Plant Hormones Anjali More University of Arkansas.
-
Upload
eric-bunyard -
Category
Documents
-
view
218 -
download
1
Transcript of Plant Hormones Anjali More University of Arkansas.
![Page 1: Plant Hormones Anjali More University of Arkansas.](https://reader036.fdocuments.in/reader036/viewer/2022062312/5519b5ec5503467a578b47ce/html5/thumbnails/1.jpg)
Plant HormonesPlant HormonesAnjali More
University of Arkansas
![Page 2: Plant Hormones Anjali More University of Arkansas.](https://reader036.fdocuments.in/reader036/viewer/2022062312/5519b5ec5503467a578b47ce/html5/thumbnails/2.jpg)
Why do plants need hormones?
Hormones enable plants to:• Respond to environmental factors and changes• Direct developmental processes
![Page 3: Plant Hormones Anjali More University of Arkansas.](https://reader036.fdocuments.in/reader036/viewer/2022062312/5519b5ec5503467a578b47ce/html5/thumbnails/3.jpg)
Why do plants need hormones?
Pathogens
Parasites
Humidity
Temperature
Light
Toxins
Insects
Oxygen
Stress
![Page 4: Plant Hormones Anjali More University of Arkansas.](https://reader036.fdocuments.in/reader036/viewer/2022062312/5519b5ec5503467a578b47ce/html5/thumbnails/4.jpg)
What are hormones?
• Harman - “to set in motion”• A chemical messenger from one cell (or group of
cells) to another• Signal molecules produced at specific locations• Found in low concentrations• Cause altered processes in target cells at other
locations• Found in multicellular organisms
![Page 5: Plant Hormones Anjali More University of Arkansas.](https://reader036.fdocuments.in/reader036/viewer/2022062312/5519b5ec5503467a578b47ce/html5/thumbnails/5.jpg)
What are plant hormones?1. Occur in small amounts2. Organic compounds3. Synthesized by plants4. Active at low concentrations5. Promote or inhibit growth and developmental responses6. Often show a separation from the site of production and
the site of action
Plant hormones do not always have all these characteristics
Plant growth regulators or plant growth substances
![Page 6: Plant Hormones Anjali More University of Arkansas.](https://reader036.fdocuments.in/reader036/viewer/2022062312/5519b5ec5503467a578b47ce/html5/thumbnails/6.jpg)
Plant hormones are chemical messengers
Hormone synthesis MessagePhysiological response
![Page 7: Plant Hormones Anjali More University of Arkansas.](https://reader036.fdocuments.in/reader036/viewer/2022062312/5519b5ec5503467a578b47ce/html5/thumbnails/7.jpg)
General Plant Hormones
• Auxins• Cytokinins• Abscisic acid• Ethylene• Gibberellins
• Jasmonic acid • Salicylic acid
Classical phytohormones
![Page 8: Plant Hormones Anjali More University of Arkansas.](https://reader036.fdocuments.in/reader036/viewer/2022062312/5519b5ec5503467a578b47ce/html5/thumbnails/8.jpg)
Auxins
Indole-3-acetic acid (IAA) • Auxein - to grow• First plant hormone discovered• Occurs in very low concentrations• Confers apical dominance• Regulates developmental processes, e.g. cell division, cell elongation etc
Auxin – important for root development
![Page 9: Plant Hormones Anjali More University of Arkansas.](https://reader036.fdocuments.in/reader036/viewer/2022062312/5519b5ec5503467a578b47ce/html5/thumbnails/9.jpg)
Cytokinins
Effect of cytokinin application on leaf senescence
• Stimulates cell division• Lateral bud development• Delays senescence and
promotes nutrient uptake
Rost et al., 1998
![Page 10: Plant Hormones Anjali More University of Arkansas.](https://reader036.fdocuments.in/reader036/viewer/2022062312/5519b5ec5503467a578b47ce/html5/thumbnails/10.jpg)
Abscisic acid• ‘Abscisin II’- role in abscission• Released during desiccation (of vegetative tissue)• Produced in response to stress• Synthesized in green fruits and seeds • General growth inhibitor – inhibits fruit ripening
ABA – The stress hormone
www.ars.usda.gov/.../ jan01/acid0101.htm?pf=1
![Page 11: Plant Hormones Anjali More University of Arkansas.](https://reader036.fdocuments.in/reader036/viewer/2022062312/5519b5ec5503467a578b47ce/html5/thumbnails/11.jpg)
Ethylene
• Fruit ripening• Opening of flowers• Induces seed
germination• Initiation of stem
elongation and bud development
Tomato
Banana
Ethylene treated
![Page 12: Plant Hormones Anjali More University of Arkansas.](https://reader036.fdocuments.in/reader036/viewer/2022062312/5519b5ec5503467a578b47ce/html5/thumbnails/12.jpg)
Gibberellins
• Ubiquitous in both flowering (angiosperms) and non-flowering (gymnosperms) plants as well as ferns• Many forms exist, named GA…GAn in the order of discovery
![Page 13: Plant Hormones Anjali More University of Arkansas.](https://reader036.fdocuments.in/reader036/viewer/2022062312/5519b5ec5503467a578b47ce/html5/thumbnails/13.jpg)
Discovered in association with foolish seedling disease of rice Discovered in association with foolish seedling disease of rice (“Bakanae”) caused by the fungus, (“Bakanae”) caused by the fungus, Gibberella fujikuroi. Gibberella fujikuroi. The fungus produces GA.The fungus produces GA.
uninfected infected
Yabuta and Sumiki, 1938
Gibberellins
![Page 14: Plant Hormones Anjali More University of Arkansas.](https://reader036.fdocuments.in/reader036/viewer/2022062312/5519b5ec5503467a578b47ce/html5/thumbnails/14.jpg)
• Synthesized in the apical portions of both stem and roots• Important effect on stem elongation in plants• Application of gibberellins promotes internode elongation • Involved in many other aspects of plant growth
Gibberellins
www.school.net.th/.../ science/10000-6600.html
![Page 15: Plant Hormones Anjali More University of Arkansas.](https://reader036.fdocuments.in/reader036/viewer/2022062312/5519b5ec5503467a578b47ce/html5/thumbnails/15.jpg)
• Cell elongation
• Seed germination
• Flower induction
• Breaking dormancy
Functions of gibberellins
- GA
+ GA
Fewer flowers and larger fruits
Delayed harvesting
Increased fruit size
GAs are commercially used for increased fruit size in table grapes and to regulate citrus flowering and rind maturation
Fruit growth – seedless grapes
![Page 16: Plant Hormones Anjali More University of Arkansas.](https://reader036.fdocuments.in/reader036/viewer/2022062312/5519b5ec5503467a578b47ce/html5/thumbnails/16.jpg)
Gibberellin mutants
• Elongated mutants – constitutive GA response (e.g.
spy in arabidopsis) or enhanced GA response (e.g. lv in pea)
• Dwarf mutants – three groups
1. Accumulate GA and mostly unresponsive to applied GA (e.g. gai in arabidopsis)
2. Reduced GA response but attain full responses with high doses of exogenous (added) GA (e.g. lgr in pea)
3. Reduced GA response but do not respond to the application of high doses of GA (e.g. lk and lkb in pea)
Ross et al. 1997
![Page 17: Plant Hormones Anjali More University of Arkansas.](https://reader036.fdocuments.in/reader036/viewer/2022062312/5519b5ec5503467a578b47ce/html5/thumbnails/17.jpg)
Dwarf mutants
A comparison of 28 day-old plant of the normal and Dwarf-1 mutant in bean
Praona and Green, 1967
Normal rice (right) and the GA-deficient “superdwarf” mutant.
![Page 18: Plant Hormones Anjali More University of Arkansas.](https://reader036.fdocuments.in/reader036/viewer/2022062312/5519b5ec5503467a578b47ce/html5/thumbnails/18.jpg)
Significance of GA mutants
• Insight into GA biosynthesis and regulation• Help us understand plant growth and development • Sex determination in maize – creation of double
mutants• Suitable for production in space…?
![Page 19: Plant Hormones Anjali More University of Arkansas.](https://reader036.fdocuments.in/reader036/viewer/2022062312/5519b5ec5503467a578b47ce/html5/thumbnails/19.jpg)
Superdwarf Wild type
GA-deficient “superdwarf” rice and normal wildtype plants – both types are 21 days old
![Page 20: Plant Hormones Anjali More University of Arkansas.](https://reader036.fdocuments.in/reader036/viewer/2022062312/5519b5ec5503467a578b47ce/html5/thumbnails/20.jpg)
Hormone synthesis Transport of hormonePhysiological response
The superdwarf mutation occurs in the late steps of GA synthesis. Other mutations occur at other steps, such as in a hormone receptor. These mutants are valuable tools in studying GA’s role in plant biology.
What experiment could we do to distinguish between these two types of mutation, i.e., synthesis or response?
![Page 21: Plant Hormones Anjali More University of Arkansas.](https://reader036.fdocuments.in/reader036/viewer/2022062312/5519b5ec5503467a578b47ce/html5/thumbnails/21.jpg)
GA exerts its effects on wild type plants – seen
here 6 days after treatment with 0 mg/ml or
10 mg/ml GA
0 mg/ml 10 mg/ml
![Page 22: Plant Hormones Anjali More University of Arkansas.](https://reader036.fdocuments.in/reader036/viewer/2022062312/5519b5ec5503467a578b47ce/html5/thumbnails/22.jpg)
Superdwarf rice, 6 days after treatment with 10 microliters of0, 1, and 10 mg/ml Gibberellic Acid (GA)
0 mg/ml 1 mg/ml 10 mg/ml
![Page 23: Plant Hormones Anjali More University of Arkansas.](https://reader036.fdocuments.in/reader036/viewer/2022062312/5519b5ec5503467a578b47ce/html5/thumbnails/23.jpg)
GA20
GA1
GA-3-beta hydroxylase
H
inactive
active
A hydroxylase is an enzyme that adds a hydroxyl group (-OH) to a substrate
![Page 24: Plant Hormones Anjali More University of Arkansas.](https://reader036.fdocuments.in/reader036/viewer/2022062312/5519b5ec5503467a578b47ce/html5/thumbnails/24.jpg)
The rice superdwarf mutant (also called Hosetsu-waisei dwarf from the original Japanese description) is caused by a change in the gene encoding a GA-3hydroxylase.
DNA
messengerRNA
5’
5’
5’
5’
Deletion of a G residue
NORMAL (wildtype) Superdwarf mutant
transcription
translation
Normal, functional protein The deletion of a G causes a premature “stop” codon – so translation ends early and a full normal protein is not made
protein
![Page 25: Plant Hormones Anjali More University of Arkansas.](https://reader036.fdocuments.in/reader036/viewer/2022062312/5519b5ec5503467a578b47ce/html5/thumbnails/25.jpg)
Mutant sequence
V P G L Q L F R R G P T G G W R C R R W 721 gtcccggggctgcagctgttccgtcgaggcccgaccggtgggtggcggtgccggcggtgg 780 R G P S S S T S A T S S T S S P T A A S 781 cgggggccttcgtcgtcaacgtcggcgacctcttccacatcctcaccaacggccgcttcc 840 T A S T T A P S * T A T A T G S R S A T 841 acagcgtctaccaccgcgccgtcgtgaaccgcgaccgcgaccgggtctcgctcggctact 900
Wildtype sequence
V P G L Q L F R R G P D R W V A V P A V 721 gtcccggggctgcagctgttccgtcgagggcccgaccggtgggtggcggtgccggcggtg 780 A G A F V V N V G D L F H I L T N G R F 781 gcgggggccttcgtcgtcaacgtcggcgacctcttccacatcctcaccaacggccgcttc 840 H S V Y H R A V V N R D R D R V S L G Y 841 cacagcgtctaccaccgcgccgtcgtgaaccgcgaccgcgaccgggtctcgctcggctac 900
Premature “STOP” codon
Shown is a small portion of the rice GA 3-hydroxylase gene. The G at nucleotide #750 of the gene is deleted in the superdwarf mutant. This causes a change in the amino acids that are encoded after that point. The letters above the DNA sequence are the one-letter abbreviations for the amino acids that are encoded by each triplet codon.
absent in mutant
![Page 26: Plant Hormones Anjali More University of Arkansas.](https://reader036.fdocuments.in/reader036/viewer/2022062312/5519b5ec5503467a578b47ce/html5/thumbnails/26.jpg)
Using codon tables to determine amino acid sequences encoded by DNA
736 c t g t t c c g t c g a g g g c c c g a c c g g t g g
mRNA c u g u u c c g u c g a _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
A.A. L F R R _ _ _ _ _
FL
L
I
M
V
S
P
T
A
Y
H
Q
N
K
D
E
C
W
R
S
R
G
![Page 27: Plant Hormones Anjali More University of Arkansas.](https://reader036.fdocuments.in/reader036/viewer/2022062312/5519b5ec5503467a578b47ce/html5/thumbnails/27.jpg)
The experiment:
Plant rice seeds – mutant and wildtype.Allow to germinate and then treat with GA at a young age.
Can alter volume, concentration, location, plant age, plant species...
![Page 28: Plant Hormones Anjali More University of Arkansas.](https://reader036.fdocuments.in/reader036/viewer/2022062312/5519b5ec5503467a578b47ce/html5/thumbnails/28.jpg)
These mutants, and others like them, have been considered for use in sustaining space travelers(see www.usu.edu/cpl) .
What properties make these plants potentially useful for space travel?
Mutant wildtypePlants of the same age