Pollinator

Research at the

National Botanic

Garden of WalesAbigail Lowe

© Abigail Lowe

The National Botanic Garden of Wales is dedicated to the research and conservation of biodiversity, to

sustainability, lifelong learning and the enjoyment of the visitor.

“Education, Conservation, Inspiration”

© Natasha de Vere

Dr Natasha de VereHead of Science

Laura JonesScience Officer

PhD Researcher (Bangor University)

Harry AllenResearch Intern (University of Bath)

The Science Team

Abigail LoweScience Officer

PhD Researcher (Bangor University)

Lucy Witter

PhD Researcher (Aberystwyth University)

Lydia CocksResearch Intern (University of Reading)

© Natasha de Vere

Science @ the Garden

of WalesSaving

plants and fungi

Saving pollinators

Science and

SocietyCollections

© Abigail Lowe

DNA Barcoding

• Small section of DNA which has high variability between species and low variability within species

• Can be used for species identification

• In plants, rbcL, ITS2 and matK commonly used

>Cotoneaster_cambricus

AGAGACTAAAGCAAGTGTTGGATTCAAAGCTGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGACTATGAAACCAAAGATACTGATATTTTGGCAGCATTTCGAGTAACTCCTCAACCTGGAGTTCCACCTGAGGAAGCAGGGGCCGCGGTAGCTGCTGAATCTTCTACTGGTACATGGACAACTGTATGGACTGACGGTCTTACCAGTCTTGATCGTTACAAAGGTCGATGCTACCACATCGAGCCTGTTGCTGGAGAAGAAAGTCAATTTATTGCTTATGTAGCTTACCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGTAATGTGTTTGGGTTCAAGGCCCTGCGCGCTCTACGTCTGGAGGATTTGCGAATCCCTACTGCTTATGTTAAAACTTTCCAGGGCCCGCCTCATGGTATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGCCGCCCTCTATTGGGATGTACTATAAAACCAAAATTGGGGTTATCCGCTAAGAATTACGGTAGAGCAGTTTATGAATGTC

© Natasha de Vere

What do they eat? Is this legal?What plants do insects visit?

Applications of DNA barcoding

Barcode Wales and UK

Pollinator research

Honeybee foraging

Medicinal properties of honey

Wild pollinator foraging

Planting for

pollinators

© Natasha de Vere

Pollinator Importance

Worth £430 million per annum

to UK agriculture

Pollinate 75% of world’s

leading crops

Removal of pollinators would

affect human nutrition and

global health

76% of resident and migrant UK butterfly

species suffered losses over the last 40 years

(Fox et al. 2015)

25% of hoverfly species in UK declined since 1980s

(Biesmeijer et al. 2006)

3 of the UK’s bumblebee species have gone extinct

and 8 others are experiencing range

contractions (Olds et al, 2018)

Honeybee colony declines in parts of Europe

(Potts et al, 2010)

© Abigail Lowe

What’s causing the

decline?

Habitat loss and land-use change Insect-harming pesticides

Pests and disease Climate change

© Abigail Lowe

Indicator pollinator groups in the U.K.

Bumblebees

Solitary bees

Hoverflies

Honeybees

0.2%4.3%

45%

50.5%

All photos © Natasha de Vere

The European honey bee, Apis mellifera

© Abigail Lowe

Bumblebees, Bombus

24/25 UK species7 are common

© Jürgen Mangelsdorf

© gailhampshire

Red-tailed bumblebee

Tree bumblebee

Garden bumblebeeBuff-tailed bumblebee

Red-tailed bumblebee

© Natasha de Vere

© Natasha de Vere

Solitary bees

© Rolf Dietrich Brecher Berlin

© Orangeaurochs

© Line SabroeSolitary bees~250 species

Furrow bees, e.g. Lasioglossum calceatum

Leaf-cutter bees, e.g. Megachile

willughbiella

Mason bees, e.g. Osmia bicornis

Mining bees, e.g. Andrena cineraria

© Natasha de Vere

Dronefly, Eristalis arbustorum

Hoverflies282 species

Bumblebee hoverfly, Volucella bombylans Dasysyrphus

Thick legged-hoverfly Syritta pipiens@gailhampshire

© gailhampshire

© Walwyn © Vlad Proklov

They feed us – but what do they feed on?

© Abigail Lowe

Dr Andrew Lucas

• Studied hoverfly communities in semi-natural grasslands

• Used DNA barcoding to investigate foraging preferences

• Significant difference between composition of pollen loads between genera

• All hoverflies don’t use the same resources!

© Natasha de Vere

Laura Jones

• Investigating the foraging preferences of honeybees

• How does foraging change throughout the season, and from year to year?

• DNA metabarcoding honey

• Over 8000 taxa to choose from

• Surveyed all flowering plants monthly, compare DNA sequences to what is available

© Tim Jones

DNA: % seq in April and May honey for 3 Hives

So what about wild pollinators?

Which plants do pollinators use?

Do pollinators show a preference for native or

non-native plants?

Is there any partitioning of floral resources between

different species?

How can we provide the plants they need in our

gardens?

© Abigail Lowe

Pollinator sampling

1. Capture pollinators using nets2. Remove pollen loads3. Extract, amplify and sequence

pollen DNA4. Compare to reference library5. Discover what plants are being

used for forage

© Natasha de Vere

So far…• Sampled from March to October

• 26 honey samples collected

• 72 bees and 85 hoverflies caught on transects

• 184 bees and 182 hoverflies caught in pan traps

• 11,714 flowering plant records represented by 1867 taxa

© Abigail Lowe

Creating spaces for pollinators

© Nigel Jones© Sarah Gould

The majority of UK bees are ground nesting

We can provide suitable habitats in our garden very

easily

Visit our Science blog on the Garden’s website to find out how you can make your own

bee hotel

© Abigail Lowe

Plants for pollinators

© Abigail Lowe

Lucy Witter – Testing seed mixes

© Natasha de Vere

© Nikki Gammans

© Lucy Witter

© Lucy Witter

What proportion of species in the seed mix are used by wild pollinators?

© Lucy Witter

What proportion of species in the seed mix are used by wild pollinators?

© Lucy Witter

Are “pollinator friendly” mixes preferred over others?

What proportion of species in the seed mix are used by wild pollinators?

© Lucy Witter

Are “pollinator friendly” mixes preferred over others?

Which mix is most aesthetically pleasing to us?

Soil type

Continuation of floral resources throughout the

season

Benefits all pollinator guilds

Good source of pollen and nectar

Climate

Competition between plant species in the seed mix (JP

Grime)

Germination and emergence success

Aesthetics

Cost

Availability

Emergence of species

Factors to consider

For the pollinator For the plant

© Natasha de Vere

Thank you for listening

abigailjayne26Abigail.lowe@gardenofwales.org.uk

© Abigail Lowe