YEAST VOL. 12: 129-134 (1996)

pMPY-ZAP: A Reusable Polymerase Chain Reaction-directed Gene Disruption Cassette for

I

Saccharomyces cerevisiae B. L. SCHNEIDER*, B. STEINER, W. SEUFERTt AND A. B. FUTCHER

Cold Spring Harbor Laboratory, P. 0. Box 100, Cold Spring Harbor, N Y 11 724, U.S. A

Received 15 February 1995; accepted 24 July 1995

Gene disruption is an important method for genetic analysis in Saccharomyces cerevisiae. We have designed a polymerase chain reaction-directed gene disruption cassette that allows rapid disruption of genes in S. cerevisiae without previously cloning them. In addition, this cassette allows recycling of URA3, generating gene disruptions without the permanent loss of the ura3 marker. An indefinite number of disruptions can therefore be made in the same strain.

KEY WORDS ~ Saccharomyces cerevisiae; gene disruption; PCR-mediated disruption; uraduction

INTRODUCTION

While one-step gene disruption has become a standard technique in most Sacchuromyces cere- visiue laboratories, the limited number of auxo- trophic markers in any one strain has made the generation of strains with multiple gene disrup- tions difficult (Rothstein, 1991; Vidal and Gaber, 1994; Sauer, 1994; KO et al., 1993; Schwob et al., 1994). Several methods have been developed to alleviate this problem. Alani et al. (1987) first reported the use of a disruption vector that could be used repeatedly in the same strain, and sev- eral recent articles detail new techniques or vectors for recycling or replacing selectable markers in S. cerevisiae (Vidal and Gaber, 1994; Sauer, 1994).

Another development has been the use of polymerase chain reactions (PCR) to generate fragments for gene disruption. About 50 nucleo- tides of homology to the target gene are provided in each PCR primer, which are then used to amplify a selectable .marker such as HZS3. Upon transformation, the small flanking regions of

*Corresponding author. tInstitut fur Genetik,Universitat Munchen, Maria-Ward Str. la, 80638 Munchen, Germany

homology direct the marker to the-target (Baudin et ul., 1993). We have designed a disruption cas- sette, pMPY-ZAP, that expands upon these pre- vious developments. The basic strategy is shown in Figure 1. By designing primers where 50 bases at the 5' end are homologous to the gene target, and 18 bases at the 3' end are homologous to the vector (Figure 2B), we are able to amplify a 2.1 kb fragment that can be used to transform yeast directly. The amplified fragment, like plasmid pNKY51 of Alani et al. (1987), includes short direct repeats flanking URA3. The terminal 50 nucleotides direct in vivo recombination. Gene disruptions are selected as URA3+ transformants, and subsequently 5-fluoro-orotic acid (5-FOA) plates are used to select for colonies where recom- bination between the directly repeated hisG se- quences has excised the URA3 gene. Thus this technique allows disruption of multiple genes with- out any requirement for clones of the genes, with- out any cloning steps, and without being limited by the auxotrophic markers in the strain of interest. We have used this method to delete both the GAL1,IO promoter and the TLCl RNA (Singer and Gottschling, 1994). Finally, we have used this technique to remove a prototrophic marker, LEU2, thus liberating an auxotrophic marker for future use.

CCC 0749-503X/96/020129-06 0 1996 by John Wiley & Sons Ltd

130

hisG URA3

B. L. SCHNEIDER ET AL.

hisG

A

YFG ORF 0 3' Region

PCR t

_ _ YFG ORF hisG URA3

Transform

,.---I

hisG 3' Region

"Pop-out" 1 Select on 5-FOA Plates

C hisG 3' Region .. .

YFG ORF

Figure 1. Basic PCR ZAP disruption strategy. (A) Primer design and PCR amplification. Primer sets are designed such that 45 to 55 bases at the 5' end direct the PCR fragment to the gene target, and the 16 to 18 bases at the 3' end are complementary to pBluescript sequences outside the polylinker in pMPY-ZAP (see Figure 2B). (B) Transformation and integration of PCR products. Following PCR amplification, unpurified PCR reactions are used to transform target strains. Transformants are selected on - URA drop-out plates, and correct integrations are identifed by PCR (see Figure 3). (C) UHA3 'pop-out' results in the final product, a disrupted gene and regeneration of the ura3 marker.

MATERIALS AND METHODS Strains and culture conditions

All DNA sequences were disrupted in the yeast strain W303a. whose genotype is MATa ade2-1 trpl-1 leu2-3,112 hiLs3-11,15 ura3-1 cnnl-100 [psi'] (Thomas and Rothstein, 1989). Standard conditions were used for culturing and manipulat- ing yeast (Guthrie and Fink, 1991).

Construction of p M P Y-ZAP The pMPY-ZAP vector was designed such that

400 bp of hisG flank thc URA3 gene. Primers were made to amplify a portion of the hisG gene from plasmid pNKY51 (Alani et al.. 1987): HisG up

GCGCCTGATTGC-3', HisG dwn 5'-TTCGACT GACTCGAGACTAGTGACCAA ATCGCAGA

5'-ACGATCGTCGAATTCGAGCTCCACTCA

TAGC-3'. The PCR fragments were cut with SucI and Spel and ligated into a similarly cut vector pWS8932 (Schneider et al., in press). The result- ing vector was cut with EcoRI and XhoI and ligated to a similarly digested PCR fragment to create pMPY-ZAP (Figure 2A).

Primer &sign and PCR amplijication of P M P Y-ZAP

The pairs of primers used to delete the GAL1,lO promoter, the TLCl RNA, and the LEU2 gene are shown in Table 1. In addition, the sequence of the primers used to check URA3 transformants and resulting 5-FOA-resistant colonies are also given. A previously published report indicated that 35 to 51 bases were sufficient to direct homologous recombination in S. cerevisiue (Baudin et al., 1993). Based on this evidence, we designed each

PCR-DIRECTED GENE DISRUPTION CASSETTE 131

Figure 2

A.

Smal EcoRl

pMPY-ZAP

-pKSII- hisG

CCAATTCGCCCTATAG TGAGTC hisG A C T C A G - P ~ ~ " -

Figure 2. Plasmid maps of pMPY-ZAP. (A) Plasmid map of pMPY-ZAP. The orientation of the hisG disruption sequence and useful restriction sites are indicated for pMPY-ZAP. (B) Primer design. The design and location of primer sequences is essential to the amplification of proper PCR products. The 16 bases at the 3' end of the PCR oligonucleotides (white on black background) must not extend further 3' than shown; otherwise they will end in palindromes (because of the restriction sites between hisG and the rest of the vector), and so will generate primer-dimers. Thus, the left-hand primer should end in 5' AGGGAACAAAAGCTGG 3', and the right-hand primer should end in 5' CTATAGGGCGAATTGG 3'.

pair of primers such that 16 to 18 bases were complementary to pBluescript sequences in pMPY-ZAP (Figures 1 and 2B), and between 45 and 54 bases were homologous to the target gene. It is important that the 3' ends of the primers do not go more than three bases into the polylinker of pMPY-ZAP; otherwise, the primers will end in palindromes and will generate primer-dimers.

PCR conditions were as follows: 1-100ng lin- earized pMPY-ZAP, 100 pmol of each primer, 200 pM dNTPs, 10 mM Tris-HC1 pH 8.3, 1.5 mM MgCl,, 50 mM KCI, 1-2.5 units Taq DNA polymerase (Boehringer Mannheim) in a total vol- ume of 50 pl. PCR reaction times were: 5 min at 94"C, 1 rnin at 5OoC, 3 rnin at 72T, for one cycle; 1 rnin at 94"C, 1 rnin at 50T, 3 rnin at 72"C, for nine cycles.

In addition to the correctly sized 2.1 kb PCR band, we frequently see a truncated amplification product of about 0.5 kb (data not shown). This

product results from amplification of a single hisG repeat. This product does not appear to interfere with correct integration, and the ratio of long product to truncated product can be maintained by the addition of a reasonably large amount of input DNA (50-100ng) and a small number of amplification cycles.

Yeast transformation, selection of transformants and PCR confirmation

Yeast strains were grown overnight at 30°C and prepared for transformation as previously described (Ausubel et al., 1992). As discussed elsewhere (Schneider et al., in press), strains were transformed by electroporation, which for this purpose was more efficient than the lithium acetate method (Ausubel et al., 1992). After transform- ation, strains were spread on -URA dropout plates and incubated at 30°C for 3-5 days. The position of the integrated fragment was tested in

132 B. L. SCHNEIDER ET AL.

Figure 3. PCR amplification of ZAP-disrupted products. (A) General strategy for PCR diagnosis of transformants. Primer Url is used in combination with Dgsl to diagnose integration at the correct site, and Dgsl and Dgs2 are used to diagnose the pop-out. Dgsl and Dgs2 can also be useful in diagnosing correct integration, because they give a fragment of one length for the wild-type allele, while giving a fragment of a different length for the disrupted allele. The UrllDgsl pair will fail to give any fragment for the wild-type allele, but failure to see a fragment may simply mean that the PCR reaction did not work for other reasons. Dgsl and Dgs2 must be custom-made for each gene of interest, and should be about 18 nucleotides long. Wowever, since the pop-out step is efficient (and can be diagnosed by Southern analysis), Dgs2 is not essential to the use of pMPY-ZAP. (B) Diagnostic PCR products from strains that were disrupted for the TLCl RNA (lanes 3-6, and 8), or the GAL1,IO promoter (lanes 10 and 12). Lane 1, molecular weight marker. Lane 2, untransformed strain W303, primers Hisg up and TLC Dgsl. Lane 3, Ura' ric::ZAP #1, primers Hisg up and TLC Dgsl. Lane 4, Ura' rlc::ZAP #2, primers Hisg up and TLC Dgsl. Lane 5 , Ura+ rlc::ZAP # I , primers TLC Dgsl and TLC Dgs2. Lane 6, Ura+ t1c::ZAP #2, primers TLC Dgsl and TLC Dgs2. Lane 7, untransformed W303, primers TLC Dgsl and TLC Dgs2. Lane 8, r1c::ZAP # I after URA3 pop-out, primers TLC Dgsl and TLC Dgs2. Lane 9, untransformed strain BS100, primers GAL Dgsl and Url. Lane 10, Ura' gul1,lO::ZAP strain BS106, primers GAL Dgsl and Url. Lane 11, untransformed strain BS100, primers GAL Dgs2 and Ur2. Lane 12, Ura+ gul1,lO::ZAP strain BS106, primers GAL Dgs2 and Ur2.

individual colonies by PCR. Briefly, colonies roughly the same diameter as a toothpick tip were resuspended in 5 pl of water and boiled for 5 min. This suspension was then added to a PCR reaction as described above. Diagnostic primers (Table 1) were designed such that only correctly integrated disruption cassettes would yield amplified bands. Colonies with the disruption cassette in the correct

position were grown overnight in YEPD (1% yeast extract, 2% peptone, 2% glucose) liquid culture to aiiuw rcwrrririrraticjn between the hbG i e l ~ a t s flanking the URA3 gene. Cultures were then washed with water and spread on three 5-FOA plates: plate 1, lo7 cells; plate 2, lo6 cells; and plate 3, lo5 cells. 5-FOA-resistant colonies were tested by PCR to confirm the complete loss of the URA3 gene.

RESULTS AND DISCUSSION The use of this universal disruption cassette re- quires three simple steps: (1) design of primers to target YFG and PCR amplification (Figures 1 and 2B); (2) transformation of recipient strain (Figure 1 B); (3) identification of correctly disrupted products by PCR (Figures 1C and 3).

We have used pMPY-ZAP to disrupt six differ- ent genes. Table 1 gives detailed results of three deletion experiments. Table 2 gives a summary of the results with eight different loci. Of the initial Ura+ transformants, from 0% to 20% had the disruption cassette correctly integrated at the tar- get gene. The location of the cassette in the other transformants was not determined, but at least some were probably at the ura3-1 locus (see below). The homologous recombination step that removes the URA3 gene was efficient and greater than 80% of colonies checked by PCR had excised the entire URA3 gene (data not shown). Figure 3 demonstrates the use of PCR to identify correctly integrated cassettes before and after URA3 exci- sion. After URA3 excision, the vector and method can be reused in the same strain. By designing diagnostic primers that yield different length PCR fragments characteristic of each gene disruption, multiple disruptions could be made and tracked through crosses using a single PCR reaction per strain.

When the method is used to remove pro- totrophic markers such as LEU2, the URA+ trans- formants can be replica-plated to drop-out plates (e.g. - LEU plates) to see whether the disruption cassette has integrated at the correct locus (data not shown). In this case, confirmation by PCR is unnecessary.

The main difficulty with the method is that the initial transformation frequency is very low. Often, several transforinations using about 1 pg of PCR fragment have to be done. For two genes, EST1 and CLG1, we failed to get any disruptants. In the former case the regions of homology were

PCR-DIRECTEI) GENE DISRUPTION CASSETTE

Table 1. Primers.

133

Primer Efficiency* Sequence?

Gal up

Gal dwn

Gal dgs-1 Gal dgs-3 Tlcl up

Tlcl dwn

TIC1 dgs-1 Tlcl dgs-2 Leu2 up

Leu2 dwn

Ur- 1 Ur-2

3/30

3/13

1/57

NA

CAAAACAATTTTAG AAGT ACTTTCACTTTGTAACTGAGCTGTCAT AGGGAACAAAAGCTGG

GGTACAATCACTTCTTCTGAATGAGATTTAGTC ATTATAGTTTTT CTATAGGGCG A ATTGG

TCCATTCTCAATTAGCTCTACC ACTTTTCGGCC AATGGTCTTGG TGTTATTCCTTCTTCGTACCGATCCTCTTCTCGACCTAACCTTTTAATTACC

ATGGGAAAGGGAACAAAAGCTGG GGTTCCTTCCCJCTTGGAAAATAATGCGACAAAAATACCGTATTGATCATC

AAAGCACTATA GGGCGAATTGG AGCAATGGTGACATATAGATCTCAA ACACACGGTTCCTTCCGCTTG ATGTCTGCCCCTAAGAAGATCGTCGTTTTGCCAGGTGACCACGTTGGTCA

TTAAGCAAGGATTTTCTTAACTTCTTCGGCGACAGCATCACCGACTTCGGTG AGAAATCACAAAAGGGAACAAAAGCTGG

GTACTGTTCACTATAGGGCGAATTGG AAGCTTGCATGCCTGCAGGTCG GCATATTTGAGAAGATGCGGCC

*Efficiency is the number of colonies with the corrcctly integrated disruption cassette divided by the total number of colonies screened. tThe sequence of the primer homologous to the pMPY-ZAP cassette is underlined.

separated by 2.1 kb, the largest distance attempted, and in the latter case only four transformants were examined. Increased separation between the re- gions of homology may be correlated with poorer disruption efficiency (Table 2), and there may also be gene-to-gene variability (Table 2). Presumably the method would be much more efficient if the amount of homology at the ends could be increased slightly. We are experimenting with various PCR methods to accomplish this.

We were concerned that homology between the URAS gene in the PCR product and the uru3-1 frameshift allele in strain W303 might cause this locus to be the primary target of recombination, as was reported for the his3 locus by Baudin et al. (1993). Therefore, we created an isogenic strain with a complete deletion of the 1.1 kb Hind111 fragment carrying the URAS gene. This strain had no homology to the URA3 fragment in pMPY- ZAP. However, we found that this uru3 deletion strain gave only a modest improvement in the frequency of correctly integrated disruption cas- settes (about two-fold. data not shown). The u r d deletion strain grew poorly, possibly because of an effect of the deletion on some gene neighboring URA3, and so we have not used it for other experiments.

Table 2 . Summary of disruptions.

Gene Separation (kb) Homology Frequency

ORFD ORFD CLGI CDC6 GALI, 10 TL CI LEU2 SIC1 EST1

0.8 0.0 1.3 I .5 0.7 0.6 0.9 1.2 2.1

54, 54 55, 55 54, 54 54, 54 54, 54 54, 54 57, 57

1100. 100 54. 54

0115 1/39 014 1/66 3/30 211 3 7157 5/10 0142

‘Separation’ is the distance on the chromosome between the two regions of homology. ‘Homology’ is the length of homol- ogy at the left and right ends of the distrupting fragmcnt. ‘Frequency’ is the number of transformants disrupted at the expected position ovcr the total number of Ura+ translbi-m- ants. For essential gcncs (e.g. CDC6), or genes where mutations grow poorly, transformations were done using a diploid straiii. For the SIC]-disrupting fragment, longer regions of homology were added by another method. Two different primer sets were used to disrupt ORFD; one removed most of the open reading frame (0.8 kb separation), while the other was an insertion with no deletion (0.0 kb scparation).

In conclusion, this method allows gene disrup- tion without a clone of the gene and without need

134 B. L. SCHNEIDER ET AL.

efficient method for direct gene deletion in Sacchavo- myces cerevisiae. Nucl. Acids Res. 21, 3329-3330.

Guthrie, C. and Fink, G. R. (1991). Guide to Yeast Genetics and Molecular Biology. Methods in Enzymol- ogy, vol. 194. Academic Press, New York.

KO, C. H., Liang, H. and Gaber, R. F. (1993). Role of multiple glucose transporters in Saccharomyces cerevisiae. Mol. Cell. Biol. 13, 638-648.

Rothstein, R. (1991). Targeting, disruption, replace- ment, and allele rescue: integrative DNA transforma- tion in yeast. In Guide to Yeast Genetics and Molecular Biology. Methods in Enzymology, vol. 194. Academic Press, New York, 281-301.

Sauer, B. (1994). Recycling selectable markers in yeast. Biotechniques 16, 1086-1088.

Schwob, E., Bohm, T., Mendenhall, M. D. and Nasymth, K. (1994). The B-type cyclin kinase inhibi- tor ~40’’~’ controls the G1 to S transition in S. cerevisiae. Cell 79, 233-244.

Singer, M. S. and Gottschling, D. E. (1994). TLCI: Template RNA component of Saccharomyces cerevi- siae telomerase. Science 266, 404-409.

Thomas, B. J. and Rothstein, R. (1989). Elevated recom- bination rates in transcriptionally active DNA. Cell

Vidal, M. and Gaber, R. F. (1994). Selectable marker replacement in Saccharomyces cerevisiae. Yeast 10, I4 1-149.

56, 619-630.

for cloning steps. It also allows multiple disrup- tions to be made in the same strain without the need for multiple auxotrophic markers. It requires long and therefore expensive oligonucleotides, but in many cases the time saved is worth the expense. It is possible that at some loci, short regions of homology will not be sufficient to target integration.

ACKNOWLEDGEMENTS The authors would like to thank members of the Futcher laboratory for their helpful discussions and Cold Spring Harbor Laboratory for its con- tinued support. This work was funded by NIH grants GM45410 and GM39978 to A.B.F.

REFERENCES Alani, E., Cao, L. and Kleckner, N. (1987). A method

for gene disruption that allows repeated use of URA3 selection in the construction of multiply disrupted yeast strains. Genetics 116, 541-545.

Ausubel, F. M., et al. (Eds) (1992). Current Protocols in Molecular Biology. Greene and Wiley, New York.

Baudin, A., Ozier-Kalogeropoulos, O., Denouel, A., Lacroute, F. and Culin, C. (1993). A simple and