BMZ) and USAID. ACi benefits from the diverse commercial and technical expertise of these private and public sector partners.

ACi completed its first phase and four years of implementation (2009 – 2013) addressing all com-ponents of the cashew value chain − from production to processing to commercialisation with direct interventions. More than 250,000 individual farmers have been trained with 1.9 million members of rural households benefiting from this intervention. In 2011, farmers trained by ACi realised US $20 million additional annual family labour income. The application of good agricultural practices resulted in remarkably higher yields and better quality of raw cashew nuts. In addition, income from cashews improved drastically the living standard and food supply for many smallholder families in non-productive seasons.

In the on-going second phase (2013–2015), ACi consolidates the training activities undertaken du-ring the first phase. ACi focusses on establishing efficient linkages between farmers and processors and developing better planting materials to increase cashew yields and quality. An innovative instrument of ACi’s phase two is the Cashew Matching Fund - a unique public private partnership model - and the only fund for cashew worldwide.



ACi’s objectives in its second phase are to:

• sustainably increase the productivity of African cashew farmers (Production) ;

• establish sustainable in-country processing and make it competitive on the world market (Proces-sing) ;

• help creating stable and sustainable business relationships amongst farmer groups, processors, buyers and retailers (Supply Chain Linkages) ;

• Organise key stakeholders of the sector at the national and regional levels around shared goals ;

• ensure the representation of the processing industry by a professional industry association; and

• align the operations of the various donor programmes supporting the sector.

ACi introduced the “Master Training Programme” (MTP) or “Programme de Maître Formateur” in French (PMF) (ACi 2015a and 2015b). The programme aims at creating a pool of qualified experts in the cashew value chain to facilitate exchange of knowledge, learning and innovation within the cashew sector in West Africa. The long-term vision of the MTP is to build a pool of technical and managerial expertise, and to facilitate regional exchange of knowledge and technologies between se-lected cashew experts by sharing lessons learnt and innovations at regional and national level. The programme brings together experts from different parts of the cashew value chain and from nine West Africa different countries.

This paper aims to describe the programme, develop the methodology used, and discuss results and the programme impact in West African cashew value chains.


Program area and participants profile

The Master Training Programme targets participants working in the private and public sectors, as well as in NGOs promoting the cashew value chain in West Africa. The applicants must be appointed by their host institution and will go through a transparent selection process in line with established crite-ria. Eligible candidates come from the following organisation, institutions or companies:

• Agricultural extension organisations

• Non-governmental organisations providing outreach, extension or research and development

• Cashew farmer organisations

• Processing factories

• Consulting organisations and training NGOs in processing

• Research and development institutions

• Inter-professional organisations or associations

• Individual independent consultants and consulting firms

• Projects and development programmes.



A mixture of participants from different professional and academic backgrounds and working place is considered in the selection of applicants to the Master Training Programme.

The program and training approach

The MTP covers a period of 7-8 months. The programme includes three one-week class-room ses-sions, offering a facilitated platform for knowledge exchange. Each session focuses on a specific set of modules. Participation is obligatory in all three sessions to complete the programme.

Field trainings of maximum of three months are organised between the class-room sessions, the so-called inter-sessions. During the intersession programmes, participants go back to their host organi-sations, institutions or companies to share with colleagues knowledge attained and do hands-on work in the field to apply what they have learned in the training sessions. Linking theoretical knowledge to practice, the MTP technical modules and activities are aligned with the cashew production, process-ing and marketing.

The trainings are conducted in Benin, Burkina Faso, Ghana and Côte d’Ivoire by the African Ca-shew Initiative with expert support from GIZ, Technoserve, FairMatch Support, the African Cashew Alliance and other national institutions and companies involved in the cashew sector. The working languages are English and French (with translation service).

The theoretical foundation of the training programme is based on two schools of thought within the social sciences, namely Gestalt Theory of psychology and the concept of Value Chain Development Theory.

The linkage between Gestalt Practice, Value Chain Development, and ACI’s Master Training Programme

Gestalt Theory, originally a theory in the field of psychology and psychotherapy, has been adapted to be used in other fields through coaching and adult learning. Professional Gestalt and adult education experts have been involved in the initiation, development and implementation of the Master Training Programme. Gestalt Theory is not a scientific theory, but it has roots in physical sciences as well as psychology (Schulz, 2013). What distinguishes Gestalt practice is that it uses the description process, the how, much more than the interpretation process, the why (Rutkowski, 2014). Simon (2009) stresses two aspects that are central to Gestalt Theory and are easily applicable to human interaction in general: contact/sensation and awareness. Throughout presentations and working group sessions within the Master Training Programme, these principles are equally applied in the dissemination of knowledge by trainers, as well as directly teaching to participants. Within the context of the West Af-rican cashew value chains, expert participants of the MTP are trained in all fields of the entire cashew value chain, in order to gain awareness beyond their own field of expertise, so that this awareness in-fluences their decisions. In Gestalt Theory, according to Simon (2009), there is a correlation between “the degree of awareness and the potential for new choices of behaviour”.



Schulz (2013) calls Gestalt Theory “a powerful theoretical tool for addressing the enormously com-plex human world of experience”. Value chain dynamics are a very complex formation to grasp, which is why Gestalt learning techniques were chosen to render the process of knowledge transfer during the Master Training Programme highly successful. Furthermore, Lahood (2014) explains, Gestalt Theory renders itself suitable for group processes since it promotes respect and appreciation of differences between group members and their awareness. Therefore, within the Master Training Programme, actors from all parts of the cashew value chain receive equal trainings, so that all parts of the value chain are strengthened. Parrilli et al. (2013) argue that regional development is closely linked to value chain development; and since the MTP is regional, it has great potential of addressing value chain development effectively.


To date, two modules of MTP have been organised. With the first module in 2013-2014, 58 experts (out of whom 26% are female) from 7 countries in West Africa (Benin, Burkina, Côte d’Ivoire, Gha-na, Senegal, Sierra-Leone and Togo) graduated and are acknowledged by the industry. Due to the

great success and high interest from stakeholders, a second module is currently ongoing with 60 par-ticipants (24% female) from 9 countries: Benin, Burkina Faso, Côte d’Ivoire, Ghana, Gambia, Mali, Senegal, Sierra-Leone and Togo (Figure 1). More than 23% of participants are from Côte d’Ivoire, the largest producer in the world.

Results show that participants have various professional backgrounds as presented in Figure 2, and about 50% are coming from the public sector (Figure 3). These show that participants work along the entire value chain. The diversity ensures mass knowledge sharing and sustainability.

Figure 1: Number of participants per country



Figure 2: Professional background of MTP participants

Figure 3: Sector of activityof MTP participants

Impact of the Master Training Programme on the value chain

Figure 4 shows the impact of the Master Training Programme on the value chain. By choosing and bringing together actors who work in different parts of the value chain, the group of participants themselves become an immensely resourceful international network. Participants use their peers as a resource through group work and discussions, and gain practical experience through field and factory visits. The content of the comprehensive training program resonates within the areas of the value chain where the individual master trainers work. The trainees/ alumni network serves future cooper-ation between actors of the different segments of the value chain as they have in-depth knowledge of the entire chain.



Figure 4: Model of the impact of the Master Training Programme on the cashew value chain

Discussion of the future of the Master Training Programme

ACi is planning on perpetuating and further developing the Master Training Programme, as it has been deemed very successful and has been well-received in West Africa. In future implementation, strengths and weaknesses need to be identified and addressed. Main weaknesses of the Master Training Programme, at present, include insufficient direct involvement of policy makers and governments. Direct involvement of a larger number of policy makers and governing bodies in the MTP would substantially increase the impact of the Master Training Programme, since policy makers would then be encouraged to become part of the network of exchange. Since the Master Training Programme is a relatively new initiative, the scope of its impact is still limited and the community of master trainers still needs to grow. A challenge faced particularly in West Africa is a language barrier between English and French native speakers. While this barrier is overcome during the training through comprehen-sive translation and interpretation work, the language barrier remains a challenge for international networking.

As presented above, the main strength of the programme is its focus on the knowledge expansion of niche experts to offer them a chance to address other key aspects of the value chain outside their own specialisation. The Master Training Programme could be implemented in any region where cashew is produced, if contents and the composition of participants are adapted to the regional context. Besides, the design of the MTP can be applied in other value chains – both in the format as well in teaching/learning methods.




Showing high success and positive reception, the Master Training Programme will continue to be implemented. Theoretical roots within Gestalt Theory and value chain development have been well developed. In order for the West African cashew value chains to become more sustainable and offer more equitable gains to all stakeholders, these stakeholders need to be brought together and empow-ered to defend their interests. By understanding the entire cashew value chain, each master trainer adds potential for sustainability to the cashew sector with his/her awareness of the system and ability to sense and keep improving his/her knowledge. As the network of master trainers grows, the poten-tial for a sustainable cashew value chain will grow.

References

ACi, (2015a). Concept note for the Master Trainer Programme for promotion of cashew value chains in Africa (Second Edition), Project Document. 2015

ACi, (2015b). Presentation made to the ACi Steering Committee Meeting in 2015

Lahood, G. A. (2014). Toward the embodiment and enactment of phenomenology, field theory and dialogue in Gestalt group process: A literature review. Gestalt Journal of Australia and New Zealand 10(2), 38-59.

Parrilli, M. D., Nadvi, K., and H. W. Yeung (2013). Local and regional development in global value chains, production networks and innovation networks: A comparative review and the challeng-es for future research. European Planning Studies 21(7), 967-988.

Rutkowski, N. (2014). Coaching and therapy: Finding common ground in Gestalt practice. Gestalt Review 18(2),146-153.

Schulz, F. (2013). Roots and shoots of Gestalt Therapy Field Theory: Historical and theoretical de-velopments. Gestalt Journal of Australia and New Zealand, 10(1), 24-47.

Simon, N. S. (2009). Applying Gestalt Theory to coaching. Gestalt Review, 13(3), 230-240.


Country Papers

COUNTRY PAPERS


Country PapersCountry Papers

Status of Cashewnut Industry in Tanzania

M. Malegesi

Cashewnut Board of Tanzania

P.O. BOX 533, Mtwara Tanzania


Abstract

Cashewnut is an important export crop and a major source of income for smallholder farmers in south-eastern Tanzania. The crop is mainly grown in Mtwara, Lindi, Ruvuma, Coast and Tanga re-gions. Recent highest record of cashew production was 197,929.500 Mt attained in 2014/2015 crop season. A very small proportion of produced raw cashew nut is processed locally. The government has recently established a programme which is the engine to speed up cashew nut processing in Tanzania. The raw cashew nut is sold through a Warehouse Receipt System whereby traders buy the cashew nuts through closed bids. This research has come up with a number of findings aimed at improving the cashew nut industry in Tanzania. Some of the findings include identification and registration of 22 clone seeds which has made Tanzania the first country to have registered cashew clones in the world.

Key words: cashew, clones, cashew nut industry, Tanzania

Introduction

Cashew (Anacardium occidentale L.) is one of the important perennial tree crops grown in tropical countries including Brazil, Vietnam, India and countries of eastern and western Africa (Ohler, 1979; Kasuga, 2010). In Tanzania, cashew is mainly grown in the coastal regions of Mtwara, Lindi, Ruvu-ma, Coast and Tanga. Other regions growing cashew nut include Morogoro, Dodoma, Mbeya, Iringa and Singida. About 43 districts are involved in growing cashew. The crop is the main source of income for 300,000 smallholder farmers, and contributes around 75% of household cash incomes. It is one of the most important export crops in terms of foreign currency earnings. A report by the Bank of Tanzania (BOT) released in 2013, showed that cashew was second after tobacco in foreign currency earnings in Tanzania. Meanwhile the sector contributes 18% of country’s merchandise export earn-ings (PASS, 2013). Furthermore, the crop creates employment among farming communities and in cashew-nut processing.



Current status

Production

Tanzania is one of the ten main traditional cashew-nut producing countries in the world. The country used to produce over 20% of global production in the 1970s recording 145,000 Mt in 1973/1974, making Tanzania the second biggest cashew producer in the World after Mozambique (CBT, 20131). Since then, cashew production started to decline recording as low as 16,500 Mt in 1986/1987. In mid- 1990s, the production recovered whereby in 2000 Tanzania recorded cashew production as high as 121,200 Mt. In 2012 the country recorded 158,134,134.37 Mt and in the year 2014/2015 the highest cashew production ever of 197,929.500 Mt was achieved. Figure 1 below illustrates trends of cashew nut production in Tanzania from 1961/1962 to 2014/2015.

Figure 1: Trend of raw cashew nut production from 1961 to 2014/2015

Source: Cashew nut Board of Tanzania

The increase in cashew nut production has been mainly due to increased acreage, government sub-sidy, stakeholders support through funds as agreed in their annual meetings and adoption of Good Agricultural Practices (GAPs). These include weeding, pruning and pesticides application as advised by scientists from the Research Institute and Extension Service.

Processing

Currently, there are about 40 small, medium and large-scale processing factories in Tanzania with a utilisation capacity of 43.6%, contributed significantly by small and medium scale firms (CBT, 20132). These factories are owned by both private and public processors. Roasting firms buy white kernels from either the 1st or 2nd stage of processing; these kernels are later roasted and flavoured to achieve the 3rd stage of processing. Processing of cashew apples is still under research and has not yet been commercialised.



Factors affecting processing performance include old or out-dated technology of equipment and ma-chinery used in cashew nut processing, lack of capital for acquiring new equipment and machinery, lack of education and knowledge on cashew nut processing and value chain linkages, lack of educa-tion and knowledge on business development skills, and lack of accessibility of raw cashew nut and information on availability of packaging materials.

Status of cashew nut processing factories

Table 1: Government sold factories

S/N Previous name New name Processing capacity (MT) Location Status

1. Likombe Cashe wnut Factory

Micronix System Ltd. 6000 Mtwara Processing

2. Newala II Ca-shew nut Factory

Micronix System Ltd. 6000 Newala Processing

3. Tunduru Cashew nut Factory

Korosho Africa Ltd. 4000 Tunduru Processing

4. Mtwara Cashew nut Factory

CC 2005 Ltd. 2000 Mtwara Processing

5. Mtama Cashew nut Factory

Lindi Farmers Ltd. 2000 Lindi Rural Processing

6. Newala I Cashew nut Factory

Agro Focus (T) Ltd. 10,000 Newala Not Process-ing

7. Lindi Cashew nut Factory

Bucco 10,000 Lindi Munic-ipal

Not Process-ing

8. Kibaha Cashew nut Factory

Kibaha Cashew Factory 10,000 Kibaha Town Not Process-ing

9. Nachingwea Ca-shew nut Factory

Lindi Farmers 5,000 Nachingwea Not process-ing

10. Masasi Cashew Factory

BUCCO 10,000 Masasi Town Not process-ing

11. Tanita I Cashew nut Factory

Mohamed Enterprises Ltd. 4,000 Dar es Sa-laam

Not process-ing

12. Tanita II Cashew nut Factory

Export Trading Ltd 0 Dar es Sa-laam

Not Process-ing

Table 2: Factories built by private companies

S/N Name Capacity (MT) Location Status1. Perfect Cashew Kernels 300 Masasi Processing2. Demros Women Group 300 Tanga City Not Processing3. Southern Jumbo Ltd. 1000 Dar es Salaam Not Processing4 Mbagala Cashew Project 2000 Dar es Salaam Processing5 HAWTE 1500 Mtwara Manispaa Not processing6 Masasi High Quality 300 Masasi Town Not processing7. Uvuki 600 Kibaha Town Not processing8. Amama Farms Ltd. 1000 Tandahimba Processing9 Naliendele Cashew Fac-

tory200 Mtwara Municipal Processing

10. WAKORU 200 Ruangwa Not Processing



Apart from idle capacities from available factories, there are still a lot of opportunities for new compa-nies to establish new factories to take advantage of available production of raw cashew nuts for both local and export markets.

Marketing

In Tanzania, raw cashews are sold through a Warehouse Receipt System (WRS). The WRS was intro-duced for cashew nut marketing in 2006/2007 crop season in Mtwara Region where cashew nut farm-ers were mandated to sell through primary cooperatives. During the following season (2008/2009) WRS was introduced in Lindi and in 2009/2010 it was introduced in Ruvuma and Coast regions.

According to UNIDO (2011), through WRS, primary cooperative societies take loans from finan-cial institutions through the cooperative union to pay for 50-60% of the existing indicative price as an initial payment to farmers. The role of CBT is to establish and coordinate the weekly auction schedule. Traders buy the nuts using closed bids after obtaining the sales catalogue and select the lots based on quality specifications. After the auction, the buyers pay through the bank within seven days. Thereafter, CBT issues export permit to exporters after paying export levy to Tanzania Revenue Authority. Experience in Tanzania has shown that WRS has increased price competition to cashew farmers, reduced cheating by using wrong measurements, and enabled the government to obtain cor-rect cashew nut data. According to CBT (2015), the market price per kilogramme of raw cashew nut in 2014/2015 ranged from Tshs. 1,000 to Tshs. 2,200.

Research

In Tanzania cashew nut research is conducted by the Naliendele Agricultural Research Institute (NARI). The institute is funded by the government, donors and contributions from stakeholder funds. The cashew research is based on breeding, vegetative propagation, biotechnology, crop protec-tion, agronomy, socio-economics, extension and technology transfer as well as value addition.

Some of the achievements recorded by the research institute in the past twenty years include regis-tration of thirty pesticides against major pests and diseases and biological control of cashew pests and identification and registration of 22 improved cashew clones. This has made Tanzania the first country to register cashew clones in the world (Masawe and Bashiru, 2015). Other achievements include establishment of appropriate vegetative propagation methods of cashew and development of an integrated crop management programme.



Future perspectives

Production

Currently, the Government of the United Republic Tanzania through CBT and CIDTF has endeav-oured to increase cashew nut production and productivity by supplying farm inputs to farmers at subsidised or zero prices. CBT and CIDTF supply seeds, seedlings, pesticides and blowers to tra-ditional and new cashew growing areas. CBT and CIDTF have established a programme of plating 10,000,000 cashew trees with the objective of raising cashew production from the current average of 120,000 Mt to 300,000 Mt per season, within the next 5 years.

Processing

The Government of Tanzania through CBT and CIDTF has established a Cashew nut Processing Programme (CPP), which is used as an engine to rise cashew nut processing. Through this pro-gramme, CBT and CIDTF are on the way to build three cashew nut processing factories in Mtwara, Ruvuma and Coast regions with a total processing capacity of 30,000 Mt. Also Tandahimba and Newala Cooperative Union (TANECU) is constructing a processing factory with a capacity of 30,000 Mt per year. Also, the government through the Prime Minister’s Office has started discussions with private companies, which acquired the 12 factories sold to them in mid 2002. The discussions aim at upgrading the redundant factories so that they can soon start processing.

Marketing

The Government of Tanzania is on its way to transform cashew nut marketing from the current Ware-house Receipt System (WRS) to the Commodity Exchange System (CES). CES will enable cashew nut to be sold through electronic auctioning whereby the traders will buy nuts without taking the trouble of travelling to Tanzania. The role of CES will be to increase price transparency, price discov-ery and reduce transaction costs to both traders and farmers.

Research

NARI is planning to complete research in agro-processing of cashew apples where most of the valued and nutritious food products such as juice, jam and pickles will be processed commercially. Also NARI is in the process of establishing a Cashew Development Centre (CDC) at Mpwapwa District in Dodoma Region with the target of proving extension services to the Central Zone.

Challenges

Some of the challenges facing the cashew nut industry in Tanzania are listed below.

a) Small estates/farms: Most cashew is grown in small farms and are owned by family members; few



estates are owned by individual companies.

b) Poor productivity: Most cashew trees are more than 50 years old with declining productivity.

c) Low investment in cashew nut processing: Most of the local investors are allocated limited funds for cashew nut processing. This leads to minimum processing in the country, thus most raw nuts are exported to other countries

Conclusion

For the cashew industry in Tanzania to grow, joint efforts among actors in the cashew value chain is important. The stakeholders should use the available technology and invest more in production and local processing to create employment and increase famers’ income.

References

BOT (2013). Economic bulletin for the quarter ending March, 2013 Vol. XLV No. 1. Bank of Tanzania.

CBT (2015). Procurement records for 2014/2015. Cashew nut Board of Tanzania.

CBT (20131). Cashew nut industry strategy. Cashewnut Board of Tanzania.

CBT (20132). Cashew nut Processing Programme. Cashew nut Board of Tanzania.

Kasuga, L. J. (2010). Status of the Cashew nut Industry in Tanzania, Second International Conference, 26-29 April, Kampala Uganda.

Masawe, P. A. L., and R. A. Bashiru (2015). Report on development and achievements of research in cashew nut industry. Stakeholders meeting held in Lindi, 28-08-2015.

Ohler, J. G. (1979). Cashew. Communication 71, Department of Agricultural Research, Royal Tropical Institute, Amsterdam, The Netherlands.

PASS (2013). Investment potential in cashew nut industry. Parastatal Agricultural Sector Support.

UNIDO (2011). Tanzania’s cashew value chain: A diagnostic. United Industrial Development Organisation, Vienna Austria.



The Status of the Cashew Industry in Malawi

F.M. Chipojola1β and E.M. Kondowe2

1Bvumbwe Agricultural Research Station, P. O. Box 5748, Limbe, Malawi2Press Agriculture Limited, Private Bag, Kasungu, Malawi

•Email of the corresponding author: [email protected]

Abstract

This article outlines the status of cashew production in Malawi. The objective of the study was to establish constraints affecting the cashew industry with the aim to find possible solutions to reverse significantly the low cashew production. The study was conducted in 2012 in Mangochi, Machinga, Salima districts, in Nkope, Liwonde and Chikwawa areas. A multi-stage sampling technique was used to select the research area and respondents. Information was collected using a structured questionnaire and data was analysed using descriptive statistics in SPSS, to analyse the constraints experienced in ca-shew production. Notable constraints included lack of planting material (27.5%), low market prices (17.5%), pests and diseases (15%), and lack of markets and information (12.5%). It was recommend-ed that unless a seed system that will make available quality planting material to farmers is developed coupled with introducing a system of price differentials for different cashew grades, developing a sustainable biological control for powdery mildew, facilitating formation of farmers associations, and putting in place a coordinated effort and a long-term institutional commitment from the government with strong support from commercial companies, donors, and NGOs to train all stakeholders, the cashew industry will remain stagnant and unattractive. What conditions are economically attractive for Malawi smallholder farmers to increase production remains uncertain.

Key words: Malawi, cashew, constraints, seed system

Introduction

Agriculture is the most important sector of the economy, employing about 80% of the workforce (Ministry of Agriculture and Food Security, 2010). The sector is dualistic, comprising smallholders and estates. More than 90% of the rural population (2.5-3 million households) are smallholder farm-ers with customary land tenure. They cultivate small and fragmented landholdings of approximately 2.4 million hectares, with low yields, and are mainly subsistence-oriented. Average landholding size has fallen from 1.5 hectares in 1968 to around 0.8 hectares (MOAFS, 2010). Over 80% of this land is planted with maize. Dependence on maize has been responsible for the repeated food crisis in Ma-lawi when the maize crop fails due to prolonged dry seasons and unexpected mid season droughts. Agriculture forms the predominant occupation of the populace and one of the cash crops grown in the country is cashew.



The cashew (Anacardium occidantale Linn) is native to the coastal parts of north-eastern Brazil, but for over 40 years it has been grown in many parts of the world including Malawi. The cashew tree favours temperatures between 15oC and 33ºC, rainfall between 750 mm and 1250 mm, altitude from sea lev-el up to 2000 m in areas close to the equator (Aliyu, 2007). In Malawi, the cashew industry plays a big role in providing employment, food, firewood, generates cash income, and contributes to the national gross production of the country. It is grown by smallholders with less than one hectare per household and estates in the lakeshore districts of Mangochi, Salima, Nkhotakota, Nkhatabay, Karonga, and other districts like Chikwawa, Machinga, Nsanje and Phalombe. The propagation is mainly by seed collected from trees known to produce high yields with big nuts. The estate sector comprises of Chik-wawa and Kaputu under Press Agriculture Limited in Salima, Nkholosa estate under Maldeco Fish-eries Limited in Mangochi and many more. Total trees according to Kachule et al. (1998) were 140, 104 producing 153 metric tones of kernel and with recent developments where cashew trees are being cleared in favour of fisheries in Mangochi over 14,000 trees have been cut down decreasing the total number of trees. Land for expansion in Malawi is available, for example Press Farming alone has land in excess of 2,500 hectares and only about 600 hectares is planted with cashew. Personal Commu-nication (Harawa, 2012) indicated that smallholder farmers in Karonga harvest a lot of cashew that is sometimes traded across the borders of Tanzania through Songwe. It is estimated that smallholder farmers in Karonga have over 1,000 hectares of cashew trees producing as little as one kilogramme per tree or as much as 5 kilogrammes per tree if properly managed. It has further been indicated that about 130 metric tons of cashew nuts are sold to Tanzania each year depriving the factory in Salima of raw materials (Kachule et al., 1998).

The cashew industry in Malawi is significantly experiencing low production such that most trees produce between 0 and 8 kg each (Chipojola et al., 2009), a development which have seen major investors like Agricultural Development Marketing Corporation (ADMARC), Nkholosa estate, pull-ing out of the industry. This has been attributed to low cashew quality, which is a factor of quantity, but important challenges remain unknown or not understood to players in the cashew value chain. The overall purpose of the study was to establish constraints affecting the cashew industry with the ultimate goal of finding possible solutions to address or reverse the declining trend for the betterment of the producers.


The study was carried out in 2012 involving all players in the cashew value chain. A multi-stage sampling technique was used to select districts, areas and respondents. The first stage was to carry out purposive sampling involving three main cashew-producing districts of Salima, Machinga and Mangochi. The second stage involved random selection of at least one area from each of Chikwawa, Liwonde and Nkope. The last stage dealt with random selection of 12 respondents per area totalling 36 cashew farmers. Policy makers, a processor, extension workers, chiefs, traders and estate owners were included in the study as key informants. Information was collected with the aid of a structured questionnaire. Data was analysed using descriptive statistics in SPSS in order to determine the so-cio-economic variables of the respondents as well as to analyse the constraints faced in cashew pro-



duction. Two focus group discussions (FGDs), involving 10 farmers each, were sampled in each area. There were 6 groups in total, with both female and male cashew producers. A checklist was used in the focus group discussions to gather information on possible interventions to revive the industry.


The respondents of which 15 were males and 21 females with age ranging from 19-57 years were grouped accordingly (those who never got married, separated or widowed and married). Information on the marital status of the respondents is provided in Table 1 below.

Table 1: Marital status of respondents (n=36)

Marital Status Male % Female %Never married 2 13.3 1 4.8Married (monogamous husband) 9 60.0 10 47.6

Married (polygamous husband) 3 20.0 0 0.0Separated/divorced 1 6.7 4 19.0Widowed 0 0.0 6 28.6

The socio-economic characteristics of the household (HH) has shown that there is an average of six individuals per HH with 20.8% falling in the age group of 5-17 years, 31.9% in 18-25 years, and 47.3% from 26 years and above indicating a large number of people being elders who could ably work in the orchards as a source of labour. Regarding the level of education of the respondents, it has been shown that 58.3% of HH individuals attained primary education, 33.4% secondary education, 1.8% tertiary education and 6.5% never went to school. Furthermore, results have shown that the average number of cashew trees per HH was 43. The trees were intercropped in many cases with maize, cassa-va and pigeon peas. The spacing between trees varied greatly such that to estimate number of hectares was not easy.

The study revealed the following nine constraints: lack of improved planting material (27.5%), low price for raw nuts (17.5%), pests and diseases (15%), and markets and information (12.5%). All these were above the average of 10.2%, indicating the seriousness of the problems facing the cashew production. Others were research and extension services (10%), coordination and policy (7.5%), lack of knowledge (5%), lack of processing units (2.5%), and lack of by-product usage 2.5%. These were below average. This information is presented in Figure 1 below.

Lack of improved planting materials ranked first and it was noted that most of the respondents knew nothing about grafting as a method of propagating planting material. The estate sector is using grafted plants to establish orchards unlike the smallholder farmers who are using seed, which is locally col-lected and directly planted, in the field. This could be attributed to high prices and unavailability of such planting materials, yet the availability of economically good planting material is the foundation of any successful production system.



Figure 1: Numbers of participants mentioning constraints experienced in cashew growing

Low prices of raw cashew nuts was ranked second as a setback in cashew nut production within the smallholder sector which in most cases is for subsistence, although the total volume of marketable surplus among smallholder production is large. The study has revealed that buyers to which small-holder cashew growers sell their nuts offer very low prices (K50/kg of nut in shell). This could be due to transport costs incurred by buyers as well as low nut quality, which have direct and significant influence on price as reported by Shomari (2002). The low quality could be a result of lack of business motive in production for smallholder farmers; as such, trees in most cases are left to grow uncared for.

The low quality could also be due to poor post harvest handling. As reported by Kachule et al. (1998) this trend forced ADMARC to pull out of the industry as processors. The management of Press Ag-riculture Company, which buys nuts in almost all the areas including Karonga District, complained of low volumes of raw nuts as most farmers opted to sell to vendors from Tanzania. The low prices could be attributed to the fact that kernels are marketed within the country, and the highest consumer being supermarkets that monopolise the market due to lack of marketing regulations. In this regard, the country is losing much according to Kachule et al. (1998).

Insect pests and diseases [mainly powdery mildew disease (PMD)] were some of the major cashew production constraints. The small-scale cashew farmers are greatly affected with PMD and it was noted that farmers do not use fungicides to control the disease compared to the estate farms. This could be due to lack of capital to purchase spraying equipment and fungicides. The disease can reduce cashew yields close to zero (Shomari, 1988; Siboe, 2002).

Moreover, farmers lacked market information, an important tool for small farmers or big estates. This is because, in most cases, information on the actual demand for particular commodities is published



in newspapers or internet to which farmers do not have access, yet planning is done according to demand. Marketing of cashew nut has been a problem particularly to the producers and this corrob-orates what Shomari (2002) found out, that market and price information influences many aspects of production, processing and marketing.

Lack of effective research and extension services was below average and the study revealed that re-search had been conducted inadequately. This includes agronomic research, which was conducted some years ago in the areas of propagation and nutrition. The low level of research is attributed to the high competition amongst tung, macadamia and pecan; and lack of capacity such that cashew re-ceived little attention. It was also noted that the country did not have a cashew breeding programme, although currently work is underway at Chitala Research Station in Salima to evaluate high yielding trees in the country which will later be cloned. Extension services were lacking and this contributed to lack of knowledge by the agents; this could be as a result of frequent transfers, retirement and deaths experienced in the extension department.

Another drawback to the cashew industry was related to lack of an enabling policy environment and coordination amongst stakeholders in the cashew industry. Researchers, extension agents and pro-ducers have no platform to interact and share their views, problems and scientific information. It has been noted that the prevailing policies regarding trade liberalisation, taxation and subsidies have not contributed to an enabling environment for the players.

The study has revealed that value chain players lacked knowledge on good agricultural practices let alone the vegetative propagation methods being employed in cashew estates. This could be attributed to inefficient extension network where extension staffs are just transferred to any other areas without consideration of what they are capable of doing. There are also problems connected to inadequate farmer training, inefficient dissemination of research findings on improved technologies and alterna-tive management practices.

There is one processing unit owned by Press Agriculture Limited in Salima and the unit is underuti-lised due to low production. The nut intake from Press Agriculture Limited, Nkholosa estate in Man-gochi, and farmers across the growing areas does not meet the factory capacity and as a result most of the processing stages are done manually to avoid unnecessary expenses on electricity. Locally, farmers just roast the nuts in an open perforated pan to burn off the Cashew Nut Shell Liquid (CNSL) and when the nuts catch fire they are thrown onto the sand or saw dust to extinguish the flame then later cooled and shelled for eating or sale. Manual processing could affect nut quality in the end because hygienic protocols could be overlooked. The low number of processing units could be attributed to lack of interest by investors due to low production, and frequent power failure. The study established that inadequate use of cashew by products is caused by lack of proper machinery or equipment.


The majority of the respondents considered lack of improved planting materials, low farm gate pric-es for raw cashew nuts, insect-pests and diseases as the main constraints; as such there is a need to



make collective effort to intervene. A deliberate policy to induce incentives for farmers to adopt new technologies would be better aligned with attractive financial investment. Viable incentives and in-stitutional support will be required for smallholders to adopt these alternative and new technologies in an environment where cashews are not the main crop with declining production. Based on the discussions the FGD proposed the following recommendations or solutions in order to increase pro-duction of cashew:

a) Deliberate effort should be made to acquire new germplasm from the existing network, to de-

velop a seed system that will ensure availability of improved planting material to farmers.

b) There is a need to introduce a system of price differentials for different grades at the farm gate. The system should be simple, easy to operate and should be developed in close collaboration with all stakeholders in the cashew industry. Vital formation should be made available to farm-ers’ associations and groups in order to achieve a stronger bargaining power for better price, and credit facilities.

c) Sustainable biological control for PMD should be developed, to improve understanding of the epidemiology of PMD at macro and micro levels.

d) Farmers’ associations should be started, and storage facilities improved at village level. Produc-tion of extension materials like leaflets, films, radio programmes or video to revive the industry, should be undertaken.

e) There is a need for sustainable funding of cashew research and development. Malawi should emulate the approach adopted in cashew research in Tanzania.

f ) There is a need to review the existing institutional framework within the country to determine what would work best. In order to achieve this, dialogue between stakeholders is necessary to put in place new rules and regulations, and determine how best the government can intervene on taxation. Research and development need to be market-oriented, demand driven and sus-tainable.

g) There is a need for coordinated effort and a long-term institutional commitment from the gov-ernment with strong support from commercial companies, donors and NGOs to train farmers on all aspects of cashew value chain which include appropriate post harvest handling, develop-ment of strategies to increase yield and quality of nuts and maximisation of the use of inputs.

h) Establishment of farmers’ and processors’ associations will help in developing business partner-ship between all players. This will facilitate the implementation of a code of practice for pro-cessing of cashew nut in line with international standards and certification systems like Hazard Analysis and Critical Control Points (HACCP).



i) Product diversification would therefore include processing of juices, wine and gin from the cashew apples that is discarded in most cases. Besides product diversification, the processed nuts (kernels) and apples could be used in different food varieties, such as dried fruits, jams, chutneys and livestock feed. In addition, the cashew nut shell liquid (CNSL) can be utilised in the manufacturing of paints, building materials, brake linings, wood treatments, and insecticide for the control of termites.

Acknowledgements

We wish to thank all players (traders, farmers, processors, researchers and policy makers) in the ca-shew value chain for providing valuable information. Mrs. Ida Mwato the Crops Officer at Machinga Agricultural Development Division is equally thanked for her encouragement. The Government of Malawi and Press Agriculture Limited are thanked for providing technical guidance and financial support.

References

Aliyu, O. M. (2007). Clonal propagation in cashew (Anacardium occidentale Linn): Effect of rooting media on the rootability and sprouting of air-layers, published online Tropical Science Journal, 47 (2), 65-72.

Chipojola, F. M., Mwase, W. F., Kwapata, M. B., Bokosi, J. M., Njoloma, J. P., and Maliro, M. A. (2009). Morphological characterisation of cashew (Anacardium occidentale Linn.) in four populations in Malawi. African Journal of Biotechnology, 8(20), 5173-5181.

Kachule, R. N., Nakhumwa, T. O., and H. Tchale (1998). Status of the horticulture sector in Malawi

Ministry of Agriculture and Food Security (2010). In Cassava and sweet potato production handbook. pp. 28-29.

Shomari, S. H. (1988). A review on cashew research in Tanzania. Paper presented at the Tanzanian Agricultural Research Master Plan Conference, Arusha, Tanzania, 12-15th December 1988.

Shomari, S. H. (2002). Opportunities and constraints to the development of cashew exports in eastern and southern Africa.

Siboe, G. M. (2002). The cashew (Anacardium occidentale L.) powdery mildew disease epidemic in Kenya. Journal of Tropical Microbiology, 1 (1), 8-13.



Nigerian Cashew Economy: Dimensions to Growth Paradigm

S. Anga

National Publicity Secretary, National Cashew Association of Nigeria

Coordinator Agribusiness, Community of Agricultural Stakeholders of Nigeria

E-mail of the corresponding author: [email protected]

Abstract

This article examines the current realities of Nigeria’s cashew economy as it relates to the growth and value chain expansion paradigm. To this end, this article looks at how Nigeria’s socio-political and economic realities have propelled the national economic thrust towards further enhancement of gains and profitability of commercial crops such as cashew as a means of generating more gainful employment, foreign exchange and sustainable economic growth. Also, focus is on how the National Cashew Association of Nigeria, an umbrella body for Nigeria’s cashew industry is impacting the growing interest on cashew as a profitable agribusiness in Nigeria. The article likewise evaluates the issues that constitute major constraints to the rapid growth of the cashew agribusiness in Nigeria. Lastly, it articulates practical approaches that will facilitate the enabling of sustainable positive growth of the cashew agribusiness in Nigeria.

Key words: agribusiness, cashew, commerce, commercial farming, economy

Introduction

Cashew (Anacardium occidentale L.), a tropical nut tree crop which serves as a source of food, income, industrial raw material and foreign exchange for many countries in Africa, Asia and Latin America, originated in Latin America, specifically north-eastern Brazil (Ohler, 1979). Apart from being a source of useful products and by-products for food, pharmaceutics and other industrial applications, cashew provides useful shade as ornamental and alley trees, and cashew trees are suitable for the control of soil erosion, particularly for the protection of watersheds and dams (Ezeagu, 2002). Historically, Portuguese explorers introduced cashew to parts of Africa and Asia from where it spread to other parts of the world and presently it is produced in thirty-two countries with sufficient warm and humid climatic conditions (Adeigbe et al., 2015). For over four hundred years after the Portuguese traders’ introduction of cashew into Nigeria in the 16th century (Woodroof, 1967), cashew trees were exploited mainly for its apple, and almost no commercial value was attached to the nuts (Aliyu, 2012). According to Ezeagu (2002), cultivation of cashew in Nigeria started in the early 1950s, through the efforts of the then Eastern Nigeria Agricultural Development Corporation where the initial objective was to use cashew trees for erosion control, because of the massive erosion problems in that part of the country. However, the designation of cashew nut as a potential revenue-earning commodity



propelled the defunct Eastern Nigeria Government to commence the first Nigerian cashew plantation which dates back to 19541, with 800 hectares in the present Enugu State whereas 200 hectares in the Western part of Nigeria were similarly established by the defunct Western Nigeria Government (Ezeagu, 2002). Nevertheless, cashew production did not greatly increase during the early 60s, with harvests not exceeding 200 tons. Since the deregulation of Nigeria’s economy in 1986, its production has substantially increased (Ezeagu, 2002).

Currently, cashew farming has grown remarkably, and it is cultivated in all geo-political zones of Nigeria at different proportions. Evidently, the major cashew growing areas in Nigeria are in Enugu, Abia, Imo, Anambra, Ebonyi and Cross River States in the eastern part of the country; Oyo, Osun, Ondo, Ekiti and Ogun States in the western part; Edo and Delta States in the Niger Delta; Kwara, Kogi, Nassarawa, Benue, Taraba, Niger and FCT in the Middle Belt, and Sokoto and Kebbi States in the north-western part of the country (NEPC, 2015). Statistically, cashew farming is at its lowest in north-eastern part of Nigeria, whereas the bulk of exported nuts comes from the eastern, western and middle belt states (NEPC, 2015). The Government of Nigeria estimates the area under cashew production as 375,000 ha in 2003 against 278,000 ha in 1999, which is about 8% annual increase of the area under cultivation, over a period of four years (Nugawela et al., 2005). Also, looking back at the cashew economy, women were engaged in factory processing work such as shelling, peeling, grading and packing cashew kernels and earn comparatively a stable income.

However, the main driver of change is the existence of an increasing export market for raw nuts and the potential market for processed nuts both locally and internationally (Nugawela et al., 2005). In recent times, there has been a steady increase in Nigeria’s annual cashew nut production from 460,000 MT in the year 2000 to 856,500 MT in the 2012. The production figures of 2012 for Nigeria are 45% of cashew nuts produced in Africa (FAOSAT, 2013). The production output estimate of 650,000 MT for 2010; 813,023 MT for 2011; and 835,500 to 856,500 MT for 2012 indicates that Nigeria’s production has steadily increased (Aliyu et al., 2011; FAOSTAT, 2013). In concordance with data released by FAOSAT (2013) and Aliyu et al. (2011), a survey carried out by the Nigeria Component of the West African Cashew Survey, in February 2001, under the auspices of the Sustainable Tree Crop Project (STCP) funded by Common Fund for Commodities, indicated that a much larger surface was planted with cashew between 1995 and 2000 (Ezeagu, 2002).

By 2013, Nigeria was listed as one of the top ten raw cashew nut producing countries in the world, with a production figure of approximately 150,000 metric tones export grade cashew nuts. Nigeria is adjudged the third largest producer in Africa after Cote d’Ivoire and Tanzania, and seventh largest in the world (NEPC, 2015). In 2013, cashew was recorded as the third largest agricultural export and foreign exchange earner for Nigeria; and about USD 110 million was earned by exporters from cashew, which represents about 10% of all agricultural export (NEPC, 2015). Noteworthy, Nigeria’s cashew export

1 The first commercial cashew plantation in Nigeria was inaugurated in the mid 1950 at Ogbe, Oji, Udi and Mbala by the defunct Eastern Nigeria Development Corporation (ENDC), and Iwo, Eruwa as well as upper Ogun by defunct Western Nigeria Development Corporation (WNDC) (Akinwale and Esan, 1989; Asogwa et al., 2009).



was largely being imported by Singapore, India, Vietnam, UAE and Hong Kong in 2013 and 2014 (NEPC, 2015). According to Nugawela et al. (2005), since 1990s, Vietnam and Indian have been the leading buyers of Nigerian cashew nuts. Tola Faseru2 (personal communication, 2015), observes that both countries are currently the biggest importers of cashew nuts from Nigeria. Similarly, the demand for Nigeria’s cashew kernels in international markets such as USA, United Kingdom, Germany, UAE, Saudi Arabia, Spain and Italy is growing (Tola Faseru, personal communication, 2015). According to Nguyen Duc Thanh, the Chair of the Vietnam Cashew Association, despite Vietnam enjoying a bumper cashew crop last year when output topped 500,000 tons, it imported 769,390 tons in 2014, a year-on-year increase of 59.28 % to process for export. Consequently, Nigeria was the second largest supplier to Vietnam in 2014, selling 106,734 tons or 13.4% of Vietnam’s imports (Vietnam News, 2015).

The cashew agribusiness in Nigeria comprising of trading and exports is projected as worth twenty-four billion naira (USD 160 million) as in 2014, and over one million people depend on the industry for their livelihood (Adeigbe et al., 2015). Based on informed forecast Tola Faseru (personal communication, 2015) notes that cashew is projected to contribute about fifty billion Naira, which is around USD 251 million to Nigeria’s economy in the year 2015. The significant rise in earnings and revenue makes cashew a major economic focus of the Federal Ministry of Agriculture and other concerned stakeholders. Interestingly, Nigeria’s growth gain in cashew production is partly attributable to the Cocoa Research Institute of Nigeria (CRIN), which has the mandate to research into cashew, and has developed an improved variety of cashew called ‘Brazilian Jumbo’ with nuts maturing within one year, in contrast to the local wild varieties, which mature after five years (Ezeagu, 2002).

Overview of cashew growth and economy in Nigeria

This article is derived from an analytical review of the National Cashew Association of Nigeria secretariat’s policy approach to the promotion of the growth of cashew business in Nigeria, the secretariat’s findings on the prevailing realities of cashew business in Nigeria, the Nigerian Government Agribusiness Policy as it concerns cashew business in Nigeria, as well as the National Cashew Association of Nigeria’s articulations on how to further drive the growth and inclusiveness of cashew business in Nigeria in a manner that promotes decent income generation and livelihood for Nigerian youths, women and men (NEPC, 2015). Mostly, the material for this overview is generated from NCAN secretariat’s in-house discoveries in the field in conjunction with its collaboration with the cashew farmers, traders, processors, and relevant Nigerian Government agencies and policy makers.

Descriptive analysis was used to analyse the socio-economic characteristics of respondents, marketing practices and experiences of respondents as well as the prevailing challenges to cashew agribusiness in Nigeria. Discussion focuses primarily on the following themes: what has led to the designation of cashew as a major commercial crop in the present Nigerian agribusiness economic policy thrust, and how to further enhance the present state of cashew commerce in Nigeria to attain the status of the

2 Tola Faseru is the current president of National Cashew Association of Nigeria (NCAN). He granted interview to Aniago, E. on Feb., 2015 on the topic Expanding Cashew Economy in Nigeria



largest cashew hub in the world in tandem with Nigeria’s massive economic potential. To appreciate the plausible genesis of the designation of cashew as a cash crop from its predominant status as a family fruit tree, the ongoing efforts to propel cashew to the position of a huge commercial crop, we need to appreciate the socio-economic realities that necessitated the current focus on cashew. Essentially, the evolution of cashew as a robust industry, developing into what we may refer to as Cashew Economy in Nigeria and the trajectories of this industry form the thematic focus. What do we mean by the expression Cashew Economy in Nigeria?

The cashew economy in Nigeria represents the various activities of people in relation to cashew in Nigeria, covering areas such as cashew farming, buying and selling of cashew between farmers and produce buyers, cashew processing, utilisation and optimisation of the value chain, and cashew research and development related activities. Culmination of activities started from the period Nigerian cashew farmers began planting cashew trees with the sole purpose of nurturing them for harvest and sales as viable profit making venture. We can also say that cashew economy in Nigeria is about how cashew has become a focal point by the policy makers as a major crop to be developed into a major commercial agro-crop for domestic and foreign markets.

There are evidences of some imported cashew kernels in big supermarket outlets and wholesale markets in Lagos. Supermarkets surveyed in a 2003/2004 New Nigerian Foundation (NNF) study on domestic consumption indicated an increasing demand (Nugawela et al., 2005). To this, Tola Faseru (personal communication, 2015), observes that presently more supermarket outlets in Lagos, Abuja and other capital cities are having varieties of imported kernels displayed on their shelves. To sufficiently appreciate the current state of cashew business in Nigeria, there is need to look back at the state of cashew utilisation in the past and efforts of cashew stakeholders such as the National Cashew Association of Nigeria (NCAN), Federal Ministry of Agriculture, Nigerian Export Promotion Council, and Nigerian Export and Import Bank, at promoting the cashew business agenda. Thus, the evolution of cashew in Nigeria from a mere leisure edible fruit tree for immediate family members, relatives and friends, to a cash crop that generates minimal amount of money from time to time, into a commercial crop which is deliberately planted, nurtured properly, harvested and processed with best global practices and sold to traders who either sell them in the domestic or foreign market. Similarly, discussion on cashew evolution and economy in Nigeria cannot be complete without understanding the challenges that confront the cashew commerce in Nigeria and the practical methods through which such challenges could be overcome.

Cashew industry stakeholders’ views

Stakeholders in the cashew industry in Nigeria such as the Federal Ministry of Agriculture, National Cashew Association of Nigeria, Raw Material Research and Development Council, USAID NEXTT, CRIN, Federal Ministry of Trade and Investment, and Nigerian Export Promotion Council are of the view that the cashew economy in Nigeria should have advanced much further than its current state if the previous governments at both the States and Federal levels had not allowed the over dependence on oil dollar to hamper the continuation of a robust cashew development plan. In line with this view,



Akinwunmi Adesina (personal communication) in his presentation at the 19th Nigerian Economic Summit tagged Growing Agriculture as a Business to Diversify Nigeria’s Economy noted that in the 1960’s Nigeria used to be a market to be reckoned with in the area of agriculture.

However, the discovery of oil has made Nigeria neglect agriculture and the nation has become a net importer of food including cashew (NESG, 2013). The current focus back to commercial crops such as cashew is because the future of earning from crude oil export is not bright. Thus, Nigeria must free herself from dependence on crude oil and concentrate on agriculture as it has enormous opportunities to increase the country’s GDP (NESG, 2013). This encapsulates the policy focus of Nigeria in recent years because Nigeria’s potentials are centred on being “blessed with eighty-four million hectares of arable land, of which only 40% is cultivated” (NESG, 2013). Similarly, Nigeria has two of the largest rivers in Africa in addition to availability of cheap labour and huge market population of 167 million people (NESG, 2013). Clearly, based on the need to diversify the means of earning foreign exchange for Nigeria, the Nigerian Government began the process of enhancing the enabling environment for agribusiness such as cashew to thrive by coming up with the Nigerian Agricultural Transformation Agenda (ATA), which is mandated with an objective of turning agriculture into a money-making business and away from being a development project (NESG, 2013). The Nigerian Agricultural Transformation Agenda prioritises on the need to:

......revive the Agricultural Research Council of Nigeria to enhance coordination of research activities across the different agricultural research institutions in Nigeria. This reform should be focused on ensuring that agro-research activities are driven by market demands, and should foster deeper linkages between the research institutions and the private sector. The reform of the council should also be geared towards increasing overall R & D spending in agriculture, and ensuring that such spending is optimally utilised (NESG, 2013).

In addition to the policy mandate stated above, the Nigerian Agricultural Transformation Agenda encapsulates the need to:

....increase efforts at raising the level of awareness of agriculture as a highly profitable business venture; and to address the issues of an aging farmer population and the poor perception of farming as an occupation amongst Nigerian youths. Considerable efforts must go into increasing the attractiveness of the sector through awareness campaigns. Such campaigns will focus on celebrating the successes of youth farmers and the enlightenment on incentives in place to enable new investors in agriculture to succeed (NESG, 2013).

Also, as part of the enabling environment which will formally institutionalise the private enterprise driven agribusiness that includes cashew, the Nigerian Government began the process of establishing commodities exchange to expand agricultural markets. According to the 19th Nigerian Economic Summit report, financing agribusiness to guarantee a successful industry transformation means securing affordable financing for agricultural projects is crucial for the development of the industry (NESG, 2013). This is also an enabling environment for cashew commerce to thrive.

According to NCAN, it has domesticated the effort of the Federal Government of Nigeria in transforming the agricultural fortunes in Nigeria, and articulated in the Nigerian Agricultural Transformation Agenda in its cashew economy agenda. The growing synergy between NCAN and



the Federal Government of Nigeria’s Agricultural Transformation Agenda is yielding positive results. Hence, cashew farmers and the business community are reporting progress and profits in their ventures. From its own perspective, NCAN contends that its deliberate approach at creating and sustaining awareness in relation to cashew business has gone a long way at keeping the cashew stakeholders abreast with current happenings in cashew business opportunities within the domestic and foreign markets. NCAN contends that its efforts have not only provided the cashew stakeholders with the necessary information essential for the optimal gains in cashew economy in Nigeria, but have also encouraged those individuals who are not presently in cashew business to join. NCAN believes that information is the key to informed approach to cashew business, thus it is going on with networking and coordination of efforts through seminars, conferences, extension programmes, farmer trainings, capacity building for cashew processors, traders, exporters and promotions through the mass media. Despite the encouraging facts and figures, NCAN is of the view that more work needs to be done to further enhance the gains of the cashew economy in Nigeria. Whereas the Federal Government is interested in making foreign exchange through export, NCAN also thinks that domestic market has a lot of potential for Nigeria because of the size of the population and economy; hence, the campaign towards the development of the domestic market as a means of harnessing the enormous potential from cashew value chain, through more investments in production and in industrial processing of all by-products of cashew. No doubt, this will create more meaningful jobs, enhance people’s well-being, and make Nigeria’s cashew finished products more available in both local and international markets.

We believe that with cashew, we can truly make a difference and create greater prosperity. Considering the size of Nigeria’s population, it is possible for us to build a domestic market that will consume over 50% of the cashew nuts produced in all of Africa by encouraging only 20% of our population to consume 400 grams of cashew kernels each month. This will bring our domestic consumption to 13,600,000,000 grams (13,600 tons) and in 12 months we will be consuming 163,200 tons of cashew kernels; that is we will require 652,800 tons of raw cashew nuts to service just our domestic needs alone. In line with making this projection a reality, NCAN started the ‘Eat Cashew Campaign’ in 2012. An expanded project for the campaign will be launched in 2016.

Conclusion

The main factors influencing production and harvesting performance of cashew in Nigeria include several internal and external factors. However, most of the factors influencing production, harvesting, processing, and export of cashew include market price of the product, low yield, climatic conditions, competition amongst the local buying agents, product quality, diseases, pests, fire outbreaks, and high cost of cashew processing. Evidently, commensurate pricing plays a major role in the production of cashew because it encourages the farmers who are assured of getting proportionate value for their efforts. Therefore, higher prices act as incentives to farmers, although over pricing could be a problem; the government should ensure that price slump is avoided through proper regulatory policies. As far as yield is concerned, low crop yield is a big challenge in Nigeria. The development and commercial



multiplication and planting of high yielding cashew varieties with yields of at least 1.5 tons per hectare will help improve productivity and profitability and get more farmers turn to cashew cultivation.

In relation to climatic conditions, the better the weather during the flowering season, the better the harvest. Particularly, when there is shortfall in rainfall or sunshine, the quality of the cashew is lowered. Hence, in the period of adverse weather conditions, the government should have in place adequate cushioning to guide against farmers going out of business. Based on careful observation of the cashew market realities, local cashew buying agents play a very important role in the cashew supply chain in Nigeria, and there is the inclination for production to increase whenever there are more local buying agents trying to secure supplies. The usefulness of the agents is evident in their individual efforts in attempting to penetrate villages in producing areas, in a bid to source supplies. The government should therefore provide employment to youths by encouraging them to become supply agents through soft starter loans to commence sourcing of products. The benefit of this is that competition amongst cashew supply agents, especially when export prices are attractive, tends to develop between established buyers and local firms.

On product quality, NCAN encourages farmers to preserve the value and quality of their cashew through proper drying; hence, after harvest, cashew nuts must be dried properly to a moisture level of 10% and then packed in jute bags and stored appropriately. Another problem to be taken seriously is diseases and pests control, because diseases and pests significantly lower production and harvest. The government could reduce this problem by giving support to disease and pest control officers in the Federal Ministry of Agriculture. From the findings by NCAN, fire outbreaks which in some cases are deliberately set off by youth hunters who are hunting rodents and bush meat, destroy sizeable amount of cashew crops annually. This is common in the Guinea Savannah ecological zones which produce cashew. Bush burning occurs especially during the dry season, and it coincides with cashew harvesting season. This can be tackled by getting farmers to create fire breaks within their cashew farms; and they can also be encouraged to take up cashew crop insurance for their farms.

On high cost of cashew processing, the government can give investment incentives to cashew processors to lower the cost of processing and thus make the kernels more competitive globally. Beyond outlining the problems and challenges, NCAN through its networking, seminars, capacity building and other sensitisation activities combined with its collaboration with government and development agencies is trying to tackle these issues. Most importantly, NCAN as a stakeholders’ forum is articulating these realities and forwarding the same to government for attention and action.



References

Adeigbe, O. O., Olasupo, F. O., Adewale, B. D., and A. A. Muyiwa (2015). A review on cashew research and production in Nigeria in the last four decades. Scientific Research and Essays, 10(5), 196-209.

Akinwale, S. A., and E. B. Esan (1989). Advances in cashew breeding in Nigeria. In Progress in tree crop research (2nd ed.). Cocoa Research Institute of Nigeria, (CRIN), Ibadan, Nigeria, 166-174.

Aliyu, O. M. (2012) Generic diversity of Nigeria cashew germaplasm, Generic Diversity in Plant: http://www.intechopen.com/books/genetic-diversity-in-plants/genetic-diversity-of-nigerian-cashew-germplasm

Aliyu, O. M., Adeigbe, O. O., and J. A. Awopetu (2011). Foliar application of the exogenous plants hormones of pre-blooming stage improves flowering & fruiting in cashew (Anacardium occidentale) Journal of Crop Science Biotech, 14(2), 143-150.

Asogwa, E. U., Ndubuaku, T. C. N., and A. T. Hassan (2011). Distribution and damage charactersitic of Analeptes trifasciata Fabricius (Coleoptera cerambycidae) on cashew (Anacardium occidentale Linnaeus 1753) in Nigeria. Agric. Biology Journal Nor Ame, 3, 421 – 431

Ezeagu, W. (2002). Assessment of the situation and development prospects for cashew nut sector: A report on Nigerian Export Promotion Council. Abuja Nigeria (13): 1-37.

Faseru, T. (2015). Expanding cashew economy in Nigeria. Personal communication, with Aniago, E., Lagos, Nigeria on February 2015.

National Cashew Association of Nigeria (NCAN) http://ncan.org.ng/index.php

NEPC (2015). ACA World Cashew Festival & Expo, Maputo, Mozambique, 21 – 24 September, 2015, Abuja: Nigerian Export Promotion Council, (NEPC),1 – 22

NESG (2013). Report on the 19th Nigerian Economic Summit: Growing agriculture as a business to diversify Nigeria’s economy. Lagos: The Nigerian Economic Summit Group Ltd/Gte.

Nugawela, P., and Oroh, R. (2005) Cashew sub-sector strategic framework: Using cashew sector markets for pro-poor growth in Nigeria. PrOpCom, Monograph Series: Making Nigerian Agricultural Markets Work for the Poor, Abuja, Nigeria, (1), 1 – 48

Ohler, J. G. (1979) Cashew. Koninklijk Institute Voorde, Tropen, Amsterdam.

Viêt Nam News (2015). Cashew firms discuss Nigeria trade, February, 04 2015, http://vietnamnews.vn/economy/266061/cashew-firms-discuss-nigeria-trade.html

Woodroof, J. G. (1967) Tree nuts: Production, processing & products. (1) AV. Publ. Co. Incorporation, UK.

Proceedings of the 3rd international cashew conference

Education

Transcript of Proceedings of the 3rd international cashew conference