Probing chromatin accessibility - Plant Physiology · Probing chromatin accessibility 2 Measuring...

Probing chromatin accessibility

Dr. Lars Hennig

Swedish University of Agricultural Sciences

Department of Plant Biology and Forest Genetics

PO-Box 7080

SE-75007 Uppsala, Sweden

[email protected]

Tel. +46 18 67 3326

Fax +46 18 67 3389

Breakthrough technology

Plant Physiology Preview. Published on July 8, 2013, as DOI:10.1104/pp.113.220400

Copyright 2013 by the American Society of Plant Biologists

www.plantphysiol.orgon September 6, 2020 - Published by Downloaded from Copyright © 2013 American Society of Plant Biologists. All rights reserved.

http://www.plantphysiol.org


2

Measuring Arabidopsis chromatin accessibility using DNase I-PCR and DNase I-chip

assays

Huan Shu; Wilhelm Gruissem; Lars Hennig*

Department of Biology and Zurich-Basel Plant Science Center, ETH Zurich, CH-8092,

Zurich, Switzerland (H.S., W.G., L.H.)

Functional Genomics Center Zurich, University of Zürich/ETH Zürich, CH-8057 Zurich,

Switzerland (W.G.)

Department of Plant Biology and Forest Genetics, Uppsala BioCenter, Swedish University of

Agricultural Sciences and Linnean Center for Plant Biology, SE-75007 Uppsala, Sweden

(L.H.)

Science for Life Laboratory, SE-75007 Uppsala, Sweden (L.H.)




3

1 This work was supported by the Sixth Framework Program of the European Commission

through the AGRON-OMICS Integrated Project (LSHG–CT–2006–037704), by the Swedish

Research Council, and by the Swiss National Science Foundation (31003A_ 130272 and

31003A_132971).

* Corresponding author; e-mail [email protected]

The author responsible for distribution of materials integral to the findings presented in this

article in accordance with the policy described in the Instructions for Authors

(www.plantphysiol.org) is: Lars Hennig ([email protected]).




4

Abstract

DNA accessibility is an important layer of regulation of DNA-dependent processes. Methods

that measure DNA accessibility at local and genome-wide scales have facilitated a rapid

increase in knowledge of chromatin architecture in animal and yeast systems. In contrast,

much less is known about chromatin organization in plants. We developed a robust DNase I-

PCR protocol for the model plant Arabidopsis thaliana. DNA accessibility is probed by

digesting nuclei with a gradient of DNase I followed by locus-specific PCR. The reduction in

PCR product formation along the gradient of increasing DNase I concentrations is used to

determine the accessibility of the chromatin DNA. We explain a strategy to calculate the

decay constant of such signal reduction as a function of increasing DNase I concentration.

This allows describing DNA accessibility using a single variable: the decay constant. We also

used the protocol together with Agronomics1 DNA tiling microarrays to establish genome-

wide DNase I sensitivity landscapes.

One sentence summary

Differential DNA accessibility, which is established by local chromatin environments and

strongly affects gene expression, can be assayed by the presented protocol utilizing DNase I

digestion coupled to detection by PCR or on tiling arrays.




5

INTRODUCTION

Chromatin has a major impact on genome organization and gene activity. Differential

accessibility of DNA is thought to be a major consequence of locally different chromatin

composition and structure (Li et al., 2007). Chromatin sensitivity to nucleases has proven to

be a powerful tool to probe DNA accessibility in chromatin. Frequently used nucleases

include deoxyribonuclease (DNase), micrococcal nuclease (MNase), and restriction enzymes.

The resolution of restriction enzymes is limited by their sequence specificity, and MNase is

more often used to determine nucleosome occupancy (Schones et al., 2008). Chromatin

sensitivity to DNase I has often been used to define the “openess” of chromatin relative to its

higher order structures. Its applicability has been manifested by detecting regulatory

elements, such as promoters, enhancers and insulators, as DNase I hypersensitive sites (Wang

et al., 2001, Crawford et al., 2004, Dorschner et al., 2004, Crawford et al., 2006, Sabo et al.,

2006, Boyle et al., 2008, Naughton et al., 2010, Pique-Regi et al., 2011). DNase I sensitivity

can also be used as a measure for the general accessibility of chromatin (Weil et al., 2004).

Initially, chromatin accessibility of local genomic regions to DNase I was probed by

Southern blotting (Mather et al., 1983, Bender et al., 2000, Wang et al., 2001, Bulger et al.,

2003). However, Southern blotting is tedious and lacks sensitivity, and the interpretation of

results can be challenging. Therefore, analysis methods based on PCR have been developed

(Pfeifer et al., 1991, Feng et al., 1992, McArthur et al., 2001, Dorschner et al., 2004, Martins

et al., 2007). In recent years, DNase I assays were coupled to high-throughput genome-wide

profiling strategies such as genome tiling arrays and next-generation sequencing (Crawford et

al., 2004, Sabo et al., 2004, Weil et al., 2004, Crawford et al., 2006, Sabo et al., 2006). While

much has been learned about accessibility of chromatin in animal and yeast systems, our

knowledge of chromatin accessibility in plants is limited. Most studies have focused on

selected genomic regions such as the GRF1 gene, the Adh1 and Adh2 genes in maize (Paul et

al., 1998a, Paul et al., 1998b), or the GRF gene, the Adh gene, and an 80 kb genomic region

harbouring 30 protein coding genes in Arabidopsis (Vega-Palas et al., 1995, Paul et al.,

1998a, Paul et al., 1998b, Kodama et al., 2007). The technique used in these reports was

exclusively DNase I treatment and analysis of accessibility using Southern blotting. More

recently, we have combined the DNase I sensitivity assay with whole genome tiling arrays in

Arabidopsis to generate a genome-wide chromatin accessibility profile (Shu et al., 2012).

Here we present a robust, optimized DNase I sensitivity assay protocol for

Arabidopsis tissues based on PCR. This protocol can be adapted to different samples or

experimental objectives; the strategies for optimizing each step are also discussed. Analysis




6

of relatively large fragments by PCR has proven to be highly robust as a first step in probing

DNase I sensitivity in any region of the genome. We also introduce a new strategy for

presenting DNase I sensitivity of the tested regions using a decay constant calculated by

fitting PCR product intensity values from a gradient digestion. In this way, the sensitivity of

each region is characterized by a single value, facilitating comparisons between different

regions or samples. Finally, we describe how our protocol can be combined with genomic

techniques for genome-wide profiles of chromatin accessibility.

RESULTS AND DISCUSSION

DNase I PCR assays often monitor the digestion of nuclei over a time course (Feng et

al., 1992, Wang et al., 2001) or in a gradient of enzyme concentrations (Vega-Palas et al.,

1995, McArthur et al., 2001, Martins et al., 2007). Here we discuss the entire procedure in the

following sections: (1) Isolation of permeabilized nuclei, (2) DNase I digestion and DNA

recovery, (3) analysis of chromatin sensitivity by PCR and (4) data interpretation (Fig. 1).

Assays to probe chromatin accessibility should use freshly prepared nuclei. The time

for isolating nuclei and the delay before digestion should be minimized to reduce unspecific

damage to chromatin. Yield and reproducibility of the nuclei extraction can be pre-tested by

measuring the DNA content from identical or similar extractions. The key to reproducible

DNase I sensitivity assays is to keep an invariable DNase-to-chromatin ratio between

replicates. An optimal ratio has to be determined empirically for each tissue. The DNA

recovered from such digests is a mixture of long and short fragments depending on the

accessibility of the chromatin. Samples must be handled with much care to minimize

unspecific fragmentation. We recommend using large-pore pipette tips and gentle handling of

nuclei and chromatin suspensions. Rigorous mixing, e.g. by using Vortex mixers, must be

avoided. To control for possible differential sensitivity of the DNA template, a digestion of

isolated DNA can be included. Ideally, the DNA is extracted from identical material as the

nuclei to be used in the experiment.

Isolation of permeabilized nuclei

Plant material




7

Because cells in expanded green tissues usually contain large vacuoles, the nuclei/cell

(w/w) ratio is much lower in older than in young tissues. In our experience, it is often more

efficient to isolate nuclei from plant cell cultures, inflorescences or young seedlings than

from mature green tissues. Fresh samples can be used for extracting nuclei. However, it is

often more practical to use frozen material. In this way, not only can plant material be stored

almost infinitely at -80˚C, but nuclei isolation can also be easily synchronized when multiple

samples are involved.

Isolation of nuclei

To minimize the time for nuclei isolation, we developed a one-incubation-step

protocol. The short isolation step also favors a higher yield of nuclei. The entire isolation

procedure should be carried out on ice or at 4˚C.

Frozen plant tissue is ground to a fine powder in liquid nitrogen to disrupt cell walls

and other fibrous structures. The disrupted plant tissue is then treated with a cell lysis buffer

to release the nuclei. Cells are lysed by a surfactant in the buffer for disrupting membrane

structures. A nonionic surfactant, e.g. Triton X-100 or Igepal CA 630, is normally used at

concentrations between 0.3 -1% (v/v) depending on the specific requirement of each

experiment (Bowler et al., 2004, Wagschal et al., 2007). Normally, a 15 min treatment with

cell lysis buffer containing 0.5% Triton X-100 is sufficient for most Arabidopsis green

tissues. It is advisable to include sucrose or hexylene glycol in the buffer (Bowler et al.,

2004) to maintain a physiological osmotic pressure. Such osmotic agent also increases

viscosity of the buffer system slightly and forms an additional protection for the nuclei. After

cell lysis, the lysate is filtered through multiple layers of Miracloth (Calbiochem, Germany)

or nylon mesh filters such as CellTrics (Partec, Germany) to remove cell debris. We

recommend the CellTrics as they guarantee a more reproducible nuclei yield. When

Miracloth is used, the Miracloth filter should be pre-saturated with cell lysis buffer before

filtering to minimize nuclei retention in the fabric. Furthermore, the Miracloth should not be

squeezed, as this can lead to considerable organelle (and organelle DNA) contamination and

therefore an unreliable nuclei yield estimation. After filtering, crude nuclei can be collected

by mild centrifugation (see the materials and methods section for details).

DNase I digestion




8

DNase I time course or gradient digestion can be used, but the latter can be more

practical when taking advantage of multichannel pipettes and PCR cyclers for handling

multiple samples. In this way, adding enzyme or stop buffer to the reaction mixture can be

carried out in synchrony for all samples. PCR cyclers are robust instruments for providing

precise temperature control for the incubation of the digestion reaction (Fig. 2). The

procedure for the DNase I gradient digestion is detailed below and steps for time course

digestion need to be adjusted accordingly.

Before digestion, the crude nuclei are washed at least once with digestion buffer to

remove the detergent carried over from the cell lysis buffer. Afterwards, the nuclei are re-

suspended in digestion buffer. For easier handling, the nuclei suspension should be split into

equal aliquots of the planned gradient digestion steps (Fig. 2). Because isolated nuclei

sediment rapidly, equal aliquotting requires pipetting the nuclei suspension up-and-down

gently before taking each aliquot. In parallel, aliquots of a DNase I dilution series are also

transferred to PCR tubes. Once the reaction is ready to start, equal volumes of the enzyme

dilutions are added to the nuclei suspensions using a multichannel pipette (Fig. 2) and mixed

by pipetting up-and-down. The digestion mixtures should be immediately transferred to the

preheated PCR cycler for incubation (Fig. 2). After the desired reaction time (typically 3 to 5

min), digestions are stopped by adding stop buffer (EDTA and/or EGTA; see the materials

and methods section for details) to all the reaction mixtures using the multichannel pipette. If

the reactions are incubated at a sub-optimal temperature for DNase I activity, e.g. 30˚C

(Kodama et al., 2007, Song et al., 2010) instead of 37˚C, incubation times can be extended to

10 to 15min. Such an extended incubation time is advantageous because it reduces effects

caused by errors in handling time.

There may be no best number of DNase I dilutions fitting all experiments. A rule of

thumb is to include enough dilutions to detect smooth transitions of band intensities and

differences between insensitive and sensitive control regions for the particular experiment

(see below). In addition, a mock digested (no DNase I) or minimally-digested (highly dilute

DNase I concentration) step should be included as input chromatin control.

After the DNase I treatment is completed, DNA should be immediately purified to

avoid further degradation. We recommend against column-based DNA purification

techniques, because they usually retain large genomic DNA fragments and therefore

introduce a digestion bias. Instead, organic solvent-based extraction and ethanol precipitation

work best. Precipitation carriers such as glycogen can be added for more efficient recovery of




9

the DNA. DNA pellets should be immediately reconstituted in 10 mM Tris-HCl buffer (pH

8.0).

After a limited DNase I digest, a large proportion of the inaccessible DNA remains in

very long DNA fragments. Precipitated very long DNA can be difficult to resuspend.

However, we strongly advise against high temperature incubation, fierce vortexing or

pipetting of the pellet to facilitate dissolving. Instead, the DNA pellet should not be over-

dried and reconstitution buffer should be added to the DNA pellet when it is still moist. After

adding the buffer, samples can be incubated on ice or in the refrigerator for 30 min to

overnight. The DNA samples are then gently pipetted or tapped to ensure homogenous

distribution in the buffer. Repeated freeze-thaw cycles should be avoided by storing the DNA

samples at 4°C. We found that recovered DNA samples can be stored at 4°C for at least one

month without detectable changes in the PCR results (data not shown).

Analysis of digested DNA by PCR

Chromatin sensitivity to DNase I results in reduced accumulation of PCR products in

treated samples in comparison to input controls (Fig. 3). There are two major factors affecting

the signal reduction in such a DNase I PCR assay: (1) the ratio of DNase I to chromatin in the

reaction, and (2) the length of the PCR amplicon: The shorter the PCR amplicon, the lower

the probability that cleavage events occur within the probed region. Therefore, longer

amplicons are better suited to probe the DNase I sensitivity. Because of qPCR relies usually

on very short amplicons, its power is limited in such DNase I-PCR assays. However, qPCR

based strategies can be used if long stretches of genomic regions are probed by tiling

amplicons (Dorschner et al., 2004) or if prior knowledge of DNase I hypersensitive sites

allows precise positioning of amplicons (McArthur et al., 2001, Martins et al., 2007). In

contrast, when prior knowledge is lacking we found conventional PCR most powerful to scan

genomic regions for differential sensitivity. Usually, 1.5~2kb long amplicons (covering ~ 7 to

10 nucleosomes) work best at this stage. Once a sensitive region is identified, higher

resolution probing by qPCR can be performed.

Here, we describe a strategy to probe the sensitivity of a genomic region by

conventional PCR using decay constants calculated from gradient digestions. As example, the

chromatin sensitivity was analyzed for two silent transposable element (TE) genes (TA2 and

Cinful-like) and two active genes (GAPDHα and ACTIN7) in Arabidopsis. We and others

have shown that transcription is generally associated with accessible chromatin (Weil et al.,




10

2004, Boyle et al., 2008, Bell et al., 2010, Shu et al., 2012, Zhang et al., 2012). Thus, we

predict that the two TE genes should be much less sensitive to DNase I than the two active

genes and therefore can be used as insensitive and sensitive controls in future assays.

Reduced DNA accessibility is now also considered a silencing mechanisms established by

Polycomb group (PcG) proteins in animals (Bell et al., 2010, Eskeland et al., 2010, Naughton

et al., 2010, Bantignies et al., 2011) and plants (Shu et al., 2012). Therefore, two Arabidopsis

PcG target genes (AG and FT) were included in the assays.

In the absence of particular hypersensitive sites the probability of cleavage within a

region is proportional to the length of this region. Thus, it is important to maintain similar

amplicon sizes for the different regions to be probed. Because inefficient PCR and saturated

PCR will strongly distort results, PCR conditions have to be carefully optimized for each

primer pair by establishing at least (1) an optimal annealing temperature and (2) an optimal

cycle number within the exponential phase. Cycle numbers might differ between primer pairs

but should lead to comparable PCR signals for the input sample.

It is important to include insensitive and sensitive controls in a DNase I sensitivity

experiment. Conventional choices for the controls are DNA for heterochromatin regions and

active genes. If PCR conditions were correctly optimized but differences between insensitive

and sensitive controls are not easily seen, the DNase I digestion conditions are not

appropriate. Typical problems are over-digestion, under-digestion or damaged chromatin in

input nuclei. A gradient digestion with isolated DNA can also be included to control for

possible differential sensitivity of the DNA template, although this does not seem to be a

common problem (Sabo et al., 2006).

DNase I digestion of native chromatin and purified DNA was carried out in triplicate

(Fig. 4). For the chromatin digestion, PCR signals of the two heterochromatic TE genes

remained nearly constant while PCR signals of the two active genes dropped rapidly,

confirming our hypothesis of differences between heterochromatin regions and active genes.

This is in agreement with genome-wide profiles (Shu et al., 2012) and establishes these

regions as insensitive and sensitive controls for future assays. Interestingly, the sensitivity of

the two PcG targeted genes AG and FT seemed to be in between the TE genes and the active

genes. In contrast, there were no systematic differences in DNase I sensitivity of isolated

DNA: for all tested fragments, PCR signals became reduced following similar patterns. This

control confirms that (1) DNA in chromatin is indeed much less accessible to nuclease

digestion than after purification and (2) the observed differences in DNase I sensitivity of




11

chromatin reflect differences in chromatin properties and not differential intrinsic sensitivity

of the DNA template.

PCR product quantification and calculation

Gel images such as in Figure 4 can reveal strong differences but comparison of many

probed fragments is not trivial. Therefore, a quantitative description of the results is desirable.

PCR products can be quantified from gel images using image processing software such as

ImageJ (Schneider et al., 2012). This does not require specialized equipment and can be

implemented on any computer. However, quantification from gel images is error-prone. It is

therefore recommended to use a microfluidics-based electrophoresis system such as

Bioanalyzer (Agilent, USA) or Experion (Biorad, USA). Of note, some organic components

in the PCR buffer can interfere with the measurement using such systems (see manufacturer’s

instruction for more details). Because purification of PCR products can introduce biases, it is

best to consider using PCR buffers with only basal salts.

DNase I sensitivity can be quantified using the PCR signal as a function of increasing

DNase I concentration; the steeper the slope, the more accessible is the DNA fragment. The

PCR signal y can be expressed as an exponential decay function of DNase I concentration x

(U ml-1):

(1) y = Y0 e-λxlt

where Y0 is the input PCR product intensity, λ (U-1 ml kb-1 min-1) is the decay constant

characteristic for a given DNA fragment, l is the amplicon length (kb) and t is the digestion

time (min). Note that the decay constant of the curve is largely independent of primer

efficiency. Nevertheless, we recommend using primer pairs with similar high efficiency when

comparing different amplicons. Figure 5 shows the fitted curves for the quantified PCR

products shown in Figure 4. The fitted curves show that Ta2 and Cinful-like were most

resistant to DNase I than ACT7 and GAPDHα and that the DNase I sensitivity of AG and FT

was intermediate between the active and heterochromatic genes with a slightly higher

sensitivity of FT than AG.

Figure 6 displays the fitted λ values on a logarithmic "heat" axis. By summarizing the

results from the three replicates one can easily describe and visualize the DNase I sensitivity

of different genomic fragments. The sensitivity of the chromatin of the tested genomic

regions varied widely. The most sensitive region was ACT7 with an average decay constant

of 0.18, and the least sensitive region was Ta2 with an average decay constant of 0.02. The




12

PcG target genes AG and FT were between the insensitive and sensitive controls with FT

most similar to the sensitive regions. In contrast, isolated DNA was always highly sensitive,

and the differences between the decay constants for the various regions were minor, probably

reflecting experimental noise (Fig. 6).

Together, the decay constant λ can be used as a convenient quantitative descriptor of

chromosomal DNA accessibility but comparisons should be restricted to similar amplicon

sizes and digestion times.

Genome-wide DNA sensitivity profiles

DNase I sensitivity can be probed locally but also genome-wide, where DNase I

treatment can be coupled to DNA size fractionation. Depending on the profiling of hyper-

sensitivity or hypo-sensitivity, different size fractions of DNA are used. For profiling hypo-

sensitivity, the least cleaved DNA fragments should be enriched. In our hands, isolation of

fragments larger than 17kb proved to work well. This fraction was shown to be highly

enriched for DNase I hypo-sensitive DNA including transposable element genes such as Ta2

from pericentric heterochromatin over active genes such as ACT7 (Fig.7, right 3 columns). In

contrast, no enrichment was seen for the undigested control (Fig. 7, left 3 columns). Isolated

DNA can be labeled and hybridized to genomic DNA tiling arrays (Shu et al., 2012).

Alternatively, isolated DNA can be subjected to next generation sequencing. On the other

hand, the hyper-sensitive DNA population can be enriched by minimal DNase I treatment. In

this case, small-sized DNA should be enriched, and high enrichment of active genes versus

heterochromatin fragments is expected (Sabo et al., 2006). Alternatively, end-labeling of

DNA after minimal DNase I treatment can be used to enrich for hypersensitive sites

(Crawford et al., 2006, Follows et al., 2006, Sabo et al., 2006).

CONCLUSION

We have presented a robust and reproducible protocol for DNase I sensitivity assays

using Arabidopsis nuclei and have discussed points to consider when adapting the protocol

for specific experiments. In principle, this protocol should be easily adaptable to other plant

species. We have shown that two TE genes are highly insensitive to DNase I, and that two

active genes are highly sensitive. These genes can serve as insensitive and sensitive controls

in future chromatin DNase I sensitivity assays. We also have shown that two PcG targets are

less sensitive than the active genes, supporting the model that PcG proteins employ




13

compaction of the chromatin as a repression mechanism not only in animals but also in

plants. Subsequent to assays of DNase I sensitivity by PCR higher resolution can be achieved

by qPCR (Dorschner et al., 2004) or by high-throughput DNase-chip or DNase-sequencing

for genomic chromatin accessibility profiling (Crawford et al., 2006, Sabo et al., 2006, Song

et al., 2010, Shu et al., 2012).

Because altered DNA accessibility is a major effect of many histone modifications,

histone variants and non-histone proteins, testing DNA accessibility will become more

common in future studies on chromatin function.

MATERIALS AND METHODS

Plant material

Two hundred milligrams of 15-day old seedlings of Arabidopsis thaliana accession

Col-0 were harvested for each replicate. Seedlings were immediately frozen in liquid nitrogen

and ground to power with pre-cooled mortar and pestle. The powder was transferred to 15 ml

tubes stored at -80˚C or used for nuclei extraction immediately.

Nuclei isolation

Frozen powder of Arabidopsis plant tissue was suspended in 10 ml of ice cold Nuclei

Isolation Buffer (1 M hexylene glycol; 20 mM PIPES-KOH, pH 7.6; 10 mM MgCl2; 1 mM

EGTA; 15 mM NaCl; 0.5 mM spermidine; 0.15 mM spermine; 0.5% Triton X-100, v/v; 10

mM β-mercaptoethanol; 1× protease inhibitor cocktail (Roche, Switzerland)). β-

mercaptoethanol and protease inhibitor were added immediately before use. The mixture was

incubated for 15 min at 4˚C with gentle rotation. The suspension was filtered through 30 nm

CellTrics, and the eluate was centrifuged for 10 min at 1500×g at 4˚C. The supernatant was

discarded, and the pellet was collected as crude nuclei extract.

DNase I digestion and DNA recovery

Nuclei extracts were washed once with 1 ml of Digestion Buffer (40 mM Tris-HCl,

pH 7.9; 0.3 M sucrose; 10 mM MgSO4; 1 mM CaCl2; 1× protease inhibitor cocktail (Roche))

and gently resuspended in 670 μl of fresh Digestion Buffer by pipetting until no clumps were

visible. Aliquots of 80 µl were transferred to five PCR tubes and kept on ice.

A DNase I (RQ1 RNase-Free DNase, Promega USA) dilution series was prepared by step-

wise dilution using Digestion Buffer to establish the following concentrations: 0, 0.125, 1.25,

2.5, and 5 U/ml. Aliquots of 30 µl were transferred to five PCR tubes and kept on ice.




14

Nuclei suspensions were pre-heated on a PCR cycler for 2 min at 37˚C. Twenty microliters of

diluted DNase I were transferred to the corresponding nuclei suspensions using a

multichannel pipette and mixed briefly by pipetting. The final DNase I concentrations in the

digestion mixtures were 0, 0.025, 0.25, 0.5, and 1 U/ml. The digestion mixtures were

incubated at 30˚C for 15 min. Reactions were stopped by adding 10 μl of 100 mM EDTA.

Reaction mixtures were then returned to ice. DNA was recovered using phenol–chloroform-

isoamyl alcohol (PCI; 25:24:1, pH 8.0) extraction and ethanol precipitation.

For digestion of isolated DNA, genomic DNA was extracted from 240 μl of the nuclei

suspension using PCI extraction and ethanol precipitation. The DNA was re-dissolved in 240

μl of Digestion Buffer and 80 μl aliquots of the extracted DNA were digested with DNase I at

final concentrations of 0, 0.025, and 0.05 U/ml. Digested isolated DNA was recovered

similarly.

PCR analysis

The precipitated DNA was re-dissolved in 150 μl of nuclease-free water, and 5 μl

were used for each PCR reaction. PCR was performed using EuroTaq (Euroclone, Italy) in

25-μl-reactions according to the manufacturer’s protocol. The PCR fragments were designed

to overlap the start codons of AG, FT, ACT7 and GAPDHα, or to locate within the annotated

sequence of Cinful-like and Ta2. For PCR primer sequences see Table 1. The absolute

quantity of the PCR product was measured using DNA 7500 kit (Agilent) on an Agilent 2100

Bioanalyzer platform (Agilent). PCR measurements were averaged across the three digestion

replicates. qPCR was performed as described before (Shu et al., 2012) using the Universal

Probe Library system (Roche). For qPCR primer sequences see Table 2.

Analysis on tiling arrays

Alternatively, the precipitated DNA was re-dissolved in 15 µl of nuclease-free water

and resolved on 3 % agarose gels. DNA fragments of sizes above 17 kb were extracted from

the gel using freeze/thaw method. The extracted DNA was amplified and labeled with biotin

using the BioPrime® DNA Labeling System (Invitrogen, California). Labeled DNA was

hybridized to Affymetrix AGRONOMICS1 Arabidopsis tiling arrays (Affymetrix, Santa

Clara, CA) as recommended by the manufacturer and previously described (Rehrauer et al.,

2010; Shu et al., 2012). Data analysis using freely available R packages has been described

(Shu et al., 2012).




15

ACKNOWLEDGMENTS

We thank the Functional Genomics Centre Zurich for providing the Agilent 2100

Bioanalyzer platform.

Literature Cited

Bantignies F, Roure V, Comet I, Leblanc B, Schuettengruber B, Bonnet J, Tixier V, Mas A,

Cavalli G (2011) Polycomb-dependent regulatory contacts between distant Hox loci in Drosophila. Cell 144: 214-226

Bell O, Schwaiger M, Oakeley EJ, Lienert F, Beisel C, Stadler MB, Schübeler D (2010) Accessibility of the Drosophila genome discriminates PcG repression, H4K16 acetylation and replication timing. Nat Struct Mol Biol 17: 894-900

Bender MA, Bulger M, Close J, Groudine M (2000) Beta-globin gene switching and DNase I sensitivity of the endogenous beta-globin locus in mice do not require the locus control region. Mol Cell 5: 387-393

Bowler C, Benvenuto G, Laflamme P, Molino D, Probst AV, Tariq M, Paszkowski J (2004) Chromatin techniques for plant cells. Plant J 39: 776-789

Boyle AP, Davis S, Shulha HP, Meltzer P, Margulies EH, Weng Z, Furey TS, Crawford GE (2008) High-resolution mapping and characterization of open chromatin across the genome. Cell 132: 311-322

Bulger M, Schübeler D, Bender MA, Hamilton J, Farrell CM, Hardison RC, Groudine M (2003) A complex chromatin landscape revealed by patterns of nuclease sensitivity and histone modification within the mouse beta-globin locus. Mol Cell Biol 23: 5234-5244

Crawford GE, Davis S, Scacheri PC, Renaud G, Halawi MJ, Erdos MR, Green R, Meltzer PS, Wolfsberg TG, Collins FS (2006) DNase-chip: a high-resolution method to identify DNase I hypersensitive sites using tiled microarrays. Nat Methods 3: 503-509

Crawford GE, Holt IE, Mullikin JC, Tai D, Blakesley R, Bouffard G, Young A, Masiello C, Green ED, Wolfsberg TG, Collins FS, National Institutes Of Health Intramural Sequencing Center . (2004) Identifying gene regulatory elements by genome-wide recovery of DNase hypersensitive sites. Proc Natl Acad Sci U S A 101: 992-997

Dorschner MO, Hawrylycz M, Humbert R, Wallace JC, Shafer A, Kawamoto J, Mack J, Hall R, Goldy J, Sabo PJ, Kohli A, Li Q, McArthur M, Stamatoyannopoulos JA (2004) High-throughput localization of functional elements by quantitative chromatin profiling. Nat Methods 1: 219-225

Eskeland R, Leeb M, Grimes GR, Kress C, Boyle S, Sproul D, Gilbert N, Fan Y, Skoultchi AI, Wutz A, Bickmore WA (2010) Ring1B compacts chromatin structure and represses gene expression independent of histone ubiquitination. Mol Cell 38: 452-464




16

Feng J, Villeponteau B (1992) High-resolution analysis of c-fos chromatin accessibility using a novel DNase I-PCR assay. Biochim Biophys Acta 1130: 253-258

Follows GA, Dhami P, Gottgens B, Bruce AW, Campbell PJ, Dillon SC, Smith AM, Koch C, Donaldson IJ, Scott MA, Dunham I, Janes ME, Vetrie D, Green AR (2006) Identifying gene regulatory elements by genomic microarray mapping of DNaseI hypersensitive sites. Genome Res 16: 1310-1319

Kodama Y, Nagaya S, Shinmyo A, Kato K (2007) Mapping and characterization of DNase I hypersensitive sites in Arabidopsis chromatin. Plant Cell Physiol 48: 459-470

Li B, Carey M, Workman JL (2007) The role of chromatin during transcription. Cell 128: 707-719

Martins RP, Platts AE, Krawetz SA (2007) Tracking chromatin states using controlled DNase I treatment and real-time PCR. Cell Mol Biol Lett 12: 545-555

Mather EL, Perry RP (1983) Methylation status and DNase I sensitivity of immunoglobulin genes: changes associated with rearrangement. Proc Natl Acad Sci USA 80: 4689-4693

McArthur M, Gerum S, Stamatoyannopoulos G (2001) Quantification of DNaseI-sensitivity by real-time PCR: quantitative analysis of DNaseI-hypersensitivity of the mouse beta-globin LCR. J Mol Biol 313: 27-34

Naughton C, Sproul D, Hamilton C, Gilbert N (2010) Analysis of active and inactive X chromosome architecture reveals the independent organization of 30 nm and large-scale chromatin structures. Mol Cell 40: 397-409

Paul AL, Ferl RJ (1998a) Higher order chromatin structures in maize and Arabidopsis. Plant Cell 10: 1349-1359

Paul AL, Ferl RJ (1998b) Permeabilized Arabidopsis protoplasts provide new insight into the chromatin structure of plant alcohol dehydrogenase genes. Dev Genet 22: 7-16

Pfeifer GP, Riggs AD (1991) Chromatin differences between active and inactive X chromosomes revealed by genomic footprinting of permeabilized cells using DNase I and ligation-mediated PCR. Genes Dev 5: 1102-1113

Pique-Regi R, Degner JF, Pai AA, Gaffney DJ, Gilad Y, Pritchard JK (2011) Accurate inference of transcription factor binding from DNA sequence and chromatin accessibility data. Genome Res 21: 447-455

Sabo PJ, Humbert R, Hawrylycz M, Wallace JC, Dorschner MO, McArthur M, Stamatoyannopoulos JA (2004) Genome-wide identification of DNaseI hypersensitive sites using active chromatin sequence libraries. Proc Natl Acad Sci U S A 101: 4537-4542

Sabo PJ, Kuehn MS, Thurman R, Johnson BE, Johnson EM, Cao H, Yu M, Rosenzweig E, Goldy J, Haydock A, Weaver M, Shafer A, Lee K, Neri F, Humbert R, Singer MA, Richmond TA, Dorschner MO, al. e (2006) Genome-scale mapping of DNase I sensitivity in vivo using tiling DNA microarrays. Nat Methods 3: 511-518




17

Schneider CA, Rasband WS, Eliceiri KW (2012) NIH Image to ImageJ: 25 years of image analysis. Nat Methods 9: 671-675

Schones DE, Zhao K (2008) Genome-wide approaches to studying chromatin modifications. Nature Reviews Genetics 9: 179-191

Shu H, Wildhaber T, Siretskiy A, Gruissem W, Hennig L (2012) Distinct modes of DNA accessibility in plant chromatin. Nat Commun 3: 1281

Song L, Crawford GE (2010) DNase-seq: a high-resolution technique for mapping active gene regulatory elements across the genome from mammalian cells. Cold Spring Harb Protoc 2010: pdb.prot5384-pdb.prot5384

Vega-Palas MA, Ferl RJ (1995) The Arabidopsis ADH gene exhibits diverse nucleosome arrangements within a small DNase I-sensitive domain. Plant Cell 7: 1923-1932

Wagschal A, Delaval K, Pannetier M, Arnaud P, Feil R (2007) Chromatin Immunoprecipitation (ChIP) on unfixed chromatin from cells and tissues to analyze histone modifications. CSH Protoc 2007: pdb.prot4767-pdb.prot4767

Wang X, Simpson RT (2001) Chromatin structure mapping in Saccharomyces cerevisiae in vivo with DNase I. Nucleic Acids Res 29: 1943-1950

Weil MR, Widlak P, Minna JD, Garner HR (2004) Global survey of chromatin accessibility using DNA microarrays. Genome Res 14: 1374-1381

Zhang W, Zhang T, Wu Y, Jiang J (2012) Genome-wide identification of regulatory DNA elements and protein-binding footprints using signatures of open chromatin in Arabidopsis. Plant Cell 24: 2719-2731




18

Figure legends

Figure 1. Outline of the DNase-PCR procedure. This outline represents the DNase I-PCR

procedure as described in the text.

Figure 2. Schematic illustration of the digestion procedure. This illustration represents the

procedure of the digestion step as described in the text. For easier handling and better

synchronization, sample aliquots can be transferred using multichannel pipettes. Digestion

can be performed taking advantage of PCR tube strips and PCR cyclers.

Figure 3. Principle of using PCR to detect the accessibility of DNA fragments in

chromatin. After a limited DNase I digest of native chromatin, more accessible chromatin is

cleaved more frequently within a short distance resulting in fragmentation of the DNA and

reduced signals from PCR reactions (right). Inaccessible chromatin is cleaved less frequently

and therefore the DNA remains nearly intact, resulting in strong PCR signals (left). The green

arrows represent primer positions.

Figure 4. DNase I-PCR shows differential DNase I sensitivity of chromatin in selected

genomic regions. Equal amounts of chromatin and purified DNA were subjected to gradient

DNase I treatments. Extracted DNA was used as template for PCR for two pericentric TE

genes (CINFUL-like and Ta2), two PcG target genes (AG and FT), and two active genes

(ACTIN-7 and GAPDHα). The experiment was replicated three times (rep. 1-3)

Figure 5. Fitting curves of the DNase I-PCR results for the selected genomic regions.

PCR products as shown in Fig. 4 were quantified using an Agilent Bioanalyzer. The

measurements were normalized to the input values and fitted to an exponential decay model.

The fitted curves for all tested genomic regions are shown for the 3 replicates (rep. 1~3) for

both digested chromatin (top) and digested isolated DNA (bottom).

Figure 6. The distribution of the decay constants of the tested genomic regions on a

“heat” axis. The fitted decay constants were averaged over the three replicates for digested

chromatin (blue text) and digested isolated DNA (red text), respectively. The results were

plotted on a logarithmic axis. Error bars show the standard error of the decay constants. The

intercept table shows a summary of the calculated results (upper right corner).




19

Figure 7. qPCR confirmation of enrichment of hypo-sensitive over hyper-sensitive DNA

regions in different size fractions after controlled DNase I digestion of nuclei. DNA

fractions of four size ranges (> 17 kb, 6 kb-17 kb, 3 kb-6 kb, <3 kb) were recovered

separately from undigested (left 3 columns) and digested (right 3 columns) nuclei.

Enrichment of hypo-sensitive (inaccessible) pericentric heterochromatin versus hyper-

sensitive (accessible) euchromatic active genes is represented by enrichment of signal

abundance for the TE gene Ta2 against the active ACTIN-7 gene as measured by qPCR. High

levels of enrichment are shown in blue and depletion in red.




20

Table 1. Primers for DNase-PCR

Locus Primer Sequence Amplicon length (bp)

Ta2 TACAGTGGCTACCACATTGC

1680 ATGAAAGCGGTCCCATCA

CINFUL-like ACCGCAATATCCGATACGAC

1651 TTCAACGTCGAACGAGTCCTAG

AG GTGAAACAAATTTTCCTGCAGAATGTC

1631 TCCTAGCTCCGATTGGTACG

FT TCTTTTAGAACGTTTTCGCTTTCG

1695 GGTTGCTAGGACTTGGAACATC

GAPDHα CTCCCTTGGAAGGAGCTAGG

1648 AATTGTGAATAACTAGCTTTAGCATTGGA

ACTIN-7 GAACTGCTCTTGGCTGTCT

1646 AGCATTGTCTCTCCCAGATTTT




21

Table 2. Primers and Universal Probes for q-PCR

Locus Primer Sequences Probe No.

Ta2 ATGAAAGCGGTCCCATCA

#119 CGACTGCTATTCCCTTGTCC

ACTIN-7 GGAAACATCGTTCTCAGTGGT

#31 CTTGATCTTCATGCTGCTAGGT



Probing chromatin accessibility - Plant Physiology · Probing chromatin accessibility 2 Measuring...

Documents

Transcript of Probing chromatin accessibility - Plant Physiology · Probing chromatin accessibility 2 Measuring...