lable at ScienceDirect

Nutrition 28 (2012) 173–181

Contents lists avai

Nutrition

journal homepage: www.nutr i t ionjrnl .com

Basic nutritional investigation

Probiotic Enterococcus lactis IITRHR1 protects against acetaminophen-inducedhepatotoxicity

Sapna Sharma M.Phil. a, Jaya Chaturvedi M.Sc. a, Bhushan P. Chaudhari M.V.Sc. b, Ram L. Singh Ph.D. c,Poonam Kakkar Ph.D. a,*aHerbal Research Section, Indian Institute of Toxicology Research (CSIR), Lucknow, Uttar Pradesh, IndiabHistopathology Laboratory, Indian Institute of Toxicology Research (CSIR), Lucknow, Uttar Pradesh, IndiacDepartment of Biochemistry, Dr. Ram Manohar Lohia Avadh University, Faizabad, Uttar Pradesh, India

a r t i c l e i n f o

Article history:Received 22 October 2010Accepted 28 February 2011

Keywords:AcetaminophenAntioxidantBcl2/BaxEnterococcusLiver toxicityProbiotics

Financial support received under the Supra-Institutiand from Indian Council of Medical Research, Negratefully acknowledged.* Corresponding author. Tel.: þ91-0522-221-3786,

þ91-0522-262-8227.E-mail address: poonam_kakkar@yahoo.com (P. K

0899-9007/$ - see front matter � 2012 Elsevier Inc. Adoi:10.1016/j.nut.2011.02.012

a b s t r a c t

Objective: Acetaminophen (APAP), an antipyretic/analgesic drug, is reported to cause toxicity onoverdose. Dietary supplements are currently being explored to decrease toxicity. In the presentstudy, the protective effect of probiotic Enterococcus lactis IITRHR1 was evaluated at different doses(107, 108, and 109 colony-forming units) against APAP-induced liver damage.Methods: Male Wistar rats were administered APAP (1 g/kg of body weight orally) for 14 d, andhepatotoxicity was assessed by marker enzymes in serum and observation of histopathologicchanges. Rats were pretreated with probiotic E. lactis IITRHR1 for 7 d and modulation of antioxi-dant enzymes (superoxide dismutase, catalase, glutathione peroxidase, glutathione-S-transferase),redox ratio, and ferric reducing antioxidant power was assessed. Oxidative damage by APAP tomembrane lipids, proteins, and DNA was also observed. Involvement of Bax, Bcl2, cytochrome c(pro-/anti-apoptotic proteins), caspases, and their modulation was assessed by immunoblotanalysis and reverse transcriptase polymerase chain reaction.Results: The E. lactis IITRHR1 pretreatment lowered the level of biomarkers of hepatotoxicity inserum. A significant increase was observed in the level of antioxidant enzymes and redox ratio anddecreased oxidative damage to membrane lipids and proteins. Probiotic E. lactis IITRHR1 alsomodulated key apoptotic/anti-apoptotic proteins such as cytochrome-c, Bcl2, Bax, expression ofcaspases, and resultant DNA damage.Conclusion: Probiotic strain E. lactis IITRHR1 was found to have antioxidant capacity and affordedprotection against APAP-induced hepatotoxicity by modulating antioxidant status, pro-/anti-apoptotic proteins, caspases, and DNA damage.

� 2012 Elsevier Inc. All rights reserved.

Introduction

Acetaminophen (APAP) is a commonly used over-the-counteranalgesic/antipyretic drug. It is safe at therapeutic doses but anoverdose is reported to cause severe liver injury [1,2]. Glucuronyltransferases/sulfotransferasesdirectly conjugate a large portionofthe therapeutic dose of APAP. The remaining part is converted toa reactive metabolite, N-acetyl-p-benzoquinone imine (NAPQI),by cytochrome P450 2E1 (CYP2E1) [3]. NAPQI forms a glutathione

onal Project (SIP-08), CSIRw Delhi as fellowship is

262-7586, ext. 269; fax:

akkar).

ll rights reserved.

(GSH) adduct that is excreted in bile [4], leading to depletion ofhepatocellularGSH.AfterexhaustionofGSH, the remainingNAPQIreacts with other cellular proteins. Binding of NAPQI to mito-chondrial proteins is the key initiator of APAP-induced cell death,leading to liver toxicity [5]. An exploration of dietary antioxidantsthatwouldoffer protection againstAPAP-inducedhepatic injury isbeing performed by many research groups [6]. Reported protec-tive agents are N-acetylcysteine, activated charcoal, and somemedicinal plants, but contraindications in immunocompromisedindividuals, allergic reactions, and gastrointestinal disturbanceshave been reported [7].

Probiotics, the live microbial food supplements, have beenused for the prevention of bacterial infections, alcohol-inducedoxidative stress [8], hepatic encephalopathy [9], cancer therapy[10], and non-steroidal anti-inflammatory drug enteropathy [11].

Fig. 1. Treatment schedule. APAP, acetaminophen; b wt, body weight; CFU, colony-forming units; CMC, carboxy methyl cellulose.

S. Sharma et al. / Nutrition 28 (2012) 173–181174

The combination of different probiotics has been shown tohave a significant effect in modulating the makeup of intestinalflora, resulting in lower levels of ammonia and endotoxins inliver [12,13]. Its protective effect against carbon tetrachloride(CCl4)-induced liver injury has been reported [14]. Probioticsmainly consist of lactic acid bacteria, including many strains ofLactobacillus, Bifidobacterium, Streptococcus, and Enterococcus.Among these the genus Enterococcus is of particular interest forenvironmental, food, and clinical research [15,16]. Enterococciare present or deliberately added to fermented foods, wherethey contribute to the organoleptic properties [17].

Enterococcus lactis IITRHR1 (GenBank accession no. FJ447353)is a novel strain that was isolated from cottage cheese anddemonstrated probiotic potential, including an efficient adhesionto intestinal epithelial cell lines (intestinal epithelial cell line 6,CRL 1592), tolerance of an acid/bile environment, and cytopro-tection [18]. Dose standardization is essential for probioticsbecause an inadequate dose may cause complications in immu-nocompromised individuals. In the present study, we evaluatedthe effect of three different doses of E. lactis IITRHR1 against APAPinduced hepatotoxicity inmaleWistar rats. Antioxidant enzymes(superoxide dismutase [SOD], catalase [CAT], glutathione perox-idase [GPx], glutathione-S-transferase [GST]), redox ratio, andferric reducing antioxidant power (FRAP) were assessed in allexperimental groups. Oxidative damage by APAP to membranelipids, proteins, DNA and involvement of critical control points ofapoptosis such as Bax, Bcl2 (pro-/anti-apoptotic proteins), releaseof cytochrome-c, activation of caspases, and DNA damage werealso assessed.

Materials and methods

Chemicals

Primary antibodies against cytochrome-c, Bax, Bcl2, b-actin, cytochromeoxidase-IV (COX-IV), and horseradish peroxidase-conjugated secondary anti-bodies were obtained from Santa Cruz Biotechnology (Santa Cruz, CA, USA). deMan-Rogosa-Sharpe medium, de Man-Rogosa-Sharpe medium Man-Rogosa-Sharpe broth, and vitamin C were obtained from Himedia Laboratories (Mum-bai, India). RNAwas isolated using an RNAspin mini-isolation kit (GE Healthcare,Buckinghamshrine, UK) and a cDNA synthesis kit was purchased from RocheDiagnostics (Mannheim, Germany). All other chemicals used throughout thestudy were commercial products of the highest purity grade and purchased fromSigma Chemicals Co. (St. Louis, MO, USA).

Microorganisms

Three different doses of E. lactis IITRHR1 (2� 1010 colony-forming units [CFU]per gram of IITRHR1 lyophilized powder; 107, 108, and 109 CFU) were prepared(0.05, 5, and 50 mg of lactic acid bacteria powder, respectively) and administeredper 200 g of rat body weight. The bacterial suspension was prepared in 0.5%carboxy methyl cellulose (CMC) and administered orally by gavage to each rat inrespective groups.

Animals

Male Wistar rats (Rattus norvegicus, n ¼ 42) weighing 200 � 10 g wereprocured from the animal house of the Indian Institute of Toxicology Research.Animals were kept under standard conditions of humidity (60–70%), tempera-ture (25 � 2�C), and a controlled 12-h light/dark cycle. Rats were fed a pellet dietand water ad libitum. Animals were acclimatized for 7 d to the experimentalanimal room conditions. The study was conducted according to the protocolapproved by the institutional animal ethics committee (ITRC/IAEC/01/2010).

Experimental design

The experimental design for the present in vivo study is summarized inFigure 1. Rats were divided into seven groups of six animals each and adminis-tered oral doses of APAP/E. lactis IITRHR1/vitamin C by gavage according to thefollowing schedule: group I (control) received the vehicle (0.5% CMC) for 21 d;Group II received APAP (1 g/kg of bodyweight in 0.5% CMC) for 14 d; groups III, IV,

and V received E. lactis IITRHR1 (107, 108, and 109 CFU, respectively) for 7 d fol-lowed by APAP treatment for 14 d; group VI received E. lactis IITRHR1 (109 CFU)for 21 d and served as the treatment control to check the effect of treatmentwithout the drug in normal rats; and group VII (vitamin C þ APAP) receivedvitamin C (500 mg/kg of body weight in 0.5% CMC) for 7 d (positive recoverycontrol) followed by APAP administration for 14 d.

Evaluation of serum marker enzymes

All animals were euthanized using chloroform and sacrificed after 21 d oftreatment. Blood was collected from each animal and serum was separatedaccording to the standard protocol. The liver marker enzymes serum glutamicoxaloacetic transaminase (SGOT), serum glutamic pyruvic transaminase (SGPT),serum alkaline phosphatase (SAP), and bilirubin and cholesterol level weredetermined by an automated clinical analyzer (Chemwell, 2910, Palm city, FL,USA) using commercially available kits (Spin React, Girona, Spain).

Preparation of homogenate for measurement of antioxidant enzymes

Liver tissues from all groups were collected, washed twice in ice-coldphosphate buffered saline (pH 7.4) and homogenized. After homogenization,samples were centrifuged at 800 � g (3K18, Sigma, Osterode am Harz, Germany)for 10 min, the supernatant was collected, and the protein content was measuredby a bicinchoninic acid method [19].

Histopathologic studies

Liver tissues from rats of each group were collected, fixed, and processed atthe central pathology laboratory of the Indian Institute of Toxicology Researchusing a paraffin-embedding technique. Liver sections (5 mm) were stained withhematoxylin, and eosin and semiqualitative scaling (125�, Leica, Cambridge, UK)was performed for each section.

Measurement of enzymatic and non-enzymatic antioxidant activities

The SOD activity in liver homogenate was estimated using the method ofKakkar et al. [20] bymeasuring spectrophotometrically the inhibition of nitrobluetetrazolium/reduced nicotinamide adenosine dinucleotide/phenazinemethosulfate-mediated formazan formation at 560 nm. SOD activity wasexpressed as units per minute per milligram of protein. CAT activity was assayedspectrophotometrically using themethodof Aebi [21]. Thedecrease in absorbancewas observed on a spectrophotometer (Spectramax plus 384, Molecular Devices,Sunnyvale, CA, USA) for 60 s at every 15-s interval at 240 nm. CAT activity wasexpressedas nanomoles ofH2O2decomposedperminutepermilligramof protein.FRAP assaywasperformed in serum,whichmeasured the change in absorbance at593 nm from the formation of a blue FeII-tripyridyltriazine (Fe-TPTZ) compound[22] and was expressed as micromoles per liter of trolox equivalent antioxidantcapacity.

Glutathione-S-transferase catalyzes the conjugation reaction with gluta-thione in the first step of mercapturic acid synthesis. It was measured accordingto the method of Habig and Jakoby [23], monitored spectrophotometrically at340 nm for 5 min, and expressed as activity per minute per milligram of protein.GPx activity was measured using the method of Paglia and Valentine [24]. Theactivity was expressed as nanomoles of reduced nicotinamide adenosine dinu-cleotide phosphate per minute per milligram of protein using a molar extinctioncoefficient of 6.22 � 103 nmol L�1 cm�1. Total glutathione and oxidized gluta-thione were measured by the method of Griffith [25] using the Ellman's reagent.The change in optical density was measured at 412 nm after 10 min andexpressed in a redox ratio, i.e., ratio of reduced glutathione to oxidizedglutathione.

Estimation of lipid peroxidation and protein oxidation

Lipid peroxidation level was measured by an estimation of malondialdehyde,an endproduct of lipid peroxidation, by the method of Wallin et al. [26]. Absor-bance was measured at 530 and 600 nm and results are expressed as nanomoles

Table 1Reverse transcriptase polymerase chain reaction primers used in the study

Target gene Primer sequence (50–30) Product size (bp)

Forward Reverse

Caspase-3 GAACGAACGGACCTGTGGACCT GCCTCCACTGGTATCTTCTGGCAT 187Caspase-9 TGAGCCAGATGCTGTCCCATACCAG CCTGGGAAGGTGGAGTAGGACAC 114GAPDH ATGGAGAAGGCTGGGGCTCACCT AGCCCTTCCACGATGCCAAAGTTGT 209

GAPDH, glyceraldehyde 3-phosphate dehydrogenase

S. Sharma et al. / Nutrition 28 (2012) 173–181 175

of malondialdehyde per milligram of protein. Protein carbonyl content wasestimated by themethod of Levine et al. [27]. The assay involves derivation of thecarbonyl group with dinitrophenylhydrazine, which leads to the formation ofa stable dinitrophenyl hydrazone product. Absorbance was measured at 370 nmand expressed as nanomoles per milligram of protein.

Preparation of subcellular fractions and immunoblot analysis

Cytosolic and mitochondrial fractions were prepared as described by Zhanget al. [28]. Briefly, tissue homogenates were prepared in ice-cold RIPA buffer. Thehomogenate was centrifuged at 800 � g for 4 min at 4�C. The supernatant wascollected and centrifuged at 22 000 � g for 15 min at 4�C. The resulting super-natant was used as the cytosolic fraction and the pellet was resuspended in coldRIPA buffer. The lysate was centrifuged at 15 000 � g for 15 min at 4�C. Theresultant supernatant was used as the mitochondrial fraction. Protein samples(60 mg) from the cytosolic and mitochondrial fractions were separated on 12%sodium dodecylsulfate polyacrylamide gel electrophoresis and electro-blotted ona polyvinylidene fluoride membrane (Hybond-P, Amersham Biosciences Ltd.,Buckinghamshire, UK). The membrane was then incubated for 1 h with primaryimmunoglobulin G antibodies. Bcl2, cytochrome-c, and Bax were used in 1:500,b-actin in 1:1000, and cytochrome oxidase IV (COX-IV) in 1:2000 dilutions. b-Actin and COX-IV were used as internal controls for the cytosolic and mito-chondrial fractions, respectively. Cytochrome-c release was determined in thecytosolic fraction, and levels of Bcl2 and Bax were assessed in the mitochondrialfraction. The immunoblot was visualized using an Immobilon western chemi-luminescent horseradish peroxidase substrate kit (Millipore, Billerica, MA, USA).Densitometry of the bands obtained was obtained using ImageJ 1.41o (NationalInstitutes of Health, Bethesda, MD, USA).

Reverse transcriptase polymerase chain reaction

Total RNA was isolated from liver tissues using an RNAspin mini RNAisolation kit (GE Healthcare) and quantified using NanoDrop spectrophotometer(ND-1000; NanoDrop Technologies, Inc., Wilmington, DE, USA). The total RNAwas then reverse transcribed with an oligo(dT) 18 primer using a first-strandcDNA synthesis kit (Gibco BRL, Life Technologies, Carlsbad, CA, USA). Allprimers used in the reverse transcriptase polymerase chain reaction (RT-PCR)are listed in Table 1. glyceraldehyde 3-phosphate dehydrogenase was used as theinternal control for the RT-PCR assay. The RT-PCR was conducted usinga gradient thermal cycler (Eppendroff, Hamburg, Germany) for caspase-9 and -3[29]. The reactions were performed in a 20-mL volume mix for 3 min at 95�C, 44cycles of 15 s at 95�C, 20 s at 62�C or 64�C, and 15 s at 72�C.

Table 2Change in levels of serum marker enzymes and cholesterol

Group Liver function test Cholesterol (mg/dL)

SGOT (U/L) SGPT (U/L) SAP (U/L) Bilirubin (mg/dL)

I 210.8 � 4.5 82.3 � 3.0 274.4 � 9.4 0.11 � 0.01 35 � 1.3II 299 � 7.8x 193 � 8.0x 727.6 � 17.6x 0.33 � 0.03x 39 � 1.4III 292 � 10.7 153.6 � 6.6y 621.8 � 9.6y 0.31 � 0.03 32 � 3.8IV 267.9 � 11.2y 106.2 � 5.6z 546.9 � 8.6z 0.27 � 0.02 27 � 3.9*

V 220.3 � 5.6z 83.7 � 3.1z 469.5 � 13.3z 0.20 � 0.04* 25 � 2.7*z z z y y

Measurement of DNA damage

The DNA damage was measured in liver tissues of all samples by homoge-nizing in digestion buffer (10 mM Tris, pH 7.5; 100 mM NaCl; 1 mM ethyl-enediaminetetraacetic acid; 1% sodium dodecylsulfate; and 50 mg of proteinaseK/mL) and incubating at 45�C overnight [30]. The aqueous phase was separatedand treated with RNase A (40 mg/mL) at room temperature for 2 h. Genomic DNAwas extracted in phenol:chloroform followed by ethanol precipitation in thepresence of 0.3 M potassium acetate. The DNA was quantified using NanoDrop(NanoDrop Technologies, Inc., San Leandro, CA, USA) resolved on 1.8% agarose geland analyzed with Alfa-Innotech image analyzer.

VI 227.2 � 3.2 84.2 � 3.2 328.6 � 21.8 0.17 � 0.0 22 � 1.3VII 222.9 � 6.7z 101.5 � 6.4z 526.3 � 16.8z 0.25 � 0.01* 27 � 2.8*

SAP, serum alkaline phosphatase; SGOT, serum glutamic oxaloacetic trans-aminase; SGPT, serum glutamic pyruvic transaminase

* P < 0.05.y P < 0.01.z P < 0.001 are statistically significant in all other treatment groups compared

with the acetaminophen-treated group.x P < 0.001 are statistically significant compared with the control group.

Statistical analysis

Data are expressed asmean� standard error. Groupswere compared by one-way analysis of variance and the significance of mean difference between groupswas done by Bonferroni post hoc test with correction for multiple testing. Two-tailed (a ¼ 2) P < 0.05 was considered statistically significant. All analysis wasperformed with SPSS 17.0 (SPSS, Inc., Chicago, IL, USA).

Results

Changes in serum marker enzymes

After APAP administration for 14 d in rats, there wasa significant increase in the important biomarkers SGOT (299 �7.8 U/L, P < 0.001), SGPT (193 � 8.0 U/L, P < 0.001), SAP (727.6 �17.6 U/L, P < 0.001), and bilirubin (0.33 � 0.03, P < 0.001)comparedwith untreated animals (Group I, Table 2). A significantalteration in serum biomarkers of hepatotoxicity was observedwith E. lactis IITRHR1 administration at different doses in ratswith APAP-induced liver damage. Pretreatment with E. lactisIITRHR1 exerted its protective efficacy in a dose-dependentmanner. At a 109-CFU dose, SGOT (220.3 � 5.6 U/L, P < 0.001),SGPT (83.7 � 3.1 U/L, P < 0.001), SAP (469 � 13.3 U/L, P < 0.001),and bilirubin (0.20 � 0.04 mg/dL, P < 0.001) levels decreasedsignificantly compared with the APAP-treated group. Acholesterol-lowering effect was also observed in dose-dependent manner with E. lactis IITRHR1 administrationbecause a lower serum cholesterol level was observed in alltreated groups compared with the vehicle control. There was nomortality in animals treated with APAP at the selected doses.

Effect of E. lactis IITRHR1 on histopathologic changes

Histopathologic examination of the liver specimens afteradministration of APAP (14 d) showed severe liver damage asevident from congestion, sinusoid dilation, and centrilobular andvacuolar degeneration (Fig. 2-B, Table 3). Pretreatment withE. lactis (108 and 109 CFU) showed protection against APAP-induced damage (Fig. 2-D, 2-E, Table 3). However, a 107-CFUdose of E. lactis IITRHR1 (Fig. 2-C) did not show pronouncedprotection. The E. lactis IITRHR1 control group (Fig. 2-G) did notshow any adverse effect and was comparable to the controlgroup.

Fig. 2. Liver sections stained with hematoxylin and eosin (magnification 125�). Vacuolar degeneration (dotted arrows) and hepatocellular necrosis (complete arrows) aredisplayed. (A) Control group; (B) group treated with acetaminophen; (C) group treated with 107 CFU of Enterococcus lactis IITRHR1 plus acetaminophen; (D) group treatedwith 108 CFU of E. lactis IITRHR1 plus acetaminophen; (E) group treated with 109 CFU of E. lactis IITRHR1 plus acetaminophen; (F) group treated with E. lactis of 109 CFU of E.lactis IITRHR1 alone; (G) group treated with vitamin C plus acetaminophen.

S. Sharma et al. / Nutrition 28 (2012) 173–181176

Assessment of antioxidant enzymes

The results presented in Figure 3A illustrate a significant(45.7%, P< 0.001) decrease in SOD activity in hepatic tissues withoral administration of APAP (1 g/kg of body weight) comparedwith the control group. Pretreatment with 109 CFU of E. lactisIITRHR1 increased SOD activity by 66.3% (P < 0.001) comparedwith APAP-treated rats. Groups with the 107- and 108-CFUdosages showed a significant increase in SOD activity level butless than in the 109-CFU dosage group.

Figure 3B illustrates a significant (P < 0.001) decrease in CATactivity in hepatic tissues with oral administration of APAP.Pretreatment with the 109-CFU dose significantly increased CAT

Table 3Effect of different dose of Enterococcus lactis IITRHR1 pretreatment on histo-pathologic changes with acetaminophen administration

Groups Hepatocellular damage/congestion/sinusoid dilation

Vacuolar degeneration

I � �II þþþ þþþIII þþþ þþIV þþ þþV þ �VI � �VII þ þ

þ, mild pathologic changes; þþ, moderate pathologic changes; þþþ, severepathologic changes; �, no pathologic changes

activity by 25.5% (P < 0.05) compared with the APAP-treatedgroup. Conversely, APAP exposure was found to decrease theFRAP by 62.7% in serum compared with the control group values.However, pretreatment with E. lactis IITRHR1 increased the FRAPvalue compared with the APAP-administered group in a dose-dependent manner. The E. lactis IITRHR1–administered groupshowed results comparable to the control group as assessed bythe enzyme activities of SOD, CAT, and FRAP.

Effect of E. lactis IITRHR1 on GPx, GST, and redox ratio

The activities of GPx and GST were significantly (P < 0.001)decreased (42.2% and 63.9%) with APAP exposure comparedwith the control group (Fig. 3D, E). GPx activity in the grouppretreated with 108 CFU of E. lactis IITRHR1 showed a 19.2%increase, whereas the group pretreated with 109 CFU of E. lactisIITRHR1 showed a 36.8% increase compared with the APAP-administered group. Group III, which was administered 107

CFU of E. lactis IITRHR1, did not showa significant increase in GPxactivity. GST activity was also increased with pretreatment with108 and 109 CFU of E. lactis IITRHR1 by 129.8% (P < 0.01) and136.1% (P < 0.01) compared with the APAP-treated groups. Theredox ratio was significantly (P < 0.001) decreased by 63.4% inAPAP-treated rats compared with the control group. GST activityin the positive recovery control group was found to increase by78.1% compared with the APAP-treated group.

Fig. 3. Effect of pretreatment with different doses of Enterococcus lactis IITRHR1 on (A) SOD activity, (B) CAT activity, (D) GPx activity, (E) GST activity, (F) redox ratio in livertissue homogenates, and (C) ferric reducing antioxidant power in serum against APAP administration. # P < 0.05, ## P < 0.01, ### P < 0.001 were used as the criteria forsignificance compared with the group; * P < 0.05, ** P < 0.01, *** P < 0.001 were used as the criteria for significance in response of other treatment groups compared with theAPAP exposed group. APAP, acetaminophen; CAT, catalase; CFU, colony-forming units; GPx, glutathione peroxidase; GST, glutathione-S-transferase; SOD, superoxide dis-mutase; vit C, vitamin C, mM; micromoles.

S. Sharma et al. / Nutrition 28 (2012) 173–181 177

Table 4Change in protein oxidation and lipid peroxidation

Groups Tissue homogenates

Protein oxidation(nmol/mg protein)

MDA formation(nmol/mg protein)

I 5.6 � 0.26 2.0 � 0.05II 13.2 � 1.2x 6.75 � 0.39x

III 10 � 0.85* 4.54 � 0.23IV 9.02 � 0.65* 3.6 � 0.48y

V 8.19 � 0.76y 2.75 � 0.85y

VI 7.66 � 0.83y 2.07 � 0.30y

VII 5.91 � 0.39z 2.6 � 0.65y

MDA, malondialdehyde* P < 0.05.y P < 0.01.z P < 0.001 are statistically significant in all other treatment groups compared

with the acetaminophen-treated group.x P < 0.001 are statistically significant compared with the control group.

Fig. 4. Immunodetection of cytochrome-c release in the cytosolic fraction. Levels ofBcl2 (anti-apoptotic) and Bax (proapoptotic) were assessed by western blot in themitochondrial fraction. Cytochrome oxidase-IV (COX-IV) and b-actin were used asinternal controls for mitochondrial and cytosolic fractions, respectively. Thesequence of samples in blot is (1) control, (2) APAP treatment; (3) 107 CFU ofEnterococcus lactis IITRHR1 þ APAP; (4) 108 CFU of E. lactis IITRHR1 þ APAP; (5) 109

CFU of E. lactis IITRHR1þ APAP administration; (6) 109 CFU of E. lactis IITRHR1 alone;(7) vit C þ APAP. # P < 0.05, ## P < 0.01, ### P < 0.001 were used as the criteria forsignificance compared with the control group; * P < 0.05, ** P < 0.01, *** P < 0.001

S. Sharma et al. / Nutrition 28 (2012) 173–181178

Effect of E. lactis IITRHR1 on lipid peroxidation andprotein oxidation

During APAP-induced hepatic toxicity, there was a significantincrease in protein oxidation (136%, P < 0.001) compared withthe vehicle control group (Table 4). However, 108 and 109 CFU ofE. lactis IITRHR1 treatment significantly decreased the proteinoxidation level by 31.8% (P < 0.05) and 38% (P < 0.01), respec-tively, compared with the APAP-administered rats. Lipid perox-idation indicates cellular injury mediated by reactive oxygenintermediates, resulting in destruction of membrane lipids andproduction of lipid peroxides. There was significant inhibitionin APAP-induced lipid peroxidation (59.1%, P < 0.01) onpretreatment with the high dose. The lipid peroxidation levelsin the positive recovery control group showed a decreasein malondialdehyde formation by 61.3% (P < 0.01; Table 4)compared with the APAP-administered group.

were used as the criteria for significance in response of other treatment groupscompared with the APAP-exposed group. APAP, acetaminophen; CFU, colony-forming units; Con, control; cyt c, cytochrome-c; cyto, cytosolic fraction; mito,mitochondrial fraction; vit C, vitamin C.

Involvement of pro- and anti-apoptotic proteins

We investigated the involvement of Bax (pro-apoptoticprotein) and Bcl2 (anti-apoptotic protein) in APAP-induced liverinjury (Fig. 4) to study the possible protection accorded byE. lactis IITRHR1 against APAP-induced cell death. There wasa significant (P < 0.001) increase in Bax and a decrease in Bcl2 inthe APAP-administered group compared with the control group.Pretreatment with 109 CFU altered the level of Bax (P< 0.05) andBcl2 (P < 0.01), which was comparable to positive recoverycontrol. At the same time, an increase in cytochrome-c release(1.1-fold, P < 0.001) was observed in the cytosolic fractionobtained from APAP-administered rats. A dose-dependent effectwas observed on cytochrome-c release during E. lactis IITRHR1pretreatment (Fig. 4). The data suggest that E. lactis IITRHR1protects by altering Bax/Bcl2 levels and inhibiting cytochrome-crelease, leading to the prevention of important steps in APAP-mediated cytotoxicity.

Regulation of caspases and DNA damage by E. lactis IITRHR1

The effect of E. lactis IITRHR1 and APAP on the expressionlevels of caspase-9 and -3 was assessed using RT- PCR. As shownin Figure 5, the mRNA expression levels of caspase-9 and -3genes were upregulated to 59.3% (P < 0.001) and 139.6% (P <

0.001), respectively, in the APAP-administered group comparedwith the control group. The E. lactis IITRHR1 pretreatment

modulated the caspase expression in dose-dependent manner.The high dose decreased caspase-9 and -3 expressions by 37.5%(P < 0.001) and 86.3% (P < 0.001), respectively, compared withthe APAP-administered groups.

The enzyme responsible for DNA fragmentation is thecaspase-activated DNase. A DNA fragmentation pattern wasstudied and a typical DNA laddering patternwas obtained, whichclearly indicated apoptosis with APAP treatment (Fig. 6, lane 2).Pretreatment with 109 CFU of E. lactis IITRHR1 showed an intactband (lane 5), which was comparable to the recovery controlDNA (lane 7). The E. lactis IITRHR1 at medium (108 CFU) and low(109 CFU) doses also prevented DNA damage, as evident fromFigure 6.

Discussion

The role of diet in health management has evolved theconcept of probiotics and its use to resolve many healthcomplications. These include an increased resistance to gastro-intestinal tract infections by inhibiting the proliferation ofpathogenic microbes [31], patients using antibiotic/chemo-therapy treatments [11,12], and alcohol induced hepaticdysfunction [14]. One of the most exciting areas hitherto lessexplored is the ability of probiotics to ameliorate hepatotoxicity.

Fig. 5. Expression levels of caspase-3/-9. Relative intensity was normalized withGAPDH (used as an internal control). The sequence of samples in blot is (1) control;(2) APAP treatment; (3) 107 CFU of Enterococcus lactis IITRHR1 þ APAP; (4) 108 CFUof E. lactis IITRHR1 þ APAP; (5) 109 CFU of E. lactis IITRHR1 þ APAP administrationfor 14 d; (6) 109 CFU of E. lactis IITRHR1 alone; (7) vit C þ APAP. # P < 0.05, ## P <

0.01, ### P < 0.001 were used as criteria for significance compared with the controlgroup; * P < 0.05, ** P < 0.01, *** P < 0.001 were used as criteria for significance in allparameters in response of other treatment groups compared with the APAP-exposed group. APAP, acetaminophen; CFU, colony-forming units; Con, control;GAPDH, glyceraldehyde 3-phosphate dehydrogenase; vit C, vitamin C.

Fig. 6. DNA was isolated from liver tissues of each group. Agarose gel (1.8%, w/v)electrophoresis was performed to observe the fragmentation pattern/DNA damage.(M) 50-bp ladder; (1) control; (2) acetaminophen treatment; (3) 107 CFU ofEnterococcus lactis IITRHR1 plus acetaminophen; (4) 108 CFU of E. lactis IITRHR1plus acetaminophen; (5) 109 CFU of E. lactis IITRHR1 plus acetaminophen admin-istration; (6) 109 CFU of E. lactis IITRHR1 alone; (7) vitamin C plus acetaminophen.

S. Sharma et al. / Nutrition 28 (2012) 173–181 179

In previous studies, we found that E. lactis IITRHR1 is bile andacid resistant. It can also adhere to intestinal epithelial cells,which promote its survival and show a broad range of antimi-crobial activity [18]. Many probiotic strains have been consumedworldwide for decades, but information regarding recom-mended dosage of Enterococcus is lacking in the public domain.The present study also reflects the importance of an adequatedose selection of Enterococcus against drug-induced hepatotox-icity. We observed a dose-dependent protective effect of E. lactisIITRHR1 against oxidative liver injury by APAP (Fig. 7) andcompared our findings with vitamin C, a well-known antioxi-dant, that was used as a positive recovery control.

Increased levels of SGOT, SGPT, and bilirubin in blood serumare indicators of hepatotoxicity. The levels of these biomarkerswere significantly reverted toward the normal values in the ratsadministered with E. lactis IITRHR1 before APAP intoxication.Simultaneously, the serum cholesterol level was decreased in allanimals administered E. lactis IITRHR1; in addition, there wasless cellular damage evident from histopathologic studies. Thesefindings are similar to a thio-acetamide–induced minimalhepatic encephalopathy model using Lactobacillus acidophilus A-4 administration and support the findings of Rishi et al. [32].

Mammalian cells are equipped with antioxidant systems tocombat oxidative stress–induced liver damage [33]. Antioxi-dants consist of non-enzymatic and enzymatic substances.Changes in the functional status of antioxidant enzymes in theliver were also estimated in the present study (Fig. 7). SOD

provides defense against the toxicity of the superoxide radicalby catalytically scavenging it. With APAP treatment, a significantdecrease in the SOD level was observed, which reverted backtoward normal with probiotic treatment. GSH is an importantnon-enzymatic cellular antioxidant, which functions in pre-venting the oxidation of protein sulfhydryl groups by freeradicals generated during oxidative stress. We observeda prevention of GSH depletion by probiotic treatments anddecreased lipid peroxidation after APAP administration. Thissupports the observation of Wabel et al. [34] who reportedincreased glutathione levels after supplementation withsymbiotic-fermented milk against lead acetate toxicity in rats.Lin et al. [35] also reported that probiotic preparations havea potential to scavenge the free radicals and release their anti-oxidative constituents.

Acetaminophen induces a mitochondrial oxidant stress,whichmay not be a cause of cell injury, but rather a consequence.The proapoptotic family member Bax resides in the cytosol, butwhen translocated to mitochondria, it oligomerizes, and theprocess is further propagated with Bcl2 release [34]. Conse-quently, cytochrome-c is released from mitochondria andautoactivates caspase-9 by an apoptosome, leading to the acti-vation of caspase-3 [36,37].

The dose-dependent response of E. lactis IITRHR1 wasobserved against increased serum enzyme markers and protec-tion against histopathologic changes. The E. lactis IITRHR1showed maximum protection at a high dose (109 CFU) bymaintaining an antioxidant–oxidant balance with SOD, CAT, andFRAP activities. In our previous studies, we found that treatmentwith E. lactis IITRHR1 significantly decreased the reactive oxygenspecies generated by APAP in primary hepatocytes [18]. It alsodecreased the damage caused by oxidative stress to lipids andproteins. Our data suggest that APAP exposure in rats increasedthe Bax level and decreased the Bcl2 in mitochondria, leading tocytochrome-c release, activation of procaspase-3, and DNA

Fig. 7. Schematic diagram of APAP-induced hepatotoxicity and its prevention byEnterococcus lactis IITRHR1. APAP is metabolized to its reactive metabolite, NAPQI,which at overdose depletes GSH and covalently binds to cellular proteins as APAP-cysteine adducts that lead to the depletion of GSH. APAP disturbs the balance ofBcl2 and Bax in mitochondria and increases membrane permeability. Theconcomitant loss of mitochondrial integrity leads to generation of oxidative stressand cytochrome-c release, activation of casapases, followed by DNA fragmentation,which leads to cellular damage. The sequence of events involved in APAP inducedhepatotoxicity is modulated by E. lactis IITRHR1 by controlling depleted GSH tomaintain an oxidant–antioxidant balance, restoration of levels of Bax/Bcl2, blockingthe release of proapoptotic protein cytochrome-c, activation of caspases, and DNAfragmentation. APAP, acetaminophen; CAT, catalase; cyt c, cytochrome-c; GPx,glutathione peroxidase; GSH, glutathione; GST, glutathione-S-transferase; NAPQI,N-acetyl-p-benzoquinone imine; SOD, superoxide dismutase.

S. Sharma et al. / Nutrition 28 (2012) 173–181180

fragmentation. Together these findings reveal the apoptoticmode of cell death in APAP-induced hepatotoxicity at thetested dose. The E. lactis IITRHR1 altered the Bax/Bcl2 level,cytochrome-c release, attenuated the caspases, and decreasedDNA damage during APAP-induced oxidative liver damage.

Conclusion

This study indicates that E. lactis IITRHR1 administrationprovides protection against APAP-induced hepatotoxicity asevident from changes in serum liver markers. The protectionagainst APAP-induced oxidative stress in experimental ratswas obtained through the antioxidative potential of E. lactisIITRHR1 by controlling critical endpoints of mitochondria-mediated apoptotic pathways such as Bax/Bcl2 levels, cyto-chrome-c release, activation of caspases, and DNA fragmen-tation. The results suggest that E. lactis IITRHR1 has thepotential to be used as prophylactic agent during APAP-induced hepatotoxicity.

Acknowledgments

Authors are grateful to the director of IITR for his kindsupport to this work. Thanks are also due to InstitutionalManuscript Review Committee for allocation of manuscriptnumber 2883.

References

[1] Bajt ML, Cover C, Lemasters JJ, Jaeschke H. Nuclear translocation of endo-nuclease G and apoptosis-inducing factor during acetaminophen-inducedliver cell injury. Toxicol Sci 2006;94:217–25.

[2] Ghosh A, Sil PC. Protection of acetaminophen induced mitochondrialdysfunctions and hepatic necrosis via Akt-NF-kappaB pathway: role ofa novel plant protein. Chem Biol Interact 2009;177:96–106.

[3] Gonzalez FJ. Role of cytochrome P450 in chemical toxicology and oxidativestress: Studies with CYP2E1. Mutat Res 2005;569:101–10.

[4] Chen C, Hennig G, Manautou JE. Hepatobiliary excretion of acetamin-ophen glutathione conjugate and its derivatives in transport deficient(TR-) hyperbilirubinemic rats. Drug Metabol Dispos 2003;31:798–804.

[5] Jaeschke H, Cover C, Bajt ML. Role of caspases in acetaminophen-inducedliver injury. Life Sci 2006;78:1670–6.

[6] Segawa S, Wakita Y, Hirata H, Watari J. Oral administration of heat-killedLactobacillus brevis SBC8803 ameliorates alcoholic liver disease inethanol-containing diet-fed C57BL/6N mice. Int J Food Microbiol2008;128:371–7.

[7] Rolff HC, Christensen HR. Dalhoff K.Intravenous or oral N-acetylcysteinetherapy in paracetamol poisoned patients. Should treatment guidelines bereviewed? Ugeskr Laeger 2010;172:1020–4.

[8] Forsyth CB, Farhadi A, Jakate SM, Tang Y, Shaikh M. Keshavarzian A.Lacto-bacillus GG treatment ameliorates alcohol-induced intestinal oxidativestress, gut leakiness, and liver injury in a rat model of alcoholic steatohe-patitis. Alcohol 2009;43:163–72.

[9] Malaguarnera M, Gargante MP, Malaguarnea G, Salmeri M, Mastrojeni S,Rampello L, et al. Bifidobacterium combined with fructo-oligosaccharideversus lactulose in the treatment of patients with hepatic encephalop-athy. Eur J Gastroentrol Hepatol 2010;22:199–206.

[10] Baldwin C, Millette M, Oth D, Ruiz MT, Luquet FM, Lacroix M. ProbioticLactobacillus acidophilus and L. caseimix sensitize colorectal tumoral cells to5-fuorouracil-induced apoptosis. Nutr Cancer 2010;62:371–8.

[11] Montalto M, Gallo V, Curigliano V, Do’onofrio L, Santoro L, Covino M, et al.The effects of a probiotic mixture on NSAID enteropathy: a randomized,double-blind, cross-over, placebo-controlled study. Aliment PharmacolTher 2010;32:209–14.

[12] Jonkers D, Stockbrugger R. Probiotics in gastrointestinal and liver diseases.Aliment Pharmacol Ther 2007;26:133–48.

[13] Sheth AA, Garcia-Tsao G. Probiotics and liver disease. J Clin Gastroenterol2008;42:S80–4.

[14] Han SY, Huh CS, Ahn YT, Lim KS, Baek YJ, Kim DH. Hepatoprotective effectof lactic acid bacteria, inhibitors of b-glucuronidase production againstintestinal microflora. Arch Pharm Res 2005;28:325–9.

[15] Franz CM, Stiles ME, Schleifer KH, Holzapfel WH. Enterococci in foodsdaconundrum for food safety. Int J Food Microbiol 2003;88:105–22.

[16] Bhardwaj A, Malik RK, Chauhan P. Functional and safety aspects ofenterococci in dairy foods. Indian J Microbiol 2008;48:317–25.

[17] Giraffa G. Functionality of enterococci in dairy products. Int J Food Micro-biol 2003;88:215–22.

[18] Sharma S, Singh RL, Kakkar P. Modulation of Bax/Bcl-2 and caspases byprobiotics during acetaminophen induced apoptosis in primary hepato-cytes. Food Chem Toxicol 2011;49:770–9.

[19] Stoscheck CM. Quantization of protein. Methods Enzymol 1990;182:50–69.

[20] Kakkar P, Das B, Viswanathan PN. A modified spectrophotometric assay ofsuperoxide dismutase. Indian J Biochem Biophys 1984;21:130–2.

[21] Aebi H. Catalase in-vitro. Methods Enzymol 1984;113:121–6.[22] Benzie IF, Strain JJ. Ferric reducing/antioxidant power assay: direct measure

of the total antioxidant activity of biological fluids and modified version forsimultaneous measurement of total antioxidant power and ascorbic acidconcentration. Methods Enzymol 1999;299:15–27.

[23] Habig WH, Jakoby WB. Assays for differentiation of glutathione S-trans-ferases. Methods Enzymol 1981;77:398–405.

[24] Paglia DE, Valentine WN. Studies on qualitative and quantitative charac-terization of erythrocytes glutathione peroxidase. J Lab Clin Med1967;70:158–69.

[25] Griffith OW. Determination of glutathione and glutathione disulfide usingglutathione reductase and 2-vinylpyridine. Anal Biochem 1980;106:207–12.

[26] Wallin B, Rosegrenn B, Shertze HG, Camejo G. Lipoprotein oxidation andmeasurement of thiobarbituric acid reacting substance formation ina single microtiter plate: its use for evaluation of antioxidants. Anal Bio-chem 1993;208:10–5.

[27] Levine RL, Garland D, Oliver CN, Amici A, Climent I, Lenz AG, et al. Deter-mination of carbonyl content in oxidatively modified proteins. MethodsEnzymol 1990;186:464–78.

[28] Zhang QH, Sheng HP, Loh TT. Redistribution of cytochrome c release is notan essential requirement in C2-ceramide induced apoptosis in HL-60 cells.Life Sci 1999;65:1715–23.

[29] Xiong Q, Xie P, Li H, Hao L, Li G, Qiu T, Liu Y. Involvement of Fas/FasL systemin apoptotic signaling in testicular germ cells of male Wistar rats injectedi.v. with microcystins. Toxicon 2009;54:1–7.

S. Sharma et al. / Nutrition 28 (2012) 173–181 181

[30] Hermann M, Lorenz HM, Vol IR, Grunke M, WoithW, Kalden JR. A rapid andsimple method for the isolation of apoptotic DNA fragments. Nucleic AcidRes 1994;22:5506–7.

[31] Moorthy G, Murali MR, Devaraj SN. Lactobacilli facilitate maintenance ofintestinal membrane integrity during Shigella dysenteriae 1 infection inrats. Nutrition 2009;25:350–8.

[32] Rishi P, Mavi SK, Bharrhan S, Shukla G, Tewari R. Protectiveefficacy of probiotic alone or in conjunction with a prebiotic inSalmonella-induced liver damage. FEMS Microbiol Ecol 2009;69:222–30.

[33] Kakkar P, Singh BK. Mitochondria: a hub of redox activities and cellulardistress control. Mol Cell Biochem 2007;305:235–53.

[34] Al-Wabel NA, Mousa HM, Omer OH, Abdel-Salam AM. Biological evaluationof synbiotic fermented milk against lead acetate contamination in rats. IntJ Food Agric Environ 2007;5:169–72.

[35] Lin WH, Yu B, Lin CK, Hawang WZ, Tsen HY. Immune effect of heat killedmulti-strains of Lactobacillus acidophilus against Salmonella invasion inmice. J Appl Microbiol 2007;102:22–31.

[36] El-Hassan H, Anwar K, Macanas-Pirard P, Crabtree M, Chow SC, Johnson VL,et al. Involvement of mitochondria in acetaminophen-induced apoptosisand hepatic injury: roles of cytochrome c, Bax, Bid and caspases. ToxicolAppl Pharmacol 2003;191:118–29.

[37] Hill MM, Adrain C, Martin SJ. Portrait of a killer: the mitochondrialapoptosome emerges from the shadows. Mol Interv 2003;3:19–26.