Contents lists available at ScienceDirect

Plant Physiology and Biochemistry

journal homepage: www.elsevier.com/locate/plaphy

Research article

L-ascorbic acid metabolism in an ascorbate-rich kiwifruit (Actinidia. ErianthaBenth.) cv. ‘White’ during postharvest

Zhen-Ye Jianga, Yu Zhonga, Jian Zhenga, Maratab Alia, Guo-Dong Liub, Xiao-Lin Zhenga,∗

a College of Food Science and Biotechnology, Zhejiang Gongshang University, Hangzhou, 310018, PR ChinabHorticultural Sciences Department, IFAS, University of Florida, Gainesville, FL, 32611-0690, USA

A R T I C L E I N F O

Keywords:Ascorbic acidBiosynthesisKiwifruit (Actinidia eriantha)PostharvestRecycling

A B S T R A C T

Kiwifruit (Actinidia eriantha Benth.) ‘White’, a novel cultivar with higher L-ascorbic acid (AsA) level, is registeredin China. Changes in AsA, related metabolites, enzymatic activity, and gene expression associated with AsAbiosynthesis and recycling process were investigated in this paper. The results indicated that AsA biosynthesisthrough L-galactose pathway supplemented by D-galacturonic acid pathway and AsA recycling collectivelycontributed to accumulating and remaining higher AsA level in kiwifruit cv. ‘White’ during postharvest.Moreover, L-galactose dehydrogenase (GalDH) activity and relative expressions of the genes encoding GDP-D-mannose pyrophosphorylase (GMP), L-galactose-1-P phosphatase (GPP), GDP-L-galactose phosphorylase (GGP),GalDH and D-galacturonate reductase (GalUR) were important for regulation of AsA biosynthesis, and the ac-tivity and expression of dehydroascorbate reductase (DHAR) were primarily responsible for regulation of AsArecycling in kiwifruit ‘White’ during postharvest.

1. Introduction

L-ascorbic acid (AsA; i.e., vitamin C) is an essential dietary nutrientfor human beings due to their inability to synthesize it. Also, AsA playsimportant roles in human body with a wide range of health benefits,such as reducing plasma cholesterol, enhancing collagen formation,minimizing nitrosoamine production, increasing iron absorption,boosting immune system, scavenging free radicals, and reducing therisk of cancer, etc (Blaschke et al., 2013; Cimmino et al., 2017;Schlueter and Johnston, 2011). However, humans are entirely relianton the dietetic sources and more than 90% AsA is derived from fruit andvegetables (Davey et al., 2000). Thus, AsA content acts as a preferentialfactor for evaluating the quality of most fruit, and increasing effortshave been devoted to AsA improvement in different fruit (Lee andKader, 2000; Liu et al., 2015; Mellidou et al., 2012; Tsaniklidis et al.,2014).

The metabolic pathways including the de novo biosynthesis, de-gradation and recycling of AsA collectively contribute to the regulationof AsA level in plants (Fig. 1). Also, in fruit, AsA is biosynthesized fromglucose through these four biosynthetic pathways, including L-ga-lactose, D-galacturonate, L-gulose, and myo-inositol pathway, but thepredominating AsA biosynthetic pathway is varied among fruit species,developmental stages or the fruit tissues (Bulley et al., 2009; Cruz-Ruset al., 2010; Davey et al., 2000). Moreover, AsA can be oxidized to

monodehydroascorbate (MDHA) by ascorbate oxidase (AO) and ascor-bate peroxidase (APX) respectively, and then MDHA can be either re-duced to AsA by monodehydroascorbate reductase (MDHAR) or dis-proportionated to dehydroascorbate (DHA) and AsA, and DHA can alsobe reduced to AsA by dehydroascorbate reductase (DHAR) before beingsubject to hydrolysis (Huang et al., 2014).

Kiwifruit varieties encompass a wide spectrum of varieties, amongwhich most commercially significant varieties are A. deliciosa (A. Chev.)C. F. Liang et A. R. Ferguson, A. chinensis Planch., and A. arguta (Sieb. etZucc.) Planch. ex Miq (Crowhurst et al., 2008). Recently, a novel cul-tivar A. eriantha Benth ‘White’ has been recognized and entitled by theHorticulture Institute, Zhejiang Academy of Agricultural Sciences andthen registered in China under code of PVR No. CNA20050673.0 (Wuet al., 2009). The kiwifruit cv. ‘White’ has attracted vital considerationas a new commercial fruit with large size, good flavor and nutrition,and easy peel like banana fruit, especially by its much higher AsA level(5.69–11.37 g kg −1 FW) as compared to the most common kiwifruitcultivars and many other fruit crops (Wu et al., 2009; Zhang et al.,2011). The fruit morphology of kiwifruit cv. ‘White’ was showed inFig. 2. To date, a range of investigations on the variation and regulationof AsA level in kiwifruit, especially, in the varieties of A. deliciosa and A.chinensis has been conducted during fruit development (Bulley et al.,2009; Li et al., 2010, 2014). Our previous work has reported the mainlyphysiological and quality changes in ‘White’ fruit during storage at

https://doi.org/10.1016/j.plaphy.2018.01.005Received 19 October 2017; Received in revised form 3 January 2018; Accepted 5 January 2018

∗ Corresponding author.E-mail address: zhengxl@zjgsu.edu.cn (X.-L. Zheng).

Plant Physiology and Biochemistry 124 (2018) 20–28

Available online 06 January 20180981-9428/ © 2018 Elsevier Masson SAS. All rights reserved.

T

room temperature (Zhang et al., 2011), but information about the AsAmetabolism associated with regulation of higher AsA level in kiwifruitcv. ‘White’ during development and postharvest is scarce. For under-standing the AsA accumulation in kiwifruit cv. ‘White’ during post-harvest, changes in contents of AsA and total-AsA (T-AsA) and relatedmetabolites, activity of enzymes and expression profiles of genes in-volved in AsA biosynthesis and recycling process were investigated inthis work. The results would be of benefit to improving targets for fruitcrops breeding strategies, especially for kiwifruit breeding, with thepurpose of increasing AsA level.

2. Materials and methods

2.1. Material

Kiwifruit (A. eriantha Benth) cv. ‘White’ selected for uniformity ofsize and maturity, as well as without blemish and decay were harvestedat 170 days after full bloom at a commercial orchard in Taizhou, China,when the soluble solid content (SSC) had reached about to 11.0%, andthen were immediately transported to a laboratory in Hangzhou by air-conditioned car (approx.3 h). Each thirty fruit without physical injurieswere placed in a clean plastic box with fruit touching, and each box was

Fig. 1. Proposed pathways for biosynthesis, degradation and recycling of AsA in plants.The enzymes catalyzing the reactions are: GDP-mannose pyrophosphorylase (GMP), GDP-mannose-3′–5′-epimerase (GME), GDP-L-galactose transferase (GGP), L-galactose-1-phosphatephosphatase (GPP), L-galactose dehydro-genase (GalDH), L-galactono-1,4-lactone dehydrogenase (GalLDH), D-galacturonic acid reductase (GalUR), myo-inositol oxygenase (MIOX), L-gulono-1,4-lactone oxidase (GLOase), monodehydroascorbate reductase (MDHAR), dehydroascorbate reductase (DHAR), ascorbate oxidase (AO), ascorbate peroxidase (APX). Adaptedfrom Smirnoff (2011).

Z.-Y. Jiang et al. Plant Physiology and Biochemistry 124 (2018) 20–28

21

enclosed in a 0.05mm thick polyethylene bag, and total 270 fruit (nineboxes) were held in chambers (MIR-554, Sanyo, Oizumi, Japan) at20 ± 0.5 °C for 21 d, Triplicate of flesh samples were collected fromthe middle part of 27 fruits being removed peels and cores (9 fruitswithout decay each replicate from the 9 boxes) on the first day and at 3-day intervals thereafter during storage, and were rapidly frozen in li-quid nitrogen and stored at −80 °C until use. Analysis in the triplicateof flesh samples was undertaken for measurements of the followingparameters.

2.2. Assays for AsA and T-AsA

One gram of sample was homogenized in 10ml of 5% (w/v) tri-chloroacetic acid (TCA). The supernatants obtained after a 20mincentrifugation at 4 °C at 12,000 g were diluted 40 times for measuringAsA. Moreover, each 1.0ml supernatant was mixed with 0.5 ml 60mMdithiothreitol-alcohol and then added NaH2PO4-Na2HPO4 buffer to pH7–8. The mixed solution was incubated for 10min at 30 °C for reductionof oxidized ascorbate to AsA, and then added 0.5ml 20% (w/v) TCA forassaying T-AsA.

The contents of AsA and T-AsA content were assayed according to amethod described by Cao et al. (2013) with some modifications. A re-action mixture (containing 1ml of the diluent, 1 ml absolute ethyl al-cohol, 0.5 ml 0.4% H3PO4-ethyl alcohol, 1 ml 1% (w/v) bath-ophenanthroline-ethyl alcohol and 0.5ml 0.3% (w/v) FeCl3-ethylalcohol) were analyzed at 534 nm using an ultraviolet-1800 spectro-photometer after in water baths at 60 °C for 30min. AsA and T-AsAwere expressed on a fresh weight as g kg−1 FW.

DHA content was calculated by T-AsA minus AsA in terms of as gkg−1 FW.

2.3. HPLC assay of metabolites

Ten grams of flesh samples was grounded with 5ml distilled water,and then centrifuged at 8000 g and 4 °C for 30min. The supernatant

was filtered through 0.22 μm filter paper, and the filtrate was used toassay glucose and fructose. The determinations were conducted withsome modifications of the method described by Andrés et al. (2015).Chromatographic separation was performed on an XBridge BEH AmideColumn (3.0× 150mm). The mobile phase was 80% (w/v) acetonitrilein distilled water with a flow rate of 0.4ml per min at 30 °C.

Two grams of flesh samples was grounded with 2ml 0.2% HPO3,and then centrifuged at 12,000 g and 4 °C for 30min. Centrifugationwas repeated for two times. The combined supernatant was filteredthrough 0.22 μm filter paper, and the filtrate was used to assay oxalicacid and tartaric acid. The determinations were conducted with somemodifications of the method described by Ma et al. (2015). Chroma-tographic separation was performed on a Vennusil MP C18(250mm×4.6mm×5 μm). The mobile phase was 5% (v/v) acetoni-trile in 0.1 mM K2HPO3(pH 2.05) with a flow rate of 0.8 ml per min at30 °C.

2.4. Determination of related enzymes in AsA metabolism

Two grams of flesh were homogenized with 5ml of 0.1 M potassiumphosphate buffer (pH 7.5) containing 0.1mM phenylmethanesulfonylfluoride, 0.5% (v/v) Triton X-100, 0.2% (v/v) 2-mercaptoethanol, and2% (w/v) PVP, and then centrifuged at 12,000×g at 2 °C for 20min.The supernatants were collected to assay L-galactose dehydrogenase(GalDH). GalDH activity was assayed according to the method ofGatzek et al. (2002).

Two grams of flesh were homogenized with 8ml of 0.1 M potassiumphosphate buffer (pH 7.4) containing 0.4M sucrose, 30mM mercap-toethanol, 10% (v/v) glycerol, 1% (w/v) polyvinylpyrrolidone (PVP)and 1mM Ethylenediaminetetraacetic acid (EDTA) and centrifuged at500 g and 4 °C for 15min to remove chloroplast and cell debris. Thesupernatant was centrifuged again at 12,000×g for 20min at 4 °C toobtain the pellet. The pellet was suspended in 3ml of 50mM Tris-HCl(pH 8.5) containing 5mM glutathione and 10% (v/v) glycerol. Thissuspended solution was again centrifuged at 2000×g for 10min at 4 °C,

Fig. 2. The fruit morphology of kiwifruit cv. ‘White’.

Z.-Y. Jiang et al. Plant Physiology and Biochemistry 124 (2018) 20–28

22

and the supernatant was used to determine L-galactono-1, 4-lactonedehydrogenase (GalLDH). GalLDH activity was assayed following Ôbaet al. (1995).

Two grams of flesh were homogenized with 50mM sodium phos-phate buffer (pH 7.2, containing 2mM EDTA, 2mM DTT, 20% glyceroland 2% PVP). The supernatant obtained after a 30min centrifugation at4 °C at 6000×g and used to assay D-galacturonate reductase (GalUR).GalUR activity was determined as described by Agius et al. (2003).

Two grams flesh was homogenized in 6ml potassium phosphatebuffer (50mM/L, pH 7.5) containing 2ml potassium phosphate buffer(100mM, pH6.8), 0.1 mM ethylenediami-netetraacetic acid (EDTA),0.3% (w/v) Triton X-100, 4% (w/v) insoluble polyvinyl-poly-pyrrolidone (PVPP), and 0.1 mM ascorbic acid, and then centrifuged at1, 6000×g for 15min. The supernatant was used immediately to assayfor APX, AO, MDHAR, and DHAR. APX and AO activities were assayedfollowing the previously protocol by Nakano and Asada (1981), andYoshimura et al. (2000), respectively, while DHAR and MDHAR activ-ities following the method of Ma and Cheng (2003).

One unit of GalDH, GalLDH, GalUR, APX, and AO activity was de-fined as the amount of enzyme causing an increase of 0.01 in the ab-sorbance per min at 340, 550, 340, 290, and 265 nm at 25 °C respec-tively, and one unit of MDHAR or DHAR activity was defined as thesubstance produced or consumed per minute per unit of total protein.

2.5. Quantitative real-time PCR analysis for expression of genes involved inAsA metabolism

Two grams of flesh samples were homogenized in liquid N2, andtotal RNA was extracted from the frozen flesh using a commercial RNAextraction kit (Tiangen, Beijing, China). Extraction was conducted ac-cording to the manufacturer's instructions. Using SuperScript™ III First-Strand Synthesis SuperMix, the first strand cDNA was synthesized byreverse transcription following the manufacturer's protocols. The pri-mers used for the quantitative real-time PCR (qPCR) were identified byPrimer 6 software Primer Premier 6.0 and Beacon designer 7.8(Table 1). Transcript levels of the genes involved in the metabolicpathways of AsA, including GMP, GME, GGP, GPP, GalDH, GalLDH,

GalUR, APX, AO, MDHAR, and DHAR, were monitored via qPCR usingthe Power SYBR® Green Master Mix Kit (Toyobo, Osaka, Japan) fol-lowing manufacturer's guidelines on a CFX384 Touch Real time PCRDetection System (Bio-Rad, USA).

The qPCR program was carried out as follows: 1 min at 95 °C; 40cycles of 15 s at 95 °C, and 25 s at 63 °C and followed by an automaticmelting curve analysis. Three independent biological replicates weredetermined for each sample. The relative expression level for each genewas calculated using the comparative Ct method (2−ΔCt method). Allanalyses were repeated three times using biological replicates.

2.6. Statistical analysis

Data were expressed as mean values ± SD and were subjected toone-way analysis of variance (ANOVA) using SPSS 20.0 software (SPSSInc., USA). The differences at P≤ .05 were considered as significant.

3. Results

3.1. Changes in AsA, DHA, T-AsA, and AsA/DHA ratio in the fruit duringstorage

AsA content of kiwifruit showed a considerably increasing trendfrom the initial day to 17 d of storage and then decline slightly, whichindicating that AsA content was 7.20 g kg −1 FW at first day of storage,and increased continuously to the highest AsA contents of 8.30 g kg −1

FW at 17 d, and then declined to 7.98 g kg −1 FW at 21 d of storage asshown in Fig. 3A.

Overall, DHA content of kiwifruit ‘white’ showed a continuouslydecreasing trend during whole storage of 21 d. At 5 d and 17 d of sto-rage, a little increasing trend was observed (Fig. 3B).

In the case of T-AsA, the level slightly declined to 5 d of storage,after which it increased and then remained stable to 21 d of storage(Fig. 3C).

The AsA/DHA ratio showed an increasing trend during wholeperiod as shown in Fig. 3D. From 1 d to 13 d of study, a slight increaseregarding AsA/DHA ratio was observed. After that a sharp increaselevel was observed from the onward days of 13 d–17 d. After 17 d, AsA/DHA ratio tended to a decreasing level continuously until 21 d. Overall,from 1 d to 21 d of storage, a significantly increasing trend was found.

3.2. Changes in activities of enzymes involved in AsA metabolism in the fruitduring storage

At the first day, 10 U g −1 activity of GalDH was observed whichtended to increase significantly to the highest activity (38.33 U g −1) at17 d of storage, and then decreased to 25.33 U g −1 at 21 d. Correlationanalysis showed that GalDH activity was positively correlated with AsAcontent (r2 = 0.841 *) (Fig. 4A). GalLDH activity maintained a rela-tively steady level for the first 17 d of storage, and then decreased alowest level at 21 d of storage (Fig. 4B). GalUR activity remained atstable levels during whole storage period, and a minor change wasobserved in GalUR activity as compared to GalDH and GalLDH(Fig. 4C).

AO activity gradually decreased to a minimum level at 17 d, andthen sharp increased to a level similar to that at 5 d (Fig. 4D). APXactivity slightly decreased for the first 17 d and then sharp reduced to aminimum level at 21 d (Fig. 4E). MDHAR activity was tending towardssteady levels except it showed a peak at 17 d (Fig. 4F), while DHARactivity enhanced rapidly for the first 5 d and then slightly increased forthe remainder of storage time (Fig. 4G).

3.3. Changes in the relative expression of AsA-related genes in the fruitduring storage

Changes in expression levels of the 11 AsA-related genes in fruit

Table 1The sequences of specific primers used for qRT-PCR analysis.

Gene GenbankAccession

Forward primer (5′ to 3′)Reverse primer (5′ to 3′)

Product (bp)

ActinidiaGMP

FJ643600.1 GCTGAACCCATCTGTTCTCGAT 145GTAATCCCTTGGCTGTCCAATG

ActinidiaGME

GU339037.1 GAGAAAGCCCCTGCTGCATTC 100CAATGAAGGTGAAAGATCGGGTT

ActinidiaGGP

GU339036.1 GTGTGGGAAATCAGCGGACAT 79GCCTCCAAGCATTTCCTTCAGA

ActinidiaGPP

AY787585.1 CTGCATTTCCCTGACCACAAGT 120GTTGTCCCATCAAGAGGATCAACA

ActinidiaGalDH

EU525847.1 CGCCTCGGCATCAACTTCTT 128CCACACTTGGTCGACACAATGTA

ActinidiaGalLD-H

GU339039.1 CCACTACAGGCGTTTGACTCAAA 74CCTCAATCTTGGCCCAATGTTC

ActinidiaGalU-R1

GU339035.1 CCAGTCAGATTGACCCAACACGT 93CTCCATGCCTTCCCAGACTGT

ActinidiaAPX

JQ011279.1 GGTGCCACAAGGAGCGTTCT 152GAAGGCGGAATCAGCGAGAA

ActinidiaMDHA-R

GU339041.1 CTCGGCTTTTCACAGCTGGTATA 91CCAACAGCCACAGTTCCCTTGA

ActinidiaDHAR

GU339034.1 GCACACGGACCATACGTTAATGA 81CACATCAAGGTGGAACAGCTTTG

ActinidiaAO

FG523033.1 GCGATTGGGAATCACAAGAT 100AATAGCTCTCGCCGGAGTAAA

Actinidia18S

JX236280.1 GCCCTATCAACTTTCGATGGTAGGA 113CCTTGGATGTGGTAGCCGTTTCTCA

Z.-Y. Jiang et al. Plant Physiology and Biochemistry 124 (2018) 20–28

23

during postharvest were showed in Fig. 5. The genes including GMP,GME, GGP, GPP, GalDH, and GalLDH involve in L-galactose pathway. Inkiwifruit cv. ‘White’, the expression of GMP and GME remained steadyat the first 5 d and 13 d respectively, and then GMP gradually increaseduntil 21 d, while GME significantly decreased during the remainderdays in storage (Fig. 5A and B). The expression of GGP increased to apeak value at 17 d, which was over 2 times higher than that of the firstday, and then sharply reduced to the initial level (Fig. 5C). The relativeexpression of GPP increased significantly during storage (Fig. 5D). Theexpression of GalDH increased sharply during the first 9 d, and thengradually increased to about 4 times higher level compared to the in-itial level whereas, GalLDH was stably expressed with a slight fluctua-tion during storage (Fig. 5E and F).

The relative expression of GalUR that involves in the D-galactur-onate pathway increased sharply to a peak at 13 d, and then graduallydecreased continuously (Fig. 5G).

AO, APX, MDHA and DHAR involve in the ascorbate-glutathionecycle. In kiwifruit cv. White, the expression of AO and APX graduallydecreased, while the DHAR increased during the storage, but the ex-pression of MDHA remained nearly unchanged level except increasingto double its original level at 17 d during storage (Fig. 5H, I, J and K).

3.4. Change in contents of AsA-related metabolites in the fruit duringstorage

The contents of glucose and fructose in the fruit increased rapidly inthe first 5 d, and then fluctuated slightly during the remainder of sto-rage time (Fig. 6A and B). The tartaric acid content gradually increaseduntil 9 d and then slightly decreased, while the oxalic acid contentsharply decreased in the first 5 d and almost varied slightly up to 17 d,and then increased to the similar level on the first day (Fig. 4C and D).

4. Discussion

4.1. Accumulation of AsA in kiwifruit ‘White’ during postharvest

Generally, AsA content in fruit decreases during postharvest. Forexample, Lee and Kader (2000) have reported that AsA losses in fruitare boosted due to the extended storage period, higher temperature andlow relative humidity. Kalt (2005) has also reported that AsA contentreduces simultaneously with the deprivation of fleshy fruit tissues (e.g.

strawberry) after over ripening. In kiwifruit, AsA content in the fruit ofA. deliciosa and A. chinensis decreases during postharvest, even the losesof AsA are up to 50–70% while fruit ripened fully (Sharma et al., 2015).Our results showed an increasing trend of AsA content in kiwifruit cv.‘White’ during storage at room temperature for 21 d, while T-AsAmaintained steady accompanied with higher AsA/DHA ratio. The pat-tern of AsA/DHA followed that of T-AsA remained reduction status inthe fruit even over ripening. Thus, this comprehensive evidence sug-gested that a higher efficiency of AsA metabolism, especially in AsAbiosynthesis or/and AsA regeneration, must take place for remaininghigher level of AsA in kiwifruit cv. ‘White’ during postharvest.

4.2. The enzymes and genes involved in AsA biosynthesis contributed to AsAaccumulation in kiwifruit ‘White’ during postharvest

Recently, it has been concluded that the activity of some key en-zymes and expression of some genes involved in AsA biosynthesis col-lectively regulate the variation of AsA content in fruit, in a parallel wayto AsA accumulation (Huang et al., 2014; Li et al., 2010; Ioannidi et al.,2009; Tsaniklidis et al., 2014). AsA biosynthesis in fruit through L-ga-lactose pathway is well established due to all of the involved enzymesand genes being identified, where the last two steps are oxidation of L-Gal to L-GalL by GalDH, and then oxidation of L-GalL to AsA by GalLDH(Laing et al., 2004). During fruit development, the GalDH activity andGalDH expression in kiwifruit are associated with AsA level, butGalLDH is post-transcriptionally controlled and is not a main factor toregulate AsA concentration (Li et al., 2010). Also, no clear relationshipbetween GalLDH expression and AsA synthesis has been found by Bulleyet al. (2009) and Ioannidi et al. (2009). Our results indicated thatGalDH activity and GalDH expression in kiwifruit cv. ‘White’ increasedand maintained higher levels, which were significantly positive corre-lations to AsA content. Although GalLDH activity maintained higherlevels, the GalLDH expression almost unchanged during postharvest.Thus, it was suggested that GalDH and up-regulated expression ofGalDH might play important role in AsA synthesis, and GalLDH mightimpart its role in AsA synthesis with respective to AsA accumulation inkiwifruit ‘White’ during postharvest.

The expression of the other genes involved in L-galactose pathwayincluding GMP, GME, GGP and GPP also contributes to regulation ofAsA accumulation in fruit. For example, Huang et al. (2014) have re-ported that GMP, GME, GalDH, GalLDH and GGP are up-regulated when

Fig. 3. Changes in AsA (A), DHA (B), T-AsA (C), and AsA/DHA ratio (D) in the fruit during storage. Data were themeans of three replicates ± SD.

Z.-Y. Jiang et al. Plant Physiology and Biochemistry 124 (2018) 20–28

24

Fig. 4. Changes in activity of enzymes involved in AsA biosynthesis and recycling in the fruit during storage. Data were the means of three replicates ± SD.

Z.-Y. Jiang et al. Plant Physiology and Biochemistry 124 (2018) 20–28

25

Fig. 5. Changes in the relative expression of genes involved in AsA biosynthesis and recycling in the fruit during storage. Data were the means of three replicates ± SD.

Z.-Y. Jiang et al. Plant Physiology and Biochemistry 124 (2018) 20–28

26

the AsA accumulation rate rapidly increases in chestnut rose fruit. Agreater AsA concentration may be connected to a greater expression ofGPP in fruit pulp of Citrus (Yang et al., 2011). Ioannidi et al. (2009)have also stated that GPP expression is correlated with AsA con-centration and imparts a vital part in maintaining pool size of AsAduring the maturing period of tomato fruit. Conversely, Mellidou et al.(2012) have revealed that only the expression of one orthologue of GGPassociates with a peak level of AsA accumulation in tomato fruit.Moreover, in various genotypes of kiwifruit, the level of GGP expressionis a chief regulator as its transcriptions is interrelated with AsA strengthduring growth of fruit, while variations in GPP expression are corre-lated with changes in AsA concentration rate. Li et al. (2010) haveobserved a strong association between the expression levels of GMP andGPP and AsA accumulation in kiwifruit development. Interestingly, inthe kiwifruit of A. eriantha, the GPP expression is greater as comparedwith GGP and GME, where the GGP expression is still higher than thatof A. deliciosa and A. chinensis (Bulley et al., 2009). Data here showedthe expressions for GMP, GPP and GGP were up-regulated in kiwifruit‘White’ along with it's AsA accumulation during postharvest. Thus,these genes might also play important role for regulating AsA bio-synthesis in relation to AsA accumulation in kiwifruit ‘White’ duringpostharvest.

GalUR is a key enzyme involved in D-galacturonate pathway of AsAbiosynthesis, and changes in its activity or/and gene expression alsoaffect AsA level in some fruit. For example, previous works haveshowed that GalUR expression is correlated to AsA content and accu-mulation in strawberry (Agius et al., 2003) and in chestnut rose fruit(Huang et al., 2014) during the period of development, as well as ingrape berries during growth and ripening (Cruz-Rus et al., 2010). Ourexperimental results revealed that GalUR activity in kiwifruit ‘White’remained at a steadily low level compared to the activities of GalDHand GalLDH during postharvest, but the GalUR expression was upregulated, which indicated that GalUR might also play a role on re-garding AsA accumulation in kiwifruit ‘White’ during postharvest.

4.3. The key enzymes and genes involved in AsA recycling contributed toAsA accumulation in kiwifruit ‘White’ during postharvest

AsA regeneration through ascorbate-glutathione cycle commonly

contributes to AsA accumulation in fruit, where the enzymes such asAO, APX, MDHAR and DHAR involve in (Huang et al., 2014; Liu et al.,2015). Data here showed that the activities and the relative expressionof AO and APX in the fruit dramatically decreased during postharvest,which indicated that AsA oxidation was relatively lower level. More-over, numerous works have revealed that the contribution of MDHARor DHAR to AsA level varies among fruit species. For instance, AsA levelin tomato fruit and strawberry fruit is associated well with MDHARrather than with DHAR (Cruz-Rus et al., 2011; Stevens et al., 2008). Bycontrast, the AsA content, and the activity and expression of DHAR inkiwifruit reduce with fruit ripening, but the activity and expression ofDHAR is positive correlations with AsA content (Li et al., 2010). Similarresults have been reported in chestnut rose fruit, where DHAR, notMDHA, correlates strongly with variations in reduced AsA concentra-tion in both gene expression and enzyme activity (Huang et al., 2014).Our data showed that the activity and expression of MDHAR almostremained steady throughout storage except at 17 d, but the expressionand activity of DHAR increased dramatically and corrected positivelywith AsA content during postharvest. Therefore, it was suggested thatDHAR might be as one of the most crucial enzymes for AsA regenera-tion and in turn contributed to AsA accumulation in kiwifruit ‘White’during postharvest.

5. Conclusion

Final AsA level in fruit during postharvest depends on it's bio-synthesis, catabolism, and recycling. Our data indicated that, in theflesh of kiwifruit ‘white’, AsA catabolism seemed to affect AsA contentminimally, as the metabolite contents such as oxalic acid and tartaricacid in the fruit was relatively low during postharvest. AsA biosynthesisthrough L-galactose pathway supplemented by D-galacturonic acidpathway and AsA recycling might collectively contribute to accumu-lating and remaining higher AsA level in the flesh of kiwifruit cv.‘White’ during postharvest. Also, the GalDH activity and the gene ex-pressions including GMP, GPP, GGP, GalDH and GalUR might playimportant roles in regulating on AsA biosynthesis, and the expressionand activity of DHAR might be primarily responsible for regulation ofAsA recycling in the flesh of kiwifruit ‘White’ during postharvest, whichwould be suggested as potentially good candidates for breeding and

Fig. 6. Changes in the contents of metabolitesrelated to AsA biosynthesis and catabolism in thefruit during storage. Data were the means of threereplicates ± SD.

Z.-Y. Jiang et al. Plant Physiology and Biochemistry 124 (2018) 20–28

27

selection new cultivars with higher AsA content during postharveststorage up to over-ripening.

Contributions

Conceived and designed the experiments: XLZ, ZYJ YZ. Performedthe experiments: ZYJ YZ JZ. Analyzed the data: YZ ZYJ JZ. Contributedreagents/materials/analysis tools: XLZ. Wrote the paper: ZYJ MA.Revised the paper: GDL XLZ. All authors have read and approved thefinal manuscript.

Acknowledgements

This work was supported by National Natural Science Foundation ofChina (No. 31371848) and National Key R&D Program of China(No.2016YFD0400901).

References

Agius, F., González-Lamothe, R., Caballero, J.L., Muñoz-Blanco, J., Botella, M.A.,Valpuesta, V., 2003. Engineering increased vitamin C levels in plants by over-expression of a D-galacturonic acid reductase. Nat. Biotechnol. 21 (2), 177–181.

Andrés, V., Tenorio, M.D., Villanueva, M.J., 2015. Sensory profile, soluble sugars, organicacids, and mineral content in milk- and soy-juice based beverages. Food Chem. 173,1100–1106.

Blaschke, K., Ebata, K.T., Karimi, M.M., Zepeda-Martinez, J.A., Goyal, P., Mahapatra, S.,et al., 2013. Vitamin C induces Tet-dependent DNA demethylation in ESCs to pro-mote a blastocyst-like state. Nature 500, 222–226.

Bulley, S.M., Rassam, M., Hoser, D., Wolfgang, O., Schunemann, N., Wright, M., Macrae,E., Gleave, A., Laing, W., 2009. Gene expression studies in kiwifruit and gene over-expression in Arabidopsis indicates that GDP-L-galactose guanyl-transferase is amajor control point of vitamin C biosynthesis. J. Exp. Bot. 60, 765–778.

Cao, J.K., Jiang, W.B., Zhao, Y.M., 2013. Experiment guidance of Postharvest Physiologyand Biochemistry of Fruit and Vegetables. China Light Industry Press, Beijing, pp.39–41.

Cimmino, L., Dolgalev, I., Wang, Y.B., Yoshimi, A., Martin, G.H., Wang, J.J., et al., 2017.Restoration of TET2 function blocks aberrant self-renewal and leukemia progression.Cell 170, 1079–1095.

Crowhurst, R.N., Gleave, A.P., Macrae, E.A., Ampomah-Dwamena, C., Atkinson, R.G.,Beuning, L.L., et al., 2008. Analysis of expressed sequence tags from Actinidia: ap-plications of a cross species EST database for gene discovery in the areas of flavor,health, color and ripening. BMC Genom. 9 (1), 1–26.

Cruz-Rus, E., Amaya, I., Sanchez-Sevilla, J.F., Botella, M.A., Valpuesta, V., 2011.Regulation of L-ascorbic acid content in strawberry fruits. J. Exp. Bot. 62,4191–4201.

Cruz-Rus, E., Botella, M.A., Valpuesta, V., 2010. Analysis of genes involved in L-ascorbicacid biosynthesis during growth and ripening of grape berries. J. Plant Physiol. 167,739–748.

Davey, M.W., Montagu, M.V., Dirk, I., Maite, S., Angelos, K., Nicholas, S., Iris, J.B., John,J.S., Derek, F., John, F., 2000. Plant L-ascorbic acid: chemistry, function, metabolism,bioavailability and effects of processing. J. Sci. Food Agric. 80, 825–860.

Gatzek, S., Glen, L., Wheeler, G.L., Smirnoff, N., 2002. Antisense suppression of L-ga-lactose dehydrogenase in Arabidopsis thaliana provides evidence for its role in as-corbate synthesis and reveals light modulated L-galactose synthesis. Plant J. 30,541–553.

Huang, M., Xu, Q., Deng, X.X., 2014. L-Ascorbic acid metabolism during fruit

development in an ascorbate-rich fruit crop chestnut rose (Rosa roxburghii Tratt). J.Plant Physiol. 171, 1205–1216.

Ioannidi, E., Kalamaki, M.S., Engineer, C., Pateraki, I., Alexandrou, D., Mellidou, I.,Giovannonni, J., Kanellis, A.K., 2009. Expression profiling of ascorbic acid-relatedgenes during tomato fruit development and ripening and in response to stress con-ditions. J. Exp. Bot. 60, 663–678.

Kalt, W., 2005. Effects of production and processing factors on major fruit and vegetableantioxidants. J. Food Sci. 70, 11–19.

Laing, W.A., Frearson, N., Bulley, S., Macrae, E., 2004. Kiwifruit L-galactose dehy-drogenase: molecular, biochemical and physiological aspects of the enzyme. Funct.Plant Biol. 31, 1015–1025.

Lee, S.K., Kader, A.A., 2000. Preharvest and postharvest factors influencing vitamin Ccontent of horticultural crops. Postharvest Biol. Technol. 20, 207–220.

Li, J., Li, M., Liang, D., Ma, F., Lei, Y., 2014. Comparison of expression pattern, genomicstructure, and promoter analysis of the gene encoding GDP-L-galactose phosphor-ylase from two Actinidia species. Sci. Hortic. 169, 206–213.

Li, M., Ma, F., Liang, D., Li, J., Wang, Y., 2010. Ascorbate biosynthesis during early fruitdevelopment is the main reason for its accumulation in kiwi. PLoS One 5, 14281.

Liu, F.H., Wang, L., Gu, L., Zhao, W., Su, H.Y., Cheng, X.H., 2015. Higher transcriptionlevels in ascorbic acid biosynthetic and recycling genes were associated with higherascorbic acid accumulation in blueberry. Food Chem. 188, 399–405.

Ma, B., Chen, J., Zheng, H., Fang, T., Ogutu, C., Li, S., Wu, B., 2015. Comparative as-sessment of sugar and malic acid composition in cultivated and wild apples. FoodChem. 172, 86–91.

Ma, F.W., Cheng, L.L., 2003. The sun-exposed peel of apple fruit has higher xanthophyllcycle dependent thermal dissipation and antioxidants of the ascorbate–glutathionepathway than the shaded peel. Plant Sci. 165, 819–827.

Mellidou, I., Keulemans, J., Kanellis, A., Davey, M., 2012. Regulation of fruit ascorbic acidconcentrations during ripening in high and low vitamin C tomato cultivars. BMCPlant Biol. 12, 239.

Nakano, Y., Asada, K., 1981. Hydrogen peroxide is scavenged by ascorbate-specific per-oxidase in spinach chloroplasts. Plant Cell Physiol. 22, 867–880.

Ôba, K., Ishikawa, S., Nishikawa, M., Hiroko, M., Tomoko, Y., 1995. Purification andproperties of L-galactono-gamma-lactone dehydrogenase, a key enzyme for ascorbicacid biosynthesis, from sweet potato roots. J. Biochem. 117, 120–124.

Schlueter, A.K., Johnston, C.S., 2011. Vitamin C: overview and update. Evid-BasedCompl. Alt. 16 (1), 49–57.

Sharma, R.R., Jhalegar, M.J., Jha, S.K., Rana, V., 2015. Genotypic variation in totalphenolics, antioxidant activity, enzymatic activity and quality attributes among ki-wifruit cultivars. J. Plant Biochem. Biotechnol. 24 (1), 114–119.

Smirnoff, N., 2011. Vitamin C: the metabolism and functions of ascorbic acid in plants.Adv. Bot. Res. 59, 107–177.

Stevens, R., Page, D., Gouble, B., Garchery, C., Zamir, D., Causse, M., 2008. Tomato fruitascorbic acid content is linked with monodehydroascorbate reductase activity andtolerance to chilling stress. Plant Cell Environ. 31, 1086–1096.

Tsaniklidis, G., Delis, C., Nikoloudakis, N., Katinakis, P., Aivalakis, G., 2014. Low tem-perature storage affects the ascorbic acid metabolism of cherry tomato fruits. PlantPhysiol. Biochem. 84, 149–157.

Wu, Y.J., Xie, M., Zhang, Q.C., Jiang, G.H., Zhang, H.Q., Long, Q.J., Chen, H.W., Shong,G.H., 2009. Characteristics of ‘White’: a new easy-peel cultivar of Actinidia eriantha.New Zeal. J. Crop. Hort. 37, 369–373.

Yang, X.Y., Xie, J.X., Wang, F.F., Zhong, J., Liu, Y.Z., Li, G.H., Peng, S.A., 2011.Comparison of ascorbate metabolism in fruit of two citrus species with obvious dif-ference in ascorbate content in pulp. J. Plant Physiol. 168, 2196–2205.

Yoshimura, K., Yabuta, Y., Ishikawa, T., Shigeoka, S., 2000. Expression of spinach as-corbate peroxidase isoenzymes in response to oxidative stresses. Plant Physiol. 123,223–234.

Zhang, J.J., Zheng, X.L., Li, J.R., 2011. Physiological and quality changes in actindiaeriantha benth ‘white’ fruit during storage at normal temperature. Food Sci. 32,309–312.

Z.-Y. Jiang et al. Plant Physiology and Biochemistry 124 (2018) 20–28

28