GENETIC POLYMORPHISM OF UDP-GLUCURONOSYLTRANSFERASE UGT2B7 AND IN VIVO GLUCURONIDATION OF OXAZEPAM:

A GENOTYPE-PHENOTYPE COMPARATIVE STUDY

Peter Somphone Kard

A thesis submitted in conformity with the requirements for the Master of Science Gnduate Department of Pharmacology

University of Toronto

8 Copyright by Peter Somphoae Kard 1999.

National Library !al of Canada Bibliothhque nationale du Canada

Acquisitions and Acquisitions et Bibliographie SeMces services bibliographiques

395 Wellington Street 395, rue Wellington OttewaON K I A O N 4 W w a O N K1AON4 Canada Canada

The author has granted a non- exclusive licence allowing the National Library of Canada to reproduce, loan, distribute or sel1 copies of this thesis in microform, paper or electronic formats.

L'auteur a accordé une licence non exclusive permettant à la Bibliothèque nationale du Canada de reproduire, prêter, distribuer ou vendre des copies de cette thèse sous la foxme de microfiche/film, de reproduction sur papier ou sur format électronique.

The author retains ownership of the L'auteur conserve la propriété du copyright in this thesis. Neither the droit d'auteur qui protège cette thèse. thesis nor substantial extracts fiom it Ni la thèse ni des extraits substantiels may be printed or othenMse de celle-ci ne doivent être imprimés reproduced without the author's ou autrement reproduits sans son permission. autorisation.

Genetic polymorphism of WDP-glucuronsyltransfenw UGT2B7 and in vivo

glucuronidation of oxazepam: A genotype-phenotype comparative study. M. Sc. 1 999.

Peter Somphone Kard. Department of Pharmacology. University of Toronto.

In this study, oxazepam was used as a probe dnig to study a genetic

polymorphism in UDP-glucuronsyltransferase UGTZB7. The SR oxazeparn glucuronide

ratio (SR ratio) of 203 subjects afier an oral dose of (RS) oxazepam was bimodally

distnbuted, with approximately 18% of the population possessing S/R ratios below an

antirnode of 1.66. An allele specific amplification assay that has the ability to distinguish

between the wildtype and variant alleles of UGT7B7 was established in this study.

Genotyping of 1 14 individuals demonstrated that the allelic frequency of the variant and

wildtype alleles within the population is 0.474 and 0.526, respectively. The genotype of

8 individuals who had previously been phenotyped demonarated that a homozygous

variant genotype is associated to an atypical phenotye, whereas, heterozygotes as well as

homozygotes for the wildtype allele are phenotypically normal in regard to the S/R ratio.

This is the first study that has demonstrated an association between a genetic

polymorphism in the UGT2B family and variations in the in vivo giucuronidation of a

drug .

1 would like to thank Dr. B.K. Tang, Dr. W. Kalow, and Dr. D.M. Grant for their guidance and support. 1 would also like to thank J. Wong, V. Ozdemir and G. Gwdfellow for technical assistance. Without the involvement of these individuals, this work could not have been possible.

Table of Contents

1. Introduction

Page

UDP-Glucuronosyltransferases The UGT Multigene Family UGTl Family Genetic Polymorphism in the UGT 1 Family

Gilbert's Syndrome Cng ler-Nad ar Syndromes

UGT2 Family UGT2 Gene Str~cture Genetic Polymorphisms in the UGT2B subfamily UGT2B7 UGT287 versus UGTZB7

Glucuronidation of Dmgs Variability in Glucuronidation

Oxazepam Factors that Influence the Metabolism of Oxazepam Enantioselective Glucuronidation Rationale Hypot hesis Objectives

II Methods and Materials

In vivo Glucuronidation of Oxazepam Subjects Chromatographic Anal ysis Data Analysis

Molecular Work DNA Extraction fiorn Tissue PCR of UGT2B7 fiorn Genomic DNA RNA Extraction fiom Tissue First-Strand Synthesis of cDNA PCR of Actin cDNA RT-PCR of UGT2B7 cDNA Gel Extraction of PCR products Subcloning and Transformation Miniprep of Plasmid DNA Sequencing Reaction

Allele S pecific Amplification Mouthwash Method for Obtaîning Genornic DNA

III Rcsults

In vivo Oxazepam Metabolkm Interindividual Variability in the S R ratio 5 1 Factors that Influence the S/R ratio 51 S- and R- Oxazepam Glucuranides vs. SIR ratio 56 Factors that Intluence the Glucuronidation of S- and R- Oxazepam 58

Molecular Work Genornic Sequence of UGT2B7 Sequence of UGT2B7 Triinscripts Allele Specific Amplification Genotyping Results Genotype-Phenotype Cornparison

IV Discussion

Distribution of the S/R Ratio S R Ratio vs. S- and R- glucuronides Factors that Influence Glucuronidation of S- and R- Oxazepam and the S/R Ratio Genotype within a population Genotype-Phenotype Cornparison Conclusion Future Studies

v References

VI Appendices Appendix 1. Appendix 2. Appendix 3. Appendix 4.

Appendix 5 . Appendix 6.

Individual Phenotypes Results Obtained in this Study Individual P henotypes Results nom Appana (1 995) Individual Genotype Results Sequence Cornparisons b e ~ n UGT2B7 and other UGT2B Isozymes Sequence of UGT2B4 Characteristics of the 8 individuals used in the genotype- phenotype comparative study

List of Figures

Figure 1.

Figure 2.

F i p n 3.

Figun 4.

Figun 5.

Figure 6.

Figure 7.

Figure 8.

Figure 9.

Figure 10.

Figun 11.

Figure 12.

Page

Gene Structure o f UGTs 4

Schematic of RT-PCR Amplification of UGT2B7 39

Vector Map of pCR@Z.l-TOPO 42

Schematic of Allele Specific Amplification 47

Distribution of SIR Ratio in a Population 53

Correlation Analyses of the S/R Ratio vs. S- and R- Glucuronides 57

Genomic Sequence of UGT2B7 62

Automated Sequence of UGT2B7 Transcript 65

Variant and Wildtype Sequences of UGT2B7 66

Allele Specific Amplification 68

Phenotype-Genotype Cornparison 71

A Plot of SIR Ratio vs. UGT2B7 Genotype 72

List of Tables Page

Table 1. Genetic Mutations Associated with CN and Gilbertk Syndromes 6

Table 2. Factors that Affect Oxazepam Metabolkm 18

Table 3. Characteristics of Subjects 3 1

Table 4. Summary Table for SR Ratios 54

Table 5. Correlation of Various Factors vs. S/R ratio, S-, and .R- Glucuronides

Table 6. Cornparison of S- and R- Glucuronides between sexes, ethnic groups, and OC users vs. Non-OC users 60

Table 7. Summary of UGT2B7 Genotypes 69

List of Abbrcviations

ASA

cDNA

CN

FISH

HDCA

HPLC

Km

MuLV

NAT

NS AID

mv

OC

PCR

RFLV

rGc

S/R ratio

UDPGA

UGT

YAC

Allele Specific Amplification

Complementary deoxyribonucleic acid

Crigler-Nad ar Syndrome

Fluorescent in situ hybridization

Hyodeoxycholic acid

High pressure liquid chromatography

Michaelis constant

Murine Leukemia Virus

N-acetyltransferase

Non-stenodal anti-inflammatory dmg

Norrnality test variable

Oral contraceptive

Polymerase chah reaction

Restriction fragment length variation

Genetic component value

SIR oxazepam glucuronide ratio

Uridine-diphospho-D-glucuronic acid

Uridine-disphospho-g~ucuronosy ltransferase

Yeast artificial chromosome

UDP-GLUCURONOSYLTRANSFERASES

UDP-glucuronosyltransfetases (UGTs) are a superfamily of dmg metabolizing

enzymes. UGTs caîaiyze the transfer of the glucuronic acid moiety of UDP glucuronic

acid (UDPGA) to a wide variety of substrates. In humans, glucuronidation represents a

major detoxification pathway for many xenobiotics as well as endogenous substrates

(Bock, 199 1; Burchell et al., 1995; Dutton. 1980). Phamaceutical agents, plant

constituents, environmental pollutants, and carcinogens are al1 substrates for UGTs.

Endogenous compounds for glucuronyhransferases include; bilimbin, steroid hormones,

fat-soluble vitamins, bile acids, thyroxine. and biogenic amines.

The UGT Multigene Family

To date, 48 distinct mamrnal ian cDNAs of the UGT multigene famil y have been

characterized (Mackenzie et al., 1997). Of these 48, there are 18 human isoforms, 17 rat

forrns, 4 mouse fons, 6 rabbit forms, 2 monkey forms, and one bovine isofonn.

The human UGTs are separated into two families, UGTl and UGT2. This

separation is based upon the similarity of the amino acid sequences. Members of the

UGTl family have a p a t e r than 50% sequence homology to each other but less than a

50% homoiogy to the members of the UGTZ family (Burchell et al., 1991).

UGTl Famiiy

Al1 the human members of the UGTl family are produas of a single gene. The

UGTl gene complex is located on chromosome 2q37 and consists of 16 exons spanning

500 Kb (Harding et al., IWO). Each isofom is comprised of one of the 12 unique

promoterffirst exons and common exans 2 to 5 (Ritter et al., 1992a). The isozymes of the

UGTl family therefore share a comrnon carboxyl tail, while possessing a unique amino

terminal region (see Figure 1 .).

The substrate preferences of six UGT l isofoms (UGT 1 A 1, 1 A3, 1 A4, 1 A6, 1 A8.

and 1A9) have been detemiined. When the full-length cDNAs of these isofoms were

transiently expressed in COS cells or aably expressed in V79, or HEK 293 fibroblasts,

they glucuronidated a wide range of substrates (Burchell et al., 1995; Cheng et al., 1998;

Ebner and Burchell, 1993; Green et al., 1998; Visser et al., 1993). Endogenous substrates

include bilirubin, thyroid hormone. and some foms of steroids. Some of the exogenous

substrates include small planar phenols, halogenated and bulky alkyl phenols, aromatic

carboxylic acids, coumarins, and amines. UGTI Al is thought to be the major isoform

responsible for the glucuronidation of bilirubin, while the phenols are specific substrates

for UGTlA6 and UGTlA9. The substrate specificity for UGTIM, 1A7, 1A8, 1 Al0 have

not been elucidated since the cDNAs fiom these isofoms have not been isolated. It is

believed that UGTl AZ, UGTl Al 1, UGTlA12 isozymes are pseudogenes since the first

exons of these isoforms contain non-sense mutations within their predicted amino acid

sequences.

Figure 1. The gene structure for the UGTl farnily and the UGT2B subfamily (l,2). UGTl isozymes are encoded frorn a single gene locateci on chromosome 2. Whereas, the UGT2B isoforms are transcribed fkom independent genes located on chromosome 4. The diagrams are not drawn to d e .

Unique promot edexon 1 Common exons 2-5

Genetic Polymorhisms in the UGTl Famüy

Much of the knowledge about genetic variations in UGTs have been gained from

the study of Gilbert's and Crigler-Naüar (CN) syndromes (see Table 1 .). Unconjugated

hyperbilimbinemia is a characteristic of both of these disorders. Before the discovery

that the isofoms of the UGTl family were encoded by a single gene complex,

researchers studying Gilbert's and CN were pualed by the findings that some patients

with Gilbert's or CN also had an inability to glucuronidate phenols while other patients

with the same disorders exhibited normal phenol metabolism. It is now known that

mutations in the unique promoter/exon 1 region of UGTl Al will give rise to a phenotype

of hyperbilimbinemia. Whereas, mutations in the cornmon exons 2-5 will not only affect

the bilimbin-metabolizing enzyme but also dl of the other isoforms encoded by the

UGT 1 gene complex including the phenol-metabolizing enzymes.

Table 1. Human UGTl A l aileles in patients with Gilbert's or Crigler-Najar di- (CN). The human wild-type UGT 1 A 1 allele, encoding the functional enzyme is regardcd as UGT 1 A 10 1.

Namt

Gilûert's Syndrome

UGTlA1*3 UGTlAlfS UGTlA1*10 UGT1AlS16 UGTlAl*17 UGTlA1*18 UGTlAl*19 UGTlA1*20 UGTlAl*21 UGT 1 A 1 *22 UGTlA1*23 UGTlA1*24 UGTlAl*25

-

Nudeotidt change

Effect on Protein

teduccd expression

S375F deletion of exon2

R341X Q35fR S381R A401P W33 JX A368T

Frameshdt A292V KS26E K437X C280X

Bosma et al. 1995/Monaghan et al. 1996lBeuîier et al. 1998 Aono et al. 1993 Aono et al. 1993Koiwai et al. 1995 Aono et al. 1995Koiwai et al. 1995 Aono et al. 1995Koiwai et al. 1995

Bosma et al. 1992 B o s m et al. L 992 Moghrabi et ai. 1993 Labrune et ai. 1994 Labrune et al. 1994 Labrune et al. 1994 Labrune et al. 1994 Labrune et al. 1994 Labrune et al. 1994 Labrune et al. 1994 Labrune et al. 1991 Labrune et al. 1994 Aono et al. 1994

Aono et al. 1993 Aono et al. 1993 Bosma et al. 1993lSeppen et al. 1994 Seppen et al. 1994

v - heteroqgous genotypes have Gilbert's syndrome, while homozygous genotypes have the CN2 phenotype -X represents non-sense mutations - adapted from Mackenzie et al. 1997

Gilbert's Syndrome

Gilbert's syndrome is a mild fonn of unconjugated hyperbilirubinemia. This

disorder is found in 2019% of the population (Bosma et al., 1995a). tt is believed that this

disorder results fkom genetic abnonnalities in the UGT responsible for the

glucuronidation of bilirubin, namel y UGTl Al. Recently, a polymorphism in the

promoter region of the UGTl Al gene was reported to be linked with most of the clinical

cases of Gilbert's syndrome (Aono et al., 1995; Bosma et al., 1995b). Patients with

Gilbert's syndrome were genotyped as being homozygous for 7 TA repeats in the

(TA),,TAA box of the promoter region. The usual number of TA repeats is six.

Recently, the nomenclature for this polymorphisrn was assigned as UGT I A 1 *28

(Mackenzie et al., 1997).

A population study conducted in Scotland demonstrated that (TA)d(TA)7

individuals possessed significantly higher biiirubin concentrations than individuals with

either the (TA)o/(TA), or (TA)o/(TA)6 genotypes (Monaghan et al., 1996). They also

reported that among the Scottish population 10-13% of individuals within the population

are homozygous for the UGT 1 Al *28 mutation.

Interesting 1 y, interethnic di fferences of the (TAhTAA box repeats were observed

between Asians. AFncans, and Caucasians (Beutler et al., 1998). Africans had the highest

gene fiequency for the (TA17 allele (0.43), followed by Caucasians (0.39), while Asians

had the lowest (TA)7 gene frequency (0.16). Furthemore, arnong the Afncan population

there were individuals with 5 and 8 (TA) repeats. In comrast, both the 5 and 8 (TA)

repeats were not observed in either the Asian or Caucasian populations.

Mutations in the coding region of UGTlAl gene have aiso been shown to be

sssociated with Gilbert's syndrome (Aono et al., 1995; Koiwai et al., 1995).

Heteroqgosity of the one of following missense mutations is linked to Gilbert's

syndrome: exon 1 (G7 1 R or P229Q). exon 4 (R3 67G), or exon 5 (Y486D). Interestingly,

homozygosity of either the G71R or the Y486D results in Crigler-Najjar syndrome type

II (Aono et al., 1993).

Crigkr-Najjar Syndrome

Cngler-Najar (CNl and CN2) syndromes are a potentially lethal form of

unconjugated hyperbilinibinemia resulting from the complete absence or severely

reduced ability to glucuronidate bilinibin (Crigler and Najjar, 1952). Based upon the

plasma levels of unconjugated bil irubin and the response to barbiturate therapy, Crigler-

Najar syndrome is categorized into two types; CXl and CN2 (Arias et ai., 1969). CN1

patients have unconjugated plasma bilinibin levels in excess of 340 pM, whereas the

bilinibin levels of CN2 patients are below 340 W. Furthemore, when both patient

groups are prescribed phenobarbital, only the CN2 patients show a decrease in

unconjugated bilirubin plasma levels.

The molecular basis for Crigler-Najjar syndrome has been extensively studied

(see Table 1 .). Like Gilbert's syndrome, both types of Crigler-Najjar syndrome are linked

to genetic variations in the UGTl gene locus.

Inactivating substitutions as well as fiameshifi and non-sense mutations which

produces tmncated proteins are shown to be associated with Crigler-Nadar syndrome

type 1. Bosma et al. (1992) were arnong the first to demonstrate that genetic

abnonnalities in the UGTl gene were linlced to CNl. Sequence analysis of one CNl

patient showed a C+T substitution in exon 4 resulting in a change of a serine residue to a

phenylalanine (üGT 1 Al *3). Another CN 1 patient had a C+T substitution at position

99 1 (UGT 1 A l *5) of the coding region. This mutation resulted in the deletion of the

entire second exon. The rnRNAs of the UGTlA4, 1A6, and 1 A9 isofoms in both

patients also contained the respective mutations. Moreover, neither of these individuals

had the abiiity to glucuronidate phenol cornpounds (Bosma et al., 1992).

In a study of CN 1 children from various regions in Europe, 9 novel mutations

associated with Crigler-Najjar syndrome type 1 were discovered (Labrune et al., 1994).

Of the 9 new mutations discovered, 6 produced inactive proteins (UGT I A1 * 16, * 17, * 18,

*20, *22, and UGTlA1*23), 2 resulted in terminal codons (UGTI A1 * 19 and

UGT1A1*24), and one was a fiameshifi mutation that produced a truncated UGTl Al

protein (UGT1 Al *2 1).

A family study of one Japanese CN1 patient reported a novel mutation (Aono et

al., 1994). The patient was genotyped as being homozygous for a missense mutation at

position 840 of the coding region (UGTlA1*25). What was interesting about this case

was that both the parmts and a brother of this individual had normal phenotypes even

though they were heterozygotes for the mutant allele.

Recently, a novel molecular basis for the pathogenesis of CN1 was reported

(Gantla et al., 1998). Two separate mutations in the non-coding intronic sequences of the

UGTl Al gene were associated with CNI. One individual was hornozygous for a G+C

mutation at the exon lhntron junction. This mutation resulted in a cryptic splice site

which deleted 141 nucleotides in the mRNA of exon 1. The other patient was

heterozygous for a C+T mutation at the splice-donor site between exon 3 and exon 4.

This individual also possessed a non-sense mutation at position 145 of the coding region

on the other allele. Both of these mutations are thought to have contnbuted to the CNl

phenotype in this individual.

In contrast to CNl patients, CN2 patients have the ability to glucuronidate

bilinibin, albeit this ability is severely limited. In general, the mutations that are

associated with a CN2 phenotype reduce the activity of the UGTI Al enzyme. Whereas.

the mutations that are linked to the CNl phenotypes generally result in the complete

inactivation of the UGTl Al protein. Thus, CN2 patients can be homozygous for a

pmicular mutation and still exhibit some biiinibin glucuronidation. UGTIAI *6,

UGTI AI *7, and UGT1Alt8 are examples where the patients have a CN2 phenotype and

are homozygous for a particular mutation (Aono et al., 1993; Bosma et al., 1993).

However, CN2 phenotypes could also result from heterozygosity of a mutation

(UGTI Al * 12) that causes CNI (Seppen et al., 1994).

The UGT2 Family

The mammalian UGT2 family consists of 2 subfamilies, UGT2A and UGTZB.

The cDNAs of both rat and bovine UGT2A genes have been isolated, and were shown to

be olfactory-specific proteins that conjugate odorant molecules Gazard et al., 199 1). To

date, however, the isolation of a human UGT2A homologue has been unsuccessful.

UGT2B genes have been isolated in humans, rats, mice, and rabbits. In humans,

7 distinct UGTZB cDNA clones have been isolated thus fu. The substrate preferences for

UGT2B 10 and UGT2B 1 1 have yet to be daermined while UGT2B4,287,2B 1 5, and

UGT217 have been show to be specific for stemids and bile acids (Beaulieu et al., 1996;

Jackson et al., 1987; Ritter a ai.. 1990). However, like the members of the UGTl family,

these isoforms also have the ability to glucuronidate a broad range of substrates.

UGTZB Gene Structure

Sequence analysis of UGT2B transcnpts have show that among the UGT2B

subfamily members, sequence differences occur throughout the entire coding region, thus

indicating that the memben of the UGT2B sufamily are transcribed fkom independent

genes. Yeast artificial chromosome (YAC) technology as well as fluorescent in situ

hybridization (FISH) studies were used to localize UGT2B4, UGT2B 1 5, and UGTZB 17

genes to a "UGTZB gene cluster" on chromosome 4q13 (Beaulieu et al.. 1997; Monaghan

et al., 1997). Analysis of UGT2B4 and UGTlB 17 exodintron structures demonstrated

that the intron locations are conserved between the UGT2B isoforms (see Figure 1). This

conservation of the gene structure suggests that the UGT2B isoforms originated fiom a

cornmon ancestral gene. Furthemore, it is believed that the individual isozymes of the

UGT2B subfamiiy are derived fkom gene duplication events.

Genetic Poly morhisms in the UGT2B Famüy

In contrast to the UGTl family, knowledge about genetic polymorphism(s) in the

UGT2 family is limited. As yet. there have been no known genetic defect(s) in the UGT2

family that are linked to clinically important phenotypes.

Recently, Belanger's group at Laval University reported the characterizarion of

genetic polymorphisms in two UGT2B genes, UGT2B15 and UGT2B4 (Levesque et al.,

1998; Levesque et al., 1997). In their fint snidy, a novel UGTZB CDNA cione was

isolated âom human prostate and LNCaP ce11 cDNA libraries UGTZB 1 5(Y8'). There

was a single amino acid difference (aspartate to tyrosine at position 85) between

UGT~B 1 5(Ya5) and UGT~B 1 5(D8'), the previous published sequence ofUGT2B 15

(Green et al., 1994). Using PCR and direct sequencing techniques. 27 subjects were

genotyped for the mutation. Of the 27 individuals tested, 6 were homotygous for the

(Y8? allele, 5 were hornozygous for the (Dg') allele. while 16 subjects had both alleles.

Similar substrate specificities were obsewed for both alleles when they were expressed in

HK 293 cells. However, the Vmax values for UGTZB 15(y83 were 2 fold higher than

that for UGT2B 1 508').

In their other study, they reponed the isolation of a novel UGT2B4 cDNA clone,

UGTZB~(E"~) (Levesque et al., 1998). The difference between U G T ~ B ~ ( ~ ~ ~ ) and the

published sequence, U G T ~ B ~ @ ~ ' ~ ) , is a substitution of aspartic acid for glutamic acid at

position 458. Sequencing of genomic DNA from 26 Caucasian subjects demonstrated

that 8% of the population were hornozygous for the (E4j8) allele, 30% were homozygous

for the allele, while 62% had both alleies. When expressed in HK293 cells,

UGT~B~(E~. '~ ) was highly active towards hyodeoxychoiic acid (HDCA). In contrast,

UGTZB~@~*) did not glucuronidate HDCA The results suggest that this amino acid is

responsible for substrate specificity.

It has yet to be detemined whether or not the genetic polymorphisms seen in the

UGTZB4 gene as well as in that of UGTlB15 gene have any physiological importance.

UGT2B7

A UGTZB7 cDNA clone was fin isolated from a Xgtl 1 cDNA library by

hybridization to a mouse glucuronosyltransferase cDNA clone (Ritter et al., I W O ) . The

transcnpt of UGT2B7 encodes a 529 amino acid protein whose primary substrates are

3 +catechol estrogens and estriol. Using human liver Ncrosomes and di fferent

expression systems, UGT2B7 has been shown to be a very non-specific enzyme.

UGT2B7 is reported to be the major UGT isofonn that glucuronidates hyodeoxycholic

acid. oxazepam, NSAIDs, and hydroxylated derivatives of prototypical carcinogens such

as benzo[a]pyrene and 2-acetylaminofluorene as well as estrogen derivatives (Jin et al.,

1993a; Jin et ai., 1997; Jin et al., 1993b; Patel et al.. 199Sb; Ritter et al., 1990; Ritter et

al., 1992b). In contrast to earlier reports, recently, UGT2B7 has been shown to have the

ability to glucuronidate morphine, opioid agonists, antagonists, and partial agonists

(Cofhan et al., 1998; C o f i a n et al., 1997).

The fact that UGT2B7 is the major isoform that glucuronidates a diverse range of

clinically important compounds attests to the physioiogical imponance of this enzyme.

Therefore, any genetic variation(s) that alters the substrate specificity or changes the

activity of the UGTZB7 protein may result in clinically relevant alterations.

UGT~B~(H'U) venus UGTZB~(Y'U)

In 1993, Jin et al. isolated a novel UGT2B7 cDNA clone from a hgt 1 1 hurnan

liver cDNA library. This clone had a C+T substitution at position 802 of the coding

region. The base pair change resulted in an amino acid (histidine to tyrosine) change at

position 268. The UGT?B~(H'") was assigned as the wildtype allele since it was

discovered first, convenely, U G T ~ B ~ ( Y ~ ~ ' ) was assigneci as the variant form. In contrast

to the wildtype fonn, when the variant form was expressed in COS cells it had the ability

to glucuronidate menthol and androsterone (Jin et al., 1993a; Rina a al., 1990).

Therefore, by changing a tyrosine residue for a histidine residue at position 268, one

could alter the substrate specificity of UGT2B7.

In this laboratory, both U G T ~ B ~ ( H ~ ~ ' ) and UGT~B~(Y'~') were expreaed in

COS-1 cells (Patel 1998). Known substrates of UGT2B7 (oxazepam, ketoprofen, (S)-

naproxen, 2-OH-estriol, estriol, hyodeoxycholic acid) were then used to compare the

kinetic parameters of both the wildtype and variant forms. There were no differences in

the Km values of the various substrates tested. However, the wildtype form had

significantly higher Vmax values for oxazepam 2-OH-estriol, and estriol as compared to

the variant form. The wildtype form had a 2 fold higher efficiency for the glucuronidation

of both 2-OH-estriol, and estnol. More imponantly, however, was the fact that the

wildtype form was able to glucuronidate oxazepam 100 times more eficiently than the

variant form when expessed in COS-1 cells.

Recently, U G T ~ B ~ ( H ' ~ ~ ) and U G T ~ B ~ ( Y ' ~ ~ ) were stably expressed in HK 293

cells (Cofhan et al., 1998). The findings obtained by Coffman et al. (1998) have

contradiaed the findings of both Jin et al. (1993) and Patel(1998). The authors reported

that both U G T ~ B ~ ( H ' ~ ~ ) and UGT~B~(Y'") efficiently glucuronidated menthol and

androsterone. Furthemore, they were unable to fuid any significant differences in the

glucuronidation of oxazepam between the stably expressed and H ~ ~ ~ . They also

reported that both UGT2B7 alleles had the ability to glucuronidate either isomer (R or S)

of oxazepam. Moreover, they suggested that UGTZB7 might not be the major isozyme

responsible for the glucuronidation of oxrwpam. since oxazeparn was found to be a very

poor subarate for the stably expressed UGTZB7 enzymes. Differences in enzyme

concentration, substrate concentration, incubation conditions, as wcll as the use of

different expression systems could possibly explain the above discrepancies.

The authors however did report that the variant fonn had approximately 100-fold

higher activity towards nomorphine and naltriben as compared to the wildtype form of

UGT2B7. In addition, the variant also possessed a 10-fold higher efficiency towards the

glucuronidation of buprenorphine.

Glucuronidation of Drugs

Glucuronidation is a major rnetabolic pathway for the elimination of many drugs

in humans (Burchell and Coughtne, 1989; Miners and Mackenzie, 1991). Many drugs

are excreted in urine and bile as glucuronide conjugates. Ouazepam (Alvan et al., 1977),

morphine (Osborne et al.. 1990). chloramphenicol (Arnbrose, l984), and zomepirac

(OWeill et al., 1982) are examples in which glucuronidation is the predominate means by

which the compound is excreted from the body.

In the past, research in the metabolism of drugs and xenobiotics has been

primarily focused on the oxidative reactions catalyzed by the cytochromes P450.

Conversely, glucuronidation has received considerably l e s attention because the

metabolites of glucuronidation are generally considered to be pharmacologically inactive

(Mulder, 1992). Nevertheless, the phannacological significance of glucuronidation

should not be overlooked since glucuronidation has major effects on the disposition,

metabolism and excretion of many therapeutic agents.

Variability in Glucuroaidation

Large interindividual variations in glucuronidation have been observed in vivo

(Miners and Mackenzie. 199 1) and in vitro using hepatic microsornes (Burchell et al.

1989). Substantial variations in the pharmacoicinetics of a drug may suggest genetic

variations in dnig metabolizing enzyme(s) (Kalow, 1989). However, the variations seen

in glucuronidation may also be due to factors such as age. sex, diet, disease state, and

exposure to xenobiotics as wel! as genetic factors.

Due to the wide overlapping substrate specificity of UGTs, the invoivement of

other metaboiic pathways, and confounding pathophysiological and environmentai

factors, finding an adequate in vivo probe to snidy polymorphic variations in a pmicular

UGT isoform may seem to be a daunting task.

The candidate in vivo probe drug should be a safe therapeutic agent with minimal

side effects. Gtucuronidation should be its predominate means of elimination. The

particular isozyme(s) responsible for its metaboiism should be elucidated. Furthemore,

the population study itself should be large enou& as to account for any non-genetic

factors that may be influencing glucuronidation activity.

Ouzepam

Oxazepam is a 3-hydroxy- 1,4-benrodiazepine derivative. Oxazeparn is one of the

moa widely used dmgs in the world (Marks, 1980). It is mainly prescribed for its

anxiolytic properties, however it aiso possesses sedative, anticonvulsant, and muscle

relaxant effects. Oxazepam has a wide margin of d e t y ; the side effects associated with

its use results from a direct extension of its therapeutic property.

Oxazepam is the active metabolite of several 1.4-benzodiazepines including

diazepam, temazepam, chiorazepate. chlordiazepoxide, and medazeparn (Sisenwine et al.,

1982). These benzodiazepines undergo N-deaikylation and C3-hydroxylation via

microsomal cytochrome P450s to form oxazepam.

Oxazepam is completely absorbed fiom the G.I. tract after an oral dose (Alvan

and Odar-Cederlof, 1 978; Sonne et al., 1 988). Glucuronidation is the major metabolic

pathway for the elimination of oxazepam: greater than 85% of oxazeparn is excreted in

urine as a glucuronide conjugate (Alvan and Odar-Cederlof, 1978). Oxidative

metabolites of oxazepam have also been reponed (Grifin et al., 1995). The major

oxidative metabolite is 6-chloro4phenyl-2(l H)-quinazoline carboxylic acid (CPQ-

carboxylic acid). Only trace amounts of the original compound are excreted in urine.

Oxazepam is characterized as a low clearance dm& clearance values range from 0.42

ml/min/kg to 2.38 ml/min/kg (Alvan and Odar-Cederlof, 1978; Greenblatt and Shader,

1980). The elimination half-life of oxazepam ranges fiom 5 to 12 hours; this is relatively

short compared to the other benzodiazepines. Oxazepam is extensively bound to plasma

proteins. with greater than 90 % of it being bound to the protein.

Many pathophysiological and environmental factors are known to influence the

metabolism of oxazepam ( S o ~ e , 1993). The following is a review of some of these

factors (Table 2).

Table 2. The effect of pathophysiological and environmental factors on the glucuronidation of Oxazepam.

Factor

Liver Acute viral hcpatitis Compensateci alcoholic iivtr cirhosis Cornpexmed aicoholic liver cirrhosis Severe alcoholic iiver cirrhosis

CL uncbanged CL unchanged Eliminauon half-life unchangecl T O ~ a reduccd by 52% Unbound CL teducal by 84%

Shull et al. 1976 Shull et al. 1976 Seilers et al. 1979 SOM^ et al. 1990

7ïtyroid Hyperthyroidism Hypothyroidism Severe hypothyroidism

Incrcase in apparent oral CL CL unchangai CL n d u d

Scott et al. 1984 Scott et al. 1984 Sonne et al 1990b

CL unchanged Scott et al 1988

Abernethy et ai. 1986

CL unchangai CL negative trend Total CL uncbangtd unbound CL rcduccd by 55%

Greenblatt et al. 1980 Drerevfuss et al. 1986 Sonne et al. 199 1

Sex Greenblatt et al. 1980 Total & unbound CL > in men

Smoking Greenblatt et al. 1980 Ochs et al. 198 1

Very low in calories/Suaicient in protein Energy deficient Protein dcficient

Sonne et al. 1989 Hamôerg et al. 1990 Hamberg et al. 1990

Concomitant drug administration

Cimetidine Propranolol Labetalol Phenobaritailphcnytoin Oral contraceptive stcmids

Patwardhan et al. 1980 Sonne et al 1990C Sonne et al 1990c Scott et al. 1983 Patwardhan et al. 1983 Abernethy et al. 1983 Sellers et al. 1980 Sellers et al. 19ûû

CL unchangcd CL uncbanged CL inrreased CL inCrtascd CL uncbangcd CL unchangcd No dispositional changes

CL incmased SR ratio &mased dt(e to increase in R-giucuwnide

Seidenan et al. 198 1

Livtr Diseme

While oxidative functions are severely harnpered in liver disease, glucuronidation

processes seem to be preserved. The eiimination of oxazeparn is not significantly

different between patients with liver cirrhosis as compared to controls (Sellers et al.,

1979; Shull et al., 1976). Significant reductions in the glucuronidation of oxazepam have

been reported in patients with sevcre hepatic dysfunction (Sonne et al., 1990a). The

mechanism(s) of this apparent sparing of the glucuronidation of oxazepam is unknown.

One theory to explain this curious finding emphasizes the importance of extrahepatic

glucuronidation. In dogs, it has been observed that as hepatic functions decrease,

extrahepatic glucuronidation becomes more appreciable (Gerkens et al., 198 1; Jaqz et al.,

1986) or in fact increases parallel to the decreases in liver function (Patwardhan et al.,

198 1). Another theory suggeas that the deeper localization of UGTs within microsornes

may be a proteaive mechanisni against liver injuries (Gregus et al., 1982).

EIypothyroidismAyperthy roidism

The pharmacokinetic properties of oxazepam in patients with thyroid disease were

detedned (Scott a al., 1984). Patients with hypothyroidism exhibited normal

pharmacokinetics for the metabolism of oxazepam. Whereas, there was an increase in

the clearance and a decrease in the half-life of oxazepam in patients with hyperthyroidism

as compared to control subjects. Patients with severe hypothyroidism were reported to

have diminished oxazepam clearance (Sonne et al., 1990b). The above findings suggest

that the thyroid hormone may influence the regulation of the UGT(s) that metabolize

oxazepam.

Diabetes

When the elimination of oxazepam was compared in 6 patients with uncontrolled

diabetes with the values obtained two months later in these same individuals when the

disease was controlled, no signifiant differences were obsennd (Scott et al., 1988).

Obesity

Obese individuals were reported to have enhanced glucuronidation capacities

(Abemethy and Greenblatt, 1986). The total metabolic clearance of lorazepam.

oxazepam, and paracetamol were reported to be increased in individuals who were

considered to be obese (179% ideal body weight).

Age

Studies involving benzodiapines that undergo biotransforrnation via oxidation

have shown age-related declines in clearance (Allen et al., 1980; Greenblatt and Shader,

1980; Kloa et al., 1975). The effects o f aging on oxazepam pharmacokinetics on the

other hand are less defined. While some have reported that the biotransformation of

oxazepam were unaffected by age (Greenblatt a al., 1980; Ochs et ai., 198 l), a trend

towards reduced clearance was detected among five elderly patients (Dreyfuss et al.,

1986). More recently, it was observed that among the very elderly (mean age 88 years)

the unbound clearance of oxazepam was reduced by 55% (Sonne et al., 199 1). The

researchers demonsuated that the reduction in the unbound clearance of oxazepam was

attributed to low concentrations of plasma albumin. Since oxazepam is a highly bound

dm& it is believed that the significant changes in unbound drug that is observed in the

elderly, combined with a decrease in oxidative metabolism may explain the obsewation

that geriatric patients have increased sensitivity towards benzodiapines.

Scx

The metabolism of oxazepam was reponed to be different between males and

females (Greenblatt et al., 1980). The elimination half-life was longer in females (9.7

hours) than males (7.8 hours). Total clearance as well as unbound clearance was

significantly greater in males than in females.

Ditt

The effects of dietary energy, protein deficiency, nutritional ingredients and

malnutntional States may influence hepatic drus metabolism (Vesell, 1984). A change in

diet fiom a high protein-low carbohydrate to a low protein-high carbohydrate resulted in

an increase in the urinary recovery for oxazepam giucuronides. The effects of energy and

protein diets on the metabolism of oxazepam antipyrine and metronidazole were

investigated (Hamberg et al., 1990). Both the energy and protein deficient diets produced

a decline in the clearance rate and prolonged the half-life of oxazepam. The diets had no

appreciable effens on the oxidative pathways of diug metabolism as measured by

antipyrine and rnetronidazole. A diet low in calories and carbohydrates but suficient in

protein has been reported to produce a decrease in the clearance of oxazepam (Sonne et

al., 1989).

Dmgs

In clinical settings, benzodiazepines are oftcn prescribed with other medications.

As such, the possibility of dnig-dmg interactions exists. Concurrent administration of

dmgs may exert diserential effects on oxidative and conjugative drug metabolism.

Cimetidine, an anti peptic ulcer dmg has been shown ta be a strong inhibitor of p hase 1

drug metabolism (Desmond et al., 1980; Serlin et al., 1979). However, cimetidine has no

effect on the glucuronidation of oxazepam and lorazepam (Pawdhan et al., 1980). The

disposition and elimination of oxazepam and lorazepam did not differ in 4 subjects before

and after the treatment with cimetidine.

The effect of the P-adrenoceptor antagonists propranolol and labetalol on the

metabolism of oxazepam was investigated ( S o ~ e et al., 1990~). Both propranolol and

labetalol were reported not to influence the pharmacokinetics of oxazeparn. Interestingly

however, there was a pharrnacodynamic interaction between oxazepam and propranolol.

The glucuronidation of oxazepam in nine epiieptic patients who were being

treated with phenytoin alone or in combination with phenobarbitone was significantly

different as compared to nine healthy volunteers (Scott et al., 1983). The patients

exhibited an increase in the apparent oral clearance and a shoner half-life for the

elimination of oxazepam.

The studies regarding the influence of oral contraceptives on the metabolism of

oxazepam are confliaing. Women who were taking low-dose estrogen oral

contraceptives (50 pg or less ethinyl estradiol) for at least 3 months did not have

signi f icantl y di fferent total oxazepam clearances from dmg-free control w omen

(Abemethy et al.. 1983). On the other hand. women who had been taking oral

contraceptives (norethindrone acetate, h g ; ethinyl estradiol, 50 pg) for as Ieast 6 months

exhibited an increase in the plasma clearance of oxazepam as compared to m r o l s

(Patwardhan et al., 1983).

The effea of acute ethanol doses on the disposition of drugs in healthy subjects

was investigated (Sellers et al., 1980). The researchers reponed that ethanol inhibited the

N-desmethylation of diazepam but spared the glucuronidation of oxazepam. In the same

shidy, disulfiram, a drug used in the treatment of some forms of alcoholism was

administered to aicoholics and control subjects. Disulfiram was able to decrease the

plasma clearance of chlorazepoxide, a drus that is mainly eliminated by oxidation

reactions. Disulfram however had minimal effects on the elimination of oxazepam and

lorazepam, dnigs that mainly undergo glucuronidation.

Ethnicity

There are many examples of interethnic differences in drug metabolism (Kalow,

199 1). Aldehyde dehydrogenase, alcohol dehydrogenase, debrisoquine hydroxylase, and

N-acetyltransferase are some of the classical examples of interethnic differences in drug

metabolism. Interethnic differences in glucuronidation have been suggested but it has

not been conclusively proven.

The glucuronidation of paracetamol was reponed to be difierent benveen

Caucasians and Afncans (Critchley et al., 1986). The mean fractional recovery of the

glucuronides of paracetamol and its metabolites over a 24 hour penod was statistically

higher in Aûicans (58%) than in Caucasians (54%). Whether or not this represents a mie

ethnic difference in the glucuronidation of paracetamol has yet to be confïrmed.

The glucuronidation of codeine phosphate was investigated in t 49 Swedish

Caucasians and 133 Chinese (Yue et al., 1989). A greater proportion of codeine-6-

glucuronide was excreted in Caucasians (62%) than in Chinese subjects (44%) in an 8

hour period. The interpretation of interethnic differences in the glucuronidation of

codeine is difficult since codeine has many metabolites and these metabolites are from

multiple metabolic pathways.

The phannacokinetic and pharmacodynamic propenies of morphine were

compared between 8 Chinese and 8 Caucasians (Zhou et al., 1993). While the

metabolism of nomorphine was not significantly different between Caucasians and

Chinese subjects, the clearance of morphine was higher in Chinese individuals than in

Caucasians. The increase in the clearance of morphine was attributed to an increase in

glucuronidation activity. Pharmacodynamically, Caucasians displayed a greater

morphine-induced reduction in blood pressure as compared to Chinese subjects.

There have been no studies that investigated the interethnic differences in the

glucuronidation of oxazepam.

Enantioselective Glucuronidation

Many drugs are prescribed in racemic formulations. It is known that

stereochemical factors have important influences on both the disposition and therapeutic

effectiveness of a dmg (Caldwell et al., 1988; Drayer, 1988; Eichelbaum, 1988).

Oxazepam is clinically prescribed as a racemic mixture. The two enantiomers of

oxazeparn have been shown to be pharmacodynamically distinct molecules. The 3(S)

enantiomer is considered to be the pharmacologically active isomer because it has a

greater than 200-fold ability to displace the specific binding of '~-diaze~am as compared

to the 3(R) enantiomer (Corbella et al., 1973; Mohier et al., 1977). Conjugation with D-

glucuronic acid produces two diastereomeric conjugates which are both

pharrnacologically inactive (Greenblatt et al., 1983; Mascher et al., 1984; Ruelius et ai.,

1979).

In vivo and in vitro studies have demonstrated that enantioselective

glucuronidation occurs in humans. Benoxaprofen, ibuprofen, naproxen (El Mouelhi et

al., l987), E- 1 O-hydroxynortriptyline (Dahl-Puustinen et al., 1989a), mexiletine (Grech-

Belanger et al., 1986), and oxazepam (Patei et al.. 1995a; Seideman et al., 1981; Vree et

al., 1991) have al1 shown varying degrees of stereoselectivity. There seems to be no

preferential enantiomer configuration (R or S) in regards to the stereoselective nature of

glucuronidation. The degree of stereoselectivity ranges fiom 9.65 for mexiletine (Grech-

Belanger et al., 1986) to 1.14 for naproxen (El Mouelhi et al., 1987). There are species

differences in the stereoselective glucuronidation of oxazepam. In vivo, rhesus monkeys

had the lowest S R oxazepam glucuronide ratio (approximately 0.6) and man had the

highest ratio (approximately 3.5) (Sisenwine et al.. 1982).

Organ stereospecifictiy have also been observed in humans. Using microsornes

fiom the liver, only the (S) enantiomer of E-10-hydroxy nortryptiline was glucuronidated.

While, microsornai preparations fiom the duodenum only glucuronidated the (R)

enantiomer (Dahi-Puustinen et al., 1989b).

Rationait

A preliminary population study perfonned on 40 healthy volunteers demonstrated

that the S/R oxazepam glucuronide ratio (SR ratio) was bimodally distributed, with 10%

of the subjects possessing abnomialiy low S R ratios (Patel et ai., 1995a). Another study

involving 94 subjects confinned the bimodal distribution of the S/R ratio (Appanna,

1995). However, Appanna observed that 20% of the subjects had SR ratios below the

antirnode. One individual was discovered to have an S/R ratio below 1. It was believed

that this individual had an enhanced ability to glucuronidate the R- isomer of oxazepam.

Unfortunately, the urine volumes were not noted for any of the subjects. Thus, a

cornparison between the total amounts of R- and S- oxazeparn glucuronide excreted could

not be made.

A family study demonstrated that the SIR ratio was hentable (Appanna, 1995).

Furthemore, a cornpanson between the inter- and intra-individual variabiiity of the S/R

ratio resulted in an extremely high (rcc = 0.98) senetic component value (Kalow et al.,

1998). This high genetic component value alon3 with the fact that the ratio is heritable

suggests that the S/R ratio is under genetic control. The bimodal distribution of the S/R

ratio in the population in tum, is therefore indicative of a genetic variability in the

isozyme(s) that are responsible for the giucuronidation of the R- and S- enantiorners of

oxazepam.

In vitro studies conducted in this laboratory using human liver microsornes have

suggested that the glucuronidation of the S- and R- enantiomers are catalyzed by different

UGT isozymes (Patel et al., 1995b). Furthemore, an inhibition profile of S- oxazepam

glucuronidation implicated UGT2B7 as the isozyme responsible for the conjugation of

the S enantiomer.

A study of 37 human liver microsornes demonstrated that approximately 10% of

the livers displayed abnormally high Km values for the fonnation of (S) glucuronide

(Patel et al., 1995a). In contrast, the formation of (R) oxazepam glucuronide in the 37

livers tested was normally distributed. From the in vitro data, it was suggeaed that the

phenotypic variations seen in vivo is a reflection of a genetic defect of the isozyme

catalyzing S- oxazepam glucuronidation namely UGT2B7.

In 1993, Jin et al. isolated a novel UGT2B7 cDNA clone from a hgt 1 1 human

liver cDNA library. There was an amino acid difference between this clone and the

wildtype form of UGTZB7. When this variant fom of UGT2B7 was expressed in COS- 1

cells, it did not have the ability to glucuronidate oxazepam (Patel, 1998).

H ypo thesis

The observed phenotypic variations in SIR oxazepam glucuronide ratios are due

to a specific UGT2B7 gene alteration.

Objectives

Most of the studies to date have focused on the glucuronidation of oxazepam as a

whoie compound or as the S R ratio. Therefore, very little is known about the factor(s)

controlling the glucuronidation of the individual enantiomers of oxazepam. It has been

demonstrated that enzyme induction by pentobarbital may alter the stereoselectivity of

oxazepam glucuronidation (Seideman et ai., 198 1). Six healthy volunteers were given a

racemic dose of oxazepam prior and pon ten &y treatment with pentobarbital.

Following the treatment, oxazepam plasma clearance was increased by approximately

50% as compared to the clearance pnor to the pentobarbitol treatment. In addition, the

S/R ratio of oxazepam glucuronides was decreased. The decrease in the SIR ratio was

attributed to an increase in the glucuronidation of the R- enantiomer.

One of the objectives of this midy is to therefore determine if any environmental

andor pathophysiologicai factors such as age, sex, ethnicity, smoking, alcohol and oral

contraceptive use influences the glucuronidation of the individuai isomers of oxazepam,

and thereby affecting the SIR ratio.

The second objective of this midy is to develop a genomic genotyping assay that

has the ability to distinguish between the UGTZB7 wildtype and variant alleles. The

assay will then be used to determine the allelic fiequencies of the wildtype and variant

alleles within the population.

The third and last objective of this study is to detemine if there are any

associations between the SIR ratio and the particular genotypes ofUGTZB7.

METHODS AND MATERIALS

In Vivo Glucuronidation in Human Subiect~

Racemic oxazepam in an oral preparation (Sem@) was supplied by Wyeth

Phannaceuticals. Al1 other ingredients were of HPLC grade obtained fiom Caledon

Laboratories.

Subjects

Two hundred and three healthy volunteers between 15-69 years of age

participated in this study. Before participating in the study, each subject was required to

fil1 out a questionnaire as well as sign a consent fonn. Age, height, weight, race, sex,

alcohol, smoking, and drug taking histories were ascenained prior to the study (Table 3).

The subjects were asked to take 15 mg (R, S) oxazepam p.o. with a glass of water

pnor to sleeping. Ovemight unne (8 hours) sarnples were collected, and the total volume

of urine was noted. A 10 ml sample was stored for analysis at -20°C.

The urine sample was diluted (50 pl of urine to 1950 pl of diailled water). The

diluted sample was then injected (30 pl) using a WISP automated programmable injector

(Waters), the mobile phase was delivered via a Waters 650 Solvent Delivery System at

1 .O rnlhin, ont0 a 25 cm Cl 8 reverse-phase ODS column. The mobile phase consisted

of 19% acetonitnle, and 7.5% isopropyl aicohol in 0.3% phosphoric acid. Glucuronides

of 3(R)-and 3(S) oxazepam were detected using a Waters Programmable Multi-

wavelength Detector with the detection wavelength set at 230 m, and AUFS set at 0.01.

The extinction coefficient of oxazepam (in methanol) is 34.2 cm1-mM'- at 230 nm (Yang

et al. 1990). The detector was attached to a Shirnadzu C4 Chromatopac analyzer and the

recorder set ai an attenuation of 2 and a chart speed of 5 .O mm/min.

Table 3.

Characteristics of Subjects Mean

Total Subjects 203 Males 118 Fernales 85 Caucasians 133 Orientais 58 Birth Conrol Pill Users 24 Age (~eam) 15169 28.9 Alcohol (d rinkdweek) 0-25 3.28 Smoking (ciga rettesheek) 0-400 9.46 Coffeefïea (cupdday) 0-11 1.64 WeightRfeight (lbslich) 1.46-3.78 2.18

Data Analvsig

Statistical analyses were paformed witb the Statistical Package for Social

Sciences (SPSS), release 8.0. The dependent variables were S-oxazepamlR-oxazeparn

ratio, amount of S- or R-oxazeparn glucuronide in eight-hour urine. The staîistical

significance of potential CO-variates (age, alcohol and caffeine consurnption, body size,

ethnicity, gender, oral contraceptive use and smoking habits) was tested with use of non-

parametric tests including the Mann-Whitney Lr test, Kolmogorov and Smirnov test,

Wilcoxon rank sum test, Chi-square test, and Spearman tank order correlations. The

subjects with Chinese, Japanese and Korean erhnic background were grouped together

and entered as a single factor (CO-variate) in the analyses. The statistical significance

level accepted for al1 statistical analyses was a = 0.05. Al1 data were presented as mean k

SD, unless otherwise stated.

DNA Extraction fiom Tissue

Genomic DN A fkom human post-mofiern liver tissues was isolated according to

the Stratagene DNA Extraaion Kit.

A small portion of liver tissue samples fiom the -70°C fkeezer was cut out and

weighed. The samples were then homogenized in a solution containing 0.32 M sucrose,

10 rnM Tris-HC1 (pH 7.5). 5 m M MgCl?, 1% Triton X-100,0.02% sodium azide (1 5 ml

of the solution to 250 mg of tissue). The sarnples were homogenized using a Brinkman

Polytron homogenizer (setting 5) for 30 seconds. Pronase (1 mg/ml) was added to the

homogenate, and the solution was then incubated for 3 houn in a shaking water bath at

5S°C, then chilled on ice for 10 minutes. 6 M sanirated NaCl solution (5 ml) was added,

and the solution was mixed by inverting the tube several times. The sample was

incubated on ice for 5 minutes. Following a centrifugation at 12,000 x g in a Sorvall

RC2-B centrifuge for 15 minutes at 4"C, a protein pellet could be visualized. The

supernatant was transferred with a sterile large bore pipette to a sterile 50 ml conical tube

(Falcon). RNAase (GibcoIBRL) was added to the supematant to yield a final

concentration of 20 &ml. The solution was then incubated at 37°C for 15 minutes. 10

ml of saturated phenol (Sigma) was added, the sample was centnfùged at 12,000 x g for 5

minutes at 4OC. The upper aqueous layer was recovered. The DNA was precipitated

with the addition of 2 volumes of 100% ethanol to the supernatant. The sample was

cmtrifbged at 12,000 x g for 10 minutes at 4OC. ï h e supematant was decanted off, and

the DNA pellet was washed with 1 ml of 70% ice-cold ethanol. The soiution was spun at

12,000 x g for 5 minutes at 4OC. The ethanol was decanted off, and the pellet was air-

dried for 10 minutes. The DNA was resuspended in 500 pi of Tns-EDTA buffer (10 mM

Tris, 0.1 rnM EDTA) and stored at 4'C until needed.

PCR h~iif icat ion of UGT2B7 fiom Genomic DNA

Two oligonucleotide primers, Pr (5'-TGACATGAAGAAGTGGGATC-3') and P6

(5'-TCAACATTTGGTAAGAGTGG-3'1, which were complementary to bases -68 1 to

700, and 824 to 805 of the UGT2B7 coding region, nspectively were used to perfonn

PCR reactions on genornic DNA extracted from liver tissue samples.

The PCR reactions contained: 0.5 pM of P? and Ps primers, -1 pg of genomic

DNA 100 @î of each dNTPs, 1.5 rnM MgC12, 2.5 units of Platinum Taq DNA

polymerase (Gibco/BRL) in 1 X reaction buffer (20 mM Tns-HCI (pH 8.4), 50 rnM KCI).

The PCR conditions were: an initial denaturation of 94OC for 3 minutes, 25 cycles

of 1 minute denaturation at 94°C. 1 minute and 30 seconds annealing at 57OC, 1 minute

and 30 seconds extension at 72OC, and a fina1 extension of IO minutes at 72°C. The PCR

was perfonned on a Gene Amp PCR System 2400 Thermal Cycler (Perkin-Elmer). 10 pl

of the amplification product was loaded in a 1% standard agarose gel (GibcofBRL)

containing 0.0 1% ethydium bromide and electrophoresed for l hour at 90 volts. The PCR

fiagrnent was visualized using a LiV transillulimator.

RNA Extraction

Human liver total RNA was isolated âom post-mortem samples. The liver tissue

samples were obtained fiom renal transplant donors with the consent of the next-of-kin,

and stored at -70°C. RNA was isolated according to the TRhlB Reagent (GibcoIBRL)

protocol.

Liver samples were taken from the -70°C freezer, and a small portion was cut out

and weighed. The sample was then homogmized in l'Rh01 (100 mg of liver tissue per 1

ml of TRkol) using a Brinkman polytton homogenizer (setting 5) for 30 seconds. A 5

minute incubation at room temperature (15-30°C) following the homogenization

permitted the complete dissociation of the nucleoprotein complexes. Chlorofonn was

then added (0.2 ml of chloroform per 1 ml of m o l ) and the samples were shaken

vigorously for 15 seconds by hand. After incubating the samples at room temperature for

3 minutes, the samples were then centrifuged at 12,000 x g in a Sorvall RC2-B centrifuge

for 15 minutes at 4OC. Following centrifugation the mixture separated into a lower red,

phenol-chloroform phase, an interphase. and a colorless upper aqueous phase. The upper

aqueous layer, which contained the RNA was carefilly removed using a I ml eppendorf

pipettor, and transferred to a fresh tube.

The RNA was then precipitated with isopropyl alcohol (0.5 ml of isopropyl

alcohol per 1 ml of TIUzol Reagent). The samples were then incubated at room

temperature for 10 minutes and centrifuged at 12.000 x g for 10 minutes at 4OC. An

RNA gel-like pellet at the bottom of the tube was visualized after the centrifugation

process. The supernatant was carefully decanted off. and the RNA pellet was washed

with ice-cold 75% ethanol in DEPC-treated water (1 ml of 75% ethanol per t ml of

-01 reagent). The samples were then vonexed for 10 seconds using a Fisher Vortex

Genie 2 and subsequently centrifuged at 7,500 x 8 for 5 minutes at 4OC. The supematam

was then decanted off, and the RNA pellet was air-dried for 10 minutes. The pellet was

redissolved in DEPC-treated H20, and the optical density was measured at 260 and 280

nm on a Beckman Du@-7 Spectrophtometer to determine the extraction efficiency and

the total RNA concentration.

Gel electrophoresis was perfonned on 1% agarose gel with 1-2 pg of total RNA

to check integrity of the RNA through the assessrnent of the 18s and 28s ribosomal RNA

bands. The individual RNA samples were then aored at -70°C until needed.

First-Strand Svnthesis of cDN A

Fust-strand cDNA was synthesized from human liver total RNA using reverse-

transcriptase M-MuLV (Boehringer-Mannheim). In a PCR tube (Perkin-Elmer), total

RNA (1-2 pg) was diluted ia DEPC-treated RNase-fiee HtO to a final volume of 8 pl, and

incubated at 6S°C for 10 minutes followed by a 5 minute incubation at 4OC. 32 ~1 of a

"master-mix" was then added to the PCR tube. The final reverse-transcriptase mixture

contained the following components: 1-2 pg of RNA, 1 m M of each dNTP, 20 units

RNase inhibitor, 140 pmol pN6 (randorn hexamer) or 200 pmol Oligo-dT, and 20 units of

M-MuLV reverse-transcriptase in 1X RT buffer (50 rnM Tris-HC1 (pH 8.3), 50 rnM KCI,

4 mM MgC12, 10 pM DTT). The mixture was incubated at room temperature for 10

minutes, and then at 3 7 T for Lhour. Samples were then stored at -70°C.

PCR Am~l i f i~a t i~n of Actin cDNA

The RNA from post-mortem tissue is ofien highly degraded, and rnay not yield

fust-strand cDNA of sufficient quality for PCR. Amplification of a 300 bp segment o f

Actin, a protein with ubiquitous expression, was used to assess the success of fist-strand

synthesis described above.

The 100 @ PCR teaction mixiure contained the foilowing: 10 pi of the reverse-

transcriptase reaction, 1.0 pM each of the forward and backward actin-specific

oligonucleotide primers, 1.0 m M Mgch. 2.5 units of Taq DNA polymerase (GibcolBRL)

in 1 X reaction buffer (20 rnM Tris-HCl (pH 8.4), 50 m M KCl). The PCR conditions

were: an initial denaturation of 94°C for 3 minutes, 30 cycles of 45 seconds denaturation

at 94°C. 30 seconds annealing at 53OC. 1 minute extension at 72OC, and a final extension

of 10 minutes at 72OC. The PCR was pdonned on a Gene Amp PCR System 2400

Thermal Cycler (Perkin-Elmer). 10 pl of the amplification produa was loaded in a 1%

standard agarose gel (Gibco/BRL) containing 0.0 1% ethydium bromide and

electrophoresed for 1 hour at 90 volts. The PCR âagment was visualized using a W

transillulimator.

PCR am~lification of UGT2B7 cDNA

Due to the degradation of the RNA, amplification of the fill-length coding region

of UGT2B7 was unsuccessful. Therefore, 2 sets of primers which produced PCR

fragments overlapping by 144 bp were used to ampli@ the entire coding region (see

Figure 2.). The first fiagment was amplified using the fonvard primer Pa (5'-

TGCATTGCACCAGGATGTC-3') and the backward primer P h (5'-

TCAACATTTGGTAAGAGTGG'), which were complementary to bases -14 to 5, and

824 to 805 of the UGT2B7 coding region. respdvely. The second fiagment was

am pli fied using the foward primer Ps (5'-TGAC ATGAAGAAGTGGGATC-3') and the

backward primer Pq (5'-AACTGAAGTAGTCTCACC-3'), which were complementary to

bases 681 to 700, and 1642 to 1625, respectively. The overlapping fiagment was also

amplified using the forward P, and backward Ps pnmers. The primers were designed to

minimize cross-hybridization with the cDNA of homologous UGT isozymes.

Each PCR reaction was 100 pl and contained 10 @ of the reversetranscriptase

reaction, 1 .O pM each of the fonvard and backard UGT2B7-specific oligonucleotide

primers, 1 .O rnM MgCI1 2.5 units of Taq DNA polymerase (Gibco/BRL) in 1X reaction

buffer (20 rnM Tris-HCI (pH 8.4), 50 mM K I ) . This mixture was preheated at 94°C for

3 minutes, followed by 30 cycles of 45 seconds denaturation at 94"C, 30 seconds

anneahg at 53OC, 1 minute extension at 72OC. and a final extension of 10 minutes at

72OC. A 10 pl aliquot of each amplification was loaded onto a 1 .û% agarose gel

containing 0.01% ethydium bromide. The sizes of the fragments were then determined

by using either a 100 bp marker andor a 1 Kb marker (MBI Fermentas) as the standard

markers.

Figure 2. Schcmatic of RNA isolation, first-sûand sycthcsis. and subscqucnt PCR amplincation of UGT2B7 cDNA

RNA Isolation

5 ' * poly A tail UGT2B7 mRNA

7 9 - OR

Random Hexamer

I Reverse Transcription

cDNA of UGT2B7 -

PCR amplincation with UGT2B7-specific priniers

Gel Extraction of PCR Products

The QIAquick Gel Extraction Kit Protocol (QIAGEN) is designed to extract and

purifi DNA from agarose gels. 50 NI of the PCR product was loaded ont0 a 1% agarose

gel containing 0.01% ethydiurn bromide and electrophoresed for 2 hours at 60 Volts. The

DNA fragment was excised from the agarose gel with a clean, sharp scalpel. The gel

slice was placed in a 1.5 ml microfuge tube and weighed. Buffer QX1 was added (3

volumes of Buffer QX1 to 1 volume of gel). The sample was incubated at 50°C for 10

minutes. 1 gel volume of isopropyl alcohol was added to the sarnple, and the solution

was vortexed. A QIAquick spin column was placed in a provided 2 ml collection tube.

To bind the DNA to the column, the sample was applied to the QIAquick column,

and centrifuged at 10,000 x g for 1 minute. The flow-through was discarded. and 0.5 ml

of Buffer QX1 was added to the column and centrifuged at 10,000 x g for 1 minute. The

sample was washed with the addition of 0.75 ml of Buffer PE to the QIAquick column.

The column was centrifuged at 10.000 x p for lminute. The flow-through was discarded

and the column was centrifuged for an additional minute at 10,000 x g. The QIAquick

column was placed into a clean 1.5-ml microfuge tube.

The DNA was eluted by the addition of 50 pl of 10 rnM Tris-HCI (pH 8.5), and

centrifugation at 10,000 x g for 1 minute. The DNA sample was stored at -20°C until

needed.

Subclonin~ and Transformation of Gel Extraaed PCR Produas

The gel extracted PCR products were insened into the plasmid vector pCR02.1-

TOPO (Invitrogen). Taq DNA polymerase has a nontemplate-dependent terminal

transferase activity which adds a single deoxyaâenosine (A) to the 3' ends of the PCR

products. The linearized plamid vector pCR02.1 -TOPO has single, overhanging 3'

deoxythymidine (T) residues (Figure 3). The overhangs allow the PCR insen to be

ligated by topoisornerase to the linearized veaor.

Subcloning and transformation was perforrned according to the T O P O - C ~ O ~ ~ ~ ~ ~ ~

protocol (Invitrogen). In a 1.5-ml microfuge tube, 2 @ of the gel extracted PCR produa

was added to 2 @ of sterile water and 1 of pCRB2.1-TOPO vector. The solution was

gently mixed and then incubated at room temperature (-2S°C) for 5 minutes. The

mixture was briefly centrifùged and placed on ice.

A vial of One s hotTM cornpetent ceils (TOPO 10 strain of E. coli) was thawed on

ice. 2 pl of 0.5 M P-mercaptoethanol was added to the via1 of competent ceils and mixed

by gently stimng with the pipette tip. 2pl of the cloning reaction was added to the vial of

One shotm cells and mixed gently. The solution was incubated on ice for 30 minutes.

The cells were then heat shocked for 30 seconds at 42OC. The via1 was imrnediately

placed on ice and incubated for 2 minutes. 250 VI of room temperature SOC medium

was added to the vial. The tube was then capped tightly and placed in a G24

Enviromental Incubator Shaker (New Brunswick Scientific Co. hc.) and shaken at 225

rpm for 30 minutes at 37OC. The vial was then placed on ice. LB agar plates containing

50 Mm1 ampicillin (Sigma) were prewarmed at 37°C for 30 minutes. 40 pl of 40 mg/ml

X-gal (GibcoA3R.L) was spread on the plates. The transformation reaction (50 pl and 200

pl) was then spread on the LB agar plates and incubated ovemight at 37OC. The strain of

E. coli used in this protocol allowed for bludwhite screening without the addition of

PTG. M e t an ovemight incubation, there were hundreds of colonies. Individual white

colonies (16 colonies) were picked streaiced on LB plates containing 50 pi/rnl ampicillin.

and culnired overnight in 3 ml of LB medium containing 50 flml ampicillin.

Figure 3.

Vector map of plasniid pCR 932.1-TOPO

EcoRi

M 13 Reverse Primer l t

EcoRI

l t M 13 Fonvard Primer

Mini~rep of Plamid DNA

The bacteria were harvested by pouring 1.5 ml of the culture into a microfùge

tube and centrifuged in a Biofûge A centrifuge (Canlab) at 12,000 x g for 1 minute. The

remainder of the culture was stored at 4OC. The medium was removed by aspiration,

leaving the bacterial pellet as dry as possible.

The rniniprep protocol was obtained from Miniatias (1990). The bacterial pellet

was resuspended in 100 pl of icetold Solution I(50 m M glucose, 25 mM T r i s 4 (pH

&O), 10 rnM EDTA (pH 8.0)) by vigorous vortexing. 200 pl of Solution II ( 0.2 N

NaOH, 1% SDS) was added and the solution was mixed by inverting the tube rapidly five

times. 150 pi of ice-cold Solution ID ( 3 M potassium, 5 M acetate) was added, and the

solution was vortexed for 10 seconds. The solution was stored on ice for 5 minutes.

Mer a centrifugation at 12.000 x g for 5 minutes at 4OC, the supernatant was caretiilly

transferred to a fiesh tube.

The double-stranded DNA was precipitated with the addition of 2 volumes of

ethanol at room temperature. The tube was then vonexed, and centrifuged at 12,000 x g

for 5 minutes at 4OC. The supematant was carefully removed by aspiration. The DNA

pellet was rinsed with 1 ml of ice-cold 70% ethanol. The tube was then centrifuged at

12,000 x g for 5 min at 4OC. The supematant was removed and the pellet air-dried for 1 O

minutes. The DNA was redissolved in 50 pl of TE (pH 8.0) containing 10 pg/ml

RNAase (GibcoiSRL). The DNA was stored at -20°C.

Analvsis of Plasmid DNA bv Restriction Analvsis

To CO* tht the transformed cells contained the insert of interest, the DNA

isolated previously, were subjected to restriction analysis. The restriction reaction

contained: 5 pl of the isolated D N 4 5 units of EcoRI (Gibco/BRL), in 1 X REA& 3

Bufier. The restriction reaction (10 pl) was loaded in a 1 % agarose gel containing 0.01

% ethydium bromide and electrophoresed for 1 hour at 90 Volts.

Seauenci na Reaction

The sequencing protocol used is described in the m~equencingTM Kit (Phannacia

Biotech). 1.5-2.0 pg of miniprep DNA was diluted in Hz0 to a final volume of 32 pl.

The double-stranded template was denatured by the addition of 8 pl of 2 N NaOH. The

tube was vonexed gently, and centrifuged briefly, then incubated at room temperature for

10 minutes. 7 pl of 3 M sodium acetate (pH 4.8) and 4 pi of H20 was added. The DNA

was precipitated by the addition of 120 ~1 of 100% ethanol. The solution was mixed and

placed on dry ice for 15 minutes. The precipitated DNA was collected by centrifugation

at 12,000 x g for 15 minutes at 4°C. The supernatant was carefully removed and

discmded. The pellet was washed with 70% ethanol. The sample was recentrifuged for

10 minutes. After the ethanol was removed, the pellet was dried, and the DNA was

redissolved in 10 pi of dinilled water.

The annealing reaction consisted of 10 pl of template DN& 2 pl of 5 pM of

Primer; either P7 or SP6 (refer to the vector map) and 2 p1 ofthe annealing buffer (1 M

Tris-HCl (pH 7.6), lOOmM MgC12 and 160 mM DTT). The sample was vonexed,

centrifuged bnefly, and incubated at 65OC for 5 minutes. The tube was quickly

transferred to a 37OC water bath and incubated for minutes. The sample was placed at

room temperature for 5 minutes, then centrifuged briefly.

The labelling reaction immediately followed the annealing reaction. The reaction

consisted of the following: 14 pl of the annealecl templatdpnmer reaction, 3 pl of the

Labelling Mix A ( 1.38 each dCTP, dGTP. and d m and 333,5 rnM NaCl), 1 pl ( 10

pCu) of labelled dNTP ( [ 3sa~ ] dATPa fmm MNm Life Science Produas hc.) and 2

pl of diluted Ti DNA polymerase. The components were mixed, and then incubated at

room temperatun for 5 minutes.

Mer the labelling reaction, 4.5 pi of the reaction was transferred into each of the

four pre-wmed sequencing mixes ("A", "C", "G", and "T" Mix-Short). The reaction

was then incubated at 37OC for 5 minutes. Mer the 5 minute incubation, 5 pl of the stop

solution was added to each tube.

The samples were heated at 75-80°C for 2 minutes and then immediately loaded

into the appropriate well of a 6% sequencing gel. The temainder of the sample was

stored at -20°C.

The sequencing gel was run at 80 Watts on a Mode1 S2 Sequencer (GibcoBRL)

for 3 hours. The gel was fixed ont0 fiiter paper, then dried for 1 hour and 15 minutes

under vacuum in a Mode 583 Gel Dryer (Bio-Rad) set at 80°C.

The Gel was exposed to BIOMAX~~MR Xray film (Kodak) ovemight at room

temperature. The autoradiograph was developed. and the sequence of the DNA was read.

Several samples were also sent to be sequenced automatedly at the Sequencing

Center located at the Hospital for Sick Children (Toronto, Ontario, Canada).

Allek-S~ecific Amdification (ASA)

PCR is a method that utilizes oligonucleotide primers to ampli@ a segment of

DNA more than a million-fold. Allele-specific amplification (ASA) is an adaptation of

PCK which can rapidly detect single base pair changes in DNA ASA relies on a single

base pair substitution at the 3' end of a primer. The substitution causes a Msmatch

between the primer and template D N 4 preventing the efficient 3' elongation by Taq

polymerase. This mismatch between pnmer and template at the 3' causes poor or no

amplification of a PCR produa Thus, by designing an extension primer with a 3' end

Iocated on the mutation site, it is possible to distinguish one allele over another.

Two separate PCR reactions were used for the allele-specific proiocol (Figure 4.).

To eliminate false negatives, the amplification of a 422 bp segment of the Hurnan growth

hormone gene (HGH) was used as an intemal control. The first reaction (wild-type

reaction) contained: O. 5 ph4 forward HGH primer (5'-TTCCCAACCATTCCCTTA-31,

O. 5 pm backward primer (5'-GGATmCTGTTGTGTmC-3'), 0.5 phi P3 pnmer (5'-

TGACATGAAGAAGTGGGATC-3'), 0.5 pi%f Wild-type primer (5'-

ATTTGGTAAGAGTGGATG-3'), -1 pg of genomic DNA 100 pM of each dNTPs, 1.5

mM Mgch, 2.5 units of Platinum Taq DNA polyrnerase (Gibco/BRL) in LX reaction

buffer (20 rnM Tris-HC1 (pH 8.4), 50 mM K I ) . In a separate tube, the variant reaction

contained the above components, but. the Variant primer (5'-

ATTTGGTMGAGTGGATA-3') for the Wild-type primer.

The PCR conditions were: an initial denaturation of 94°C for 3 minutes, 25 cycles

of 1 minute denaturation at 94T, 1 minute and 30 seconds annealing at 57"C, 1 minute

and 30 seconds extension at 72"C, and a final extension of 10 minutes at 72°C. The PCR

was performeâ on a Gene Amp PCR Syaem 2400 Thermal Cycler (Perkin-Elmer). 10 pl

of the arnplification product was loaded in a 1% standard agarose gel (Gibco/BRL)

containing 0.01% ethydium bromide and electrophoresed for 1 hour at 90 volts. The PCR

âagment was visualized using a W transilluminator.

1 A Sim~le M o u t h w a s h A

8 subjects were chosm to condua phenotype-genotype correlation comparisons.

Of the 8 individuals chosen, 3 were phenotypeâ as having atypical SR ratios (< 1.66).

The remaining 5 subjects had normal phenomes. The characteristics of the 8 individuals

used in this study are in Appendix 6.

Genornic DNA from these individuals was collected using a recently developed

method (Lum and Merchand. 1998). The method involves using mouthwash (FreshBurst

Listerine) to collect the genornic DNA of buccal cells. 10 ml of undiluted Listerine was

given to the subjects approximately 1 hr after they brushed their teeth. The subjects were

told to swish the mouthwash vigomusly throughout the mouth for 1 min. The samples

were then collected and transferred to a 50-1111 conical tube for centrinigation at 2700 rpm

for 15 minutes. The supematant was decanted, and the pellet was washed in 25 ml of TE

bufier [10 mM Tris (pH 8.0), 10 rnM EDTA (pH 8.0)]. The suspension was centrifûged

at 2700 rpm for 15 minutes, and the supernatant was discarded. The pellet was

resuspended in 700 p1 of lysis buffer [10 mM Tris (pH 8.Q 10 m . EDTA (pH &O), 0.1

M NaCI, and 2% SDS] and transferred to a 2-ml microcentrifige tube containing 3 5 pl of

20 mg/rnl proteinase K. The samples were mixed and digeaed at 58 OC for 2 hours. The

DNA was then extracted f?om each sample with eqwl volumes of phenoCchloroform

(1 : 1) and with an equal volume of chloroform alone, each time vortexing for 10 seconds

and centrifùging at 14,000 rpm for 2 minutes. The DNA was removed from the

supematant with 3 M NaOAc (pH 6.0; 1/10 volume of supematant) and 2 volumes of

cold 100% ethano1 and precipitated at -20 O C for 2 hours. The DNA was pelleted at

10,000 rpm for 10 minutes, washed with 70Y0 ethanol, and air-dried for 10 minutes. The

pellet was resuspended in 100 pl of TE, and the concentration of the DNA was calculated

on a Bedonan Du@-7 Spectrophtometer. The DNA samples were then subjected to ASA

genotyping following the protocols described above.

Interindividual variabüity in SIR ouzepam giucuroiiide ratio (S/R ratio)

A histogram of the results demonstrates that the data is bimodally distributed

(Figure 5). Furt hermore. pro b it (Bli ss, 1 93 4) and NTV (Endrenyi and Patel. 1 99 1 )

analyses of the log-transformed ratios demonmated that approximately 18 % of the

popuiation have S/R ratios below an apparent antimode of 1.66. herestingl y, 2 out of

the 203 individuals had extremely low SR ratios.

Factors that influence the S/R ratio

The S/R ratio amonp 203 healthy volunteers varies from 0.45 to 9.07. The mean

S/R ratio was 3.06 with a standard deviation of 1.14 (Table 4). Note that the S / R ratios of

94 subjects were obtained from Appanna (1995).

The 133 Caucasians in this study seemed to possess a higher mean S R ratio

(3.10k1.62) than the 58 Orientais (2.9511.00). However, this difference was not

statistically significant (p>O.OS). The percentase of individuals below the population

antimode also differed between the two racial groups. Among the Caucasian population

21% of individuals had S/R ratios below 1.66, while only 14% of individuals in the

Oriental population had S/R ratios below the antimode. A chi-square test however

demonstrated that this difference was not statiaically significant (p= 0.28).

When the metabolism of oxazepam was cornpared between male (n= 118) and

female (n= 85) subjects, a statistical difference was observed (pC0.05). In general, male

subjects have higher S/R ratios (3.22k1.49) than females subjects (2.82I1.32).

Furthemore, the percentage of individuals with atypical phenotypes (S/R ratio below

1.66) in the male population (13%) was also statistically different f5om the female

population (26%).

When the female subjects were demarcated by oral contraceptive use, females

who were taking oral contraceptives had mon variation and higher S/R ratios (3.13f 1.46)

than women who were not taking oral contraceptives (2.72Il.22). This difference was

not statistically significant.

Speannan's rank correlations were perfomed between the S/R ratio and potential

co-variates; age, body sire, caffeine consumption, ethanol use, and smoking habits (Table

5). Of the above factors mentione4 body size was the only variable that was

significantly correlated to the S/R ratio (rs= 0.28. p<O.OO 1).

Figura 5. Distribution of log SIR oxazepam glucuronide ratio (SIR ratio) in 203 volunteers. The SIR ratios of 94 subjects were obtained from Appana (1 995). The arrows represent the location of the antimode as detemined by N l V analyses.

Log SIR Ratio

Table 4. Summary table for the SIR oxazepam glucuronide ratio (SIR ratio) in 203 healthy volunteeo.

Total Populrtioa

Caucuirn Oriental

Female P"" I Noa Oral Contraceptive users Oral Contnceptive uscn

I Caucasian Male Oriental Male

I Caucosian Femrile Oriental Female

Mann-Whitney U-test, p* 0.05 " Chi-Square test, p< 0.05

O/. BELOW ANTIMODE

18

2 1 12

9 25

./. BELOW POP. AlVTIMODE

-Note that the S/R ratios of 94 subjects were taken from Appana (1995)

Table S. Non-parametnc cornlation analyses for S/R oxazepam glucuronide ratio, amount of Ssxaxepam glucuronide. and amount of R-glucuronide versus age. body size, caffeine, ethanol, and smoking.

Ase

Body Size (IbTinc h)

Caffeine (CU pdday )

E thanol (glass/w k)

, Smoking (cighk)

S/R ratio

Spearman's pvalue

O. 10

Amouat of S-giuc. (n- 1

Spearman's r. pvalue

0.38

0.02

O. 74

0.07

0.83

Spearman's ra

-0.1 1

AmounLi of S and R-oxazepam glucuronida ucreteâ in 8 eight-hour urine samples and the S/R ratio

The S/R ratio was significantly correlated to the amounts of both S- and R-

oxazeparn glucuronide excreted (Figure 6 4 6B). A strong positive correlation with a

spearman's rank coefficient of 0.63 was observed between the amount of S- oxazepam

glucuronide excreted and the SIR ratio (p<O.OOI). In contrast, the amount of R-

oxazepam glucuronide excreted over an 8-hou period was negatively correlated (rs= - 0.29) to the S/R ratio (p<O.OS).

When the amount of S- oxazeparn glucuronide was plotted against the amount of

R- oxazepam glucuronide (Figure 6C), a statiaically significant correlation was observed

Figure 6. Correlation analysis between the log SIR ratio and the log amounts of S and R oxazepam glucuronide excreted in an 8 hour period (A,B). Correlation between log amount of S and R oxazepam glucuronide (C). (n= 11 5)

-0.50 0.00 0.30 1 .O0

Log SR Ratio

- .

0.00 0.30

Log S;R Ratio

Facton that influence the amount of R- oxazepam giucuronide escretcd

There was no difference in the amount of R- oxazepam glucuronide excreted in 8-

hour urine samples between 29 Oriental (1 46H2) and 79 Caucasian (1 57k68) subjects

(Table 6A).

The metabolisrn of R- oxazepam was also not statistically significant b e ~ e e n

male (n= 73) and female (n= 42) subjects. hterestingly, when oral contraceptive users

were removed from the female group, the amount of R-oxazepam glucuronide excreted

by males (156k65) was significantly higher (pc0.05) than by females who were not

taking oral contraceptives (1 24H2).

Oral contraceptive users excreted significantly (pC0.05) more R- oxazepam

glucuronide (198B4) than females who were not taking oral contraceptives (124k42).

Neither age, body size, caffeine, ethanol. or smoking had any significant effects

on the amount of R- oxazepam glucuronide excreted (Table 5).

Facton that influence the amount of S oxazcpiim glucuronide excreted

The glucuronidation of S-oxazepam was not different between Caucasians and

Orientals (p>O.OS). However, Caucasians tended to excrete more S-oxazepam

glucuronide (437G20) than Orientais (4 1 1flO3).

The glucuronidation of S-oxazepam was not different between the male and

female subjects of this snidy (Table 68). But, males generally excrete more S-oxazeparn

glucuronide (#8*l9 1) than females (399I246).

Similar to the results of R- oxazepam, the glucuronidation of S- oxazepam was

statistically different between non-oral contraceptive users and oral contraceptive users

(p<O.OS). Females who were taking oral contraceptives excreted much higher amounts of

S- oxazepam glucuronide (546B8 1) than women who were not taking oral

contraceptives (325k193).

Fwthemore, when oral contraceptive users were nmoved from the female

population, a statistical difference @<0.05) was observed between males (4481 19 1) and

female subjects who were not taking ord contraceptives (325k193) in regards to the

glucuronidation of S-oxazeparn.

Body size was significantly correlated (p<O. OS) with the rnetabolism of S-

oxazepam (rr= 0.23). In contras& age, caffeine. ethanol, or smoking was shown not to

influence the glucuronidation of S- oxazepam (Table5).

Table 6. Cornparison of the variation in the amount of R-,S -oxazepam glucuronides, and SIR ratio excreted in an 8 hour period (A,B,C).

A. Amount of (R)-axazepam glucumnidc @ea& keight~oîume cdfecteQ

1 1 MEAN 1 STDEV 1 CV% Oriental (n= 29)

Caucasian (n= 79)

Male (n= 73)

Female (n= 42)

Non OC Users (n=2%)

Orien ta1 (n= 29)

Caucasian (n= 79)

Male (n= 73)

Female (n= 42)

Non OC Users (n=28) OC Usem (1144)

Amount of (S)-epam glucuronidr @e& height *volume coüected)

STDEV

*, (-) Mann-Whitney U-test, p< 0.05

SR aazepam glucuronide rutb in an 8 hour urine sample.

1 MEAN 1 STDEV

Onen ta1 (n=29)

Caucasian (n-79)

Male (n=73)

Femde (n=42)

Non OC Usen (n= 28) 1 2.65 1 1.26

Genomic Sequeace of UGT2B7

Previous sequences of UGT~B~(H~'*) and UGT~B~(Y'~*) were obtained h m

either cDNA clones Grom human cDNA libraries or messenger RNA fiom human tissue

amples. Here, we report the f i s t genomic sequence of the variant UGTZB7 allele

(UGT~B 7 ( ~ 268)).

Two primen, P5 and P6 which amplie a 144 base pau fragment of the UGT2B7

coding region encompassing the 802 mutation site were used in a PCR reaction on

genomic DNA. The PCR amplification produced 2 produas (Figure 7B). The lengths of

the Fragments were approximately 1.4 Kb and 1.6 Kb, respectively. The 1.6 Kb Fragment

is believed to be UGT2B4. The difference in site of these produas amplified from

mRNA (144 bp) and h m genomic DNA (1.4 Kb) suggests the existence of an intron in

this portion of the coding region.

Sequence analyses of the 1.4 Kb fragment revealed an introdexon splice site 105

base pairs away fiom the 3' end of the PCR fiagment (Figure 7A). Furthermore, the

sequence of the fragment matched that of the UGTZB7 variant allele with 2 additional

mutations (a T+A mutation and a G+A mutation at positions 73 5 and 80 1 of the coding

region). The 2 new mutations were silent mutations since they did not result in a change

of the amino acid sequence of the UGT2B7 gene.

Figure 7. Sequence of genomic DNA. PCR was pe~ormed on genomic DNA isolated fiom human liver tissue using P5 and P6 pnmers. Using RT-PCR P5 and P6 primers amplifies a I w bp fragment. However. PCR amplification with P5 and P6 pnmers using yenomic DNr\ as a template produces two fragments (B). nie upper band is approximately 1.6 Kb. the lower band is approximately 1.4 Kb. The lower band was gel purified. subcloned. transformed and then sequenced. The sequence matched that of the UGT2B7 variant with two additional mutations (A). The sequence also contains a intron/exon splice-site. The 1.6 Kb fragment is believed to be UGT2B4. (* npresents mutated base pairs)

Squence o f UGT2B7 Triascript

A sequence cornparison of the various members of the human UGT2B subfamily

reveals that the region amplified by the PS-P6 primers is highly homologous. in this

region, UGTZB7 shares a pater than 85% homology with UGT2B4, 2B 10, and

UGT2B 15 (Appendix 4.). The high homology of the UGTZB isozymes in this region

originally caused conceni as to the identity of the 1.4 Kb fiagment. Although the

fiagment shares the highest homology to UGT2B7, the fiagment could also have been a

novel UGT isoform or a mutated fonn of one of the other UGTZB enzymes. Therefore,

we decided to txy and ampli@ the entire coding region of UGT2B7 to see whether or not

the 2 new mutations observed in the genomic sequence also existed in the transcripts of

UGT2B7.

Our initial attempts to ampli@ the entire coding region of UGT2B7 from 6 Iivers

(K- 16, K- 19, K-27, K-28, L- 19, and L- 16) were unsuccessful due to the degradation of

the messenger RNA frorn these liver samples. We then decided to use 2 sets of primers,

P3-P6 and P5-P4 that together ampli@ the entue coding region of UGT2B7 (see Figure

2). Mer several attempts, we were successful in ampliQing the P3-P6 and P5-P4

fragments tiom al1 6 liven.

When 3 clones containing the P3-P6 insen âom 3 different liver sampies (K- 19,

K-28, L-19) were squenced automatedly, 866 out of the 869 base pairs completely

matched the published sequence of UGT2B7 (Figure 8). The three differences were the

C+T, T+A, and G+A mutations at positions 802, 80 1, and 735 of the coding region,

respectively. 'ïherefore, the genomic sequence of the variant allele with the 2 additional

mutations was neither a sequencing artifact nor the sequence of another UGT isozyme. It

is the sequence of UGT2B7.

hterestingly, al1 six liver samples contained at least one clone that possessed the

variant UGT2B7 allele. Furthemore. in addition to the mutation at position 802, the

variant allele was always associated with the 735 and 801 mutations. Figure 9A and 9B

are sequencing gels fkom UGT2B7 wildtype and UGT2B7 variant sequences,

respectively .

While using PS and P6 pnmers to perfonn RT-PCR we discovered that the P5 - P6 pnmers were not specific for only the UGT2B7 gene, the pnmers also had the ability

to amplifi the UGT2B4 gene as well (Appendix 5.). Therefore, we believe that the 1.6

Kb @ment produced fkom using P5-P6 pnmers to PCR genomic DNA is UGT2B4,

while the 1.4 Kb produa is UGT2B7.

Figure 8. Squence Analysis. RT-PCR was perfomed on mRNA ervtracted from human liver tissue using P3-P6 primers. The 839 base pair m e n t wac subsequently gel purifieci, subcloned and then sequenced. Ml3 foward (A) and reverse (B) pnmers were used to sequence. The sequence matched the published sequence of the UGT2B7 variant allele with 2 additional mutations. (U represents mutated base pairs)

Figure 9. Sepuence analysis. RT-PCR was performed on RNA isolated from human liver tissue using P3 and P6 primers. The RT-PCR product was subsequently subcloned. transformed. and then sequenced. The sequence matches that of UGT2B7 wildtype (A) and UGT2B7 variant plus two additional mutations (B). (* represents mutated base pairs)

802 (C)

735 (G)

+$O1 (A)

"735 (A)

*802 (T)

Allele Specific Amplification Aasay (ASA)

The results h m 3 individuals who were genotyped using the ASA method are

shown in Figure 10. The 422 bp eagment represents the amplification of the intemal

conaol (the human growth hormone gene), the 1.4 Kb fragment is UGT2B7, while the

1.6 Kb fragment is UGT2B4.

Individual A is a heterozygote, individual B is homozygous wildtype, whereas

individual C is a homozygous variant.

Genotyping a population using ASA

Of the 114 subjects genotyped, 54 individuals were heterozygotes, 33 were

homozygous wildtypes. while 27 subjects were homozygous for the variant allele (Table

7). Therefore, the gene frequencies of the wildtype and variant alleles are 0.526 and

0.474, respectively .

No difference was observed when the genotypes 50 male and 6 1 female subjects

were compared. In males, the percentage of homozygous wildtype, heterozygous, and

homozygous variant genotypes were 32,44, and 24, respectively. While, in females

28%, 49%. and 23% were genotyped as homozygous wiidtype, heterozygous, and

homozygous variant, respectively.

Out of the 98 Caucasian subjects testeà, 30%- 46%, and 23% were genotyped as

homozygous wildtype, heterozygous. and homozygous variant, respectively.

Figure 10. Allele Specific Amplification (ASA). Results Born heterozygous (A). homozyçous wildtype (B). and homozygous variant ( C ) individuais. The lower band is an amplitication of the human growh hormone gene The rniddle band is UGT3B7. and the uppermosr band is believed to be CGT384

Table 7. Summary of results from ASA genotyping assoy of 114 subjects.

Heterozygous

Homozygous Wildtype

Homozygous Variant

Total

Number Observed

Number Ex~ected

Genotypepbenotype cornparisons

8 individuals who had been previously phenotyped were chosen to perfonn a

genotype-p henotype comparative study (Figure 1 1). 2 of the 3 individuals who had

atypical S/R ratios were homozygous for the variant allele, while the other abnomial

subject was a heterozygote. Looking at the arnounts of S and R-oxazepam glucuronide

exmted, the heterozygote excreted normal amowits of the S-oxazepam glucuronide,

however, he excreted an abnonnally high amount of R- oxazepam glucuronide. Of the 5

normal phenotypes, 4 were genotyped as heterozygotes, while the remaining subject was

a homozygote for the wildtype allele (Figure 12.).

Figure 11. Phenotype-Genotype Cornparisons. Summary of phenotype-genotype results from 8 individuals, 3 were classified as being atypical (S/R ratio below 1.66). while 5 had normal phenotypes (SR ratio above 1.66) (A). Genotyping results Born the 8 individuals dong with the appropriate controls (B). ûenomic DNA controls were collected fkom blood (1-3). whereas genomic DNA used for phenotype-genotype cornparisons was collected from mouthwash. ASA of atypical abjects (4-6) and individuals with S/R ratios above the antimode (7- 1 1).

A.

Atypi cal

Normal

-

- -Note Variant is UGT21 -NA: Not Available

S/R oxazepam gi~ctnnide

ratio

1.38 1.17 1.38

1.8 1 2.20 2.98 4.67 3 .O4

hount of S-oxazepam glucuronide excreted in

8hrs (peakheightivol)

422 202 240

Amount of R-oxazepam glucuronide excreted in

8hn (peakheight*vol)

305 172 173

V W V W V W v w V W V W V W V W V W V W V W

Figure 12. SIR ratio versus genotype of UGT2B7 in 8 subjects.

W N V N

Genotype for UGTZB7

DISCUSSION

Distribution of the SIR oxazepam giucuronide ratio

There is a p a t e r than 20 fold variation in the Sm-oxazepam glucuronide ratio

( S R ratio) among 203 healthy volunteers. A histogram as well as probit and NTV

analyses of the data reveals that the SIR ratio is bimodally distributed (Figure 5).

Furthermore, approximately 18% of the population possess S/R ratios below an apparent

antimode of 1.66.

A previous population study conducted in this laboratory had also demonstrated a

bimodal distribution in the SIR ratios of 77 subjects (30 students, 47 elderly patients).

However, in contrast to our data, Patel et al. (1995a) reported that approximately 10 % of

the population had S/R ratios below an apparent antimode of 1 .go. This discrepancy in

the antimode value as well as the percentage of atypical subjects within a population

between the 2 studies may have resuited nom the inclusion of 47 geriatric patients to the

earlier study. Differences in age, health status, and concomitant dmgs in the elderIy

patients may have produced the differences seen. In fact. Patel observed that the S R

ratio in the patient population displayed positive skewness. He also reponed that there

was prevalence for higher S- to R- ratios in the geriatric subjects as compared to the

student population.

Kinetic analysis of 11 subjects demonstrated that urinary S/R ratios were

significantly correlated (r,= 0.90, p<0.05) to the plasma clearance of oxazepam (Patel et

al., 1995a). in the same midy, the phannacolcinetic parameters of 2 atypical subjects who

had S/R ratios of 1.41 and 1.57, respectively were compared to 9 normal individuals

(Mean f SD: 3.52 k 0.60). The results demonstrated that the 2 atypical subjects possess a

2-fold increase in the half-life of oxazepam as well as a 50% reduction in the plasma

clearance of the dnig as compared to nomal subjects. Inferring from the above results,

Our data thenfore suggeas that approximately 20 % of the population exhibit abnormal

kinetics for the metabolism of oxazepam. However, more pharmacokinetic studies are

needed to confinn this hypothesis. Since owepam is one of the most prescribed drugs

in the worki, the findings from these studies may have major clinical implications.

S/R ratio versus amount of S and R glucuronide

A strong correlation (r,= 0.63, p<O.OO 1) was observed between the S/R ratio and

S- glucuronidation (Figure 6A). However, the S I R ratio was also significantly correlated

( r r -0.26, pC0.05) to the amount of R- glucuronide (Figure 6B). Thus, in general, in

vivo variations in the S/R ratio is mainly a reflenion of the variations in the

glucuronidation of S-oxazepam. However, the importance of variations in R-

glucuronidation to the variations in the SIR ratio can not be discounted.

Interestingly, the amount of S- glucuronide was also significantly correlated to the

amount of R- glucuronide (rr= 0.5 1, p<O.OO 1). Inhibition studies using human liver

microsornes demonstrated that the glucuronidation of the S- an R- isomers of oxazepam

are catalyzed by different UGT isozymes (Patel et al., 1995b). The correlation seen here

thus suggests that the different UGT isoforms that ghcuronidate the S- and R-

enantiomers of oxazepam are co-regulated.

Factors that influence the metaboiism of osazepam

As described in the introduction, many factors are known to influence the

glucuronidation of oxazepam. In this study, Eicton such as age, ethanol, smoking, and

caffeine were shown not to infiuence either the glucuronidation of the individual isomers

of oxazepam or the S/R ratio (Table 5). in con- body size and oral contraceptives

were shown to influence the glucuronidation of oxazepam.

Obesity

Obesity was shown to enhance the glucuronidation of S- oxazepam (r,= 0.23,

p<0.05) in 1 15 volunteers. Furthemore, among 203 subjects, body size was significantly

correlated to the S/R ratio (r,= 0.28, p<0.001). These results are in agreement with a

report that demonstrated that the clearance of oxazepam was increased in obese subjects

(Abemethy and Greenblatt, 1986). An increase in the Iiver size of obese subjects is

believed to be the reason why obese in4viduals have a higher capacity to glucuronidate

oxazepam. Interestingly, however, the glucuronidation of R- oxazepam was not

influenced by body size.

Oral contraceptivesi

A previous study demonstrated that oral contraceptive use increases the clearance

of oxazepam by 2-fold when compared to females who were non-oral contraceptive users

(Patwardhan et al., 1983). Whether this inductive effect is directly due to the progestin or

estrogen in the oral contraceptives or secondary hormonal changes resulting from oral

contraceptive use is still not known.

In this study. orai contraceptives were shown to significantly influence the

glucuronidation of both S- and R- isomen of oxazepam (Table 64B). The mean

amounts of the S- and R- oxazepam glucuronides excreted in oral contraceptive users

(546a8 1 and 198I 94, respectively) was significantly higher (p<0.05) than the mean

amounts of the S- and R- oxazepam glucuro~des excreted in females who were not

taking oral contraceptives (325I193 and 124k 42, respeaively).

Furthemore, oral contraceptives seem to induce the glucuronidation of S-

oxazepam to a greater extent than R- oxatepam. This was evidenced by the fact that the

S/R ratios in oral contraceptive users (n= 14, 3.13f 1.65) is higher than the SIR ratios in

women who were not taking oral contraceptives (n= 28, 2.6511.26).

The differential induction pattern seen in body-size and orai contraceptive use

suppons the hypothesis that the different isomen of oxazepam are catalyzed by different

UGT isoforms. However, the earlier suggestion that these isoforms are CO-regulated may

have been an overgeneralization.

The difference in the S/R ratio b e ~ e e n 1 18 males (3.22k1.49) and 85 females

(2.82f 1.32) was shown to be statistically significant (pC0.05). A sexual dimorphism was

also apparent when the percentages of atypical subjects ( S / ' ratio below 1.66) were

compared between the sexes. Twice as many females (26%) had S/R ratios below the

antimode as compared to males (13%). Furthemore, when oral contraceptives users

were removed h m the female population, the formation of both S- and R- glucuronides

were significantly less (p<0.05) in the female population (3252193 and 124k 42,

respectively) as compared to the male population (448k191 and 156k 65, respectively).

There is incnasing evidence that hormonal nicton are significant contributors the

glucuronidation of many drugs. In fa* sexual dimorphisms been demonstrated for the

glucuronidation of paracetamol, temazepam. and propranolol as well as oxazepam

(Greenblatt et al., 1980; Miners and Mackenzie, 1991). In al1 these cases, males have

shown a p a t e r capacity for glucuronidation than females.

Paracetamol is the only substrate thus fa that has been used to study the effects of

the menstrual cycle on dmg glucuronidation (Miners et al., 1983; Somaja and Thangam,

1987). The glucuronidation of paracetamol during the follicular and luteal phases were

shown not to be different in these studies.

Ethnicity

Studies involving morphine, codeine. and paracetamol have suggested that there

are interethic differences in the glucuronidation of these cornpounds (Critchley et al.,

1986; Yue et al., 1989; Zhou et ai., 1993). In this study, we observed that Caucasians

tended to metabolize oxazeparn more eniciently than Orientals, however, the differences

were not statistically significant. The SR ratio was higher in 133 Caucasian subjects

(3.10k1.62) as compared to 58 Oriental subjects (2.95c1.00). The percentage of atypical

subjects within the Caucasian population (2 1%) was aiso higher than that observed in the

Oriental population ( 14%).

The glucuronidation of the individuai enantiomers of oxazepam was also shown

not to be statistically different between the two racial groups. However, Caucasians

tended to excreted more S- and R- oxazepam glucuronides (437e20 and 157f 68,

respectively) than Orientais (4 1 1 e O 3 and 146= 72, respectively).

Genttics

Although fàctors such as sex, oral contraceptive use. and obesity have been

demonstrated to be contributors to the variability of the SIR ratio seen in vivo, these

factors do not completely explain why a large percentage of individuals within the

population have amical S R ratios.

A study involving microsomes from 37 human livers have demonstrated that the

distribution of both the SIR ratio as well as the Km values for the formation of S-

glucuronide display a distinct bimodality (Patel et al., 1995a). In vivo, we have observed

that the distribution of the S/R ratio among 203 volunteers is also bimodally distributed.

Furthermore, family studies have demonstrated that the atypical phenotype is heritable

(Appana, 1995). Moreover. cornparisons of the inter- and intra-individual variability of

the SR ratio demonstrated a high genetic component value (roc= 0.98) (Kalow et al.,

1998). These results therefore suggest that the SR ratio may also be influenced by

genetic as well as environmental factors.

In vitro studies onginating f?om this laboratory irnplicated UGTZB7 as the major

UGT isoform that catalyzes the glucuronidation of S-oxazepam (Patel et al., 1995b). In

1993, Jin et ai. isolated a variant clone of UGT2B7 fiom a Lgt 1 1 human liver cDNA

library (Jin et al., 1993). This clone had a C 4 ' substitution at position 802 of the coding

region. The base pair change resulted in an amino acid (histidine to tyrosine) change at

position 268 of the amino acid sequence.

When the wildtype (H~~') and variant sequences were expressed in COS4

cells (Patel. 1998), the wildtype form was shown to be able to giucuronidate oxazepam

100 times more efficiently than the variant fon.

A genotyping assay (RFLV) was developed to test for this particular mutation in

the mRNA of human liver tissue samples (Patel, 1998). RFLV consists of RT-PCR,

restriction analysis. followed by another PCR reaction. The genotyping of 4 atypical and

33 normal livers, demonstrated that a heterozygosity of the variant allele was associated

with an atypical phenotype, whereas, normal phenotypes were associated with

homozygosity of the wildtrpe allele. Thus, it was hypothesized that the variation in the

SIR ratio seen in vivo results âom a genetic mutation of the UGT2B7 gene.

Attempts to repeat the RFLV genotyping assay produced inconsistent results.

However, reanalysis of the data by the sequencing of RT-PCR products of 2

heterozygotes (K- 16, K 19) and 4 hornozygous wildtype livers (K-27, K-28, L 1 9, and L-

16) discovered that al1 6 samples contained the variant sequence. Thus suggesting that

the RFLV assay is not allele specific and that the hquency of the variant allele is higher

than previously thought.

Allele Specific Amplification of UGT2B7

In this study, we developed a new, rapid and simple genomic genotyping assay

that has the ability to discriminate between the UGT2B7 wildtype and variant alleles

(Figure 10). Allele specific amplification (ASA) is an approach that has been

successfblly used in the genotyping of mutations in N-acetyltransferase 2 (NATZ) as well

as mutations in Cytochromes P450 CYP LAI, 2A6, and 2D6 (Blum et al., 199 1; Daly et

al., 1994).

The genotyping of 1 14 individuals was conducted using ASA (Table 7). The

allelic fiequencies of the wildtype and variant gaies within the population were

determined to be 0.526 and 0.474, respectively. Chi-square analysis of the observed and

expected fiequencies demonstrates that the data is in agreement with the Hardy-Weinberg

principle (%'= 0.286, pi 0.87). The high prevalence of the variant allele (0.474) within

our population is in direct conflid to the earlier genotyping study (Patel. 1998) which

reported that the Eequency of the variant allele was 0.04.

Gilbert's syndrome is a mild form of unconjugated hyperbilirubinaemia. This

disorder is very common, affecting between 249% of the population (Bosma et al.,

1995). Gilbert's syndrome is clinically characterized by a consistent mildly raised non-

fasting total serum bilitubin concentration above 17 pmol/L. Most of the clinical cases of

Gilbert's syndrome are associated with a mutation in the promoter region of the bilirubin

glucuronsyltransferase, UGT 1 A 1 (Monaghan et al.. 1996). A homozygosity of the (TA),

mutation in the promoter region produces Gilbert's syndrome. Funhemore, it is believed

that the wildtype (TA)o allele exhibits dominance over the mutated (TA), allele, since,

both homozygosity or heterozygosity of the (T& allele produce normal phenotypes. In

the Sconish population, 10-13 percent ofthe population was reponed to be homotygous

for (TA), mutation (Monaghan et al., 1996).

The genotyping of 114 subjects for UGTZB7 aileies revealed that approximately

20% ofthe population were homozygotes for the variant allele. The phenotyping of 203

individuals demonstrated that approximately 20 % of the population exhibit abnorrnal

oxazeparn metabolism. The consistency between the genotyping and phenotyping results

suggested that a homozygosity of the variant allele might be associated with an atypical

phenotype. The data also suggests that the wildtype allele displays dominance over the

variant allele. This situation may be analogous to the situation of the (TAb mutation and

its association with Gilbert's syndrome.

Pbenotype-Genotype Coinparison

A phenotyps-genotype comparative study was conduaed to test the hypothesis

that atypical S/R ratios are associated with homozygous variant genotypes. The genomic

DNA from 8 subjects who had been previously phenotyped (5 normal, 3 atypical) was

obtained from mouthwash. ASA wâs then perfomed on these 8 samples (Figure 1 1B).

All five normal phenotypes had either a hornozygous wildtype (n= 1) or

heterozygous (n= 4) genotypes. whereas, 2 out of the 3 atypical subjects were

homozygotes for the variant allele. However. contrary to the hypothesis, the other

atypical individual possessed a heterozygous genotype. What was interesting about this

individual was that he exhibited a significantly enhanced ability to glucuronidate the R-

isomer of oxazepam (Figure 1 1 A). In contra% his ability to glucuronidate S-oxazepam

was normal. Therefore, in this panicular case, the atypical phenotype resulted from an

increase in the ability to glucuronidate R-oxazepam and not a genetic alteration in

UGTZB7.

The genotyping results fiom these 8 individuals supported the hypothesis that the

S/R ratio phenotypes and UGT2B7 genotypes are associated to one another. However,

due to the limited number of individuals in the study, we were not able to definitively

prove the hypothesis.

Nothing is known about the identity of the UGT isoform(s) that catalyzes the

formation of Rsxazepam glucuronide. Therefore, whether or not there are any genetic

alteration(s) in the enzyme(s) that influence the metabolism of oxazepam is still

unknown. Furthemore, we have previously demonstrated that environmental factors

have the ability to influence the S I R ratio. We can not, therefore, discount the tact that

the induction of R-oxazepam glucuronidation seen in this particular individual was

caused b y non-genet ic facto r(s).

Condusion

In summary, we were able to demonstrate that approximately 20% of the

population possess atypical S/R ratios. Funhennore. we also demonstrated that the

variation in the S I R ratio is rnainly a refiection of the variation in S-oxazepam

glucuronidation. Moreover, factors such as sex. body site. as well as oral contraceptive

use were shown to significantly influence the glucuronidation of oxazepam.

A genotype assay that is able to discriminate between the wildtype and variant

alleles of UGT2B7 was also established. The 6equencies of the wildtype and variant

alleles within a population were s h o w to be 0.526 and 0.474. respectively. And lady, a

phenotype-genotype comparative study revealed an association between the SIR ratio

phenotypes and UGT2B7 genotypes.

Future Studies

Patel(1995a) using 2 atypical and 9 normal subjects concluded that atypical S/R

ratios are related to abnormal oxazepam metabolism. in this study, we were able to show

an association between the S/R ratio and a specific genetic alteration in the UGT2B7

gene in 8 subjects. From these results, we suggest that a genetic aiteration in UGTZB7 is

relateâ to an atypical S/R ratio, which in tum causes abnonnal oxazepam metabolism. A

possible future study would be to combine genotype-phenotype -dies with

phannacokinetic analyses.

Family studies have demonstrated that the SR ratio is heritable (Apparia, 1 995).

Whether or not the UGT2B7 genotypes are inherited. and the mode of inhentance, is still

to be elucidated.

Abemethy, D. R., and Greenblatt, D. J.: Drug disposition in obese humans. An update. Clin Pharmacokinet 11: 199-213, 1986.

Abernethy, D. R., Greenblatt, D. J., Ochs. K R., Weyers, D., Divoll. M., Hmatz , J. S., and Shader, R. 1.: Lorazeparn and oxazepam kinetics in women on low-dose oral contraceptives. Clin Pharmacol Ther 33: 628-32, 1983.

Allen, M. D., Greenblatt, D. J., Hannatz, I. S., and Shader, R. 1.: Desmethyldiazepam kinetics in the elderly afler oral prazepam. Clin. Pharmacol. Ther. 28: 196-202, 1980.

Alvan, G., and Odar-Cederlof, 1.: The pharmacokinetic profile of oxazepam. Acta Psychiatr Scand Suppl 274: 47-55, 1978.

Alvan, G., Siwers, B., and Vessman, J. : Pharmacokinetics of oxazepam in healthy volunteers. Acta Phannac. Tox. 40 (Suppl. 1): 40-5 1, 1977.

Arnbrose, P. J. : Clinical p harmacokinetics of chloramp henicol and chlorarnp henicol succinate. Clin. Pharmacokinet. 9: 222-23 8, 1984.

Aono. S., Adachi, Y., Uyama, E.. Yamada Y.. Keino, H., Namo, T., Koiwai, O., and Sato, H: Analysis of genes for bilirubin UDP-glucuronosyltransferase in Gilbert's syndrome [see comments]. Lancet 345: 95 8-9, 1995.

Aono, S., Yamada, Y., Keino, H., Hanada, N., Nakagawa, T., Sasaoka, Y., Yazawa, T., Sato, K, and Koiwai, O.: Identification of defect in the genes for bilirubin UDP- glucuronosyl- transferase in a patient with Crigler-Najar syndrome type II. Biochem Biophys Res Commun 197: 1239-44, 1995.

Aono, S., Yamada, Y., Keino, H., Sasaoka, Y., Nakagawa, T., Onishi, S., Mirnura, S., Koiwai, O., and Sato, H.: A new type of defect in the gene for bilirubin uridine 5'- diphosphate- glucuronosyltransferase in a patient with Crigler-Najjar syndrome type 1. Pediatr Res 35: 629-32, 1994.

Appana, G.: Pharmacogenetic studies: in vitro biotransformation of bupranolol. In vivo glucuronidation of oxazepam. In Department of Phmacology, pp. 1 1 i , Unverstiy of Toronto, Toronto, 1995.

Arias, 1. M., Gartner, L., Cohen, M., Ben Esser. J., and Levi, A. J.: Chronic non- haemolytic unconjugated hyperbilirubinaemia with giucuronosyltransferase deficiency. Am. J. Med. 47: 395-409, 1969.

Beaulieu, M., Levesque, E., Hum, D. W., and Belanger, A: Isolation and characterization of a novel cDNA-encoding a human üDP-glucumnosyltransferase active on C-19 steriods. J. Biol. Chem. 271: 22855-22862, 1996.

Beaulieu, M., Levesque, E., Tchernof. A., Beatry, B. G., Belanger, A, and Hum, D. W.: Chromosomal localization, structure, and regulation of the UGTZB 17 gene, encoding a C 19 steroid metabolizing enzyme. DNA Ce11 Bi01 16: 1 143-54, 1997.

Beutler, E., Gdbart, T., and Demina, A.: Racial variability in the LJDP- glucuronosyltransferase 1 (UGT 1 A 1) promoter A balanced polymorp hism for regulation ofbilhbin metabolism? Proc. Natl. Acad. Sci. 95: 81704, 1998.

Bliss, A.: The method of probits-a correction. Science 79: 409-4 10, 1934.

Blum, M., Demierre, A., Grant, D. M., Heim, Y.. and Meyer, U. A: Molecular mechanism of slow acetylation of dmgs and carcinogens in humans. Proc. Natl. Acad. Sci. USA 88: 5237-5241, 199 1.

Bock, K. W.: Roles of UDP-glucuronosyltransferases in chernical carcinogenesis. Crit Rev Biochem Mol Bi01 26: 129-50, 1991.

Bosma, P., Chowdhury, J., and Jansen, P.: Genetic inheritance of Gilbert's syndrome. Lancet 346: 314-315, 1995a.

Bosma, P. J., Chowdhury, J. R., Bakker, C.. Gantla S., de Boer, A., and Oostra, B. A.: The genetic basis of the reduced expression of bilirubin UDP-glucuronosyltransferase I in Gilbert's syndrome. N. Engl. J. Med. 333: 1 171 -5, 199%.

Bosma, P. J., Chowdhury, J. R.. Huang, T. J., Lahiri. P., Elferink, R. P., Van Es, H. H., Lederstein, M., Whitington, P. F.. Jansen, P. L.. and Chowdhury, N. R.: Mechanisms of inherited deficiencies of multiple UDP- glucuronosyltransferase isofonns in two patients with Crigler-Najjar syndrome, type 1. Faseb J 6: 2859-63. 1992.

Bosma, P. J., Goldhoom, B.. Oude Elferink, R P.. Sinaasappel, M., Oostra. B. A., and Jansen, P. L.: A mutation in bilirubin uridine 5'-diphosphate-glucuronosyltransferase isoform 1 causing Crigler-Najjar syndrome type II [see comments]. Gastroenterology 105: 2 16-20, 1993.

Burcheil, B., Brierley, C. H., and Rance, D.: Specificity of human UDP- Glucuronosyltransferases and xenobiotic glucuronidation. Life Sciences 57: 18 19- 183 1, 1995.

Burchell, B., and Coughtrie, M. W. : UDP-glucuronosyltransferases. Phannacol Ther 43: 26 1-89, 1989.

Burchell, B., Nebert, D. W., Nelson, D. R.. Bock K. W., lyanagi, T., Jansen, P. L., Lancet, D., Mulder, G. J., Chowdhury, J. R, Siest. G., and et al.: The UDP glucuronosyltransferase gene superfamily: suggested nomenclature based on evolutionary divergence. DNA Cell Bi01 10: 487-94, 199 1.

Caldwell, J., Winter, S. M.. and Hutt, A J.: The pharmacologicai and toxicological significance of the stereochemistry of dnig disposition. Xenobiotica 18 (Suppl. 1): 59-70, 1988.

Cheng, Z., Radorninska-Pandya, A, and Tephly, T. R.: Cloning and expression of human UDP-glucuronosyitransferase (UGT) lA8. Arch Biochem Biophys 356: 30 1-5, 1998.

Coffman, B. L., King, C. D., Rios, G. R, and Tephly, T. R.: The glucuronidation of opioids, other xenobiotics, and androgens by human UGT2B7Y(268) and UGT2BîH(268). Dnig Metab Dispos 26: 73-7, 1998.

Coffman, B. L., Rios, G. R., King, C. D., and Tephly, T. R.: Human UGT2B7 catalyzes morphine glucuronidation. Dtug Metab Dispos 25: 1-4, 1997.

Corbella, A., Ganboboldi, P., Jommi, G., Forgione, A, Marcucci, F., Martelli, P.. Mussini, E., and Mauri, F.: Stereochemistry of the enzymatic 3-hydroxylation of 1.3dihydro-2H- 1.4-benzodiapin-2-ones. J. Chem. Soc. Chem. Comrn. 1973 : 72 1-722.

Crigler, J. F., and Najar, V. A.: Cogenital familial non-haemolytic jaudice with kemicterus. Paediatrics 10: 169- 180, 1952.

Critchley, J. A., Nimmo, G. R., Gregson, C. A., Woolhouse, N. M.. and Prescott, L. F.: Intersubject and ethnic differences in paracetamol metabolism. Br. J. Clin. Pharmac. 22: 649-657, 1986.

Dahl-Puustinen, M. J. , Peny, T. L., Dumont, E., von Bahr, C., Nordin, C., and Bertilsson, L.: Stereoselective disposition of racemic E- 10-hydroxynortnptyline in human beings. Clin. Pharmac. Ther. 45: 650-656, 1989a

Dahl-Puustinen, M. L., Dumont, E., and Bertillsson, L.: Glucuronidation of E- 10- hydroxynonriptyline in human liver, kidnay, and intestine: organ-specific differences in enantioselectivity. Dmg Metab. Dispos. 17: 422436, 1989b.

Daly, A, Cholenon, S., Armstrong, M., and Idle, J. R.: Genotying for polymorphisms in xenobiotic metabolism as a predictor of disease susceptibility. Envir. Health Perspect. 102 (Suppl(9): 55-61, 1994.

Desmond, P. V., Patwardhan, R V., Schenker, S.. and Speeg, K. V.: Cimetidine impairs the elimination of chlordiazepoxide in humans. h a i s of Intemal Medicine 93: 266-268. 1980.

Drayer, D. E.: Problems in the therapeutic dm8 monitoring: The dilemma of enantiomenc drugs in man. Ther. Dmg Monit. 10: 1-7, 1988.

Dreyfiss, D., Shader, R. I., Harrnatz, J. S., and Greenblatt, D. J.: Kinetics and dynamics of single doses of oxazepam in the elderly: implications of absorption rate. J Clin Psychiatry 47: 5 1 1 4 , 1986.

Dutton, G.: Glucuronidation of dnigs and other compounds, CRC Press, Boca Raton, FL. 1980.

Ebner, T., and Burchell, B.: Substrate specificities of two stably expressed human liver UDP- glucuronosyltransferases of the UGT1 gene farnily. Drug Metab Dispos 21: 50-5. 1993.

Eichelbaum, M.: Pharmacokinetics and pharmacodynamie consequences of stereoselective dnig metabolism in man. Biochem. Pharmac. 37: 93-96, 1988.

El Mouelhi, M., Ruelius, H. W., Feneslau, C., and Dulik, D. M.: Species dependent enantioselective glucuronidation of three 2-arylpropionic acids. Naproxen, ibuprofen, benoxaprofen. Dnig Metab. Dispos. 15: 767-772. 1987.

Endrenyi, L., and Patel, M.: A new. sensitive graphical method for detecting deviations from the normal distribution of drug responses: the NTV plot. Br. J. Clin. Pharmacol. 32: 159-166, 1991.

Gantla, S., Bakker, C. T., Deocharan, B.. Thurnmala, N. R., Zweiner. J., Sinaasappel, M., Roy Chowdhury, J., Bosma, P. J., and Roy Chowdhury, N.: Splice-site mutations: a novel genetic mechanism of Crigler-Najjar syndrome type 1. Am J Hum Genet 62: 585-92, 1 998.

Gerkens, J. K., Desmond, P. V., Schenker, S., and Branch, R. A.: Hepatic and extrahepatic glucuronidation of lorazepam in the dog. Hepatology 1 : 3 29-3 3 5, 198 1.

GrechoBelanger, O., Turgeon, J., and Gilbert, M.: Stereoselective disposition of mixiletine in man. Br. J. Clin. Pharmac. 21: 481487, 1986.

Green, M., Otum, E. M., and Tephly, T. R.: Stable expression of a human liver UDP- glucuronosyltransferase (UGT2B 15) with activity toward steroid and xenobiotic substrates. Dnig Metab. Disp. 22: 799-805, 1994.

Green, M. D., King, C. D., Mojarrabi, B., Mackenzie, P. I., and Tephiy, T. R.: Glucuronidation of amines and other xenobiotics catalyzed by expressed human UDP- glucuronosyltransferase 1 A3. Dnig Metab Dispos 25: 37- 12, 1998.

Greenbla~ D. J.. Divoll M.. Abemathy, D. R, Ochs, H. R., and Shader, R 1.: Clinical pharmacokinetics of the newer benzodiapines. Clin. Pharmacokinet. 8: 233-252, 1983.

Greenblaa D. J., Divoll, M.. Harmatz, J. S., and Shader, R. 1.: Oxazepam kinetics: effects of age and sex. J. Pharmac. Exp. 'fher. 215: 86-9 1, 1980.

Greenblatt, D. J., and S hader, R. 1. : Effects of age and other drugs on benzodiazepine kinetics. Armeirnittelforschung 30: 886-90. 1980.

Gngus, Z., Watkins, J. B., Thompson , T. N., and Naassen, C. D.: Resistance of some phase II biotransfomation pathways to hepatotoxins. J. Pharmacol. Exp. Ther. 222: 471- 479, 1982.

Hamberg, O., Ovesen, L., Dorfeldt, A, Loft, S., and Sonne, J.: The effect of dietary energy and protein deficiency on drug metabolism. Eur J Clin Phmacol 38: 567-70, 1990.

Harding, D., Jeremiah. S. J., Povey, S., and Burcheil, B.: Chromosornal mapping of a human p henol UDP-glucuronosyltransferase. Ann. Hum. Genet. 54: 17-2 1, 1990.

Jackson, M. R., Mccarthy, L. R., Harding, D.. Wilson, S., Coughtrie, M. W., and Burchell, B.: Cloning of a human liver microsoma1 UDP-glucuronosyltransferase cDNA. Biochem. J. 242: 581-588, 1987.

Jaqz, E., Ward, S., Johnson, R. F., Schenker, S.. Gerkens, J., and Branch R. A.: Extrahepatic glucuronidation of morphine in the dog. Drug Metab. Disp. 14: 627-630, 1986.

Jin, C., Miners, J. O., Lillywhite, K. J., and Mackenzie, P. 1.: Complementary deoxyribonucleic acid cloning and expression of a human livet uridine diphosphate- glucuronosyltransferase glucuronidating carboxylic acid-containing drugs. J Pharmacol Exp Ther 264: 475-9, 1993a

Jin, C. J., Mackenzie, P. 1.. and Miners, J. O.: The regio- and stereo-selectivity of C 19 and C2 1 hydroxysteroid glucuronidation by UGT2B7 and UGT2B 1 1. Arch Biochem Biophys 341: 207-1 1, 1997.

Jin, C. J., Miners, J. O., Burchell, B., and Mackenzie. P. 1.: The glucuronidation of hydroxylated metabolites of benzo[a]pyrene and 2- acetylaminofluorene by cDNA- expressed human UDP- glucuronosyltransferases. Carcinogenesis 14: 263 7-9, 1993 b.

Kalow, W.: Race and therapeutic drug response. New Engl. J. Med. 320: 588-590, 1989.

Kalow, W.: Interethic variation of dmg metabolism. TIPS 12: 102- 107, 199 1.

Kalow, W., Tang, B., and Endrenyi, L.: Hypothesis: Cornparisons of inter- and intra- individual variations can substitute for twin studies in drug research. Pharmacogenetics 8: 283-289, 1998.

Klotz, U., Avant, G. R., Hoyumpa, A., Schenker, S., and Wilkinson, G. R.: The effects of age and liver disease on the disposition and elimination of diazepam in adult man. I. Clin. Invest. 55: 347-359, 1975.

Koiwai, O., Nishizawa, M., Hasada, K., Aono, S., Adachi, Y., Marniya, N., and Sato, H.: Gilbert's syndrome is caused by a heterozygous missense mutation in the gene for bilirubin UDP-glucuronosyltransferase. Hum Mol Genet 4: 1 1836, 1995.

Labrune, P., Myara, A, Hadchouel, M., Ronchi. F., Bernard, O., Trivin, P., Chowdhury, N. R, Chowdhury, J. R., Munnich, A., and Odievre, M.: Genetic heterogeneity of Crigler-Najjar syndrome type 1: a snidy of 14 cases. Hum Genet 94: 693-7, 1994.

Lazard, D., Zupko, K., Poria, Y., Nef. P., Lazarovits, J., Hom S., Khen, M., and Lancet, D. : Odorant signal temination by olfactory üDP @ucuronosyl transferase. Nature 349: 790-3, 1991.

Levesque, E., Beauiieu, M., and Belanger, A: uGT2B4 @a): A üDP- glucuronosyltransferase encoded by a polymorphic gene with differential substrate specificity. Submitted for publication in Pharmacogenetics, 1998.

Levesque, E., Beaulieu, M., Green, M. D., Tephiy. T. R., Belanger. A.. and Hum. D. W. : Isolation and characterization of UGTZB 1 j(YS5): a UDP- ~lucuronosyltransferase encoded by a polymorphic gene. Pharmacogenetics 7: 5 17-25, 1997.

Lum, A, and Marchand, L. L.: A simple mouthwash method for obtaining genomic DNA in molecular epidemiological studies. Cancer Epidemiology, Biomarken & Prevention 7: 7 19-724, 1998.

Mackenzie, P. L, Owens, 1. S., Burchell. B., Bock K. W., Bairoch, A., Belanger, A., Foumel-Gigleux, S., Green, M., Hum, D. W., Iyanagi. T., Lancet, D., Louisot, P., Magdalou, J., Chowdhury, J. R., Ritter, J. K., Schachter, H., Tephly, T. R., Tipton, K. F., and Neben, D. W.: The UDP glycosyltransferase gene superfamily: recommended nomenclature update based on evolutionary divergence. Pharmacogenetics 7: 255-69, 1997.

Maniatis, T., Fritsch, E. F., and Sambrook J.: Molecular cloning: a laboratory manual., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1990.

Marks, J.: The benzodiazepines-Use and abuse. .Anneim-Forsch.30: 898-90 1, 1980.

Mascher, H., Nitsche, V., and Shutz, K: Separation. isolation, and identitication of optical isomers of 1.4-benzodiazepine glucuronides hom biological fluids by reversed phase high-perfomance liquid chromatography. J. Chromatogr. Biomed. Appl. 306: 23 1- 239, 1984.

Miners, J. O., Attwood, J., and Birkett, D. J.: hluence of sex and orai contraceptive neriods on paracetamoi metabolism. Br. J. Clin. Pharmac. 16: 503-509. 1983.

Miners, J. O., and Mackenzie, P. 1.: Drug giucuronidation in humans. Pharmacol Ther 5 1: 347-69, 199 1.

Mohler, H., Okadda, T., Heitz, P. H., and Ulrick J.: Biochemical identification of the site of action of benzodiapines in human brain by 3 ~ d i a z e ~ a m binding. Life Sci. 77: 985- 996, 1977.

Monaghan, G.. Burchell, B., and Boxer, M.: Structure of the human UGT2B4 gene encoding a bile acid UDP- glucuronosyitransferase. Marnm Genome 8: 692-4, 1997.

Monaghan, G., Ryan, M., Seddon, R., Hume, R., and Burchell, B.: Genetic variation in bilinibin UPD-glucuronosyltransferase gene promoter and Gilbeds syndrome [see comments]. Lancet 347: 578-8 1, 1996.

Mulder, G.: Glucuronidation and its role in regulation of biological activity of drugs. Annual Review of Pharmacology and Toxicology 32: 25-49, 1992.

Ochs, H. R., Greenblatt, D. J., and Otten, H.: Disposition of oxazepam in relation to age, sex and cigarette smoking. Klin. Wochenschr. 59: 899-903, 198 1.

O'Neill, P. J., Yorgey, K. A., Renzi, N. L., Williams, R. L., and Benet, L. 2.: Disposition of zomepirac sodium in man. J. Clin. Pharmac. 22: 470476, 1982.

Osborne, R., Joel, S., Trew, D., and Slevin. M.: Morphine and metabolite behavior after different routes of morphine adminstration: Demonstration of the importance of the active metabolite morphine 6-glucuronide. Clin. Pharmac. Ther. 47: 12- 19. 1990.

Patel, M.: Genetic variability of an Uridine-diphosphoglucuronosyltransferase: UGT2B7. In Department of Pharmacology, pp. 125, University of Toronto, Toronto, 1998.

Patel, M., Tang, B. K., Grant, D. M., and Kalow. W.: Interindividual variability in the glucuronidation of (S) oxazepam contrasted with that of (R) oxazepam. Pharmacogenetics 5: 287-97, 1995a.

Patel, M., Tang, B. K., and Kalow, W.: (S)oxazepam glucuronidation is inhibited by ketoprofen and other substrates of UGT2B7. Pharmacogenetics 5: 43-9, 1995b.

Patwardhan, R. V., Johnson, R. F., Hoyurnpa, A., Sheehan, A, Desmond, P. V., Wilkinson, G. R., and Branch, R. A.: Normal disposition of morphine in cirrhosis. Gastroenterology 81: 1001-1011, 1981.

Patwardhan, R. V., Mitchell, M. C., Johnson. R. F., and Schenker, S.: Differential effects of oral contraceptive steroids on the rnetabolism of benzodiazepines. Hepatology 3: 248- 53, 1983.

Patwardhan, R. V., Yarborough, G. W.. Desmond, P. V., Johnson, R. F., Schenker, S., and Speeg, K. V., Jr.: Cimetidine spares the glucuronidation of lorazepam and oxazepam. Gastroenterology 79: 912-6, 1980.

Ritter, J. K., Chen, F., and Sheen, Y. Y. : A novel complex locus UGTl encodes human bilimbin, phenol, and other UDP-glucuronosyltransferase family with identical carboxyl tennini. J. Biol. Chem. 267: 3257-6 1, 1992a

Ritter, J. K., Sheen, Y. Y., and Owens, 1. S.: Cloning and expression of human liver UDP-glucuronosyltransferase in COS- 1. 3,4-catechol estrogens and estnol as primary substrates. J. Biol. Chem. 265: 7900-7906, 1990.

Ritter, K., Chen, F., Sheen, Y. Y., Lubet, R. A, and Owens, 1. S.: Two human liver cDNAs encodes UDP-glucuronosyltransferases with 2 log differences in activity toward parallel substrates including hydeoxycholic acid and certain earogen denvatives. Biochemistry 31: 3409-34 14, 1 W2b.

Ruelius, H. W., Tio, C. O., Knowles, J. A., McHugh S. L., Schillings, R. T., and Sisenwine, S. F.: Diastereoisomeric glucuronides of oxazepam. Isolation and stereoselective enzymic hydrolysis. Dmg Metab Dispos 7: 40-3, 1979.

Scott, A. K., Cameron, G. A., Khir, A. S. M., McHardy, K. C., and Hawksworth, G. M.: Oxazepam elimination in patients with diabetes mellitus. Br. J. Clin. Pharmac. 26: 224, 1988.

Scott, A. K., Khir, A. S., Bewsher. P. D., and Hawksworth, G. M.: Oxazepam pharmacokinetics in thyroid disease. Br J Clin Pharmacol 17: 49-53, 1984.

Scott. A. K., Khir, A. S., Steeie, W. H., Hawkswonh G. M., and Petrie, J. C.: Oxazepam pharmacokinetics in patients with epilepsy treated long-term with phenytoin alone or in combination with phenobarbitone. Br J Clin Phmacol 16: 44 1-4, 1983.

Seideman, P., Ericsson, O., Groningsson, K., and von Bahr, C.: Effect of pentobarbital on the formation of diastereomeric oxazepam glucuronides in man: analysis by high performance liquid chromato.graphy. Acta Pharmacol Toxicol (Copenh) 49: 200-4, 198 1.

Sellers, E. M., Giles, H. G., Greenblatt, D. J., and Naranjo, C. A.: Differential effects of benzodiazepine disposition by disulfiram and erhanol. Armeirnittelforschung 30: 882-6, 1980.

Sellers, E. M., Greenblatt, D. J., Giles, H. G., Naranjo, C. A., Kaplan, K., and MacLeod, S. M.: Chlordiazepoxide and oxazepam disposition in cirrhosis. Clin Pharmacol Ther 26: 240-6, 1979.

Seppen, J., Bosma, P. J., Goldhoom, B. G., Bakker, C. T., Chowdhury, I. R., Chowdhury, N. R, Jansen, P. L., and Oude Elferink, R P.: Discrimination between Crigler-Najjar type 1 and II by expression of mutant bilirubin uridine diphosphate- glucuronosyltransFerase. J Clin Invest 94: 23 85-9 1, 1994.

Serlin, M. I., Sibeon, R. B., and Mossman, S.: Cirnetidine: interaction with oral anticoagulants in man. Lancet 2: 3 17-3 19. 1979.

Shull, H. J., Wilkinson, G. R., Johnson, R.. and Schenker, S.: Normal disposition of oxazepam in acute viral hepatitis and cirrhosis. ANI Intern Med 84: 420-5, 1976.

Sisenwine, S. F., Tio, C. O., Hadley, F. V., Liu, A. L., Kimmel, H. B., and Ruelius, H. W.: Species-related diReremes in the stereoselective glucuronidation of oxazepam. Dnig Metab Dispos 10: 605-8, 1982.

Somaja, L., and Thangam, J.: Salivary paracetamol elimination kinetics during the menstruai cycle. Br. J. Clin. Pharmac. 23: 348-350, 1987.

Sonne, J.: Factors and conditions atfecting the glucuronidation of oxazepam. Phmacol Toxicol73 (Suppl 1): 1-23, 1993.

Sonne, J., Andreasen, P. B., Loft. S ., Dossing, M., and Andreasen, F. : Glucuronidation of oxazepam is not spared in patients with hepatic encep halopathy . Hepatology 1 1 : 95 1-6, 1990a.

Sonne, J., Boesgaard, S., Poulsen, H. E., Loft. S., Hansen, J. M., Dossing, M.. and Andreasen, F.: Pharmacokinetics and pharmacodynarnics of oxazepam and metabolism of paracetamol in severe hypothyroidism. Br J Clin Phannacol 30: 737-42. 1990b.

Sonne, J., Dossing, M., Loft, S., Olesen, K. L., Voiimer-Larsen, A., Victor. M. A.. Hamberg, O., and Thyssen, H.: Single dose phannacokinetics and pharmacodynarnics of oral oxazepam during concomitant administration of propranolol and labetalol. Br J Clin Phannacol 29: 33-7, 1990c.

Sonne, J., Dragsted, J., LoR S., Dossing, hl., and Andreasen, F. : Influence of a very low calorie diet on the clearance of oxazeparn and antipyrine in man. Eur J Clin Pharmacol 36: 407-9, 1989.

Sonne, I., LoA. S., Dossing, M., Boesgaard, S., and Andreasen, F.: Single dose phannacokinetics and pharmacodynarnics of oral oxazepam in very elderly institutionalised subjects. Br. J. Clin. Pharmacol. 31: 719-722, 199 1.

Sonne, J., Loft, S., Dossing, M., Vollmer-Larsen, A. Olesen, K. L., Victor. M., Andreasen, F., and Andreasen, P. B.: Bioavailability and p harmacokinetics of oxazepam. Eur J Clin Pharmacol 35: 385-9, 1988.

Vesell, E.: Complex effects of diet on dnig metaboism. Clin Pharmacol Ther 36: 285- 296. 1984.

Visser? T. J., Kaptein, E., Gijzel, A L., de Herder, W. W., Ebner, T., and Burchell, B.: Glucuronidation of thyroid hormone by human bilirubin and p henol UDP- glucurony ltransferase isoenzymes. FEBS Lett 324: 3 58-60, 1 993.

Vree, T. B., Baars, k M., and Wuis, E. W.: Direct high pressure liquid chromatographie analysis and preliminary pharmacokinetics of enantiomen of oxazepam and temazepam with their corresponding glucuronide conjugates. Pharm Weekbl [Sci] 13: 83-90, 199 1.

Yue, Q. Y., Svensson, J. O., Alm, C., Sjoqvist, F.. and Sawe, J.: Interindividual and interethnic differences in the demethylation and glucuronidation of codeine. Br J Clin Pharmacol 28: 629-37, 1989.

Zhou, H. H., Sheller, J. R., Nu. H.. Wood, M., and Wood, A. J.: Ethnic diflerences in response to morphine. Clin Pharmacol Ther 54: 507-13, 1993.

SE?< AG€ iUCE

O M 25 CHINESE

1 F 24 CAUCASIAN

2 M 23 CHINESE

3 F 42 CAUCASIAN

4 M 24 CAUCASIAN

5 F 40 CHINESE

6 M 25 CAUCASIAN

7 F 24 C W S 1 A N 8 M 23 CHINESE

9 M 24 CAUCASIAN

10 M JO CHMESE

11 F 39 CAUC.4SIAN

12 M 26 CAUCXSUN

13 M 18 CAUCASIAN

14 hl 19 CAUCASIAN

15 .CI 18 CACCASlrLV

16 F 19 CAUCr\SlXN

17 hl 19 CAUCASIAN

18 .Cl 19 E.iND. 19 hl 19 CAUCSIZuV

20 M 19 E.MD. 21 M 19 CAUCASIAN

22 M 18 CAUCASIAN

23 M 18 CAUCASlAV

24 M 19 PHILOPiNO 25 M 22 CAUCASIAN

26 hl 20 CAUCASIAN

27 hl 23 CAUCASIAN

28 hf 25 CAUCASlAN

29 F 32 EMD. 31 hI 32 CAUCSUV

32 F 30 CAUCASIAN

33 F 27 CAUCASiAii

35 M 19 CAUCASIAPJ

36 .Li 18 CAUCASIAN

37 hi 19 CAUCASttV

38 M 41 C H M S E 39 F 39 CHINESE M X1 26 CAUCASIAN

JI 81 29 CAUCASWN

42 M 34 CAUCASiAN

43 19 CAUCASIAN

46 M 19 CAUCASUN

47 M 19 CHINESE

48 M 18 PiüLOPiNO 49 M 18 CHINESE 50 M 23 CAUCASM

OC

NO YEs NO NO NO NO NO

YES NO NO NO E S NO NO

NO Y 0

HO Y 0

NO NO NO NO

NO NO NO

NO NO NO NO YES NO NO

YES NO NO NO NO NO NO NO NO NO NO

NO NO NO NO

Vol (II) 0.3 85 0.460

0.525

0.300

0.335

0.630

0.460

0.265

0.330

1.020

0.365

0.700

0.365

0.240

0.475

0.235

0.085

0.200

0.500

0.230

0.425

0.095

0.385

0.225

0.470

0.400

0.265

0.270

0.230

0.070

0.235

0.565

0.365

0.430

0.305

0.385

0.320

0.455

0.300

O. 130

0.550

O. 105

0.720

0.480

0.150

0.245

0.500

SEX AGE RACE

19 CHINESE

23 K o m 20 CAUCASWrJ

22 CAUCASIAN

51 CAUCStAN

37 P?IILOP[NO

24 C A U C s h v

22 CAUCSMN

32 CAUCSWN

23 CHMESE

19 CAUCASMN

22 CHMESE

23 CAUCr\SUrJ

2s CAUCASIAN

22 CAUCA!%lR

22 CAUCASUN

19 CAL'CZ\Slu

19 CAUCASIAN

25 CAUCASWIV

22 CHINESE 24 CAUCASIAN

22 CAUCASIAN

20 CAuCsIrLV

22 C A U C S I r n

22 CAUCASIAN

22 CXUCASIrn

27 CAL'CSlrtV

29 CAUCA!WN

24 CHCESE

20 CAUCASWN

22 C m C A u C

22 CAUCfiIAN

22 CIUNESE

51 CAUCSLW

49 CAUCASIAN

21 CAUCASIAN

23 CHINESE

38 CAUCASIrLV

18 CHINESE 19 EiND. 2s CAUCIISIAÀ'J

24 CAUCASUN

21 CHINESE

19 EJND. 24 CAUCASWN

19 CAUCASWN

18 CAUCASUN

24 CHINESE 21 CAUCASUN

2.36 NO 3.00 NO

2.01 NO

2.46 NO

2 . 1 NO

1.n NO 2.0 t NO 2.11 NO

1.74 NO 2.32 NO

1.97 NO

2.78 NO 2.16 NO

1.86 YES 2.28 NO 2.04 NO 1.91 NO

2.01 YES 2.73 NO

1.76 NO

2.03 YES 1.83 YES 2.16 NO

1.88 NO

2.64 NO

1.67 NO

2.04 NO

2.3 1 YES 1.67 NO

3.20 Y 0

1.79 YES 1.97 NO

1.46 NO

2.65 NO 236 NO

243 NO

231 NO

3.62 .JO

2.29 NO

2.57 NO

2.06 NO

2.09 NO

1.48 NO

197 NO

1.97 NO

206 NO 1.63 NO

23s NO

3.07 NO

M E RACE 24 CAUW1AN 26 CAUCASIAN

22 CAUCASIAN

33 CAUCASIAN

26 CAUCASIAN

23 CHINESE 34 CAUCASIAN

34 CAUCASIAN 20 CAUCASIAN

20 CAUCASIAN 37 M. E S T 29 M. EAST

21 CAUCASIAN

21 CAUCASIAN 22 CAUCASIAN 47 CHINESE 43 CHMESE 17 CHMESE 16 CHXNESE

2.12 NO

2.28 NO 247 NO

2.67 NO

1.75 YES 1.83 NO 2.78 NO

2.09 NO

1.99 NO 1.72 YES

2.43 NO

2.44 NO

2.26 NO 2.06 YES

2.12 NO

2.17 NO

1.82 NO

2.08 NO

1.81 NO

Appendix 2.

Results from Appana (1 995) W/HT AL SMOKING COFFATA

SEX AGE RACE 37 CAUCASIAN 3s CAUCASIAH 39 CAUCASIAY 29 CAUCASIAN 44 CAUCASWN 31 CAUCASIAN 43 CAUCASIAN

20 CAUCASIAN 22 CAUCASIAN 34 CAUCASIAN 56 CAUCASMN

21 CAUCASIAN 23 CAUCASIAN 34 CAUCSfAN 27 CAUCASWN

23 CAUCASIAN 23 CAUCASIAN 42 CAUCMIiLV 23 CAUCASIAN 21 CAUCASIAN

28 CAUCASIAN 23 CAUCASUN 62 CHINESE 60 CHINESE

30 END 20 CHMESE 24 CHTNESE 27 CAUCASIAi

61 CAUCASIAN 47 CHmEsE 22 CHLNESE 21 CHINESE 32 CAUCASLW 18 CHDESE 24 CtiiNE!jE 19 CHINESE 23 CHINESE 27 CHINESE 32 CAUCASIAN 41 JAPANEsE 54 CHDIESE 23 CiiiNESE 24 CHINESE 21 CAUCASIAN 34 CAUCSWN 30 CAUCASWIV

2.73 YES 1.86 NO 2 3 NO

1.67 NO 220 NO 2.25 NO

2.5 1 NO 2.54 NO

2.64 NO 2.11 NO

2.13 Y 0 2.13 NO 2.63 NO 2.07 YES

2.03 NO

2.06 NO

2.55 NO 2.19 YES 2.18 YES 2.29 NO 2.24 NO 2.76 NO

1.88 NO

2.30 NO 2.17 NO

1.61 NO

2.39 NO 2.02 NO

2.55 YES 1.81 NO

8 NO

2.18 NO 2.67 NO

1.94 NO

210 N O

1.74 NO

2.06 NO

1.67 YES 2.63 NO

2-17 NO

2.87 NO 2.36 NO

2.28 NO

1.81 NO

1.83 YES 1.71 NO

SEX AGE RACE 63 CAUCAsL4N

35 CAUCASWN

64 CAUCASWN 29 LiND. 30 CAUCASLW 37 CAUCASIAN

21 CAUCMfAN

35 EIM). 35 Enm. 29 B MD. 26 CAUCASfAN 27 CAUCASIAii

26 CAUCASIAN 15 CHTNESE

63 CAUCAStAN

63 CAUCASIAN

69 CAUCASIAN 57 CAUCASLLY 64 CAUCASIAN

23 CHI?(ESE

22 CHINESE 26 CAUCASIAN

51 CHINESE 20 CHNESE 19 KORErlN

23 PHïtiPCNO 22 K 0 R E . W 26 CHINESE 45 CAUCASIAN

76 CWNE!X 31 C A K X S I M

20 CÂL'CASlrtV 52 CHMESE 27 CAUCSWN

22 CAUCAS1AN

31 CHINESE 37 CHINESE

25 CAUCSMN 34 CAUCASIAN

59 CÂUCrSSIrW 30 CAUCASWN

29 CAUCASIAN

31 CAUCA!3IAN

30 CAUCAStAN

62 CAUCSWN

60 CAUCASlAN

29 CAUCASIAN

31 CAUCASIAN

WTm (Iblbch) OC

2.27 NO 270 NO 2 . NO 2.17 NO 1.82 NO 2 3 4 NO 1.7 NO

2.27 NO

2.02 YES

1.97 NO 2.44

2.43 NO

2.52 NO 1.83 NO 2.46 NO

1.64 NO 2.21 NO

1.73 NO

2.36 YES

1.86 NO 1.65 NO

2.21 NO

2.34 NO 1.97 NO

2.37 NO

1.78 NO

2.21 NO 2.07 NO

1.95 NO

2.22 NO

1.83 YES

1.83 YES 2.36 NO

L.70 NO

2.00 YES

1.80 NO

1.88 NO

1-75 30 2.43 NO

2.42 NO 2.01 NO 1.67

2.25

2.03

237 NO

2.28 NO l.67

2.28

Appendix 3. Resuits of ASA genotyping assay. Gcnomic DNA uns loiDdly pmvidcd by Dr. Grant.

Subject

00 1NC 003CB OOJBP 007EV 013A.R OZOCB 029NJ 034AG 039TW 040SS 042DS 043PV OJIYA OJSSD 0~6m 047MC 048JG 049ED 052MS 053IR 054sv 055SJ 056RF 057AP 058KM 059MH O6 lDM 062KA 063DS 064LC 065BC 066ST 067TT 06SSH O7OB W 07 1BT 072MM 073K 071CB 075JL 076DM 077RS 082RW O83 CD 084CD

Race

C C C C C C M C C C C I C C O C

C C C

OC C C

C C C C C C C C C C I C C C C C C C C C C

Sex

F F M F F M F F F F M F F M F F

M F F F F F

M M F F F M M M M F F F F F M M M M F M F

Hctcrozygous Homozygous Homo ygous W iidtype Variant

Appendix 4.

Sequence cornparison between UGT2B7 and tlie otlier UGT2B subfamily niernbers in tlie 144 base pair stretcli amplified by P5 and P6. Note that the regions of the PS and P6 priniers are identical to the sequences of UGT2B7 and UGT2B4. Also note that ASA uses PS and either the variant or wildtype primers (PV, PW), and tliat the products produced by ASA is 5 base pairs shorter than the products produced by the P5 and P6 primers.

- + represents the 802 mutation site - * represents base pair difference from UGT2B7

Appendu 5. The sequence of the UGT2B4. P5 and P6 pnmers were used in a RT-PCR reaction on mRNA extfacted âom human liver tissue. The product was subcloned, transformecl, and then sequenced. The sequence matches the sequence of UGT2B4.

+ Position 723 on coding region

4-• Position 829 on coding region

C G T

Appendix 6.

Characteristics of the 8 individuals in the genotype-plienotype coniparative study.

S/R Ratio

1.38 1.17 1.38 1.81 2.20 2.98 4.67 3.05

Ami. of S-giuc.

42 1 172 240 587 235 N A 859 73 1

k1cc

Cliincse Caticasifin Caiicasian

Korcan Caiicasian Chinesc

Caucasian Caucasian

2.57 1.76 2.34 3 .O

2.24 2.36 1.92 2.28

LA-

Oral coiitraceplive

NO NO NO NO NO NO YES NO --

- NA: nd available