1/22/2020

1

Measuring Outcomes Post-Transplant in Multiple Myeloma

Luciano J Costa, MD, PhD

Associate Professor of Medicine

University of Alabama at Birmingham

Conflicts of Interest

• Research Support: Janssen, Amgen

• Honorarium: Celgene, BMS, Janssen, Amgen, Sanofi, AbbVie

• Speaker bureau: Amgen, Janssen, Sanofi

• Off label uses of pharmaceuticals will be discussed in this presentation

2

Learning Objectives

• Describe the different parameters utilized to measure and describe outcomes

after autologous transplantation (aHCT) for multiple myeloma (MM)

• List traditional response criteria in MM and understand its limitations

• Review novel methods to identify and measure disease burden in MM

• Discuss how aHCT and therapeutic innovations in MM have affected outcomes

1/22/2020

2

Why to Measure Outcomes in MM?

• Compare Therapies

• Prognostication

• Modify treatment

—Progression or lack of response triggers change in therapy

—Uncommonly done in other circumstances (e.g lack of CR)

—No studies prospectively

CR= Complete Response4

Ideal Outcome

• Easy to Measure

• Measurable in all patients

• Reproducible

• Assessable early on treatment

• Correlates well with clinically meaningful outcomes

—Overall survival

—Quality of life (QOL)

5

IMWG Response Assessment in MM

IMWG= International Myeloma Working Group6

Kumar S et al. Lancet Oncol 2016; 17: e328–46

1/22/2020

3

ARS 1

What test is not part of traditional IMWG response assessment in MM?

a) Serum Protein Electrophoresis

b) Bone marrow aspiration and biopsy

c) Functional Imaging (PET/CT)

d) 24h Urine Protein electrophoresis

e) Serum Immunofixaton

7

Does Traditional Response Criteria Check all the Boxes?

• Easy to Measure?

—Cheap, but not easy

—Multiple tests, requires marrow assessment.

• Measurable in all patients?

—Almost- challenge of non-secretory or oligo secretory MM

• Reproducible?

—Not well studied

• Assessable early on treatment?

—Not well studied

• Correlates well with clinically meaningful outcomes ?

—Overall survival – Yes, with caveats

—Quality of life – No data

8

Response and Survival in MM

OS= Overall Survival; PFS= Progression-free Survival; nCR: near complete remission

VGPR: very good partial response; PR: partial response; SD: stable disease; PD: progressive disease9

Martinez-Lopez J et al. Blood 2011; 118:529

1/22/2020

4

ARS 2

What is not a limitation of current traditional response assessment in MM?

a) Response categories correlate poorly with OS

b) It requires invasive bone marrow aspiration and biopsy

c) Criteria were not anchored in hard data

d) Requires multiple tests

e) Protein electrophoresis is expensive

10

Earlier Trials: aHCT Improves OS in MM

11

Attal M et al. N Engl J Med 1996;335:91

Child A et al. N Engl J Med 2003;348:1875

Modern Trials :Transplant Improves Short and Long Term Outcomes

12

GROUP No INDUCTION COMPARISON > VGPR PFS OS

GIMEMA 402 RD x4 MPR x 6aHCT x 2

6359

22 mo median

43 mo*65% 4 yrs

81%*MultiCenter 389 RD x4 CDR x 6

aHCT x25054

29 mo

43 mo*68% 4 yrs

77%*EMN02 1192 VCD x3-4 VMP x 4

aHCT 1 or 27485*

57% @ 3 yrs65%

HR 0.73*

NS(short fu)

IFM 2009 700 VRD x3 VRD x 5aHCT + VRD x 2

7788*

36 mo

50 mo*82% 4 yrs81%

Palumbo A et al. N Engl J Med 2014, 371:895.

Gay et al. Blood 2015, 126:389.

Cavo et al. Blood 2017, 130:397.

Attal M et al. N Engl J Med 2017, 376:1311

There has been NO MODERN transplant vs. No transplant trialNo: number of patients; RD: lenalidomide/ dexamethasone; MPR: melphalan/ prednisone/ lenalidomide; mo: months; CDR:

cyclophosphamide/ dexamethasone/ lenalidomide; VCD: bortezomib/ cyclophosphamide/ dexamethasone; VMP: bortezomib/

melphalan/prednisone; HR: hazard ratio; fu: follow-up; VRD: bortezomib/ lenalidomide/ dexamethasone

*Statistically significant difference

1/22/2020

5

CR only a good thing because of MRD (-) CR

13Lahuerta et al. J Clin Oncol 2017;35:2900

Measurable Residual Disease (MRD)

• Quantification of burden of disease beyond traditional protein-based tests and

assessment of response

• Irrelevant when CRs were rare (2000)

• Crucial when CR is the norm (2020)

• Open questions

—What is the best method?

—How feasible?

—Can it predict OS?

—Can it be used as surrogate endpoint in clinical trials?

14

Flow Cytometry- Technical Principles

15

Analytical Software

1/22/2020

6

NGS – Technical Principles

16

Malignant cell

CTGAACTG

CTGAACTG

CTGAACTGCTGAACTGCTGTTCAG

CACTTCAG

CACGACAC

TGCGACACTACCTCAC

TGGTAtCAC

CTGAACTGIdentification of

Clonogenic sequence(s)

Treatment

Search for and quantification of clonogenic

sequence(s)

Calculate burden of MRD

NGS: Next Generation Sequencing

Different Methods to Assess MRD

17

MFC (First Generation)

EuroFlow™ – Next Generation

Flow (NGF)

ClonoSEQ®- Next

Generation Sequencing

(NGS)

Applicability >95% of cases >95% of cases >92% cases

Requires initial sample No No Yes

Availability Can be performed locally Can be performed locally, few

centers have implemented

Sample shipped to central

laboratory from any site

Required sample ??? 2 x 107 nucleated cells Up to 20 µg of DNA (~3 x

106 nucleated cells)

Can be performed in

stored samples

No No Yes

Limit of detection ???? 2 x 10-6 (20 events) 6.8 x 10-7

Limit of quantification ??? 5 x 10-6 (50 events) 1.8 x 10-6

FDA cleared No No Yes

Bal S et al. Br J Haematol.2019;186:807-819

MFC=Multiparameter Flow Cytometry

µg= microgram

ARS 3

In contrast with Next Generation Flow an important property of Next Generation Sequencing is:

a) It does not require a pre-treatment sample with high MM content

b) Can not be run on stored samples

c) Is informative in <70% of cases

d) It can detect multiple mutations important for MM pathogenesis

e) Has a limit of detection < 10-6

18

1/22/2020

7

MRD Strongly predicts Outcomes in CR patients (MFC 10-4)

19Munshi et al. Jama Oncology 2017;3:28

Depth of Response Matters (NGS)

20Perrot A et al. Blood. 2018;132:2456

< 10-6

< 10-6, 10-5

< 10-5, 10-4

> 10-4

MRD Partially Abrogates Cytogenetic Risk

21

Perrot A et al. Blood. 2018 132:2456

1/22/2020

8

Can MRD be Used as Surrogate Endpoint in MM trials?

22

Validating a prognostic marker Validating a surrogate endpoint

• Correlations of MRD status PFS on individual patients• Does not involve treatment comparisons• Multiple studies provide assessment of consistence and

robustness

Data points generated by:

Individual patient

Each trial

• Correlations of Odds Ratio on MRD endpoint Hazard Ratio on PFS

• Multiple studies provide the “building blocks” – treatment comparisons from each trial

Munshi et al. Jama Oncology 2017;3:28

Shi Q et al. J Clin Oncol 2017; 35:552

Courtesy of Dr. Q. Shi

Limitations of MRD Assessment

• Pre-Analytical Issues—Quality of marrow aspirate

—Invasive test (limited retesting)

—Heterogeneous marrow infiltration

—Extra-medullary disease

• Analytical Issues—Analytical validation

—Clinical validation

—Limited cross-validation

—Test availability

—Cost

23

Functional Imaging Adds to MRD

24Rasche A et al. Leukemia 2019, 33:1713

1/22/2020

9

IMWG-defined MRD Response

• Sustained MRD- negative - MRD negativity in the marrow (NGF or NGS, or both) and by imaging as defined below, confirmed minimum of 1 year apart.

• Flow MRD- negative - Absence of phenotypically aberrant clonal plasma cells by NGF on bone marrow aspirates using the EuroFlow standard operation procedure with a minimum sensitivity of 1 in 10⁵.

• Sequencing MRD- negative - Absence of clonal plasma cells by NGS on bone marrow aspirate using the LymphoSIGHT platform (or validated equivalent method) with a minimum sensitivity of 1 in 10⁵.

• Imaging plus MRD-negative - MRD negativity as defined by NGF or NGS + disappearance of every area of increased tracer uptake found at baseline PET/CT or decrease to less mediastinal blood pool SUV or less than that of surrounding normal tissue.

25Kumar S et al. Lancet Oncol 2016; 17: e328–46

Traditional and MRD Response in aHCT Trials in MM

26

Patient Characteristics Post Induction Best On Study

Regimen/Trial N ISS-3 High-risk ≥ VGPR MRD<10-5

≥ VGPR ≥ CR MRD <10-5

MRD <10-6

IFM2009RVD-aHCT-RVD

350 17% 18% 47% 88% 59% 30% (NGS)

FORTEKRD-aHCT-KRD

158 15% 33% 73% 89% 60% 58% (NGF)

CASSIOPEIADaraVTD-aHCT-DaraVTD

543 15% 15% 65% 35% (NGF)

85% 54% 64% (NGF)

39% (NGS)

GRIFFINDaraRVD-aHCT-DaraRVD

104 14% 16% 72% 96% 80% 69 % (NGS)

Attal M et al. N Engl J Med 2017 376:1311

Gay F et all ASCO 2019; Moreau P et al. Lancet 2019,394:29

Voorhes P et al. ASH 2019, abstract 691

KRD: carfilzomib/lenalidomide/dexamethasone

DaraVTD: daratumumab/bortezomib/thalidomide/dexamethasone

DaraRVD: daratumumab/lenalidomide/bortezomib/dexamethasone

ARS 4

What is not true about contemporary MM trials incorporating aHCT?

a) MRD is a validated surrogate of OS

b) High rates of MRD (-) CR are seen with quadruple therapy

c) MRD (-) at least partially abrogate other prognostic factors

d) aHCT leads to higher rates of MRD (-) CR than conventional therapy

e) Few studies report MRD with threshold of 10-6

27

1/22/2020

10

Opportunities With MRD Assessment

• MRD-based eligibility

• MRD as primary endpoint

• MRD Response-adapted therapy trials

—Intensification

—De-intensification/ treatment discontinuation

• Measure effect of each phase of therapy despite patient being in CR

—Bal et al TCT 2020 abstract 27

• Development and cross-validation of minimally invasive “MRD equivalents”

—Cell free DNA

—Mass Spectrometry

28

MRD response-adapted therapy

29Costa et al. ASH Annual Meeting 2019, abstract 860

MRD response-adapted therapy

30Costa et al. ASH Annual Meeting 2019, abstract 860

1/22/2020

11

Conclusions

• OS and QOL are clinically significant outcomes in MM

• Traditional response assessment correlates poorly with OS, inadequate for highly

effective therapies

• MRD assessment post initial therapy by NGF or NGS is one of the strongest

predictors of outcomes in MM

• Functional imaging partially overcomes limitations of MRD assessment

• Multiple opportunities for MRD to improve MM care

—Surrogate for clinical trials

—MRD-based treatment intensification and de-identification31

References

• Cavo M, Terpos E, Nanni C et al. Role of (18)F-FDG PET/CT in the diagnosis and management of multiple myeloma and other plasma cell disorders: a consensus statement by the International Myeloma Working Group. Lancet Oncol. 2017 Apr;18(4):e206-e217

• Kumar S, Paiva B, Anderson KC et al. International Myeloma Working Group consensus criteria for response and minimal residual disease assessment in multiple myeloma. Lancet Oncol. 2016 Aug;17(8):e328-e346

• Munshi NC, Avet-Loiseau H, Rawstron AC et al. Association of Minimal Residual Disease With Superior Survival Outcomes in Patients With Multiple Myeloma: A Meta-analysis. JAMA Oncol. 2017 Jan 1;3(1):28-35

• Bal S, Weaver A, Cornell RF, Costa LJ. Challenges and opportunities in the assessment of measurable residual disease in multiple myeloma. Br J Haematol. 2019 Sep;186(6):807-819

32