PLASMIDS AND STRAINS

III. PLASMIDS AND STRAINS

111.1. List of Plasmids

pRC7 This work

pRC8 This work

- 87-

111.2. List of Strains

W0-1

SNI52

RPC5l

RPC63

RPC75

RPC98

RPCI02

RPCI06

RPCIIO

RPCil4

RPCH8

RPCI22

RPCI26

RPC130

RPC132

RPC134

RPC149

RPC165

RPCI88

RPC192

RPC202

RPC206

RPC212

RPC216 This work

RPC229 This work

RPC238 This work

RPC270 'This v:ork

RPC272 This work

RPC278

RPC286 ~--~~-~~~~~ ,, .. " il_ .. -:1_!__~ __:_ .....

- ~ ·-~-~~~ ~- ~ ~ - .. BY474l MATa his3th leu2t10 met/5t10 ura3L10 lliis- Leu-~ratM!¥) : {31)

yapl.t\ (#569) BY4741 yaplt1::KanMX4 His- Leu- Ura-Mef! Open Biosystems

yap3.t\ (#954) BY4741 yap3t1::KanMX4 His- Leu- Ura· Mef Open Biosystems

hap4.t\ (#4959) BY4741 hap4t1::KanMX4 His- Leu-ura-Mer Open Biosystems

aftl.t\ (#4438) BY4741 aftlt1::KanMX4 His- Leu· Ura· Mef Open Biosystems

- 88-

111.3. List of Oligonucleotides

Primer Length Sequence Notes Locus

ONC2 42 5'-TAGAGGCACTCATGCTCACGGTT GTTCAAA TTGAAA TTCT AA 3' Primer for amplifying uptlank of CAP2 with

CAP2 uptag; -22 to -1 w.r.t ATG

ONC3 44 5'-TCAT AGCCAACACAGGGCGATGA CTT ACAGT ATGAAGT A TTTCC 5' Primer for amplifying uptlank of CAP2 with

CAP2 down tag; 1908 to 1931 w.r.t ATG

ONC4 20 5'- TGTTGTCAAGATTGTCTTGC 3' Primer for amplifying uptlank of CAP2;

CAP2 2228 to 2209 w.r.t ATG

ONC5 41 5 '-CGTGAGCATGAGTGCCTCT AACCAGTGTGATGGAT A TCTGC 5' Primer for amplifying Selectable markers from

CAP2 pSN vectors; with reverse complement of uptag 3' Primer for amplifying Selectable markers from

ONC6 41 5'-TCGCCCTGTGTTGGCT ATGA AGCTCGGA TCCACT AGT AACG pSN vectors; with reverse complement of CAP2 down tag

ONC7 20 5'- CATCAGCAAATGAAGTTGTG 5' Primer for checking CAP2 disrution; -350 to -

CAP2 369 wrt ATG -

ONC8 20 5' -AAACAAGCACTT ACTCGATG 3' Primer for checking CAP2 disrution; 2279 to

CAP2 2260 w.r.t. ATG

ONC9 27 5 '-CGGAA TTCCATGCCCGCAAAAGGTCCT-3' 5' Primer for checking CAP2 disrution; +I to

CAP2 +18 wrt ATG

ONCIO 28 5 '-GCCGCTCGGGCAGAAGCTGT AGAAGCT-3' 3' Primer for checking CAP2 disrution; + 1 to

CAP2 +18 w.r.t. ATG

ONC11 27 5'-CGGAATTCCATGAATGTTTTTACATCA-3' 5' Primer for checking CAP2 disrution; 532 to

CAP4 516 wrt ATG

ONC12 28 5' -GCCGCTCGAGTTGTCCGTTGATGCA TT A-3' 3' Primer for checking CAP2 disrution; 2279 to

CAP4 2260 w.r.t. ATG

ONCI9 20 5' -AAAGAAACAA TTTCCTTTTG 5' Primer for amplifying uptlank of CAP2; -313

CAP2 to -294 w.r.t ATG

ONC40 20 5 '-TGTTGTCT AGA TTGTCTTGC 3' Primer for CAP2; +2228 to +2209 w.r.t. ATG CAP2 ONC45 25 5'- TTTGAAgtCgACATGCCCGCAAAAG 5' PrimerforCAP2; -12 to+J3 wrtATG CAP2 ONC46 28 5 '- GcTCgAcAgAtCT A TT AT ATGCTCTTCT 3' Primer for CAP2; 1913 to 1889 wrt ATG CAP2

ONC54 18 5'-AAA ACC AAC TAC GTC TAC 5' Sequencing Primer for CAP2 in pN1M1; -61to

pN1M1 -44 wrt ATG o(CAP2

- 89-

ONCSS 18 S'-GTA AAA TT'T'CAA TCTCTC

ONC59 Z5 S'·ATQJ('H~CCCAJ\TAAA'rf'ACACAAAG C

ONC60 49

ONC86 27 5'-TAGGGCCCTAAAATAGATTAGAGATCC -3'

ONC87 46 5'- ATCTCGAGGCACGTCAGCAACGCAGATATT ATITTAATGGGTAAAC -3'

ONC89 46 5'- ATTCCGCGGGATGCGTCACCATGCTACAGAAAGTAGTI'TGAATT GA -3'

ONC90 26 5'- CTr CGA GCT CGT T AA ACA AAA TCA AT-3'

ONC115 23 5'- GCCAACA'T'ATCCATAGTTAAAGC-3' 3' Primer for Up·splitmurkcr lrlfl/1

• 90-

ONC129 20 5'- AAT TCA GAA TCA TCT CGA GC -3' 3' Primer for diagnostic PCR CAP3

ONC130 26 5'-TAACTAGTGATTACCCATACGACGTT-3' 5' Primer for amplifying 3xHA tag sequences p2382

ONCI31 26 5' -AT ACTAGTTGCAGCGT AGTCTGGGAC-3' 3' Primer for amplifying 3xHA tag sequences p2382 pFA-ARG4-

ONC132 18 5'-TTCTTCAACTTCCAAGTG-3' Sequencing Primer 3xHA tag construct MET3p-3xHA

5'-5'-primer to amplifying MET3p-driven 3xHA-

ONCI33 97 GCCACGTCGTTCCCACATTTTTTTTGGATATATACTATTAATTTTTATAACAAAC CAP2 T ACACCAAAGTGATCCCACAGAAGCTTCGT ACGCTGCAGGTC -3'

CAP2 expression cassette

5'-3 '-primer to amplifying MET3p-driven 3xHA-ONC134 97 TGAAGGTGGTGATCCTGCTATTGCAATGGGAGACGGTGCCTGTTTTGGTATAAT CAP2

ATTAGGACCTTTTGCGGGACTAGTTGC AGCGT AGTCTGGGACA -3' CAP2 expression cassette

5-5' -primer ONC166 81 CATAAATTAAATTAAAGAGCTGCAATTTATTAGATACCAAGTGAATATTAGAT

to amplifying HAH-pMAL2 CAP4

CTTTT ACAGTCTTCGT ACGCTGCAGGTC-3' expression cassette

5'-3'-primer ONC167 85 CTCGTGACTGTTAACACTCTCCGCTTTATTACTTTTTGTCCATGATGTAAAAACA

to amplifying HAH-pMAL2 CAP4

TTCATTGTAGTTGATTATTAGTTAAACCAC-3' expression cassette

ONC168 19 5'- GAT TIC TTG CTA CTG ACC C -3' 5 '-upcheck primer for dignostic PCR CAP4

5'-5' -primer to amplify cassette for 3xHA tagging ONC169 85 GAATGCAAGTTGAGGTACAATCAGTAGCCAACGTGTTACGAGAATTAGATAGA CAP2

AGAGCATATAATCGGATCCCCGGGTTAATTAA-3' at C-terminus of CAP2

5'-3 '-primer to mnplify cassette for 3xHA tagging ONC170 85 TTCAAAACGAAAAGAAAAGAAAAAAAAAACTGAAGTGTCGGAAATACTTCAT CAP2

ACTGT AAGTCAAAGAA TTCGAGCTCGTTTGGCC-3' at C-terminus of CAP2

ONC171 17 5'- TACTAACTTCGGTCTCT -3' 5 '-primer for diagnostic PCR CdHISJ ONC214 36 5'-CGTCAAGTGATGTCGATCCCAAGTGTTGATACTCCA-3' 5' -primer (Sense) for CAP2 SDM CAP2 ONC215 36 5'-TGGAGTATCAACACTTGGGATCGACATCACTTGACG-3' 3' -primer (Anti-sense) for CAP2 SDM CAP2

5'-3 '-primer for CAP4 disruption using HAH1 ONC216 83 TCACACACATACAAAAAAATAAGCAAAAAGATTCAAAATAATGTTCTGTTCTA CAP4

GTGTGTGCTGAT ATCATCGATGAATTCGAG-3' cassette

ONC223 18 5'- ATG TCG ATC CCA AGT GTT -3' 5'-primer to screen for SDM clone of CAP2 CAP2

- 91 -

RT-PCR Primers

ONC174 23 5'-CAATAAAACTGGTGGCTCCAATG·3' 5' R'T'-PCR primer fbr CAP2 CAP2

ONC175 21 5'-0CA TCTGCACATGGAATOAAA•3' I 3' RT-PCR primer for CAP.2 CAP2

ONCI76 21 5'· TPC'fCv'ltrf' ACCT~C'r~G·3' S' RT·PCR. pr1mur for SCR I SCRI

ONC177 28 5'-ACACTGATI'ACTC'i'Ji.GCGTTCACJ/\A'FfCo3' 3' lrt'·PGR primer for SCR I SCR1

ONC217 23 S'•AAAGIJ'CGTCTGAGGCAGTTGAAG•3' S' R'I'.PCR primer ll1r CSA/ CSAI

ONC218 25 5'·CnCOAAATM'CATCACCAGC'l"M'AG•3' 3' RT·PCR primer for CSA I CSA!

ONC219 21 5'-CGTTGC'ITCTGn·rcCG'fTGA-3' 5' RT·PCR prinier for RBTS RBTS

ONC220 21 5'-GGCAATGACACCACCAATAGC-3' 3' RT-PCR primer for RBT5 RBT5

ONC198 23 5'-AAGAAA'I'GG'i.ITGACGGAAGAAC-3' 5' RT-PCR primer for J-IMXI J-IMXJ

ONC199 24 5'-GAAAT ATGTCCAAGTACCCGAAAG-3' 3' RT-PCR primct-lill' 1/MXJ HMXI

ONC200 23 5'-TGTGAAAAAGTCGG'I'GTG'J'CATG-3' 5' RT-PCR primer for FET3 FET3

ONC201 26 5'-AATACCTCTAGCAGTGAAACCAGTTG-3' 3' RT-PCR primer for FET3 F£1]

ONC206 23 5'•CAG'TCGATGGCAG'ITAGTTCATG·3' 5' RT-PCR primer for FRPI FRPJ

ONC207 24 S'•CACCCT'fCTAGCAC1.JYI'GACAA'fG·3' 3' RT-PCR primer for FRP I FRf'l

ONC210 23 S'·GCCA 'IT AATCGACT'fCC1'CCAA·3' 5' RT-PCR primer forSFUI SFUI

ONC211 22 S'·<lAA'l'A 'f<LM T<JACGATG!A'r!GCA'M'G·3' 3' RT-PCR primer for SFU I SFUI

ONC208 ~ 5'tr~0-Ae'JTJTiTf'GNf<;-AGAGACCACAe3' 5' RT·PCR primer f'or ARNI ARNJ - - --

ONC209 23 5'-'r'ri'C'f'TCTTGAAATTC:CCGAA<JA·3' -

5' RT-PCRpnmcrlor/fRN/ 'AJJ]il

-92-

111.4. Construction of Plasmids for Deletion and Complementation Analyses

111.4.1. CAP2 deletion plasmid construction

Plasmid pSFS2A that harbors the SATJ flipper cassette (203) was kindly provided by

Dr. Joachim Morschhauser. As shown in Fig. III.1 (A), the SATJ flipper cassette

contains a dominant Nourseothricin resistance marker (caSATJ) for the selection of

integrative transformants and a C. albicans-adapted FLP gene under the control of

MAL2 promoter that, allows the subsequent excision of the cassette, by virtue of the

flanking FLP target sequences.

CAP2 deletion SATJ flipper cassette contained in pSFS2A was constructed in

the following way: An Apai-Xhoi fragment of the C. albicans CAP2 gene, called 5'

CAP2 (from positions -432 to + 32 with respect to start codon of the CAP2) was

amplified from SC5314 genomic DNA with primers ONC59 and PAGE purified

ONC60 and a Sacii-Saci fragment of the C. albicans CAP2 gene, called 3' CAP2

(from positions + 1872 to + 2233 with respect to the start codon of the CAP2) was

amplified from SC5314 genomic DNA with the PAGE purified primers ONC61 arrd

ONC62 using a mixture ofTaq and Pfu DNA polymerase (both from MBI Fermentas)

in a PCR reaction as mentioned below.

The reaction mixture included 1 x Taq buffer with 20 mM (NH4)2S04, 2 mM

MgCh, 0.2 mM each dNTP, 0.4 !-lM each primer, 0.25 U Taq DNA polymerase, 0.5 U

Pfu DNA polymerase and 20 ng genomic DNA in a total volume of 100 I-ll. The PCR

conditions were as follows: 94°C, 4 min (Step1), 94°C, 1 min (Step2), Ta °C, 1 min

(Step3), 72°C, 1 min (Step4), 72°C, 10 min (StepS). Steps 2-4 were repeated for 30

cycles. TheTa for 5' CAP2 was 50°C while for 3' CAP2 was 58°C.

- 93-

(A)

(B)

FllT MAL1p mFLP

s·cm FRT MAL2p caFLP

SJ/Xh p ~ I SeD Sd

• b -- I~ • .//////U?i?ZZZ/~1

•

•

ACT!t caSATI FRT

f' t¥ iscnScJ

! .-uaad220V22~ ACT!t caSATJ FRT

~1 .. 1. Sci ! I '. ~~' I'J!-0-1 -~ ·~ ua?adVZV/27~ ~·lcAP2

ACT/t ct!SATI

Fig. 111.1. Oonstr.uction of SATJ flipper disruption cassette for CA'R~ contained

in plasmid<rpRCili:il. . .

(A) Structure of the S'A'.TJ .flipper cassette contained in plasmid pS"FS~A. The C

a/bicans-adapted FLP gene (caFLP) is represented by the 1gre),r: arrow, the I

nourseothriCiniitesistance marker ( caSATJ) by the hatched ar.row, the,Md\_~2 promoter

(PM.ru) by the: bent arrow, and the transcription tennination seqpq1~e of the C

albicans ACT7l rgerie 'f:rAcw) by the filled circle. The 34-bp FLP IFeadm~~nation·target

sequences ·~RRf) ·;flank._inglfhe cassette are black arrows. Only relevant l(~tFiction sites

are given; iWlique1sites Uanking the SATI flipper: A, Apal; B, iBam:I;JJ;/ ~ Kpnl; N,

Notl; P, PsfJ; Sl, Sal~; Sci, Saci; Sell, Sacii; Xh, Xhol. @J) Stroctw;~ of the SATJ

flipper cassette Ior CAP2 deletion contained in plasmid pRCi\i:, an: intermediate

plasmid DNA which contained only 5' -CAP2 regions {caned as• \lpi~. Formaking

pRClO, we Cloned a POR amplicon containing 5'-CAP2 as a .&pai+..fJzoi fragment

into plasmid< pSFS2A cut with same restriction enzymes' present at: N;+t~nus to the

SATI flipper cassette. for details of the 5'-CAP2 regions, .refer fol the text. (q

Structure. of the SATJ ffipper cassette for cap2 deletion contam.ed in p~asmid 1pRC 11, . i

a plasmid DNLA ''which contained SATI flipper cassette flanked by 5:' fGAP2 regions

(called as upflarik) and 3'-CAP2 regions (called as downflanki. IFonrpakffig.pRCll,

we cloned a PCR amplicon containing 3 '-CAP2 as a SaoU-Sadl I fragment into

plasmid pRCIO cut with same restriction enzymes at the C-termilius of the SATJ

flipper cassette. For details of the 3 '-CAP2 regions, refer to the text. The plasmid

pRCll now has the SATI flipper disruption cassette for CAP2 wherein the whole

coding region ofthe CAP2 is replaced by SATJ flipper cassette.

-94-

The 5' CAP2 and 3' CAP2 fragments were then cloned sequentially on both sides of

the SATJ flipper cassette contained in plasmid pSFS2A using appropriate restriction

enzyme sites to generate plasmid pRC10 (with 5' CAP2 only) and pRCll (with 5'

CAP2 as well as 3' CAP2) in which the CAP2 coding region from position + 32 to +

1872 was replaced by the SATJ flipper cassette as shown in a schematic in Fig. III. 1

(B) and (C).

111.4.2. CAP3 deletion plasmid construction

Using the same strategies as mentioned above for CAP2 deletion cassette preparation,

CAP3 deletion cassette was constructed in the following way: An Apai-Xhol

fragment (positions -352 to+ 6 of CAP3) was amplified from SC5314 genomic DNA

with the primer pair ONC86 and PAGE purified ONC87. A Sacii-Saci CAP3

downstream fragment, called 3' CAP3 (from positions+ 1179 to+ 1548) was amplified

with the PAGE-purified primers ONC89 and ONC90. The CAP3 upstream and

downstream fragments were cloned sequentially on both sides of the SATJ flipper

contained in plasmid pSFS2A to generate final plasmid pRC13 in which the CAP3

coding region from position+ 6 to+ 1548 was replaced by the SATJ flipper cassette.

111.4.3. CAP2 complementation plasmid construction

Plasmids pRC20 with C. dubliniensis ARG4 as the selectable marker was constructed

to facilitate complementation analysis of cap2 homozygous disruption mutant by

targeting a wild-type version of the CAP2 gene to the RPSllocus in following ways:.

(i) Construction of plasmid Cip10-C.d.ARG4:

Plasmid CiplO (173) was kindly provided by Dr. A.J.P. Brown and it has C. albicans

URA3 ( caURA3) as selectable marker, RPSJ locus for targeted integration of

linearized plasmid after digestion with either Stul or Ncol restriction enzymes apart

from a ColEl origin of replication and ampicillin resistance gene for selection in

- 95-

bacteria. We needed the CiplO vector with ARG4 marker genes for the

complementation studies where C. albicans strain was Arg· auxotroph.

The CipiO-C.d.ARG4 plasmid was therefore constructed by swapping the caCJJ?A3

marker gene in the plasmid CiptO with C. dubliniensis ARG4 marker gene from the

plasmid pSN69 (!8'4), a kind gift from Dr. S.M. Noble. As shown in Fig. II1.2~ the

CipiO-C.d.ARG4 construction was achieved in a two-piece ligation where both the

plasmids CiplO and pS\~69 were digested with BamHI and Noti to pop out C.a.URA3

and C.dARG4 max:ker genes respectively. After gel purification and gel extr~ction

using QIAEX kit (Qiagen), both the fragments, that is vector preparation (CiplO

minus C.a.URA3) and insert preparation (C.dARG4 minus pSN69}, were ligated in a

two-piece sticky encUigation to get the Clp 10-C.d.ARG4 plasmid DNA.

(ii) PCR amplitication efthe·G4cP2 gene:

Wild type CAP2 coding region alongwith 631 bp upstream and 323bp doWnstream

was amplified usiag a temp1ate of genomic DNA isolated from olini~ isolate

SC5314, primers ONCl;~H and ONC40 and Phusion ™ High Fidelity DNA

polymerase (Finn£ymes~ to produce a blunt-end PCR product ef 2859' bp. The

reaction mixture induded b Phusion HF buffer, 0.2 mM of each dNTP, b.5 ttM of

each primer, 1.0 U PhusioaTM DNA polymerase and 40 ng genomic Dl\M~. in a total

volume of H)9 J:ti. The PCR conditions were as follows: 98°C, 4 min (St~l), 98°C,

l Osee (Step2), 50°C, 39 sec (Step3), 72°C, 1 min 30sec (Step4), 72°C, 7 min (StepS)

and Steps 2-4 were repeated for 26 cycles.

(iii) Construction of pRC20:

Blunt end .PCR product obtained from the above PCR was gel puri:fied, extracted

using QIAEX gel extraction kit from Qiagen and then ligated to Sail cut and blunted

(using T4 DNA polymerase from Fermentas) Cip10-C.d.ARG4 in a blunt end ligation

-96-

Fig. 111.2. Construction of the plasmid for CAP2 complementation.

Schematic for the construction of Clp10-C.d.ARG4, parental vector for pRC20. As mentioned in the text, BamHI

and Notl uniqe restriction enzyme sites flanking the two marker genes present in CiplO and pSN69 were used to

construct the Clp10-ARG4 in a two piece-ligation. Clp10-C.d.ARG4 now has C.dubliniensis ARG4 marker gene. A

MCS (Multiple Cloning Site) is present at the 5'- end of the RPSJlocus and Sail unique site shown in the MCS

was used to put the CAP2 gene (with 631 bp upstream and 323 bp downstream) into the Clpl0-C.d.ARG4 to obtain

pRC20 as mentioned in the text.

Bam HI

Notl BamBI

caURAJ

Apal --" Sall Bglll Ncol

Mlul

ClplO (5198 bp)

"-./ BamHl & Notl Double digestion; Ligation

pSN69 (6730bp)

Notl

Apal --~ Sall Bglll Ncol

Mlul CiplO-C.d.ARG4 (7083bp)

to get pRC20 bearing CAP2 ORF flanked by 631 bp upstream and 323 bp

downstream sequences.

The clones were screened by restriction mapping. Three independent clones were

used to transform the C. albicans homozygous cap2LYcap2LJ mutant strain and a

strain was isolated where the cap2LYcap2LJ mutation was complemented as assayed

on YPD+10% serum plates and on YPD+ 0.15mM BPS plates. The CAP2 insert in

pRC20 was sequenced completely. As the insert was 2859 bp long, we used many

primers to completely sequence the insert.

.... ONC 213

(+61)

ONC56 (+404) .... ....

ONC10 (+526)

ONC57 (+870) .... ONC81

(+ 1600) .... .... ONC58 (+1790)

) .... ONC40 (+2228)

Fig. 111.3. The strategy to sequence the CAP2 coding region with 631 bp upstream

and 323 bp downstream sequences in plasmid pRC20. The recombinant plasmid was

sequenced using all the oligos with the position of their 5 '- end nucleotide mentioned

in the cartoon. The co-ordinates of oligos are with respect to(+ 1) ATG of CAP2 ORF.

Table 111.1 Summary of sequencing of CAP2 coding region in plasmid pRC20

Oligos ID CAP2 regions Changes in the Changes in the a.a. (Start Position) covered nucleotide (Position wrt ORF)

ONC213 (+61) -31 to -630 Five changes1 Not in coding region; Also between -115 to -261 didn't map in the region with

GATA-e1ement ONClO (+526) +476 to -60 Three changes2 Y-S (45th residue)

P-L (47th residue) ONC56 (+404) +461 to +1223 One change at +774 No change; Silent mutation

(A to G) ONC57 (+870) +915 to +1445 One change at+ 1279 Pro to Ser (42in residue)

(C toT) ONC58 (+1790) +1714to+1258 With one change Same as above

common to ONC57 ONC81 (+1600) + 1650 to+ 1957 One change at +1848 No change; Silent mutation

(T to C) I Changes m thts reg10n mclude A to Cat -260, C toG at -217, an msertlon ofT at -138, A toG at -121

and C to T at -116 with respect to ATG of CAP2 coding region, where first nucleotide upstream to A of

ATG was denoted by -1. 2 Changes in this region covered by ONC10 at nucleotide level are from TAC

(encoding Tyr) to TCA (encoding Ser) at 45th residue, and from CQC to CIC at 47th residue with

respect to CAP2 ORF (634 a.a.). Interestingly, it was found that the above mentioned changes are same

as the sequences present in the second CAP2 allele, orf19.8298 in C. albicans genome.

-97-

111.5. Construction of Epitope-tagged CAP2 plasmids

111.5.1. Construction ·Ofithe Tet-regulatable CAP2::HA3 plasmid:

Plasmid pNIMl (1'99) was kindly provided by Dr. J. Morschhauser which contains a

Tet-inducible gene ~Cassette as shown in Fig. III. 4 (A). The cassette has a dbminant

selection marker, caSATJ, conferring resistance to Nourseothricin, and can be ~targeted

to the ADHJ loaus. Sall and Bglll are the unique sites that can be used to 1s¥bstitute

any other ORfs for caGFP in the vector pNIMI containing the Tet-inducible gene

cassette. Therefore, CAP2 coding region was amplified using primers ONC45 and

ONC46 as a SaU-BgllH fragment and SC5314 as template. We also decided to put an

HA3 tag sequence at .the C-terminus of CAP2 coding region to facilitate det~on of

overexpressed Capgp. For this, HA3 tag sequence was amplified using d~C5l and

ONC53 as 5' Bgllii.:Blll111at 3' fragment and p2382 as template (238). The primers

were designed sa as to preserve the reading frame of the l!!A3 tag sequ~ces with

respect to the CAP2 coding Fegion and also to introduce a step codon a~er the tag

sequence. These two fr-agments were then ligated to the SaU-BgMf fl;a~ent of

plasmid pNIMt containing the Tet-inducible gene expression cassette in a ltfuee-piece

ligation. About 24 bacter.ial U;ansformants were screened by restr.idion mapping and

pRC2 was obtained. This plasmid contains the Sali-BgHI fragment of C;lP2 coding

region fused to Satlf..:.Bglwlti .fuagment of plasmid pNIMl in a tw&-piet:e ligation.

Sequencing ofpRC2 revealed that the CAP2 coding region was extended by about 30

amino acid residues as the CAP2 stop codon was removed in the proaess, tp have the

HA3 tag sequences at its C-terminal end.

Therefore in the next round ofligation reaction, BgHI cut intcrmedi~te product

pRC2 was ligated to BgUI-BamHI cut HA3 tag sequences in a two pieee ligation

resulting in a recombinant plasmid called pRC4 containing the Tet-inducible

-98-

l

Fig. 111.4. Construction of the Tet-regulatable CAP2:: HA 3 plasmid

(A) Structure of the Tet -inducible gene cassette contained in plasmid pNIM1. Unique restriction sites that can be

used to substitute other ORFs for caGFP and to excise the whole cassette from the vector backbone are indicated.

(B) Structure of the PrccCAP2:: HA 3 expression cassette contained in plasmid pRC4 with unique EcoRI site

highlighted which was used in combination with Bglii site to screen the right clones. (Bottom) Gel picture of

Native PAGE (6%) to analyze EcoRI and Bglii double digested recombinant vectors (2, 3, 4, 6, 7, 8, 9, 12, 14, 17,

22) and parental vector (V). M1 & M2 are 1 OObp ladder and 1Kb ladder respectively.

(A)

(B)

car!TA

684bp

564bp

caSATI '-

:g J

.§-Q Q ......

A pal

3'ADHJ

A pal

TACT/ CAP2::/IA, PTet 3'ADHJ

CAP2::HA3 expression cassette. Clones were screened by restriction mapping where

EcoRI and Bglii double digestion will produce a distinguishing band of either 564bp

in parental vector (V) and recombinant clones with HA3 tag sequences ligated in

desired orientation or 684bp in the recombinant clones with HA3 tag sequences

ligated in reverse orientation (Fig. III. 4 (B)).

The transformant #4 (pRC4) was sequenced to confirm the 3xHA tag sequence in the

correct orientation and to verify any nucleotide changes using various primers shown

in Fig. III.5.

ONC54 (-61) ... +I

'-ONC56

(+404) . ... ONC57

(+870) ... @lt1fiHi{l'Jiijl22bPj

ONC81 (+ 1600) ...

.,_ ONC58 (+1689)

Fig. III.5 CAP2 coding region with HA3-tag sequenes at the C-terminus contained in plasmid, pRC4.

Sall and Bglii sites used in the cloning and all the oligos with the position of their 5 '- end nucleotide

used in sequencing are shown. Thick line around CAP2- HA3 showing vector region and co-ordinates

of oligos position are shown with respect to start codon of CAP2 coding region; + 1 co-ordinate is given

for A of ATG start codon while sequences preceded by it are given negative (-) co-ordinates and

sequences followed by it are given positive(+) co-ordinates.

Table 111.2. Summary of sequencing of CAP2-HA3 in plasmid pRC4

Oligos ID Regions covered Changes Changes in the a.a. with the position

ONC54 -36 to +768 Three changes* in nucleotide Y -S at 45th residue P-Lat 47th residue

ONC56 +551 to +1103 No change No change

ONC57 +959 to +1569 No change No change

ONC58 +1689 to+ 1192 No change No change

ONC81 +1652toendof

No change No change coding region

*Changes at nucleotide level are from TAC (encoding Tyr) to TCA (encoding Ser) at 45th residue and

from CQC to CIC at 47th residue in total length of 634 a.a. Cap2 protein. Interestingly, it was found

that the above mentioned changes are the same as the sequences present in CAP2 allele.

-99-

111.5.2. Construction :oNhe Tel-regulatable CAP2 plasmid:

In an effort to have an untagged version of CAP2 expressed under Tet-irtducible

promoter, plasmid pRC2 was cut with Bglii (restriction enzyme site present at:the end

of CAP2 coding region) and blunted (using T4 DNA polymerase from Fermen,tas) to

generate a stop coden after two amino acid residues from the last amino acid: ~esidue

in CAP2 coding region. Olones were confirmed by sequencing using oligo 0Nd81.

111.5.3. Construction,gofTet-regulatable CAP2::yEGFP plasmid:

In an effort to have yEGFP tag sequence fused at the C-terminus of CAP2. coding

region expressed under Tet-inducible promoter, plasmid pRC2 was cut with BglU and

ligated to Bgllti fr-agment of yEGFP sequences obtained from pKN85 (K. Natarajan,

unpublished). The resultant recombinant plasmid after two-piece ligatibh was

screened by restriction :mapping and the junction of ligation was con~ed by

sequencing using ONCSI to have yEGFP sequences ligated in the desired orientation.

111.5.4. Construction' oflfet~regulatable CAP2::Myc13 plaslilid:

In order to have B;xMyctag :sequence fused at the C-terminus o.f CAPl cod~g;region

expressed under Tet\..inducibte promoter, plasmid pRC2 was cut with BgDI!f and

ligated to 5' BamHt:-Bglii 3' fi::agment of Myc13 sequences (obtained from1 Rpl-2

constructed in oar Mb). The resultant recombinant plasmid after ~wo-ptece: tigat.ion

was screened by restriction mapping and the junction of ligation was oonfi$ed by

sequencing using ONC8l to have Myc 13 sequences ligated in the desired eR.en$tion.

111.5.5. Construction of the MET3p-HA3::CAP2 plasmid

Plasmid pF A-ARG4-MET3p (85) was kindly provided by Dr. Jurgen Wendland which

has a unique Spel site at the C- terminus end of MET3p sequences. We decid~ to put

HA3 tag sequences at the 3' end of METp sequences in the plasmid pFA-ARG4-

MET3p, which could then be used as a template for making MET3p-driven as well as

- 100-

N-terminal HA3 tagged CAP2 expression cassette. For this, we amplified HA3 tag

sequences using ONC130 and ONC131 as Spei-Spei fragment from p2382 as

template and Pfu DNA polymerase (from Fermentas). Spei digested PCR product of

HA3 tag sequences was then ligated into Spei cut plasmid pF A-ARG4-MET3p to get

pRC 18. The resulting plasmid pRC 18 was confirmed by restriction mapping.

111.5.6. Construction of plasmid for C-terminal 3xHA tagging of CAP2

Plasmid pFA6a-3HA-His3MX6 (151) was kindly provided by Dr. Mark Longtine and

used to prepare pRC6, pRC7, pRC8, and pRC9 to be used as templates for making

cassettes for C-terminal HA3- and Myc13- tagging of CAP2 at the native locus in

RPC51 or SN152 strain replacing one or both alleles of CAP2 gene respectively. The

plasmids were constructed as given in the schematics in Fig. III.6. The plasmid

pF A6a-3HA-His3MX6 was digested with Bg!II and Pmel unique restriction sites

flanking the His3MX6 marker gene in a sequential digestion and the desired vector

backbone fragment was gel purified and extracted from the gel piece using QIAEX

gel extraction kit (Qiagen). The plasmids pSN40 (forC.m.LEU2 marker gene) and

pSN52 (for C.d.HISJ marker gene) were first digested with Apai, a unique site

present at one end of the respective marker genes. The cut end was filled-in using T4

DNA polymerase from Fe1mentas to produce blunt ends and then cut with BamHI

unique site present at the other end of the respective marker genes in both the vectors.

The desired fragment was then gel purified and extracted from the gel pieces using

QIAEX gel extraction kit (Qiagen). A two-piece ligation using T4 DNA ligase from

Fermentas then resulted into the recombinant plasmids pRC6, pRC7, pRC8, and

pRC9 which were confirmed by restriction mapping.

- 101 -

111.6. Construction ·of r,ecoinbinant CAP2 and CAP4 expression plasmids

111.6.1. Construction 10f~GST- and 6xHis- truncated CAP2

The N-terminal CAIJ>2 coding region (+ 1 to +542 with respect to atg) including! the

DNA-binding bZIP domain (+264 to +450 with respect to atg) was PCR amplified

from SC5314 genomic DNA using primers ONC 9 and ONC 10 and recombinantiPfu

DNA pol)merase tFerrnentas) to incorporate unique restriction sites EcoRI and :Nhol

at the 5' and 3' ends of the PCR amplicon respectively. The amplicon was :gel

purified, digested with licoRIIXhol and cloned into expression vector pGEX-5X-3

(Amersham) cut with EtoR.I!Xhoi to generate an N-terminal GST fusion protein

contained in the recombinant expression vector (Ip6). The construct was vea".fi.e'dl by

restriction mapping and ;subsequently by sequencing using universal MB forward and

reverse primers. In order ter construct a 6xHis-tagged version of the Ci!tPl fusion

protein, the N-terminus 54-l base pair CAP2 coding region contained in vectorr ~p6

was subcloned into a 6xSis· rtagging vector pET28b+ (Novagen) Bsing the EadRJI and

Xhol resulting in recombinant vector (1p9).

111.6.2. Constructionof•GSlf- andr6xHis- full length CAP4

To construct GST- and 6xiffis- fun length CAP4 expression plasmid, the cemplbe

CAP4 coding region {S31 ibp~ was PCR amplified from SC5314 genomic IDN.A a~~ng

primers ONC 11 and ·ONC t:Q and recombinant Pfu DNA pol)merase (Fem1en~l to

incorporate unique restriction! sites· BooRI and Xhol at the 5' and 3' ends of the P<CR

amplicon respectively. The amplicon was gel purified, digested with EcoRI!Xhoi and

cloned into expression vector pGEX-5X-3 (Amersham) cut with the EcoRI!Xhoi to

generate anN-terminal GST .fusion protein contained in the recombinant expression

vector (Ip7). The construct was verified by restriction mapping and subsequently by

sequencing using universal M13 forward and reverse primers. In order to construct a

- 102-

Fig. 111.6. Construction of the plasmids for C-terminal tagging.

As shown and described in the schematic here, the construction of template vector to amplify cassette for 3xHA

tagging of any gene at the C-terminus in C. albicans involved the swapping of His3MX6 marker genes in the

Longtine's plasmid with the heterologous marker genes (C.m. LEU2, C. d. H!Sl and C.d. ARG4) from pSN vectors

for use in C. albicans. The subcloning involved ligation between larger Bgl!l-Pmel fragment of pFA-3HA­

His3MX6 and smaller fragment containing heterologous marker genes (C.d. HJSJ)

pFA6a-3HA-His3MX6

Bglii and Pmel sequential digestion of pFA6a-3HA-His3MX6

BamHI BamHI Apal

"' r--~~~---...:..J . •. • · • Markergeli~ • • • • • • •

pSN40/pSN52/pSN 69

Apal digestion, filled-in the end and BamHI digestion of pSN Vectors

Gel purification ofboth the fragments followed by two-piece ligation

· · · •M.arker gen¢ • • > •

pRC6/ pRC7 I pRC8/ pRC9

6xHis-tagged version of the CAP4 fusion protein, the complete CAP4 coding region

contained in vector Ip7 was subcloned into a 6xHis tagging vector pET28b+

(Novagen) using the EcoRI and Xhol resulting in recombinant vector Ip10.

111.7. Construction of plasmid with cap2A.l allele

To construct the CAP2 mutant allele with CBF domain deletion (cap2t11 allele) using

QuikChangeR II XL Site Directed Mutagenesis Kit (Stratagene, Cat #200521),

mutagenic pnmers were designed usmg Strata gene web-based

QuikChange primer design program. Primer sequences to delete CBF domain ( + 187

to +237 with respect to ATG) are as follows:

5'-CGTCAAGTGATGTCGA TCCCAAGTGTTGAT ACTCCA-3' (sense) and

5'-TGGAGTATCAACACTTGGGATCGACATCACTTGACG-3' (anti-sense).

pRC20 was used as a template for the in vitro site-directed mutagenesis reaction. The

resultant plasmid pRC45 with the mutant allele of CAP2 was sequenced to confirm

the changes and the mutated region of CAP2 was subcloned into a fresh pRC20 vector

using BsmBI and Tthllll unique sites to exclude any possibility of undesired

mutations outside the region of our interest. The resultant plasmid pRC53 with CAP2

mutant allele with HAPS-interacting domain deletion (cap2t11 allele) was sequenced

again to confirm the sequnces.

111.8. Construction of plasmid for CAP2 overexpression in yeast

We used YEplac195 (80), a high copy yeast shuttle vector to construct a recombinant

plasmid containing CAP2 coding region alongwith its 631 base pair upstream and 323

base pair downstream region for CAP2 overexpression inS. cerevisiae. The plasmid

YEplac195-CAP2 was constructed by subcloning a 2869 base pair Kpni-Xbai

fragment from pRC20 (containing CAP2 alongwith extra 10 nt from the vector

backbone) into Kpni-Xbai cut YEplac195 (5208bp). The resultant plasmid

- 103-

YEplac195-CAP2 was screened by restriction mapping and used to transform Sc

afil L1 strain to check for suppression of BPS-sensitive phenotype of the yeast deletion

mutant in iron-depleted medium.

III.9. C. albicans strain Constructions

111.9.1. Construction of CAP2L1, mutant strain

Construction ofCAP2 detetien cassette by fusion PCR technique

The fusion PCR Strategy, outlined in Fig. III. 7, uses a two-step fusion PCR protocol

that results in a disruption fragment with relatively long (~350 nt) regions of

homology with the tru:get loc1:1S. The first round of PCRs involves three separate

reactions i.e. amplification of the upstream and downstream flanking sequences of the

target gene (with a template of genomic DNA and primers 1 and 3 or 4 and 6, in

separate reactions) and the selectable marker (with cloned HISJ, LEU2, or AiRG4 and

primers 2 and 5). The mtemal PCR primers i.e. 5' tails of primers 2 and 3 ru-e

complementary, as are the 5' tai;ls of primers 4 and 5 and thus in the sec0nd ,Qr

"fusion" round of PCR, aH the three products of the first round are combined, and Ia

fusion product is amplified with primers 1 and 6.The result is a disruption fragment

with long regions ofbomol'ogy to the :upstream and downstream flanking sequences ef

the target gene.

To construct the CAP2 deletion cassette, we used fusion PCR strategy as

described previously by Noble and Johnson (184) that involves two rounds of PCR

reactions. In the first round ofPCR reactions, the CAP2 up flank sequences (313bp; -1

to -313 with respect to A TG) and downflank sequences (321 bp; + 1908 to 2228 with

respect to ATG) were amplified using Platinum pfx DNA polymerase (Invitrogen, Cat

#11708-013), SC5314 genomic DNA as template, and primers ONC1-0NC2 and

ONC3-0NC4 respectively in separate reactions. Primers ONC5 and ONC6 were used

- 104-

for amplification of selectable markers using Platinum Taq DNA polymerase High

Fidelity (Invitrogen, Cat #11304-011) with pSN52 (Cd.HJSJ) and pSN40 (CmLEU2)

as templates in separate reactions.

A

1 . Disruption of 1st Allele

5' flank 3' flank

~ X X

2. Disruption of 2nd Allele

X X

~

B 1. Amplification of Flanking Sequences and li'\ Selectable Marker ~ ,®,.

5' flank • 3' flank 350 nt ~·Ta~getrf3ene: 350 nt ~

C.d. HIS/, Cin.f.EU1, or C.d. ARG./ ~@

2. Fusion Reaction

3' "'""""'"'"' ·HIS I, LE(I2, or ARG4 5' 5' - '3'

a· '"""""""'" 5' 5' . HTSi,l.f.U:t, ot ARGI ~o---3'

Fig. 111.7. New method of gene disruption in Candida albicans with fusion PCR

and heterologous markers. (A) The new method of gene disruption is diagrammed

in this schematic. (B) Fusion PCR consists of two rounds of PCRs. In the first,

primers 1 and 3 are used to amplify genomic DNA on the 5' side of the target gene;

primers 4 and 6 are for the 3' side of the target; and primers 2 and 5 are used to

amplify the selectable marker. The red (primers 2 and 3) and green (primers 4 and 5)

primer tails represent exogenous, complementary sequences used for mutually primed

synthesis in the second round ofPCR (Adapted from 184).

The 5' tails of primers ONC2 and ONC5 are complementary, as are the 5' tails

of primers ONC6 and ONC3 because we put unique 20-mer sequences (uptag) at the

5'-end of ONC5 and its complementary sequence at the 5'-end of ONC2. Similarly,

unique 20-mer sequences (down tag) were incorporated at the 5 '-end of ONC4 and its

- 105-

complementary sequence at the 5'-end of ONC6. Thus in the second or "fusion"

round of PCR, all the three products of the first round are combined, and the fusion

product was amplified with primers ONC 19 and ONC4 using Platinum Pfx DNA

polymerase (Invitrogen) in two steps as follows.

Step 1:

Two separate reaction mixtl:.rres were prepared that included 1x Pfx amplification

buffer with 50 mM MgS04, 0.3 mM each dNTP, 1.0 U Platinum Pfx DNA

polymerase and either 3C+ ng Upflank (U) + 100 ng Selectable marker (S) or 30 ng

Downflank (D) + IOQ ng Selectable marker (S) in a total volume of 25 m each. ifhe

PCR conditions were as fGHows: 94°C, 1' (Step1), 94°C, 30sec (Step2), 40°C, 30:sec

(Step3), 68°C, 3' (Step4), St~s 2-4 were repeated for 7 cycles, the contents of l:)qth

the reactions were mixed andi the Steps 2-4 repeated again for 7 cycles.

Step II:

Another reaction mix-ture were prepared that included lx Pfx ampH,.ficatioa b~fter

with 50 mM MgS04, ~3 mM eaah dNTP, 0.6 OM each of primet"S ONCJ9 and

ONC4, 1.0 U Platinum Pfx E>NA po'l:}merase in a total volume of 50 Dt and mi~ed

with the 5001 fusion product synthesized in Stepl. The PCR conditions were 'as

follows: 94°C, 4 min {Step~), 94°C, 30 sec (Step2), 50°C, 30 sec {StepJ), 68°C, 3in!lln

(Step4), Steps 2-4 were repeated for 30 cycles. This PCR reaction contains, the

primers ONC19 and ONC4 to be able to amplify the fusion product syntbesiQ:e'di in

step I.

The resulting fusion product is the disruption fragment with long regions1 of

homology to the upstream and downstream flanking sequences of the CAP2 gene and

heterologous selectable marker genes. The genome sequences and co-ordinates of C.

- 106-

albicans (SC5314) CAP2 and its neighboring genes were obtained from Candida

Genome Database (http://www.candidagenome.org/).

Construction of CAP2LVCAP2L1 deletion mutant

To construct CAP2LVCAP2L1 mutants, the triply auxotrophic strain SN152 which is

Arg- His- Leu- was used to permit disruption of both alleles of the gene with two

auxotrophic markers; the third marker is available for introduction of a wild-type copy

of the disrupted gene for complementation analysis. Disruption constructs were

prepared with two heterologous selectable marker genes, i.e. C. dubliniensis HJSJ,

and C. maltosa LEU2. The C. albicans strain SN152 was transformed by

electroporation, as described under Section II.3 (203) with the linear fusion PCR

product in which almost all of the CAP2 ORF was replaced with one of two

heterologous selectable marker genes and ~313 base pair upstream and ~320 base pair

downstream sequences of CAP 2 were present at the 5' and 3' region of the fragment

respectively. In the first round, we transformed C. albicans strain SN152 with either

the CdHIS 1 or CmLEU2- marked disruption cassettes. The independent His+ and

Leu+ trans formants were screened by diagnostic PCR and the positive strains RPC51

(C.d. HISJ marked) and RPC63 (C.m. LEU2 marked) were used for the second round

of transformation with the CmLEU2 and CdHJSJ marked disruption cassettes

respectively. The His +Leu+ and Leu +His+ trans formants were again screened by

diagnostic PCR to ensure locus specific integration of the cassetes and the disruprion

of both the alleles of CAP2. We also checked for the absence of another copy of wild

type CAP2 by diagnostic PCR using CAP2 ORF- specific primers.

Confirmation of CAP2 deletion by PCR analysis

Genomic DNA was isolated from C. albicans strains wild type for CAP2 (+I+), either

C.d.HIS1 marked (H) or C.m.LEU2 marked (L) heterozygous for CAP2 (-/+) and

- 107-

C.d.HIS1/C.m.LEU2 mar.ked (H/L) homozygous for CAP2 (-/-) from overnight

grown culture in YEPD. PCR was done using one locus specific primer (binding! at

upstream to cassette, calted upcheck primer) and other primer binding at marker gene

(Fig. III.S A upper pane~) using genomic DNA as template. As the result showed both

heterozygous strains had specific band indicative of integration of either C.d.HIS l

marked cassette (873bp) or C.m.LEU2 marked cassette (943bp). These strains are

named RPC5l and RPC63 respectively (Fig. III.S A lower left panel~. We carried qut

a multplex PCR with boththemarker gene specific primers alongwith upcheck primer

using genomic DNA isolated from C.d.HIS 1/C.m.LEU2 marked (H/L) homozygoUs

for CAP2 ( -/-). As shown in Fig. UI.S A lower right panel, homozygous null str.ain1 (or

CAP2 resulted in two bands, indicative of both the alleles of CAP2 gene been

replaced by disruption cassette. V.fe named this strrun RPC75. Next, to confir.m iliat

no more CAP2 wild type, copy is remaining in RPC75 (-/-), we carried out a PQR

analysis using CAP2 OR.lF specific pt:imers and genomic DNA isolated from \\it'd type

CAP2 (+/+), RPC75 (-/-}, and iliree independent transformants of hetero-zygp"Us

strains. As shown in the Fig. UI.S B, no CAP2-specific band was obtained in RPCC75

(-/-)strain while a band o.f expected size (1.38 Kb) was seen in case of witd ~e. as

wel1 as heterozygous str.aias. The results of the screening and the logic behirid

selection of fusion PCR technique for gene disruption will be discussed m rn~te

details under Section V.2.

111.9.2. Construction of·C1:1P2 complemented strain

pRC20 was used to facilitate complementation analysis of the homoeygelis

cap2Lilcap2t1 RPY75 strain by targeting a wild-type version of the CAP2 gene to llie

RPSJ locus, with C. dubliniensis ARG4, as the selectable marker. To target the

integration of pRC20 to the RPSJ locus, the plasmid was first digested with Stul,

- 108-

Fig. 111.8. PCR analysis of wild type, heterozygous, homozygous cap2A null mutant strains for CAP2 in

SN152 strain background.

(A) The cartoon in the upper panel shows the structure of disruption cassettes bearing heterologous marker genes

constructed using fusion PCR technique for the disruption of one or both alleles of CAP2. The arrow shows the

position of upcheck primer ONC7 (in 5' CAP2) and either of C. dubliniensis HISJ or C. maltosa LEU2-specific

primers ONC30 and ONC33 respectively. Gel picture in the lower left panel shows the absence ofPCR product in

wild type strain ( +/+) while presence of specific, intense band of expected sizes in heterozygous strains ( +/-) that

are either C.d. HISJ marked (H) or C.m. LEU2 marked (L). Gel picture in the lower right panel shows the presence

of two bands indicating both the alleles of CAP2 being replaced by C.d. HISI-marked and c:m.-LEU2 marked

disruption cassettes (H/L) resulting in homozygous null mutant strain for CAP2 (-/-). M= marker. (B) The cartoon

in the upper panel here depicts the position of primers ONC56 (forward) and ONC58 (reverse) in the CAP2 ORF.

The gel picture in the lower panel shows the presence of PCR amplicon of the desired size in the wild type ( +/+)

and three independent transformants of CAP2 heterozygous strains (-/+) but PCR amplicon is absent in the

homozygous null mutant strain(-/-). M=marker (lKb ladder).

(A) ... Allele 1 (B)

+ 5' CAP2 3' CAP2 I > CAP20RF

Allele 2 .. +-

M +/+ -!+ M -/+ -1- M +I+ -I- -/+ M

943bp 873bp 1.38Kb .....

873bp

Fig. 111.9. Diagnostic PCR to check integration of pRC20 in the complemented (cap2Aicap2AICAP2) strain.

(A) The mechanism of integration event of Stui cut pRC20 at RPSJ locus. Location of the PCR primers is shown,

while (B) Gel analysis of PCR amplicons: Lanes 1 and 2 with ONC56/0NC145 and Lanes 3 and 4 with

ONC56/0NC58 where samples in Lanes 1, 2, 3, and 4 are cap2i1/cap2i1/CAP2, cap2i1/cap2L1,

cap2i1/cap2i1/CAP2, and CAP2/cap2L1 respectively. M is marker (lKb ladder, Fermentas). 1Kb, 2Kb and 3Kb

bands ofthe 1Kb ladder are marked with arrow.

Homologous recombination ONC56

l tCaRPSJ

2.83Kb

..­ONC145

(B) 1 2

ONCs61 ONC14S

M 3

ONCS6/ ONCS8

4

which cuts uniquely within the RPSI sequence and thus separates theN- terminus and

C-terminus of the gene to facilitate homologous recombination at the two ends

required for integration. About 0.5J.!g of Stu! cut linearized vector was transformed

into RPY75 strain by electroporation as mentioned the Section II.3 and Arg+

transformants were selected on SD only plate (as the RPY75 strain was already

marked with HISI and LEU2 marker genes in the process of disrupting both CAP2

alleles). The transformants were streaked out to obtain clonally pure colonies and

diagnostic PCR was performed using genomic DNA from several transformants to

confirm the targeted integration of the cassette and the re-insertion of wild type

version of CAP2 gene.

Confirmation of integration of CAP2 gene at RPSI locus:

The Fig. III.9. shows the integration events of the cassette and results of the PCR

analysis to confirm the targeted integration as well as the presence ofwild type CAP2

gene in the complemented strain. PCR was carried out using primers ONC56 (5'­

primer binding to the CAP2 coding region) and ONC145 (3 '-primer binding to the 3'

UTR of RPSllocus) with genomic DNA from independent transformants as template

to verify the insertion of pRC20 into the RPSI locus. As expected, an amplicon of

~2.83 Kb was observed. The presence of CAP2 ORF was further confirmed by

another PCR using primers ONC56 and ONC58, which amplify within the CAP2

coding region resulting in an amplicon of~ 1.38Kb as expected.

III.9.3. Construction of cap2L1 cap3L1 double mutant strain

The C. albicans RPC75 (cap2L1/cap2L1) strain was transformed by electroporation

with an Apai-Saci fragment from plasmid pRC13 in which almost all of the CAP3

ORF was replaced by SATI flipper. The linear DNA fragment was purified by agarose

gel electrophoresis, excised and extracted with the QIAEX II gel extraction kit

- 109-

(Qiagen, Cat #20021) prior to the transformation. The NouR transformants were

obtained after one day of growth on YPD agar plates containing 200J..1g(mL of

nourseothricin at 30°C. Resistant colonies were picked and directly used to inpculate

in YPD liquid medium containing 200J..1glmL nourseothricin for genomic DNA

isolation. We analysed 8 transformants for correct integration by diagnostic P<CR and

observed an efficiency of -75%. One positive NouR transformant, in which the SATJ

flipper had disrupted one of the CAP3 alleles (RPC114, Fig. III.lO.B, lane 2) was

grown in YPD liquid medium without nourseothricin for 6-8h to allow fer: FLP­

mediated excision of the SATJ flipper cassette. The cell density of the cultUre was

determined by rneasur.ing absorbance at 600nm and a more accurate count made by

haemocytometer. CeUs were diluted and approximately 100 cells were plated onto

YPD plates containing 25J..1g(mL of nourseothricin. Nou5 strains can grow on YPD

plates containing 25:J.!gl.mL ef nourseothricin, but at a slower rate ilian NouR

transformants. This enabled convenient detection ofNou5 derivatives based on slllaller

colony size as compared with their NouRparenta1 strains. ~15-20 colonies out of 100

were found to be Nou5• PCR verification confirmed the absence of SATJ flipper

cassette in the Nou5 derivatives as a PCR using caSATJ-specific primer gave no

amplification (RPC 118, Fig. 111.1 O.B, lane 3 ). Next, the RPC 118 was used to disrupt

the remaining wild type allele of CAP3 by the same procedure of integration and

subsequent excision of the SATJ flipper to construct cap3.t1 null mutant in cap2.t1 null

background.

Confirmation of CAP3 deletion by PCR

The construction of NouR derivatives, and absence or presence of a wild type CAP3

ORF after second round of CAP3 disruption was confirmed by diagnostic PCR. As

shown in Fig. III.lO.C, various NouR derivatives obtained after second round of

-110-

Fig. 111.10. CAP3-disruption SATJ flipper cassette and verification of its targeted integration.

(A) Structure of the CAP3-disruption SATJ flipper cassette contained in plasmid pRC13. Location of the PCR

primers is shown which were used to do diagnostic PCR while, (B) and (C) shows the gel analysis of PCR

amplicons obtained using ONC102-0NC66 and ONC102-0NC129 respectively: In both the gel images, loading

order is as follows: Lanel: PCR with SN152 genomic DNA template, Lane 2 and 3 are PCR with genomic DNA

isolated from RPC114 (NouR transformants obtained after first round of transformation) and RPC118 (Nous

transformants obtained after first round of transformation and SATJ flipper excision). Lanes 4 to 13 are PCR with

genomic DNA template isolated from ten NouR transformants obtained after second round of transformation. M is

marker (lKb ladder, Fennentas).

(A)

(B)

ONC102 A

- -~--- I II • Sen Sci

I IV/////////////////////~ol· ..... --__,1 l 5' CAP3

I I I I

' I ', I ' I I

+­

ONC66

_ I3 'CAP3

......... :,'' ... ... , ,

"',- ... -... -~ ~

--------~:----~]-------crAMPnJ~ai~Ie~Ie~InJ2-----~>I~~-----~~------------­+-

ONC129

(C)

1 2 3 4 5 6 M 7 8 9 10 11 12 13 1 2 3 4 5 6 M 7 8 9 10 11 12 13

1.13 Kb 995 bp

integrative transformation were confirmed using ONC102 and ONC66 (lanes 4 to 13).

Lane 1 had the genomic DNA sample isolated from SN152. As the result indicated

~80% of the NouR derivatives had SATJ flipper integrated at correct locus. Next, we

checked for the absence or presence of a wild type CAP3 using CAP3 ORF-specific

primer (ONC129) alongwith ONC102. Five out of the ten NouR derivatives screened

after the second round of transformation did not have CAP3 ORF indicating that both

the alleles of CAP3 gene were disrupted (Fig. III.lO.C, lanes 4, 5, 10, 11, and 12). We

also found that some ofthe NouR derivatives after second round of transformation still

had intact CAP3 ORF indicating that probably in such cases the SATI flipper had

gone to the same locus which was disrupted in first round (Fig. III.10.C, lanes 6, 7, 8,

9, and 13). This is likely because the same site of recombination is present at the loci

of both CAP3 alleles. Lanes 1, 2 and 3 are positive control representing parental

strain, NouR derivative, and Nou8 derivative from the first round of transformation.

We also confirmed the Nou8 derivatives after second round of transformation by PCR

(data not shown).

111.9.4. Construction and verification of CAP2L1 null mutant ofW0-1 strain

The C. albicans W0-1 (CAP2/CAP2) strain was transformed by electroporation with

an Apal-Sacl fragment from plasmid pRCll which almost all of the CAP2 ORF was

replaced by SATI flipper. The linear DNA fragment was purified by agarose gel

electrophoresis, excised and extracted with the QIAEX II gel extraction kit (Qiagen,

Cat #20021) prior to the transformation. The NouR transformants were obtained after

one day of growth on YPD agar plates containing 200J..Lg/mL of nourseothricin at

30°C. Resistant colonies were picked and directly used to inoculate in YPD liquid

medium containing 200J..Lg/mL nourseothricin for genomic DNA isolation. We

analysed 12 transformants for correct integration by diagnostic PCR and observed

- 111 -

-80% efficiency. One of the NouR transformant, in which the SATJ flipper was

integrated in one ohhe CAP2 aHele (RPC98, Fig. III.11.B, lane 2) was grown in YPD

liquid medium without nourseothricin for 6-8h to allow for FLP-mediated excision of

the SATJ flipper cassette. The cell density of the culture was determined by measUring

absorbance at 60@run and a more accurate count made by haemocytom:eter.

Approximately 100 ceUs were plated onto YPD plates containing 25J.lg/mL of

nourseothricin. Nou5 strain can grow on YPD plates containing 25J:.lg/rnL of

nourseothricin, but at a slower rate than NouR transformants. This enabled a

convenient detection e.f Nou5 derivatives by their smaller colony size as compared

with their NouR parentm strains. -15-20 colonies out of 100 were found te be, 1Nou5•

PCR verification confilmed the absence of SATJ flipper cassette in Nou5 derivanye as

the PCR using caSATJ-specific pcimer gave no amplification (RPCJ,62, Fig. m.ll.B,

lane 3). Next, the strain. R!PC~i@2 was used to disrupt the remaining wild cype aMele of

CAP2 using the same procedure of integration and subsequent excision of the SATJ

flipper to make cap2Naap2 4 strain of W0-1.

Confirmation of CA<P2~ deletion jn W0-1 strain by PCR

The construction of NouR derivatives, and absence or presence of a wiitd type CAP2

ORF after second round of CAP2 disruption was confirmed by diagnostic PCR. As

shown in Fig. HLI LB, various NouR derivatives obtained after second round of

integrative transformaiion were confirmed using ONC101 and ONC66 (lanes 4·tt:> ll).

Lane 1 had the genomic DNA sample isolated from SC5314. -90% of the INouR

derivatives had SATJ flipper integrated at correct locus. Next, we checked for the

absence or presence of a wild type CAP2 using CAP2 ORF-specific primers (ONC56

and ONC58). Two out of the seven NouR derivatives screened after the second round

of transformation did not have the CAP2 ORF indicating that both the alleles of CAP2

- 112-

Fig. 111.11. CAP2-disruption SATJ flipper cassette and verification of its targeted integration.

(A) Structure of the CAP2-disruption SATJ flipper cassette contained in plasmid pRC11. Location of the PCR

primers is shown which were used for diagnostic PCR while, (B) and (C) shows the gel analysis ofPCR amplicons

obtained using ONC101-0NC66 and ONC56-0NC58 respectively: In both the gel images, loading order is as

follows: Lanel: PCR with SC5314 genomic DNA template, Lane 2 and 3 are PCR with genomic DNA isolated

from RPC98 (NouR trans formants obtained after first round of transformation) and RPC 102 (No us trans formants

obtained after first round of transformation and SATJ flipper excision). Lanes 4 to 11 are PCR with genomic DNA

template isolated from eight NouR transformants obtained after second round of transformation. M is marker (1Kb

ladder, Fermentas).

(A) ONC101 A

--~-- - I l 5' CAP2 ' ' ' '

' ' - ~

' ' '

+­

ONC66

ONC56

Sell Sci

JI/////7///V///.//////ff~..J· .... -----' 13'CAP2 I

' '

--------~------Jt======:~ccAnP~2~alliue~Ie2I~/2L:===~~Lr ____ _L ______________ _

+-

ONC58

(B) (C)

1 2 3 4 5 M 6 7 8 9 10 11 1 2 3 4 5 M 6 7 8 9 10

1.3 Kb

11

-1.38Kb

Fig. 111.12. Verification of PTerdriven epitope-tagged and untagged CAP2 expression strains.

The upper panel shows the structure of the Tet-inducible CAP2 expression cassette, which was integrated to the

ADHJ locus of the RPC51 strain. The 5'-primers ONC103 (binding to PTet region) and 3'-primer ONC104

(binding to 3'-UTR of ADHJ locus) are depicted, which were used in diagnostic PCR to verify the targeted

integration of various Tet-inducible CAP2 expression cassettes at correct locus. The lower panel shows the result

of diagnostic PCR. Only three NouR-transfonnants with CAP2: :3xHA under PTet are shown which produced an

expected 1.08 Kb band.

PADHI cartTA

M 1 2

caSATI

3

TACT/ CAP2

1.08 Kb (pTET-CAP2)

ONC103 Sail __. A pal

Kpnl

- ··- ··- ·· - ··

PTet 3'ADHJ +-

ONC104

1.08 Kb

gene were disrupted (Fig. III.ll.C, lanes 7 and 8). We also found that some of the

NouR derivatives after second round of transformation still had the intact CAP2 ORF

indicating that probably in such cases the SATJ flipper had gone to the same locus

which was disrupted in the first round (Fig. III.ll.C, lanes 4, 5, 6, 9, 10 and 11). This

is likely because the same site of recombination is present at the loci of both CAP2

alleles. Lanes 1, 2 and 3 are positive control representing parental strain, NouR

derivative, and Nous derivative from the first round of transformation. We also

confirmed the Nous derivatives after second round of transformation by PCR (data not

shown).

111.9.5. Construction of PrerCAP2 strain

The C. albicans RPY75 (cap2.11cap2L1) strain was transformed by electroporation

with a Kpnl-Sacii fragment from each of the plasmids pRC4, pRC14, pRC19, and

pRC25 containing CAP2-HA3, CAP2-yEGFP, CAP2 only, and CAP2-Myc13

respectively. The linear DNA fragments of different CAP2 variants under pTET­

regulation were excised and purified by agarose gel electrophoresis and extracted with

the QIAEX II gel extraction kit (Qiagen, Cat #20021) prior to the transformation. The

NouR transformants were obtained after one day of growth on YPD agar plates

containing 200j..tg/mL of nourseothricin at 30°C. Resistant colonies could be picked

and directly used to inoculate in YPD liquid medium containing 200j..tg/mL

nourseothricin for genomic DNA isolation. We analysed 12 transformants for correct

integration by diagnostic PCR using ONC103 and ONC104, which binds to Pret and

3'-UTR of ADHJ (Fig. III.l2, upper panel). We observed ~1.08 Kb band of expected

size (Fig. III.l2, upper panel). We obtained ~80% efficiency of targeted integration at

the correct locus although only 3 representative independent transformants (1, 2, 3)

are shown. Four NouR transformants from each variant were saved and tested for their

- 113-

ability to grow on iron-deficient medium as a functionality test for the CAP2

overexpression.

III.9.6. Construction of PMETrCAP2::HA3 expression strains

The PMm-driven N-terminal HA3-tagging-cassette was amplified using long primers

designed to generate amplicons flanked by sequences homologous to the gene of

interest. For CAP2, forward primer ONC133 was used with reverse primer ONCl34.

These are 97 mer oligonucleotides (synthesized from IDT and PAGE purified inithe

lab on DEAE-Sepharose column) wherein the first 75 bases from the 5' end of

ONC133 correspond to the gene sequence and next 22 are same as the 'Sl primer' as

recommended (85) willie ·first 72 bases from the 5' end ofONCB4 correspond to the

gene sequence and the. nex:t 25 correspond to the HA3 tag sequences. pRClr8 was used

as the template in the PCR ""~th the Platinum Pfx DNA polymerase (mvitrogen)

enzyme system as fo)lews:

The reaction mi.;x:4Ure inctuded 2x Pfx amplification buffer with 5@ mtv1

MgS04, 0.3 mM each d~~P,,®.4 pM each ofprimers ONC133 and ONCl34, 8@5qg

of plasmid DNA template and 2.5 U Platinum Pfx DNA polymerase in a totalr vol~e

of 100 J:ll. The PCR conditions were as follows: 94°C, 2 min (Stepol), 94:oc, t5sec

(Step2), 45°C, 30sec (StepB), 68°C, 3 min 30sec (Step4), 94°C, 15see (Step5), "68~C,

30sec (Step6), 68°C, 3 min 3@sec {Step7), Steps 2-4 were repeated fm 5 cycles and

then Steps5-7 were repeated for1 the Sllbsequent 25 cycles.

The amplicon was analyzed on a 0.8% agarose gel to check its specificity and

intensity. It was then purified by agarose gel electrophoresis, the co:r:rect band excised

and extracted with the QJAEX .'tl gel ex-traction kit (Qiagen, Cat #20021). Thepurifiedl

amplicon was quantified on agarose gels with the help of known amount of DNA

standards (data not shown) and ~0.5Jlg DNA was used to transform C. albicans strain,

- 114-

RPC51. Transformants were selected on synthetic deficient medium lacking arginine

and histidine, as the integration of the cassette in the chromosome would result in

arginine and histidine prototrophy. The homologous regions in the amplicon

correspond to the CAP2 sequence immediately before and immediately after the start

codon, resulting in integration at theN-terminus of CAP2 ORF, thus replacing the

native promoter by the MET3p-driven HA3-tagged-cassette. Transformants were

analyzed by diagnostic PCR using ONC132 (binding to HA3 region) and ONC58

(binding to CAP2 ORF) to verify the targeted integration of the cassette at the correct

locus (refer to Fig. III.13, upper panel).

CAP20RF

..

1971 bp (pMET3-HA3:: CAP2)

Fig. 111.13. Verification of PMETJ-driven N-terminal 3xHA-tagged CAP2

expression strains.

The upper panel shows the structure of the PMETJ-driven N-terminal 3xiiA-tagged

CAP2 expression cassette, which was amplified using long oligos with about 70 nt

homologous sequences for site of integration. The cassette was integrated to the N­

terminus to the start codon of the CAP2 gene in the RPC51 strain. The 5'-primers

ONC132 (binding to 3xHA region) and 3'-primer ONC58 (binding to CAP2 ORF) are

depicted, which were used in diagnostic PCR to verify the targeted integration of

PMETJ -driven N-terminal 3xHA-tagged CAP2 expression cassette at correct locus.

The lower panel shows the result of diagnostic PCR. Three out of five Arg+­

transformants with CAP2::HA3 expression under MET3 promoter, which produced an

expected 1.971 Kb band are shown.

- 115-

We screened 24 independent transformants and could obtain 8 transformants with

targeted integration at right locus (see the Fig. HI.13, lower panel where five

representative t:ransformants are shmvn). The transformants were saved and tested for

their ability te grow on iron-deficient medim plate as a functionaiity te5t for the CAP2

overexpressing strains.

111.9.7. Construction of C-terminal3xHA epitope-tagged CAP2 strains.

The HA3-tagging-cassette was amplified using long primers that were designed so that

the amplicon is flanked by sequences homologous to the gene of interest. For CAP2,

forward primer ONC169 was used with reverse primer ONC170. Trllese are 85 mer

oligonucleot.irles (synthesized from IDT and PAGE purified in the ~lab on DEAE­

Sepharose oolumn) wherein the first 65 bases from the 5' end cor+es;IJ;Ond to the gene

sequence and next 20 bases are the same as either 'F2 primer' in caSe ofONC169 or

'Rl primer' in case of ONC170 as recommended (151). The PCR was done using

pRC6 (with C.m. LEU2 marker gene) as template and Phusion High Fidelity (HF)

DNA polymerase (finnzyrne) enzyme .system as follow.s:

The reaction mixture included lx Phusion HF butTer, 0.:2 mM of each dNTP,

0.5 ~ each of primers ONC 169 and ONC 170, 1.0 U Phusion'W PNA polymerase

and 100 ng linearised p]asmid DNA as template in a totai volmne. ef t~O Jll. The PCR

conditions were as foHows: 98°C, 4 min (Step I), 98°C, lOsee (Step2), 48°C, 30sec

(Step3), 72°C, I mill 36sec (Step4), 98°C, !Osee (StepS), 60°C, :38set (Step6), 72°C,

1 min 39sec (Step7), Steps 2-4 were repeated for 5 cycles and then Steps5-7 were

repeated for the subsequent 25 cycles.

The amplicon was analyzed on a 0.8% agarose gel to check its specificity and

intensity. It was then purified by agarose gel electrophoresis, the specific band was

excised and extracted with the QIAEX II gel extraction kit (Qiagen, Cat #20021 ).

- 116-

Figure 111.14. Construction and Verification of C-terminal 3xHA epitope-tagged CAP2 expression strains

(A) Schematic diagram showing the strategy for C-terminal 3xHA epitope-tagging of CAP2 gene. 1. The plasmid

pRC6 containing 3xHA cassette was used as template for PCR amplification using long primers containing the

homologous region (represented by the overhang in the diagram on the top) for CAP2 gene. For introducing the

cassette at the C-terminus of CAP2, region included in the forward primer was the DNA sequence just before the

termination codon whereas that in reverse primer, it was just after the termination codon of CAP2 gene. 2. and 3.

The linear amplicon was used to transform C. albicans strain RPC51 where the homologous recombination will

lead to integration at CAP2 locus. The resultant Leu+ transformants could be selected on synthetic deficient

medium plate lacking leucine and histidine. The 5'-primers ONC81 (binding to CAP2 ORF) and 3'-primer

ONC106 (binding to C.m. LEU2 region in the cassette) are depicted, which were used in diagnostic PCR to verify

the targeted integration of 3xHA tagging cassettes. (B) The gel picture shows the result of diagnostic PCR. Four

out of six Leu+ transformants with CAP2::HA3 expression under native promoter, which produced an expected 1.2

Kb band are shown.

(A)

3. Homologous recombination

ONC81 _.

pRC6

!1. Amplification of the module for C-terminal HA 3 tagging of CAP2

···············

! 2. Transformation in RPCSl

! 'Stop codon

CmLEU2

(B)

123456M

ONC106

1.2Kb

1.2Kb (CAP2 ::HA)

The purified amplicon was quantified on agarose gels with the help of known amount

of DNA standards (data not shown) and ~0.5)lg DNA was used to transform C.

albicans strain, RPC51. Transformants were selected on synthetic deficient medium

lacking leucine and histidine, as integration of the cassette in the chromosome would

result in leucine and histidine prototrophy. The homologous regions in the amplicon

correspond to the CAP2 sequence immediately before and immediately after the stop

codon, resulting in integration at the C-terminus of CAP2 ORF replacing the native

CAP2 by the CAP2::HA3 copy (See Fig. III.14. (A) for the integration events).

Transformants were analyzed by diagnostic PCR using ONC81 (binding to CAP2

ORF) and ONC106 (binding to C.m.LEU2 marker gene) to verify the targeted

integration of the cassette. We screened eight independent transformants and could

obtain five transformants with targeted integration at the correct locus (see the Fig.

III.14. (A)) where five representative transformants are shown, of which only one is

negative). The transformants were saved and tested for their ability to grow on iron­

deficient medium as a functionality test for the CAP2::HA3 strains.

111.9.8. Construction of PMALrregulatable CAP4 strains

HAH1-PMAL2 cassette for CAP4 expression:

Plasmid HAH1-PMAL2 , a generous gift from Dr. K. Ganesan, was used as a template to

amplify the HAH1-PMAL2 cassette for PMALrregulatable expression of CAP4

employing a combination of split-marker strategy and HAHl cassette. The split

marker strategy requires the amplification of the cassette in two fragments that

contain overlapping regions of the ARG4 selectable marker. To amplify the HAH1-

PMAL2 cassette, we used ONC166/0NC115 to give the up-split fragment and the

ONC114/0NC167 to give down-split fragment. Both up-split and down-split

fragments have about 1.07 kb overlapping region of the ARG4 selectable marker and

- 117-

is flanked by 60 nt homology to the site of integration at both ends. After

transformation, the hiighly recombinogenic ends of the up-split and dov.lll-split

fragments will recombine to recreate a functional ARG4 gene in vivo that is ~ed as

the selectable marker. The 60 bp homology regions at the ends of the transforming

DNA would help to target the cassette to the CAP4locus.

The HAHJ cas~:ette also contains derivatives of hisl/13' and his] !D' flarik:ing

the intact ARG4 gene. The HISI segments are nonfunctional, so the HAHJ cassette

confers an Arg+ His- plrenotype. The two HISJ segments share 354 bp ofhomdlogy

and can thus recombine to yield an intact HISJ gene. This recombination exciseS the

ARG4 gene and resrilts in an Arg- His+ phenotype. By either a mitotic recembmation

or a gene conversion e,lP"ent, the HAH cassette from one allele is integrated info: the

second aHele. Conseq1Jent to this integration, the cells become Arg.._ His.._ uponi the

recombination of MsJA3' and his:JA5' regions. Therefore, both the alleles ef a r~ene

of interest can be replaced by a single transformation using HAHl cassette.

Construction of PMAu-Cd'PlJJC. albiaans strain:

As mentioned above, the HAH1-P~t~AL2 cassette for regulatable expression Gf CAP4

was amplified in two fragments, namely, Up-split and down-split. The up-split and

down-split fragments of lllABJ- PMALZ cassette for CAP4 were amplified using pR:rner

pairs ONC166-0NCH5 and ONCi l4-0NC167 respectively, plasmid HiAHi-PMlf!2i as

template and Phusion BF DNA polymerase (Finnzyme) enzyme system as follows:

Two separate reaction m~xtures were prepared including 1 x Phusion HF buffer, Q.2

mM of each dNTP, 1.6 U PhusionliM DNA polymerase, 5 ng linearised plasmid DNA

as template and 0.5 f1M .each of either primer pair ONC166-0NC115 or ONC~'6'~-

0NC114 in a total volume of 100 ~1 for each reaction. The PCR conditions were as

follows: 98°C, 4 min (Stepl), 98°C, lOsec (Step2), 48°C, 30sec (Step3), 72°C, 1 min

- 118-

Figure 111.15. Construction of MAL2 promoter regulated CAP4 (PMAL2-CAP4)

(A) Conversion of HAHJ to HISJ. The HAHJ marker (top) comprises an intact ARG4 gene flanked by HISJ deletion derivatives hisl/13' and

hisl/15'. The HISJ segments are nonfunctional, so the HAHJ cassette confers an Arg+ phenotype. The HISJ segments share 354 bp of homology

and can thus recombine to yield an intact HISJ gene. Recombination excises the ARG4 gene and results in an Arg· His+ phenotype. (B) Anticipated

use of HAHJ to select for homozygous mutants with both alleles of CAP4 under regulatable expression of MAL2 promoter in SN152 strain. One

allele of CAP4 is disrupted with a HAHJ- PMALl insertion through transformation and selection for an Arg+ phenotype. The HAHJ- PMAL2 cassette

will replace the native promoter of CAP4 gene and as a result CAP4 expression will be regulated by MAL2 promoter. Growth of the Arg+ His­

transformant in YPM overnight will then yield rare recombinant segregants in which the HAHJ insertion allele is homozygous. Such segregants

may be selected after they undergo recombinational excision within one HAHJ cassette to yield a unique Arg+ His+ phenotype. (C) Diagnostic PCR

to verify the targeted integration of the PMAu-regulatable expression cassette for CAP4. The upper panel shows the gel picture of PCR analysis to

verify the heterozygous mutant (CAP4/cap4::HAHJ-PMAL2-CAP4) using ONC168 (binding at upstream to the site of integration in CAP4 5'-UTR)

and ONC115 (binding at a region of C.a.ARG4 gene in the HAHJ cassette). The samples in lane P is genomic DNA template used in PCR from

parental strain SN152 while Lanes T1, T2*, T3, and T4 are genomic DNA template used in PCR from various independent transfonnants of

heterozygous mutant strains. Lane M is 1 Kb DNA ladder. T2* was subsequently used for constructing the homozygous PMAu-CAP4 strain. The

lower panel shows the gel picture ofPCR analysis to verify the homozygous mutant (cap4t1::HISJ- PMAu-CAP4/cap4t1::HAHJ- PMAu-CAP4) using

ONC 168 (binding at upstream to the site of integration in CAP4 5 '-UTR) and ONC 12 (binding at a region of CAP4 ORF). The samples in lane P is

genomic DNA template used in PCR from parental strain SN152 while Lanes T2* is the genomic DNA template used in PCR from parental

heterozygous mutant strains, and T1, T2, and T3 are genomic DNA template used in PCR from various independent transformants ofhomozygous

mutant strains. Lane M is 1 Kb DNA ladder. T1, named RPC229 was used for further analysis.

(A)

ONC166 -- -......_...

HAH-pMAL2 cassette

ONC114 !---+

ARG4

~

ONC115

........ ~ ·.·.· ·. · . ·.·.·. ·.·.·.·.·.·.·.·.·. . . . . . . . . ~ . ........

pMAL2

.................. ONC167 Arg+ His-

Intra-chromosomal recombination 1 1 hisR= 354bp

(B)

E] ......... ,· :.·-:. ····.<·

' .. · .. · .·.·.·.· ' ... ' .....

pMAL2

Arg- His+

Arg· His· Leu· CAP4 (+/+)

(C)

CAP4/cap4£1: :HAH l­pMAL2-CAP4

! Step 1: Transformation

Arg+ His· Leu· CAP4 (+/-)

cap4£1: :H/Sl-pMAL2-CAP41 cap4£1: :HAH l-pMAL2-CAP4

----Gfi#1E:~ .. ~,_ .... ~---

! Step2: Gene conversion

----tsa+.::=ll.:~ ...... r--­

~~---­! Step3: HIS 1 recombination

----1!1.1.11 - -·-----e£35!111:=,. .... _. __ _

Arg+ His· Leu· CAP4 (-/-)

Arg+ His+ Leu· CAP4 (-/-)

Wild type CAP4

· P T 1 T2* M T3 T 4

p T2* M Tl T2 T3

30sec (Step4), 98°C, lOsee (StepS), 60°C, 30sec (Step6), 72°C, 1 min 30sec (Step7),

Steps 2-4 were repeated for 5 cycles and then Steps5-7 were repeated for the

subsequent 25 cycles.

The 81 bp ONC166 and 85 bp ONC167 oligonucleotides have 18 bp and 28

bp corresponding to 'common vector primer for pFA backbone (Vl)' and 'MAL2

promoter primer' respectively as recommended (K. Ganesan, unpublished data). The

amplicons were analysed, purified by ethanol precipitation and quantified.

Approximately, l.5J.!g of the purified amplicons each from up-split and down-split

was used for transformation into C. albicans strain SN152 by electroporation as

mentioned earlier. A strain bearing PMAu-CAP4 allele in the parental strain SN152

could be constructed three steps as shown in Fig. III. IS. (B). One allele of CAP4 was

disrupted by the HAHJ- PMAL2 insertion through transformation and selection for an

Arg+ phenotype on synthetic deficient medium lacking arginine. We obtained ~100

colonies from the entire transformation mix. The Arg+ His- transformants were

maintained on YPM medium and inoculated in YPM liquid media overnight to isolate

genomic DNA. The diagnostic PCR was done using ONC168 (binding upstream to

the site of integration in CAP4 5'-UTR) and ONC115 (binding in a region of

C.a.ARG4 gene in the HAHJ cassette). PCR verification showed targeted integration

at the correct locus in 7 transformants out of 32 screened. (Fig. III.15.C, upper panel;

only four representative Arg+ His- transformants are shown). One Arg+ His­

transformant (T2* or RPC216) was subsequently used for constructing the

homozygous PMAu-CAP4 strain. Growth of the Arg+ His- transformant in YPM

overnight yields rare recombination segregants in which the HAHJ insertion allele is

homozygous. Such segregants can be selected on the synthetic deficient medium plate

lacking arginine and histidine after they undergo recombinational excision within one

- 119-

HAHJ cassette to yield a unique Arg+ His+ phenotype. We screened 10 Arg+ His+

transformants and found that all of them were positive. A diagnostic PCR uSing

ONC168 (binding upstream to the site of integration in CAP4 5'-UTR} and ONCGl2

(binding in a region of CAP4 ORF) confirmed the replacement of native promoters of

both the CAP4 alleles bJf PMAL2 (Fig. III.lS.C, only three representative transformants

are shown).

111.9.9. Construction ofrcap4Aicap4/J. strains

Construction of the HAUJ: :CAP4 disruption cassette

We used HAHI plasmid, a generous gift by Dr. K. Ganesan for constructing the

HAHJ::CAP4 disruptiaoa cassette. As mentioned above in case of HAHl-PJ\tA1.2

cassette preparation using split marker strategy, we constructed tip-split and down­

split fragments for HAMJ::CAIP4 disruption cassette using primer pairs ON<CI66-

0NC115 and ONCI ~4-0NC2l6 respectively, plasmid HAH1 as template and

Phusion HF DNA pol)\merase (Finnzyme) enzyme system. We used, ONC2ID6 'at the

place of ONC 167, which has 23 bases at the 3 '-end corresponding to commQn, reverse

vector primer forpFA '1ector (RVl) as recommended (K. Ganesan, unpublished1data).

The primer has 60 bas-es homologous region to the site of integrat~on immediately

after the stop codon of CAP4 gene. The amplicons were analysed, parified ley eilianol

precipitation and quaatitied as mentioned in case of HAH- PMAi£2· The resUlting

cassette thus would be able to replace the complete ORF of CAP4 gene (Fig.

III.16.A).

Construction of the cap4Ll C. albicans strain and its verification

Approximately, l.SJ.!g of the purified amplicons each from up-split and down-split

were used for transformation into C. albicans strain SN152 by electroporation. One

allele of CAP4 is disrupted with a HAH1-PMAL2 insertion through transformation and

- 120-

Fig. 111.16. Construction of cap4A null mutant strain using HAHJ cassette.

(A) Schematic shows the use of HAHJ cassette for CAP4 gene disruption in SN152 strain. One allele of CAP4 is

disrupted with a HAHJ insertion through transformation with selection for an Arg+ phenotype. The HAHJ cassette

will replace the complete CAP4 ORF. Growth of the Arg+ His- transformant in YPM overnight will then yield rare

recombinant segregants in which the HAHJ insertion allele is homozygous. Such segregants may be selected after

·they undergo recombinational excision within one HAHJ cassette to yield a unique Arg+ His+ phenotype as shown

in Fig. V.lB. The primers used for the screening of desired transformants with heterozygous cap4!1::HAHJICAP4

(using ONC168 and ONC115) and homozygous cap4!1::HAHJ/cap4LJ.::H/Sl (using ONCll and ONC12) are

shown. (B) Diagnostic PCR to verify the targeted integration of the HAHJ cassette for CAP4 disruption. The upper

panel shows the gel picture ofPCR analysis to verify the heterozygous mutant (cap4!1::HAHJ/CAP4). The samples

in lane Pis genomic DNA template used in PCR from parental strain SN152 while Lanes Tl, T2, T3, and T4* are

genomic DNA template used in PCR from various independent transformants of heterozygous mutant strains. Lane

M is 1 Kb DNA ladder. T4* was subsequently used for constructing homozygous. The lower panel shows the gel

picture of PCR analysis to verify the homozygous mutant (cap4!1::HAHJ/cap4!1::HISJ). The samples in lane Pis

genomic DNA template used in PCR from parental strain SN152 while Lanes T4* is the genomic DNA template

used in PCR from parental heterozygous mutant strains, and Tl to T4 are genomic DNA template used in PCR

from various independent transformants of homozygous mutant strains. Lane M is 1 Kb DNA ladder. The wild

type band is missing in transformants with cap4!1 null mutant but some artifact was seen in all the transformants.

(A)

ONC168 ....

HAHJ::CAP4 Cassette

Arg- His- Leu­CAP4 (+/+)

ONCII ....

1 Homologous­recombination

.,_ ONC115

ONC12

Arg+ His- Leu­CAP4 (-/+)

(B)

CAP4-l

CAP4-2 Wild type CAP4

T 1 P M T2 T3 T 4 *

P T 4 * T 1 T2 T3 T 4 M

the trans formants were selected for an Arg + phenotype on synthetic deficient medium

lacking arginine. We obtained 150 colonies from the entire transformation mix. The

Arg+ His- transformants were maintained on SC-Arg+His+Leu plate and inoculated

into SC-Arg+His+Leu liquid media overnight to isolate genomic DNA. The

diagnostic PCR was done using ONC168 (binding upstream to the site of integration

in CAP4 5'-UTR) and ONC115 (binding to a region of C.a.ARG4 gene in the HAHJ

cassette). PCR verification showed targeted integration at the correct locus in 4

transformants out of 16 screened. (Fig. III.16. B, upper panel; only four representative

Arg+ His- transformants are shown). One Arg+ His- transformant (T4* or RPC270)

was subsequently used for constructing the homozygous cap4LJ. strain. Growth of the

Arg+ His- transformant in YPD overnight yields rare recombination segregants in

which the HAHJ insertion allele is homozygous. Such segregants could be selected on

synthetic deficient medium lacking arginine and histidine after they undergo

recombinational excision within one HAHJ cassette to yield a unique Arg+ His+

phenotype. We screened 10 Arg + His+ transformants and found that all of them were

positive clones. A diagnostic PCR using ONC 11 (binding to the 5 '-end of the CAP4

ORF) and ONC12 (binding to the 5'-end ofthe CAP4 ORF) confirmed the deletion of

both the CAP4 alleles (Fig. III.16. B, lower panel; only four representative

transformants are shown).

111.10. Bacterial Expression and purification of Cap2p and Cap4p proteins

The recombinant plasmids lp9 and Ip10 were transformed into E. coli BL21 (DE3)

cells and grown in LB media containing 25 J.lg ofkanamycin/ml at 37°C to an OD600

of 0.5. Expression was induced by the addition of 0.1 mM isopropyl-B-D­

thiogalactopyranoside (IPTG) for 3 h at 3 7°C. The cells were then harvested,

- 121 -

resuspended in binding !buffer (20mM Sodium. phosphate pH 7 .4, 500 mM NaCl, 20

mM Imidazole) and .~1ysed by sonication.

The recombinant Cap2 protein was found to be in the insoluble fraction while

the recombinant Cap4 was soluble. To resolubilize the Cap2 recombinant protein, the

insoluble fraction was solubilized in the Binding buffer contaning SM Urea and 1 mM

~-ME. The resolubil£2:ed recombinant Cap2-6xHis protein was gradually diluted to

reduce the urea concentration to 4M and loaded onto a His-Trap Affinity column (GE

Healthcare) pre-equilibrated with the Binding buffer containing 4M Urea, I mM P­

ME. The column was then washed with the pre-equilibrated buffer followed\ by a

linear gradient of 4Jl to 0.0 M Urea for on-column refolding of the protein. F.tnally,

the purified protein was· eluted with Elution buffer (20mM Sodium phosphate p'f:I 7.4,

500mM NaCl, 508 mM hnidazole and 1 mM ~-ME). The eluate peak fractions

containing Cap2-6xFI:is were poOled and dialyzed against a low salt buffer(~·mM Na

phosphate pH 7 .0, 0.2M NaCl). The purified Cap2-6xHis protein was fmmd to ib'e at

least >95% pure as judged lby SDS-:PAGE and the concentration was 9.6 Jigtml (Fig.

III.17 .A). This purified Oap2tprotein was used to obtain polyclonal ant~bod~ m .rabeits

as per established protocals €97). The antibody could detect both recombinant Cap2-

6xHis and native Cap2 ia C. albicans cell extracts.

The recombinant Oap4 was found to be soluble and was direcHy toaded ont<) a

fresh His-Trap Affinity column (GE Healthcare) pre-equilibrated with the Bindiqg

buffer washed and eluted with Bution buffer. The eluate peak fraction containing

Cap4-6xHis was further p'UJ.;}tied by gel filtration and simultaneously exchanged inte a

low sa1t buffer (20 mM Na phosphate pH 7.0, 0.2M NaCl). The purified Cap4-6xllis

protein was found to be at least >95% pure as judged by SDS-P AGE and the

- 122-

Fig. 111.17. SDS-PAGE analysis to quantify the purified recombinant Cap2p

(rCap2p) and recombinant Cap4p (rCap4p).

(A) 2.5 f.ll of the purified Cap2 protein and its 2-fold serial dilutions were resolved on

an SDS-P AGE gel along with 0.25 f.ll of the BioRad low range protein marker

(2.0f.lg/f.ll/band) and its 2-fold dilutions. Similarly, (B) 5.0 f.ll of the purified Cap4

protein and its 2-fold serial dilutions were resolved on an SDS-PAGE gel along with

0.25 f.ll of the same BioRad low range protein marker and its 2-fold serial dilutions.

Both the gels were stained with Coomassie Brilliant Blue and the specific protein

bands were quantitated by comparing their intensities with those of the protein marker

bands. The concentration of the purified Cap2p was estimated to be ~0.6f.lg/f.ll and

that of the Cap4p was ~0.4f.lg/f.ll.

(A)

(B)

rCap2p

lx 2x 4x 8x 16x

1 2 3 4 5

Biorad Marker

Biorad Marker

lx 2x 4x

6 7 8

rCap4p

lx 2x 4x 8x lx 2x 4x 8x

1 2 3 4 5 6 7 8

concentration was 0.4 )lg/ml (Fig. III.17.B). This sample was used to immunize

BALB/c mice as per established protocols (97).

111.11. Cap2 and Cap4 Antibodies

Bleeds were obtained after 2nd and subsequent boosts, sera collected and the antisera

was used at 1: 1000 dilution to probe C. albicans extracts and appropriate recombinant

purified proteins as controls. Serial dilutions of the recombinant proteins (50 )lg to

0.4 )lg, 5-fold dilutions) were spotted onto PVDF membranes and the dot blots were

also probed simultaneously. Blots were developed as described in Section II.8. The

antibodies were specific and the two antibodies did not cross-react with the reciprocal

protein blots. The antibodies could detect recombinant as well as native Cap2p or

Cap4p (as appropriate) from C. albicans cell extracts.

- 123-