PowerPoint Presentationfacweb.northseattle.edu/estavney/Bio260/… · PPT file · Web view ·...
Transcript of PowerPoint Presentationfacweb.northseattle.edu/estavney/Bio260/… · PPT file · Web view ·...
![Page 1: PowerPoint Presentationfacweb.northseattle.edu/estavney/Bio260/… · PPT file · Web view · 2010-07-20PowerPoint Presentation Author: ... Last modified by: IT Services Created](https://reader036.fdocuments.in/reader036/viewer/2022062908/5aba2dfd7f8b9ab1118b8944/html5/thumbnails/1.jpg)
Microbial Genetics: DNA and RNAWhat chemical carries the genetic instructions in cells, and how is this chemical reproduced? How is this chemical used inside
the cell to direct the production of new molecules?
• The Need for Protein Making Instructions• Phenotype = genotype (+ environment)• 1 chromosome gene ---> 1 protein• DNA-->RNA (copy)-->protein production
• Structure of DNA, The Genetic Material• Two polynucleotide strands with H bonds
• DNA + protein make up a chromosome• RNA is single stranded, difft sugar, uracil
• How DNA copies itself when a cell divides• DNA replication by unzipping• DNA polymerase enzyme synthesizes new complementary strands --> 2 new helices
• Transcription: Making a short DNA copy• RNA polymerase makes RNA from DNA
• Only one set of instructions (gene) is copied• Copy is complementary to the DNA gene• In eukaryotes, the RNA copy is edited
• The Three Kinds of RNA• mRNA: carries instructions for 1 protein• rRNA: structural support in ribosomes• tRNA: amino acid trucks with anticodons
• Steps of Translation (Protein Synthesis)
DNA, the genetic material, replicates by semiconservative replication. It is further copied in transcription for use in building proteins for the cell.
![Page 2: PowerPoint Presentationfacweb.northseattle.edu/estavney/Bio260/… · PPT file · Web view · 2010-07-20PowerPoint Presentation Author: ... Last modified by: IT Services Created](https://reader036.fdocuments.in/reader036/viewer/2022062908/5aba2dfd7f8b9ab1118b8944/html5/thumbnails/2.jpg)
Flow of Genetic Information
Figure 8.2
![Page 3: PowerPoint Presentationfacweb.northseattle.edu/estavney/Bio260/… · PPT file · Web view · 2010-07-20PowerPoint Presentation Author: ... Last modified by: IT Services Created](https://reader036.fdocuments.in/reader036/viewer/2022062908/5aba2dfd7f8b9ab1118b8944/html5/thumbnails/3.jpg)
DNA is a Double-Stranded Chain of Nucleotides
![Page 4: PowerPoint Presentationfacweb.northseattle.edu/estavney/Bio260/… · PPT file · Web view · 2010-07-20PowerPoint Presentation Author: ... Last modified by: IT Services Created](https://reader036.fdocuments.in/reader036/viewer/2022062908/5aba2dfd7f8b9ab1118b8944/html5/thumbnails/4.jpg)
DNA
Figure 8.4
![Page 5: PowerPoint Presentationfacweb.northseattle.edu/estavney/Bio260/… · PPT file · Web view · 2010-07-20PowerPoint Presentation Author: ... Last modified by: IT Services Created](https://reader036.fdocuments.in/reader036/viewer/2022062908/5aba2dfd7f8b9ab1118b8944/html5/thumbnails/5.jpg)
Microbial Genetics: DNA and RNAWhat chemical carries the genetic instructions in cells, and how is this chemical reproduced? How is this chemical used inside
the cell to direct the production of new molecules?
• The Need for Protein Making Instructions• Phenotype = genotype (+ environment)• 1 chromosome gene ---> 1 protein• DNA-->RNA (copy)-->protein production
• Structure of DNA, The Genetic Material• Two polynucleotide strands with H bonds
• DNA + protein make up a chromosome• RNA is single stranded, difft sugar, uracil
• How DNA copies itself when a cell divides• DNA replication by unzipping• DNA polymerase enzyme synthesizes new complementary strands --> 2 new helices
• Transcription: Making a short DNA copy• RNA polymerase makes RNA from DNA
• Only one set of instructions (gene) is copied• Copy is complementary to the DNA gene• In eukaryotes, the RNA copy is edited
• The Three Kinds of RNA• mRNA: carries instructions for 1 protein• rRNA: structural support in ribosomes• tRNA: amino acid trucks with anticodons
DNA, the genetic material, replicates by semiconservative replication. It is further copied in transcription for use in building proteins for the cell.
![Page 6: PowerPoint Presentationfacweb.northseattle.edu/estavney/Bio260/… · PPT file · Web view · 2010-07-20PowerPoint Presentation Author: ... Last modified by: IT Services Created](https://reader036.fdocuments.in/reader036/viewer/2022062908/5aba2dfd7f8b9ab1118b8944/html5/thumbnails/6.jpg)
DNA Replication is Semiconservative
Figure 8.3
![Page 7: PowerPoint Presentationfacweb.northseattle.edu/estavney/Bio260/… · PPT file · Web view · 2010-07-20PowerPoint Presentation Author: ... Last modified by: IT Services Created](https://reader036.fdocuments.in/reader036/viewer/2022062908/5aba2dfd7f8b9ab1118b8944/html5/thumbnails/7.jpg)
• DNA replication is semiconservative
DNA
Figure 8.7
![Page 8: PowerPoint Presentationfacweb.northseattle.edu/estavney/Bio260/… · PPT file · Web view · 2010-07-20PowerPoint Presentation Author: ... Last modified by: IT Services Created](https://reader036.fdocuments.in/reader036/viewer/2022062908/5aba2dfd7f8b9ab1118b8944/html5/thumbnails/8.jpg)
DNA Replication Involves Several Enzymes
Figure 8.6
![Page 9: PowerPoint Presentationfacweb.northseattle.edu/estavney/Bio260/… · PPT file · Web view · 2010-07-20PowerPoint Presentation Author: ... Last modified by: IT Services Created](https://reader036.fdocuments.in/reader036/viewer/2022062908/5aba2dfd7f8b9ab1118b8944/html5/thumbnails/9.jpg)
Central Dogma of Biology: How Shape and Form Are Dictated By DNA Genes
A segment of DNA (gene)
carries specific coded
instructions for the making
of a single proteins.
Genotype:The genes carried in a cell for a particular trait
Phenotype: The physical expression of genes for a particular trait
QuickTime™ and a decompressor
are needed to see this picture.
DNA Genes are Instructions for Making Specific Polypeptides
![Page 10: PowerPoint Presentationfacweb.northseattle.edu/estavney/Bio260/… · PPT file · Web view · 2010-07-20PowerPoint Presentation Author: ... Last modified by: IT Services Created](https://reader036.fdocuments.in/reader036/viewer/2022062908/5aba2dfd7f8b9ab1118b8944/html5/thumbnails/10.jpg)
Microbial Genetics: DNA and RNAWhat chemical carries the genetic instructions in cells, and how is this chemical reproduced? How is this chemical used inside
the cell to direct the production of new molecules?
• The Need for Protein Making Instructions• Phenotype = genotype (+ environment)• 1 chromosome gene ---> 1 protein• DNA-->RNA (copy)-->protein production
• Structure of DNA, The Genetic Material• Two polynucleotide strands with H bonds
• DNA + protein make up a chromosome• RNA is single stranded, difft sugar, uracil
• How DNA copies itself when a cell divides• DNA replication by unzipping• DNA polymerase enzyme synthesizes new complementary strands --> 2 new helices
• Transcription: Making a short DNA copy• RNA polymerase makes RNA from DNA
• Only one set of instructions (gene) is copied• Copy is complementary to the DNA gene• In eukaryotes, the RNA copy is edited
• The Three Kinds of RNA• mRNA: carries instructions for 1 protein• rRNA: structural support in ribosomes• tRNA: amino acid trucks with anticodons
DNA, the genetic material, replicates by semiconservative replication. It is further copied in transcription for use in building proteins for the cell.
![Page 11: PowerPoint Presentationfacweb.northseattle.edu/estavney/Bio260/… · PPT file · Web view · 2010-07-20PowerPoint Presentation Author: ... Last modified by: IT Services Created](https://reader036.fdocuments.in/reader036/viewer/2022062908/5aba2dfd7f8b9ab1118b8944/html5/thumbnails/11.jpg)
Transcription is Performed by RNA Polymerase
![Page 12: PowerPoint Presentationfacweb.northseattle.edu/estavney/Bio260/… · PPT file · Web view · 2010-07-20PowerPoint Presentation Author: ... Last modified by: IT Services Created](https://reader036.fdocuments.in/reader036/viewer/2022062908/5aba2dfd7f8b9ab1118b8944/html5/thumbnails/12.jpg)
Translation or Protein Synthesis
Figure 8.2
![Page 13: PowerPoint Presentationfacweb.northseattle.edu/estavney/Bio260/… · PPT file · Web view · 2010-07-20PowerPoint Presentation Author: ... Last modified by: IT Services Created](https://reader036.fdocuments.in/reader036/viewer/2022062908/5aba2dfd7f8b9ab1118b8944/html5/thumbnails/13.jpg)
Figure 10.17
Anatomy of a Messenger RNA
Leader
Trailer
mRNA is a Chain of Nucleotides
![Page 14: PowerPoint Presentationfacweb.northseattle.edu/estavney/Bio260/… · PPT file · Web view · 2010-07-20PowerPoint Presentation Author: ... Last modified by: IT Services Created](https://reader036.fdocuments.in/reader036/viewer/2022062908/5aba2dfd7f8b9ab1118b8944/html5/thumbnails/14.jpg)
Microbial Genetics: DNA and RNAWhat chemical carries the genetic instructions in cells, and how is this chemical reproduced? How is this chemical used inside
the cell to direct the production of new molecules?
• The Need for Protein Making Instructions• Phenotype = genotype (+ environment)• 1 chromosome gene ---> 1 protein• DNA-->RNA (copy)-->protein production
• Structure of DNA, The Genetic Material• Two polynucleotide strands with H bonds
• DNA + protein make up a chromosome• RNA is single stranded, difft sugar, uracil
• How DNA copies itself when a cell divides• DNA replication by unzipping• DNA polymerase enzyme synthesizes new complementary strands --> 2 new helices
• Transcription: Making a short DNA copy• RNA polymerase makes RNA from DNA
• Only one set of instructions (gene) is copied• Copy is complementary to the DNA gene• In eukaryotes, the RNA copy is edited
• The Three Kinds of RNA• mRNA: carries instructions for 1 protein• rRNA: structural support in ribosomes• tRNA: amino acid trucks with anticodons
DNA, the genetic material, replicates by semiconservative replication. It is further copied in transcription for use in building proteins for the cell.
![Page 15: PowerPoint Presentationfacweb.northseattle.edu/estavney/Bio260/… · PPT file · Web view · 2010-07-20PowerPoint Presentation Author: ... Last modified by: IT Services Created](https://reader036.fdocuments.in/reader036/viewer/2022062908/5aba2dfd7f8b9ab1118b8944/html5/thumbnails/15.jpg)
=
3 Types of RNA – Each With a Different Job
Messenger RNA (mRNA)
Carries copy of gene informationto the ribosome to make protein
anticodon
Ribosomal RNA (rRNA)
Part of the structure ofthe ribosome; key component in aminoacid linking machinery
CUGC U G
Transfer RNA (tRNA)
Carries amino acids to the ribosome for linking; identified by anticodon “sign”
![Page 16: PowerPoint Presentationfacweb.northseattle.edu/estavney/Bio260/… · PPT file · Web view · 2010-07-20PowerPoint Presentation Author: ... Last modified by: IT Services Created](https://reader036.fdocuments.in/reader036/viewer/2022062908/5aba2dfd7f8b9ab1118b8944/html5/thumbnails/16.jpg)
How Gene Instructions are Communicated
![Page 17: PowerPoint Presentationfacweb.northseattle.edu/estavney/Bio260/… · PPT file · Web view · 2010-07-20PowerPoint Presentation Author: ... Last modified by: IT Services Created](https://reader036.fdocuments.in/reader036/viewer/2022062908/5aba2dfd7f8b9ab1118b8944/html5/thumbnails/17.jpg)
mRNA Codon Dictionary of the Genetic Code
![Page 18: PowerPoint Presentationfacweb.northseattle.edu/estavney/Bio260/… · PPT file · Web view · 2010-07-20PowerPoint Presentation Author: ... Last modified by: IT Services Created](https://reader036.fdocuments.in/reader036/viewer/2022062908/5aba2dfd7f8b9ab1118b8944/html5/thumbnails/18.jpg)
DNA template strand:
CGTTTACGACCGGCCTTAGATCCTGACG
Central Dogma: DNARNAProtein
mRNA: GCAAAUGCUGGCCGGAAUCUAGGACUGC
Transcription by RNA polymerase
Translation by ribosome
Protein: Met -
Leu -Ala -
Gly -Ile
![Page 19: PowerPoint Presentationfacweb.northseattle.edu/estavney/Bio260/… · PPT file · Web view · 2010-07-20PowerPoint Presentation Author: ... Last modified by: IT Services Created](https://reader036.fdocuments.in/reader036/viewer/2022062908/5aba2dfd7f8b9ab1118b8944/html5/thumbnails/19.jpg)
Translation in Prokaryotes Can Occur Simultaneously With Transcription
Figure 8.11
![Page 20: PowerPoint Presentationfacweb.northseattle.edu/estavney/Bio260/… · PPT file · Web view · 2010-07-20PowerPoint Presentation Author: ... Last modified by: IT Services Created](https://reader036.fdocuments.in/reader036/viewer/2022062908/5aba2dfd7f8b9ab1118b8944/html5/thumbnails/20.jpg)
A Ribosome Has Two Subunits and Three tRNA Binding Sites
![Page 21: PowerPoint Presentationfacweb.northseattle.edu/estavney/Bio260/… · PPT file · Web view · 2010-07-20PowerPoint Presentation Author: ... Last modified by: IT Services Created](https://reader036.fdocuments.in/reader036/viewer/2022062908/5aba2dfd7f8b9ab1118b8944/html5/thumbnails/21.jpg)
Translation: Initiation, Elongation, Termination
Termination
Initiation
Elongation (3-4 steps)
![Page 22: PowerPoint Presentationfacweb.northseattle.edu/estavney/Bio260/… · PPT file · Web view · 2010-07-20PowerPoint Presentation Author: ... Last modified by: IT Services Created](https://reader036.fdocuments.in/reader036/viewer/2022062908/5aba2dfd7f8b9ab1118b8944/html5/thumbnails/22.jpg)
Steps of Translation
Protein Synthesis Movie