Piezoelectric Plate Sensor for in situ Genetic Detection ...4314/datastream... · Piezoelectric...
177
Piezoelectric Plate Sensor for in situ Genetic Detection of Hepatitis B Virus in Serum without DNA Isolation and Amplification A Thesis Submitted to the Faculty of Drexel University by Mehmet Çağrı Soylu in partial fulfillment of the requirements for the degree of Doctor of Philosophy August 2013
Transcript of Piezoelectric Plate Sensor for in situ Genetic Detection ...4314/datastream... · Piezoelectric...
Piezoelectric Plate Sensor for in situ Genetic Detection of Hepatitis B Virus in
Serum without DNA Isolation and Amplification
A Thesis
Submitted to the Faculty
of
Drexel University
by
Mehmet Çağrı Soylu
in partial fulfillment of the
requirements for the degree
of
Doctor of Philosophy
August 2013
© Copyright 2013
Mehmet Çağrı Soylu. All Rights Reserved.
ii
Dedication
Dedicated to: My precious son, Efe Kayra Soylu.
iii
Acknowledgements
I would like to express my gratitude to my advisors, Dr. Wan Y. Shih and Dr.
Wei-Heng Shih, for their priceless support, patience, guidance, and wisdom during my
Ph.D. This thesis would not be possible without them and their advising.
I would like to separately thank my committee members, Dr. Kambiz Pourrezaei,
Dr. Ahmet Saçan, Dr. Anthony P. Green, and Dr. Suresh G. Joshi, for their precious
suggestions, comments, and critiques that improved my perspective, and illuminated my
way in pursuing PhD degree.
I would also like to thank Dr. Banu Onaral for her support since the beginning of
my academic career in the USA and for placing her trust and confidence in my abilities to
accomplish graduate study.
I am grateful to the Ministry of National Education, Turkey for providing me this
scholarship to obtain this Ph.D. degree.
I would love to utter my appreciation to my lab mates, Dr. Youngsoo Chung,
Giang Au, Wei Wu, Song Han, Cheng-Hsin Lu, Kannaporn Pooput, Xin Xu, Chuan Qin,
for their invaluable help, warm friendships, and sharing their experience and knowledge
whenever I needed.
I would like to thank my lab mate, friend, and confidant, Dr. Ceyhun E. Kırımlı. I
think he will be successful in his academic life as much as his success in being a good
friend. I wish him good luck in his future academic career with all my heart.
iv
I would also love to express my gratitude to my parents in law, Cumali and
Songül Önen.
I would like to mention my appreciation to my parents, Mevlüt and Serpil Soylu,
and my brother, Mustafa Çağlar Soylu, for placing their trust and confidence on me and
standing behind me.
And I would like to thank to my son, Efe Kayra Soylu, for his supernatural ability
to make me smile even in my most desperate times, reminding me that the world is a
place worth to live, and giving a purpose and meaning to my life, which is to see him
happy.
Lastly, I would love to thank my beloved, lovely wife, Şebnem Soylu, for
showing me that there is one whom you can share a life with, there is one whom you can
devote your life for, and there is only one in the universe whom you can feel happy with.
v
Table of Contents
List of Tables ................................................................................................................... viii
List of Figures .................................................................................................................... ix
Abstract ............................................................................................................................ xiii
1. Chapter I: Background: Hepatitis B Virus and Diagnosis Methods of Hepatitis B .... 1
1.1 Hepatitis B Virus and Disease .............................................................................. 1
1.2 Diagnosis of Hepatitis B ...................................................................................... 6
1.3 The Importance of HBV DNA Detection ............................................................ 9
2. Chapter II: Review on DNA Detection Methods ...................................................... 13
2.1 Biosensor Platforms for DNA Detection ........................................................... 15
3. Chapter III: Piezoelectric Materials ........................................................................... 22
3.1 Piezoelectricity ................................................................................................... 22
4. Chapter IV: Piezoelectric Plate Sensor (PEPS) ......................................................... 27
4.1 Piezoelectric sensors and applications ............................................................... 27
4.2 Piezoelectric Plate Sensor (PEPS)...................................................................... 27
4.2.1 Overview ..................................................................................................... 27
4.2.2 PMN-PT PEPS ............................................................................................ 28
5. Chapter V: Objective and Aims................................................................................. 37
5.1 Objective ............................................................................................................ 37
5.2 Challenges for developing PEPS as a real-time, in situ HBV quantifier without
the need of DNA isolation and amplification................................................................ 37
5.2.1 Improving insulation to reduce signal noise ............................................... 37
5.2.2 Exposing genetic materials for real-time in situ viral genetic detection ..... 38
5.2.3 Prevention of nonspecific binding .............................................................. 38
5.3 Approaches ......................................................................................................... 39
5.3.1 Aim I: Investigation of MPS coating for better insulation ......................... 39
5.3.2 Aim II: Direct detection of ssDNA, dsDNA and viral DNA in spiked sera 41
5.3.3 Aim III: Direct detection of viral particles in spiked sera .......................... 42
6. Chapter VI: Electrical Insulation and Receptor Immobilization ............................... 43
vi
6.1 Electrical Insulation............................................................................................ 43
6.1.1 Introduction ................................................................................................. 43
6.1.2 Experimental Section .................................................................................. 48
6.1.3 Result and Discussion ................................................................................. 51
6.1.4 Conclusion .................................................................................................. 66
7. Chapter VII: Detection of ssDNA, dsDNA, and extracted viral DNA ...................... 67
7.1 Quantification on Receptor Immobilization ....................................................... 67
7.1.1 Introduction ................................................................................................. 67
7.1.2 Experimental Section .................................................................................. 69
7.1.2.1 PMN-PT PEPS fabrication ....................................................................... 69
7.1.2.2 Target DNAs, probe DNA, and reporter DNAs ...................................... 71
7.1.2.3 Immobilization on PEPS .......................................................................... 73
7.1.2.4 Immobilization on QCM .......................................................................... 75
7.1.3 Results and Discussion ................................................................................... 75
7.1.4 Conclusion ...................................................................................................... 81
7.2 Introduction to Viral DNA Detection with PEPS .............................................. 81
7.2.1 5% BSA solution as simulated serum ......................................................... 82
7.2.2 BSA blocking .............................................................................................. 83
7.2.3 Setup for double stranded HB viral DNA detection ................................... 85
7.2.4 In situ validation of specific target DNA detection with reporter
microspheres (MS) .................................................................................................... 88
7.3 Results and discussion ........................................................................................ 90
7.3.1 ssDNA, dsDNA, and extracted viral DNA detection ................................. 90
7.3.2 Effect of target DNA length ........................................................................ 94
7.3.3 Fluorescent Microspheres Validation ......................................................... 96
7.4 Conclusion ........................................................................................................ 101
8. Chapter VIII: Effect of Sample Volume at Extremely Low Concentrations .......... 102
8.1 Introduction ...................................................................................................... 102
8.2 Experimental Section ....................................................................................... 103
8.3 Results .............................................................................................................. 104
8.3.1 The Effect of Sample Volume .................................................................. 104
vii
8.3.2 The Estimation of captured DNA on PEPS .............................................. 106
8.4 Conclusion ........................................................................................................ 112
9. Chapter IX: Genetic Detection of HB viral particles .............................................. 113
9.1 Introduction ...................................................................................................... 113
9.2 Experimental Section ....................................................................................... 114
9.2.1 Setup for viral particles detection ............................................................. 114
9.3 Results .............................................................................................................. 115
9.4 Discussion ........................................................................................................ 133
9.5 Conclusion ........................................................................................................ 139
10. Chapter X: Conclusion ......................................................................................... 140
10.1 Investigation of MPS coating for better insulation .......................................... 140
10.2 Investigation of direct detection of ssDNA, dsDNA and viral DNA in spiked
sera 140
10.3 Investigation of direct detection of viral particles in spiked sera ..................... 141
LIST OF REFERENCES ................................................................................................ 142
viii
List of Tables
Table 7.1 The sequences and lengths of the probe DNAs, target DNAs, reporter DNAs,
and their corresponding melting temperatures, TM. (*Heating at 95°C denatures double
stranded DNA regardless its length.171
) ............................................................................ 72
Table 7.2 Percentages of relative frequency shifts at various concentrations due to
dsDNA and viral DNA over relative frequency shift due to ssDNA and percentage of
relative frequency shift at various concentrations due to viral DNA over relative
frequency shift due to dsDNA .......................................................................................... 95
Table 8.1 ∆f due to DNA captured by PEPS at extremely low concentrations .............. 110
Table 9.1 The effect of heating time on lysing the virus ................................................ 124
Table 9.2 The effect of detergents on lysing the virus .................................................... 124
Table 9.3 Estimated and PCR results for bacterial blinded tests .................................... 133
Table 9.4 p-values of t-test for the viral particles detection ........................................... 136
ix
List of Figures
Figure 1.1 An illustration of Hepatitis B Virus (HBV) (© 2002 James A. Perkins,
Medical and Scientific illustrations, http://people.rit.edu/japfaa/infectious.html) ............. 2
Figure 1.2 An illustration of HBV replication steps (Dienstag, J. L., Drug therapy -
Hepatitis B virus infection. New England Journal of Medicine 2008, 359, (14), 1486-
1500.)18
................................................................................................................................ 5
Figure 1.3 The cumulative incidence for chronic hepatitis B patients to develop
hepatocellular carcinoma (HCC) with respect to the level of serum HBV DNA (Ayoub,
W. S.; Keeffe, E. B., Review article: current antiviral therapy of chronic hepatitis B.
Alimentary Pharmacology & Therapeutics 2011, 34, (10), 1145-1158.)69
...................... 10
Figure 3.1 Some natural piezoelectric materials (Manbachi, A.; Cobbold, R. S. C.,
Development and application of piezoelectric materials for ultrasound generation and
detection. Ultrasound 2011, 19, (4), 187-196.)109
............................................................ 23
Figure 3.2 An illustration of the direct piezoelectric effect: a) before applying stress, and
b) during stress .................................................................................................................. 25
Figure 3.3 An illustration of the converse piezoelectric effect: a) before applying an
electric field, and b) and during an electric field .............................................................. 26
Figure 4.1 A schematic of PEPS electrically insulated with MPS coating for in liquid
detection ............................................................................................................................ 30
Figure 4.2 (a) A micro graph of PEPS, and (b) a cross-section SEM micrograph of PMN-
PT material ........................................................................................................................ 31
Figure 4.3 (a) A schematic top view of the first LEM, (b) WEM vibration where the
yellow rectangle illustrates the initial position of the PEMS and the dash line rectangle
illustrates the bent or extended positions, and c) the spectrum of a PEPS. ...................... 33
Figure 4.4 Dose-response of synthesized DNA detection in phosphate buffered saline
(PBS) by using PEPS (Wu, W.; Kirimli, C. E.; Shih, W. H.; Shih, W. Y., Real-time, in
situ DNA hybridization detection with attomolar sensitivity without amplification using
(pb(Mg1/3Nb2/3)O3)0.65-(PbTiO3)0.35 piezoelectric plate sensors. Biosens Bioelectron
2013, 43, 391-9.)124
........................................................................................................... 35
Figure 6.1 Hydrolysis Reaction of MPS Adsorbed on a Gold Surface ............................ 45
x
Figure 6.2 Condensation Reaction of Two Adjacent Hydrolyzed MPS on a Gold Surface
........................................................................................................................................... 45
Figure 6.3 Anionic Hydrolysis Reaction of MPS on a Gold Surface under Basic
Conditions ......................................................................................................................... 46
Figure 6.4 Schematic of the setup for in situ measurement of MPS coating thickness on
the gold electrode surface of a QCM ................................................................................ 49
Figure 6.5 Δf versus time of a 5 MHz QCM undergoing MPS coating in (a) 1% MPS
solutions with 0% DI water in ethanol, (b) 1% MPS solutions with 1% DI water in
ethanol, and (c) 0.1% MPS solutions with 0.5% DI water in ethanol at various pH values.
The corresponding thickness in nm as determined by Eq 1 is labeled along the right y-
axis. ................................................................................................................................... 53
Figure 6.6 Coating rate versus pH in 1% MPS and 1% DI water (open circles) and in
0.1% MPS with 0.5% DI water (open diamonds). The coating rate at each pH was
determined as the slope of the least-squares fit of the curve shown in Figure 6.5 (a) – (c)
of that pH. Labeled on the right y axis is the estimated 36 h coating thickness by
multiplying the QCM coating rate by 36. The filled symbols depict the 36 h coating
thickness obtained from the SEM. .................................................................................... 54
Figure 6.7 CV curve of 36 h MPS coating in (a) 1% MPS + 0% DI water (the insert
shows an optical micrograph of one of the gold-coated glass slides used for the
experiments), (b) 1% MPS + 1% DI water (the insert shows the blowup at pH 8.0 and
9.0), and (c) 0.1% MPS + 0.5% DI water (the insert shows the blowup at pH 9.0). ........ 56
Figure 6.8 (a) Cross-section view, (b) top-view SEM micrographs of MPS coating after
36 h coating in 1% MPS + 1% DI water at pH 9, and (c) cross-section view SEM of a
MPS after 36 h in 1% MPS + 1% water at pH 8.0............................................................ 58
Figure 6.9 (a) Cross-section view and (b) top-view SEM micrographs of MPS coating
after 36 h in a 0.1% MPS solution in ethanol with 0.5% DI water at pH 9, which indicates
that the 36 h coating thickness was about 70 nm, consistent with the 72 nm thickness
estimated from the QCM result......................................................................................... 59
Figure 6.10 Jmax versus pH with 1% MPS and 0% DI water (black), 1% MPS and 1% DI
water (red), and 0.1% MPS and 0.5% DI water (green) where Jmax was the maximal
amplitude of current density. ............................................................................................ 61
Figure 6.11 In-air and in-PBS phase angle versus frequency resonance spectra of PEPS
insulated in (a) 1% MPS with 0% water at pH 4.5, (b) 1% MPS with 1% water at pH 9.0,
and (c) 0.1% MPS with 0.5% water at pH 9.0. The insert in panel a shows an optical
micrograph of a PEPS. ...................................................................................................... 63
xi
Figure 6.12 Stability performance in terms of resonance frequency shift versus time in
PBS of two different PEPS each with a different MPS coating: (a) PEPS A with MPS
coating in 1% MPS with no water at pH 4.5 and (b) PEPS C with MPS coating in 0.1%
MPS and 0.5% water at pH 9.0. Note that the data shown were the average of two
independent runs and panels a and b had different scales in terms of Hz. ....................... 65
Figure 7.1 In air (black) and in PBS (red) phase angle versus frequency spectra of a
PEPS. ................................................................................................................................ 70
Figure 7.2 Immobilization scheme ................................................................................... 74
Figure 7.3 QCM frequency shift due to sulfo-SMCC and probe DNA binding ............... 76
Figure 7.4 A schematic of how the polarization direction changes with electric field (E):
a) for E>0, and b) for E<0 (Zhu, Q.; Shih, W. Y.; Shih, W. H., Mechanism of the flexural
resonance frequency shift of a piezoelectric microcantilever sensor in a dc bias electric
field. Applied Physics Letters 2008, 92, (3).)178
............................................................... 78
Figure 7.5 Comparison of PEPS and QCM frequency shifts due to sulfo-SMCC and
probe DNA binding........................................................................................................... 80
Figure 7.6 A schematic illustration of 5% BSA blocking. ............................................... 84
Figure 7.7 An illustration of detection setup .................................................................... 87
Figure 7.8 A scheme of the fluorescent microspheres validation ..................................... 89
Figure 7.9 Resonance frequency shift during several steps of immobilization and
detection. ........................................................................................................................... 92
Figure 7.10 a) Dose-response of extracted Hepatitis B Virus DNA detections in 7.5ml of
5%BSA+PBS, b) Comparison of relative frequency shifts versus concentrations of
synthesized single and double stranded DNA and viral DNA .......................................... 93
Figure 7.11 Electrical confirmation for the viral DNA detection by using fluorescent
micrographs....................................................................................................................... 97
Figure 7.12 Fluorescent images of FRMs for the confirmation of viral DNA detections at
a) 30 copies/ml, b) 60 copies/ml, c) 600 copies/ml, and d) 60,000 copies/ml of
concentrations ................................................................................................................... 98
Figure 7.13 Relative frequency shifts due to fluorescent microspheres at certain
concentrations. ................................................................................................................ 100
xii
Figure 8.1 Comparison of relative frequency shifts versus concentrations of viral DNA
detections in 3.5ml, 7.5ml, and 50ml of sample solutions. ............................................. 105
Figure 8.2 ∆f/f values of viral DNA detections in 3.5 and 7.5mL of sample solutions vs.
concentrations ................................................................................................................. 108
Figure 8.3 ∆f due to DNA captured by PEPS and linear fitting ..................................... 111
Figure 9.1 Viral and human DNA detection by pDNASgene1 .......................................... 116
Figure 9.2 Viral and human DNA detection by pDNASgene2 .......................................... 118
Figure 9.3 Dose-response results of extracted HBV DNA detections with pDNASgene2 120
Figure 9.4 Dose-response results of viral DNA detections in viral particles spiked
samples ............................................................................................................................ 122
Figure 9.5 Dose-response results of viral DNA detections in viral particles spiked
samples with 10% SDS ................................................................................................... 126
Figure 9.6 Comparison of ∆f values due to viral DNA with 0% SDS and viral particles
detections with 10% SDS................................................................................................ 128
Figure 9.7 Electrical validation for the detection of viral particles by using fluorescent
microspheres ................................................................................................................... 130
Figure 9.8 The fluorescent micrographs of sensor surface after fluorescent microsphere
validation of viral particles detection at a) 300 copies/ml, b) 600 copies/ml, and c) 6000
copies/ml of concentrations ............................................................................................ 132
Figure 9.9 Gel electrophoresis picture of PCR results for blinded sample A, ................ 134
Figure 9.10 Gel electrophoresis picture of PCR results for blinded sample B, .............. 135
Figure 9.11 Sample size determination with 0.9 confidence level ................................. 138
xiii
Abstract
Piezoelectric Plate Sensor for in situ Genetic Detection of Hepatitis B Virus in Serum
without DNA Isolation and Amplification
Mehmet Çağrı Soylu
Wan Y. Shih, Ph.D.
Wei-Heng Shih, Ph.D.
Hepatitis B is a viral infection caused by Hepatitis B virus (HBV) that attacks the
liver and can cause both acute and chronic disease in humans. Worldwide, two billion
people are infected with the virus and about 350 million people suffer from chronic HBV
infection. To diagnose chronic HB the current gold standard is quantitative real-time
polymerase chain reaction (qPCR) quantifying serum viral load. However, qPCR needs
expensive equipments and chemical agents. A low-cost HB viral load quantification tool
will help identifying patients for treatment and save lives. A lead magnesium niobate-
lead titanate (PMN-PT) piezoelectric plate sensor (PEPS) is a new type of sensor
developed in Shih’s laboratory. In-situ real time detection is achieved by monitoring the
PEP’s resonance frequency shift which is caused by binding of the target to the receptor
on the PEPS surface. What makes the PEPS unique is that the shift is caused by the stress
generated by the binding of the target and is inherently amplified by the polarization
switching in the PMN-PT layer. 3-Mercaptopropyltrimethoxysilane (MPS) coating has
previously been used on a PEPS is not sufficient for DNA detection requiring high
sensitivity. Furthermore, direct detection of HB viral count in human serum in situ
requires releasing the genetic material and de-hybridization of viral DNA.
xiv
The goal of this thesis is first to improve the insulation coating and second to
examine direct quantification of HB viral count without DNA isolation, concentration,
and amplification using PMN-PT PEPS. We have shown that by coating the PEPS with
0.1% MPS and 0.5% water at pH 9 for 36 hr reduced the current by two orders of
magnitude and that with such insulation the width extension mode (WEM) resonance
frequency of a PEPS was stable, i.e., with <9 Hz standard deviation at a resonance
frequency of 3.33 MHz for more than 24 h in a phosphate buffered saline (PBS) solution.
The surface of the coating was also smooth, optimal for PEPS binding stress induced
detection resonance shift. In situ detection of viral DNA spiked in simulated serum in
one single test was accomplished with a flow system where the viral DNA was first
denatured in a reservoir at 95C, followed by fast cooling in narrow tubing in a cooling
medium to allow the denatured DNA to be detected by the PEPS in the detection cell at
55C. PEPS has demonstrated 30 copies/ml analytical sensitivity in such in situ viral
DNA detection. By examining viral DNA detection at extremely low concentrations such
as 10-100 copies/ml with different volumes, we estimated that one copy of viral DNA
caused a WEM detection resonance frequency shift of -f = 1.7 Hz per copy. In situ
detection of HB viruses in simulated serum in one single test was achieved by adding
10% sodium dodecyl sulfate (SDS) in the simulated serum samples spiked with HB viral
particles where the viral particles were lysed, DNA released and denatured at 95C for 10
min in the reservoir. Results indicate that using such schemes PEPS could in situ detect
the genetic signature of HB viral particles in simulated serum in a single test in 40 min
with 300 copies/ml sensitivity.
1. Chapter I: Background: Hepatitis B Virus and Diagnosis Methods of
Hepatitis B
1.1 Hepatitis B Virus and Disease
Hepatitis B (HB) is a viral infection by hepatitis B virus (HBV) illustrated in
Figure 1.1 that attacks the liver and can cause both acute and chronic disease in humans.
Two billion people worldwide are infected with the virus, and about 350 million people
suffer from chronic infection.1 600,000 people are estimated to die each year from acute
or chronic HBV infection2. Left untreated, chronic HB leads to cirrhosis and liver cancer.
1 in 4 adults chronically infected by HBV during childhood later die from liver cancer or
cirrhosis caused by the chronic infection.3 Liver cancer caused by HBV is among the first
three causes of death from cancer in men, and a major cause of cancer in women.4 Liver
cancers are often found in a late stage with a 5-year survival rate of <5% and more than
80% of liver cancer patients are chronic HB patients.5-8
2
Figure 1.1 An illustration of Hepatitis B Virus (HBV) (© 2002 James A. Perkins,
Medical and Scientific illustrations, http://people.rit.edu/japfaa/infectious.html)
3
In developing countries such as China and eastern Asia, about 8-10% of the
population is chronically infected with HBV.2, 9
In other words, approximately 135
million people in China suffer from chronic HBV. HBV carriers may be asymptomatic
and are unaware that they are infected with HBV.10
On the other hand, hepatitis B
infection is a treatable disease due to the recent development in anti-viral medications.11
Therefore, it is important to identify people with chronic HB infection so they can be
treated.5-7
Hepatitis B virus can be transmitted among hosts by three ways, which are direct
blood to blood contact, sexual activity and perinatal transmission.12
Transmission modes
of Hepatitis B are the same as those for the human immunodeficiency virus (HIV).13
However, HBV is excessively infectious in comparison with HIV.14
Whereas HIV can
survive outside the body for several hours,15
the Hepatitis B Virus can survive outside the
body for at least seven days.16
During this time, the Hepatitis B Virus may be infectious,
if it gets in the body of a person not protected by the vaccine.5, 17, 18
Hepatitis B virus has a partially double-stranded relax circular DNA (rcDNA).19
In its genome, there are 3200 nucleotides encoding four main genes which express the
viral proteins. Viral proteins consist of the envelope protein, hepatitis B surface antigen
(HBsAg); a structural nucleocapsid core protein, hepatitis B core antigen (HBcAg); and a
soluble nucleocapsid protein, hepatitis B e antigen (HBeAg).20
The core antigen (HBcAg)
is encoded by the hepatitis B core genes, and the hepatitis e antigen (HBeAg) is encoded
by the precore gene. Virus-infected cells secrete HBeAg.18
The outer lipid envelope of
4
the virus contains three types of hepatitis B surface antigen (HBsAg). Small (S), medium
(M) and large (L) surface antigens, which are encoded by PreS1, PreS2 and S genes,
respectively, are the proteins on outer surface.21
Virus-infected hepatocytes secrete
HBsAg, but no virions (neither empty nor DNA-filled).22
In other words, the surface
antigen is secreted as non-infectious subviral particles.17, 23-25
Serum HBsAg is one of the most significant markers of HBV infection, and the
antibodies against the HBsAg indicate the body’s immune response to the viral infection.
HBeAg is a serum marker of active viral replication when the HBV DNA count in serum
is 100,000 to 1 million copies/ml or higher. Hepatitis B endures a retroviral replication
which is reverse transcription from RNA to DNA.20
Annihilation of HBV infection is
difficult due to the stable, long enduring, covalently closed circular DNA (cccDNA)
placed in hepatocyte nuclei and HBV DNA integrated into the host genome (Figure
1.2).18
5
Figure 1.2 An illustration of HBV replication steps (Dienstag, J. L., Drug therapy -
Hepatitis B virus infection. New England Journal of Medicine 2008, 359, (14), 1486-
1500.)18
6
Acute Hepatitis B is initial infection of Hepatitis B virus. Acute infection may not
cause any symptoms or may make infected individuals seriously ill. Most of adults
patients recover and can be rid of the virus without any problems. When there are still
Hepatitis B viruses left in the blood stream for more than six months, the patient is
diagnosed as having a "chronic infection". Chronic infection is more dangerous than
acute infection and can end up with cirrhosis and hepatocellular carcinoma regardless of
having any symptoms.26-34
1.2 Diagnosis of Hepatitis B
The diagnosis of HBV infection is made by its biochemical, virological and
histological features. Chronic HBV infection can be diagnosed by routine liver function
tests and serological assays for the detection of HBV antigens (HBsAg and HBeAg) and
antibodies (anti-HBs, anti-HBc and anti-HBe). In order to determine the phase of chronic
hepatitis B, disease activity, candidacy for antiviral therapy and response to treatment,
monitoring HBV DNA levels in serum is essential. In some cases, liver biopsy might be
essential to verify the diagnosis, recognize any simultaneous disease affecting the liver,
and determine the stage of fibrosis and the necroinflammation.26, 35
Due to the recent advent of HB antiviral treatment, chronic HB is curable, if
diagnosed early. HBV DNA quantification is critical in treatment monitoring. Besides,
HBV DNA detection-quantification is necessary to determine whether HBV is replicating
or not. A patient’s infectious state is correlated with the serum viral count (<10,000
7
copies/ml HBV inactivity). In clinical studies, IU/ml has been used as unit for viral count,
however copies/ml will be used as unit in this study to provide consistency. 1 IU/ml is
approximately equal to 5 copies/ml HBV.36
However, active chronic HB would be
asymptomatic, and active chronic HB patients might be unaware that they are infected
with HBV. Additionally, some studies have shown that there is still a risk of liver cancer
and death for even inactive HB carriers (300-10,000 copies/ml).26-33
HBV DNA is detectable in serum of more than 90% of infected individuals who
are positive for hepatitis B surface antigen (HBsAg) and hepatitis B e antigen (HBeAg).
The usage of detection and quantification of HBV DNA is the most preferred diagnostic
technique to measure the number of infectious particles, and important diagnostic and
prognostic information can be obtained by measuring the HBV DNA level in serum.37-42
Detection of genetic signatures allow us to quantify the amount of genetic
material, differentiate the strains and the drug resistive type of viruses at very early stage
of infection, provide proper disease treatment, and monitor treatment process.43-45
Polymerase-Chain-Reaction (PCR) can amplify a single or a few copies of a piece
of DNA across several orders of magnitude, generating thousands to millions of copies of
a particular DNA sequence. Polymerase-Chain-Reaction (PCR) is used as gold standard
to quantify the number of genetic materials. Currently, DNA detection is carried out
using commercial polymerase chain reaction (PCR) to quantify DNA concentration in
serum with a sensitivity of 20-60 IU/ml (100-300 copies/ml) using real-time (RT) PCR.19
8
Using PCR, pathogenic microorganism’s genetic signature can be detected at early stage
of the initial infection. However, PCR is complex, and expensive. It requires
sophisticated equipment and highly trained personnel, which is not readily available in
developing countries.27, 46-48
There are also some commercial DNA detection kits that are based on signal
amplification following molecular hybridization (including the ‘hybrid capture’ and the
‘branched DNA’ methods) with the best sensitivity of 2000 copies/ml.49, 50
However,
these systems require amplification, purification, isolation, well trained operators, and
they are time consuming.50
Methods under development such as fluorescence, quartz crystal microbalance
(QCM), electrochemical, binding to nano-metal particles, surface plasmon resonance
(SPR) and microcantilevers exhibit a concentration sensitivity of 6x105 copies/ml to
6x109 copies/ml.
51-56 Although many of these methods are label-free, they are still
insufficient for the pathogenic microorganism’s DNA detection that requires sensitivity at
<300 copies/ml.33
Although atomic force microscopy (AFM) has capability of detecting
DNA at 60 copies/ml sensitivity, it is not rapid, high-throughput, multiplex, and field-
ready detection.57
As mentioned above, due to the recent advent of HB antiviral treatment, chronic
HB is curable, if diagnosed early. However, chronic HB is asymptomatic, and chronic
HB patients are unaware that they are infected with HBV. Most chronic HB patients live
9
in developing countries screening patients for chronic HB with PCR is too expensive to
be readily available. A sensitive, low-cost HB viral load quantification tool will help
identify patients for treatment and save lives.
1.3 The Importance of HBV DNA Detection
Acute Hepatitis B is initial infection of Hepatitis B virus. Acute infection may
not cause any symptoms or could make infected individuals seriously ill. Most of adults
patients recover and get rid of the virus without any problems. If there is still Hepatitis B
virus left in the blood stream for more than six months, the patient is diagnosed as having
a "Chronic Infection".58-63
HBV infection causes 1.2 million deaths each year, and it is the 10th leading
cause of death worldwide. 40% of chronic HBV patients will develop liver disease. In
eastern Asia, 1 in 10 people is chronically infected with HBV.64-66
Chronic HB is
asymptomatic, and chronic HB patients are unaware that they are infected with HBV.63
Chronic infection is dangerous and ends up with liver diseases regardless having
any symptoms. According to the recent studies, 40% of chronic hepatitis B patients will
finally develop liver failure, such as acute exacerbation on liver, cirrhosis, and
hepatocellular carcinoma (HCC).64, 67, 68
A patient’s infectious state is more correlated
with the serum HBV DNA count (<104 copies/ml HBV inactivity). However, there is still
a risk of liver cancer and death for some inactive HB carriers (down to 3x102 copies/ml).
The risk for chronic hepatitis B patients to develop hepatocellular carcinoma with respect
to the level of serum HBV DNA can be seen in Figure 1.3.69
10
Figure 1.3 The cumulative incidence for chronic hepatitis B patients to develop
hepatocellular carcinoma (HCC) with respect to the level of serum HBV DNA (Ayoub,
W. S.; Keeffe, E. B., Review article: current antiviral therapy of chronic hepatitis B.
Alimentary Pharmacology & Therapeutics 2011, 34, (10), 1145-1158.)69
11
Serum HBsAg level is really correlated to acute infection. Chronic HBV carriers
may have the level of HBsAg in serum lower than the HBsAg ELISA kit’s detection limit
(0.5 ng/ml). HBeAg-negative chronic hepatitis B patients may be misclassified as
inactive carriers due to the lower HBV DNA levels than the limit of active HBV infection
(<10,000 copies/ml). As can be seen in Figure 1.3, there is still death risk for patients
with HBV DNA level lower than activity limit. If the variation in HBV DNA level is
monitored by a sensitive DNA detection method, development of liver diseases and death
can be prevented by early detection and choosing appropriate antiviral therapy.70
Determination of HBV genotype by HBV DNA detection has an impact on both
progression of chronic hepatitis B and antiviral therapy. Chronic hepatitis B patients with
genotype A, B, D or F are naturally HBeAg-negative at <20 years of age, while the
patients with genotype C are HBeAg-negative at a mean of 47.8 years.69, 71
Chronic HBV
patients with different genotypes may have different disease progress, and diagnosis and
observation of disease progress may be difficult. Besides, the recent studies have clearly
demonstrated that the different HBV genotypes have a significant role on response to
antiviral therapy. Thus, determining the genotypes of hepatitis b virus could considerably
be useful to decide an appropriate treatment and estimate the response to antiviral therapy
in patients affected by chronic hepatitis B.72
Due to the recent advent of HB antiviral treatment, chronic HB is curable, if
diagnosed early. Choosing appropriate antiviral therapy for HB by establishing the
12
genotype of HBV can prevent the liver failure which is seen at the late phase of chronic
hepatitis B.69
HBV DNA detection and quantification are necessary to determine whether HBV
is replicating or not, and also critical in treatment monitoring as well.
PCR is used as gold standard for DNA detection. Quantitative Real-time PCR
(RT-PCR) is able to quantify the number of HBV DNA level in serum at 100 copies/mL.
DNA detection kits are based on signal amplification by PCR following molecular
hybridization (2x103 copies/ml). However, PCR requires complex lab-works such as
isolation, concentration and is expensive. It requires DNA isolation, sophisticated
equipment and highly trained personnel, which is not readily accessible for developing
countries.27, 46-48
Most chronic HB patients live in developing countries and screening
patients for chronic HB with PCR is too expensive and not readily available.
A sensitive, simple, more readily available HB viral load quantification tool will
help identify patients for treatment and save lives.
13
2. Chapter II: Review on DNA Detection Methods
Analytical appliances which are named as biosensors, translate biochemical
reactions or interactions to analytical signals that can be enlarged, processed and saved.
DNA biosensors contain an immobilized DNA strand in order to identify the
complimentary sequence by DNA–DNA hybridization. Furthermore, DNA biosensors
can be used to detect other analytes, with the probe molecule which can be in the form of
an aptamer.73
Using DNA biosensors in the diagnosis of infectious diseases makes it easier to
differentiate diverse strains of a pathogen with right choice of strain-specific DNA probes
and it provides earlier diagnosis chance comparing to immunosensors.74
Even though the
ultimate goal is to determining DNA traces autonomously, in clinical samples, it is still
necessary to make PCR amplification previously until reaching detectable DNA levels.75
Although they are able to render unlimited sensitivity and amplification, PCR settings are
generally very complex, contaminate easily and they require trained manpower and huge
equipment.76
While current endeavors with DNA chips pursue the mission of creating PCR-free
DNA detection systems, this, however, has not been accomplished fully in commercial
devices because they are not as sensitive as PCR and needs PCR for amplification.73, 77
In
general, hybridization indicator (marker) is used for DNA duplex formation detection.78
14
DNA chips are time-consuming, expensive and complex, and it is only sensitive when
combined with PCR.77
DNA chips (or DNA microarrays) are one of the main trends towards the study of
novel diagnostic methods which usually involve microfabricated diagnostic tools using
techniques such as screen printing. The aim is creating high opaque microband sensor
collections covered with various explorations for immediate detection of several DNA-
target series (with or without a label) printed on the chip by traditional
photolithography.79
DNA microarrays (DNA chips) have been used for researches on
genomic structure and gene expression at length for various and concurrent target
detection.80
Large-scale and decentralized DNA testing is required for clinical applications.
New methods for DNA analysis include DNA chips (DNA microarrays)81
and
microfluidics82
that couples DNA detection with model pretreatment under in vivo-like
hybridization circumstances such as fast DNA hybridization and denaturation under flow
conditions.83
Nano engineered structures may produce higher sensitivity and specificity,
such as carbon nanotubes (CNTs) (210 × 106 copies/ml of sensitivity)
84 and DNA/protein
conjugates (12 × 106 copies/ml of sensitivity).
80, 85
In this chapter optical, electrochemical, piezoelectric, and magnetic particles
methods for DNA detection are reviewed as follows.
15
2.1 Biosensor Platforms for DNA Detection
Optical fiber sensors have an important place in bio-chemical sensing applications
due to its size, light weight and high flexibility obtained by fiber optic properties. The
working principle of an optical fiber sensor is based on either direct or indirect sensing
mechanisms. In the direct sensing, measuring relies on the analyte’s native optical
properties, such as its refractive index, absorption, or emission. In case of the indirect
sensing mechanism, the color or fluorescence of an indicator immobilized on sensor,
label, or bio-probe which is optically detectable is monitored. The optical fiber sensor has
an bio-chemical transducer system. The transducer system changes the optical properties
based on interaction with the analyte. The transduction reagent is immobilized on a
membrane that is held against the fiber.86-88
Most of the DNA optical biosensors use an optical strand to proliferate the signal
produced by a fluorescent label. Generally, a DNA single chain probe is located in the
ending of the fiber and, subsequent to hybridization with the flattering chain, changes in
the fluorescence intensity ensuing from the discerning relationship between the DNA
duplex and the label are measured.80
Although it is regenerated after extended storage and belligerent washings, the
sensitivity was not as high as PCR and classic nucleic acid hybridization. The biohazard
concern of working with carcinogenic compounds is another problem which causes the
search for alternatives.75
16
Biosensors which are based on optical fibers are appropriate for miniaturization,
because of the too small diameter of the fibers. By conveying light for long distances
without losing signal, detection of inaccessible or hazardous samples is allowed. The
optical structure of the signal emits intrusion from electrical noises and, is appropriate for
in vivo implementations. These biosensors generally have low stability and are apt to
intrusion from environmental light, separately the high cost of quartz optical fibers for
transmission of UV light.80
Optical transmission through tiny compounds gained a new impulse with the
beginning of the surface plasmon resonance (SPR) technique, with directing light waves
to the border among a metal and a dielectric. A real-time SPR organization under
incessant flow was applied to DNA detection, by an immobilized biotinylated study in an
avidin-covered chip, and additional requisite of the target-DNA.89
The resonant mirror is another kind of optical biosensor , an transitory wave
sensor that mingles the straightforwardness of SPR devices with the superior sensitivity
of wave-guiding devices.75
These biosensors calculate discrepancies in the exterior
optical parameters thanks to the biochemical reaction (e.g. DNA hybridization),
specifically the interfacial refractive index. They have found prominent functions in
detecting human genetic mutations and nM levels of PCR products from organisms that
are genetically modified.90, 91
The immense attention of fleeting waves for biosensor
applications come out from needless target-chain labeling, speed of the hybridization
17
reaction, and 100-fold or more probe reutilization. A considerable problem is the low
sensitivity which require up to 10 µg of DNA per milliliter.92
Colorimetric biosensors are an alternative to fluorescent tagging for DNA
detection. This kind of biosensors is harmless, simple and inexpensive. Detection is
carried out by a reaction with signal amplifier. Their detection limit is at 1 pg of target
DNA.80
Funcionalized gold nanoparticles (GNPs) have been used as an alternative system
to DNA labeling in optical detection. GNPs have relatively higher stability and low noise
level than fluorescent tagging.93
By using conjuction with DNA/nanoparticles conjugates,
the detection principle of colorimetric biosensors can be explained.94
The most advantageous part of this system is GNPs which are used without
hindering signal interpretation. This technique is rapid, uncomplicated, cheap and
appropriate for the usage of other types microspheres and nanoparticles. Recent
development has shown that DNA/nanoparticle-based colorimetric biosensors have
encouraging potential to be a point-of-care diagnosis tool. However, the low sensitivity at
millions of copies per ml is a main drawback in this type of DNA detection platform.80, 95
Recently, quantum dots have been known as one of the most important and
popular nano particles for fluorescent tagging of probe biomolecules. The colors of
quantum dots are really related to their size. Its broad absorption spectra and narrow
18
emission shifts provides discrete room between excitation and emission wavelengths.96
These useful properties of quantum dots make dots discernible labels for unlike targets.
Recently, it has been demonstrated that quantum dots is used as biomarkers to
functionalize nanotubes for improved DNA detection in terms of sensitivity.97
But, still
QDS with 60,000 copies/ml of sensitivity are not as sensitive as DNA detection
requires.80, 98
A single DNA molecule with several hundred base pairs has a considerably high
molecular weight. When hybridization happens between single stranded DNA molecule
and its complementary part, the total mass on the piezoelectric quartz surface where
probe DNA is immobilized increases. Thus, it causes a change in resonance frequency of
quartz. This is the principle of the well-known quartz crystal microbalance (QCM). Since
its sensitivity limit is at several fM of target DNA, it is clearly seen that the only mass of
DNA is not enough for the required sensitivity for clinical applications.80
In literature, it has been known that there are a few piezoelectric microcantilever
sensors for ssDNA detection. PZT piezoelectric-exited cantilever sensor (PEMS) is one
of those sensors, and has been used for extracted ssDNA detection at 700 copies/ml
sensitivity limit. However, it requires extraction and concentration of genomic DNA for
detection purpose. On the other hand, it also needs DNA de-hybridization in other place
before detection. Whereas it is sensitive, extraction, concentration and de-hybridization
steps PEMS requires makes ssDNA as time-consuming as PCR.99
Another PZT
microcantilever is able to detect PCR products de-hybridized in other place at 13.8 x 106
19
copies/ml sensitivity level by using silica nanoparticles to amplify the signal for
sensitivity enhancement. This method’s sensitivity level is not appropriate for DNA
detection which requires high sensitivity. Additionally, it uses silica nanoparticles to
improve the detection limit only up to several millions copies/ml.100
In previous studies,
it is known that denaturation of double stranded DNA has been carried out in other
chamber or place, not in situ.
For electrochemical DNA sensing, a single stranded DNA is immobilized on an
electrode, which is used for measuring changes, a result of hybridization, in electrical
parameters such as current, potential, and impedance. The materialization of solid
electrodes has made electrochemical DNA detection applicable.80
In order to produce electrical signal for DNA detection, generally enzymatic
labels have been used. The enzymes which were previously conjugated to probe DNA
activate the redox reaction. Thus, there is an electrochemical change on electrode because
of hybridization. In PCR-free DNA detection, electrochemical DNA detection amplified
by enzymes is the most promising methodology with 3 x 106 – 6 x 10
6 copies/ml of
sensitivity. This methodology is very complex and time consuming and needs
purification of target DNA, whereas it is sensitive.101, 102
In other technique, hybridization indicators which have different binding affinities
for single and double stranded DNAs have been used, and electroactively exhibit the
difference on electrode surface in terms of hybridization concentration. Thus, they clearly
show the variation in electrochemical response with 1 x 106 copies/ml of detection
20
limit.103
While this technique is able to recognize the target effectively and selectively, it
does not still match the sensitivity requirement of HBV viral count quantification.104, 105
Consequently, electrochemical methods for DNA detection are comparatively
sensitive, simple, rapid, and cheap. They are also quite appropriate for
commercialization.73
However, they still need isolation, concentration, and sample
preparation.106
In DNA detection with magnetic particles, it has recently been known that metal
nanoparticles/DNA/magnetic microbeads sandwich model has been extendedly used.107
When probe DNAs conjugated on a magnetic nanoparticle hybridize with their target
DNA, the magnetic moments of magnetic nanoparticles under the effect of a magnetic
field line up communally and produce a meaningful signal. In the interim, the arbitrarily
DNA sequences, which allows to eradicate the need of washing, does not give any net
signal. In the last several years, usage of magnetic micro and nano particles in DNA
detection has dramatically raised. However, magnetic particles in DNA detection still
need applications of magnetic particles yet needs some enhancement in terms of
sensitivity and noise background, therefore is not in situ or real time108
.
In the biosensing literature, DNA detection has an important place. As mentioned
previously, no platform for DNA detection has been yet capable of detecting DNA at
PCR-like sensitivity without amplification. PCR is still the gold standard for DNA
detection. The need of isolation, concentration, and sample preparation indicate that most
21
of DNA detection methods under development would not be easy, thus won’t be
competitive compared to commercial PCR.
None of the technologies completely fulfills the requirements of unmet need
mentioned in Chapter 1. Still, there is a need of a sensitive, simple, more readily available
HB viral load quantification tool will help identify patients for treatment and save lives.
22
3. Chapter III: Piezoelectric Materials
3.1 Piezoelectricity
Literally, piezoelectricity means ‘pressure-driven electricity’. According to the
online etymology dictionary, ‘Piezo’ comes from the Greek root ‘piezein’ meaning ‘to
press, squeeze’; and ‘electricity’ comes from the Greek word ‘elektron’, an ancient
source of electric charge. Practically, some solid materials generate electricity when they
are exposed to pressure, and slightly move when an electric field is applied. The first
phenomenon is named as ‘piezoelectric effect’ and the reverse is named as ‘converse
piezoelectric effect’. Some of these materials can be seen in Figure 3.1.109
23
Figure 3.1 Some natural piezoelectric materials (Manbachi, A.; Cobbold, R. S. C.,
Development and application of piezoelectric materials for ultrasound generation and
detection. Ultrasound 2011, 19, (4), 187-196.)109
24
When a molecule has positive and negative electrical charges separated it is
known as a dipole moment. The dipole moment is a vector that extends from the negative
charge to the positive charge. The vector summation of all the dipole moments per unit
volume of a crystal is called the dipole density, also known as the polarization density
with the unit of C.m/m3.110
The molecular dipole moments in a piezoelectric crystal can
re-orient themselves, when the crystal is exposed to a mechanical stress. This effect
causes a difference in surface charge, and thus a voltage. This phenomenon is called the
direct piezoelectric effect and can be seen in Figure 3.2. Likewise, the shape of the
dipoles slightly can change when the piezoelectric crystal is exposed to an electric field.
This change in the shapes of dipoles leads to change in the material dimensions. This
phenomenon is called the converse piezoelectric effect as see in Figure 3.3. The direct
and converse piezoelectric effects enable the materials to convert the mechanical energy
to electrical energy and vice versa.111
25
Figure 3.2 An illustration of the direct piezoelectric effect: a) before applying stress, and
b) during stress
26
Figure 3.3 An illustration of the converse piezoelectric effect: a) before applying an
electric field, and b) and during an electric field
27
4. Chapter IV: Piezoelectric Plate Sensor (PEPS)
4.1 Piezoelectric sensors and applications
A sensor which uses the piezoelectric effect to measure acceleration, pressure,
strain, or force by generating electrical charge is called as ‘Piezoelectric Sensor’. In order
to measure a variety of processes, piezoelectric sensors have been used as a versatile tool.
In many different industrial branches, they have been used for process control, quality
assurance, and research and development. Even though the piezoelectric effect was stated
by Pierre Curie in 1880, it was started to be used for sensing applications in the 1950s
and has been increasingly used since then. The natural reliability of piezoelectric
materials made the piezoelectric sensors regarded as mature technology. The
piezoelectric sensors have been successfully used in many areas of applications, such as
biomedical, aerospace, automotive and nuclear fields.112
4.2 Piezoelectric Plate Sensor (PEPS)
4.2.1 Overview
There is an emerging class of biosensors that can detect targets directly from
samples without labeling. Among them are the piezoelectric microcantilever sensor
(PEMS)113-123
and its successor, piezoelectric plate sensor (PEPS).124
A PEMS consists of
a highly piezoelectric layer such as lead zirconate titanate (PZT),114, 120, 124, 125
or lead
28
magnesium niobate-lead titanate, (PbMg1/3Nb2/3O3)0.63-(PbTiO3)0.37 (PMN-PT),113, 115-119,
121-123 bonded to a non-piezoelectric layer such as tin
116 or copper,
117-122. PEPS consists of
solely a thin highly piezoelectric layer such as a PMN-PT layer as thin as 8-μm in
thickness.124
For direct biosensing, a PEMS or PEPS with receptors specific to the target
analytes immobilized on its surface is directly immersed in the sample with or without
flow.113-116, 120-124
Mechanical resonance, mostly flexural-mode resonance in the case of
PEMS113-119
and length extending mode (LEM) or width extending mode (WEM)
resonance in the case of PEPS,124
of the sensor is electrically excited and monitored.
Binding of the target analyte to the receptor on the sensor surface shifts the sensor
resonance frequency. Direct detection of the target analyte is achieved by monitoring the
sensor’s resonance frequency shift in real time.113-116, 120-124
4.2.2 PMN-PT PEPS
Piezoelectric materials are unique materials that have piezoelectric effect.
Piezoelectric material generates electrical charge under an applied mechanical stress and
results in mechanical strain with an applied electrical field.112
A piezoelectric plate sensor (PEPS) has a PMN-PT layer less than 100 µm in
thickness thinly coated with an electrode <150 nm in thickness on either side of the plate.
A PEPS may be square, rectangular, circular in shape, or hollow in the center of the plate,
and 100-2000 µm in its lateral dimension, and the edge of a PEPS may be completely of
partially fixed on a substrate for handling.
29
For detection, receptors specific to the target analyte will be coated on a PEPS
surface and excited electrically at its length extension mode (LEM), width extension
mode (WEM), or any other planar extension mode (PEM) resonance frequency, f,---
typically in the range of 0.4 to 50 MHz. Binding of the target analyte to the specific
receptor on the PEPS surface shifted the LEM, WEM, or PEM resonance frequency.
Detection of the target analyte is achieved by monitoring a PEPS LEM, WEM, or PEM
resonance frequency shift.
PEPS has only one piezoelectric layer with thin top and bottom electrodes as
shown in Figure 4.1 schematically and in a micrograph in Figure 4.2 (a). As seen in
Figure 4.2 (b), PEPS has a sandwich structure which consists of lead magnesium
niobate‐lead titanate (Pb(Mg1/3Nb2/3)O3)0.65-(PbTiO3)0.35 (PMN-PT) film and
electrodes on its both sides.126
30
Figure 4.1 A schematic of PEPS electrically insulated with MPS coating for in liquid
detection
31
Figure 4.2 (a) A micro graph of PEPS, and (b) a cross-section SEM micrograph of PMN-
PT material
a)
b)
32
A PMN-PT piezoelectric plate sensor (PEPS) is a new type of sensor
developed in Shih’s laboratory. To detect a target molecule, receptor specific to a target is
immobilized on the PEPS surface. Binding of the target to the receptor on the PEPS
surface causes the resonance frequency of the PEPS to change. In-situ, real-time
detection of the target is achieved by monitoring the PEPS’s resonance frequency shift
using simple electrical measurements. What makes the PEPS unique is that its detection
resonance frequency shift which is caused by the stress generated by the binding of the
target to the PEPS surface is inherently amplified by the polarization switching in the
PMN-PT layer more than 1000 times than could be accounted for by the mass change
alone.118
33
Figure 4.3 (a) A schematic top view of the first LEM, (b) WEM vibration where the
yellow rectangle illustrates the initial position of the PEMS and the dash line rectangle
illustrates the bent or extended positions, and c) the spectrum of a PEPS.
34
Receptor which is specific to a biomarker is immobilized on the surface of the
electrical insulation layer. Binding of a target on the PEPS surface shifts the PEPS
longitudinal extension mode (LEM) or width extension mode (WEM) resonance peak
frequency. Detection of a target protein or DNA marker is achieved by directly
immersing a PEPS in the human fluids and monitoring the LEM or WEM resonance
frequency shift as seen in Figure 4.3 (a) and (b) respectively.116
Also, in Figure 4.3 (c) LEM
and WEM can be seen on a spectrum of PEPS.
PEPS has several advantages. By using PEPS, rapid, all-electrical, real-time, in
situ, label free quantification of DNA is possible. Previous study on PEPS has
demonstrated that PEPS is able to detect DNA at 960 copies/ml in Phosphate Buffered
Saline (PBS), as shown in Figure 4.4.124
35
Figure 4.4 Dose-response of synthesized DNA detection in phosphate buffered saline
(PBS) by using PEPS (Wu, W.; Kirimli, C. E.; Shih, W. H.; Shih, W. Y., Real-time, in
situ DNA hybridization detection with attomolar sensitivity without amplification using
(pb(Mg1/3Nb2/3)O3)0.65-(PbTiO3)0.35 piezoelectric plate sensors. Biosens Bioelectron
2013, 43, 391-9.)124
36
In the study of Wu et al., 2013, such a high sensitivity was a result of 1000 times
improvement in the relative resonance frequency shift of detection, - ∆f/f in the PMN-PT
PEPS.119
Polarization switching in the PMN-PT layer depending on binding of the target
analyte causes a change in the binding-induced elastic modulus change.119
Since
resonance frequency is directly proportional to the square root of the elastic modulus, the
change in the binding-induced elastic modulus produces change in the resonance
frequency orders of magnitude larger than could be accounted for by the mass change
alone.119
This effect makes the PMN-PT PEPS much sensitive from all other non-
piezoelectric sensors and weakly piezoelectric sensors, such as quartz not showing such
binding-induced elastic modulus change.124
When change in PEPS’s resonance frequency due to Sulfo-SMCC and probe
DNA binding is compared with the change in QCM’s resonance frequency due to the
same analytes, significant amplification effect of polarization switching can clearly be
seen. Different frequency shifts in both QCM and PEPS due to the same amount of
analytes are shown.
37
5. Chapter V: Objective and Aims
5.1 Objective
The objective is to investigate PMN-PT PEPS for sensitive, rapid, direct HB viral
count quantification without the need of DNA isolation, concentration, and amplification.
Therefore we can construct a viable tool that is readily available for the developing
countries for HBV DNA detection.
5.2 Challenges for developing PEPS as a real-time, in situ HBV quantifier
without the need of DNA isolation and amplification
5.2.1 Improving insulation to reduce signal noise
Because the working environment of PEPS is ionic biological fluids such as
serum, and stool PEPS requires good insulation to prevent the inductive effect of ionic
solutions on sensor performance. In addition, a high signal to noise ratio (SNR) by
suppressing the electrical noise on the signal is necessary to detect such a small amount
of genetic signatures.127
38
Previously, Capobianco et al. showed that 3-Mercaptopropyltrimethoxysilane
(MPS) coating could be used as insulator on a PEPS. However, the performance of the
insulation is not sufficient for DNA detection that requires high sensitivity.114
MPS coating on a gold surface requires both hydrolysis and condensation.
Hydrolysis of MPS requires a certain amount of H2O. Condensation can occur at alkaline
solutions because silanols are most stable at pH 3-6, but condense rapidly at pH 7-9.
Condensation of MPS requires an environment at high pH. The hydrolysis and
condensation reactions are greatly affected by the MPS concentration.128
5.2.2 Exposing genetic materials for real-time in situ viral genetic detection
In genetic detection of HBV, lysing virus and isolation of genetic material play an
important role. In order to directly detect HB viral count in human serum, viruses should
be lysed to release the genetic material. Besides, HBV DNA is covalently closed circular
and partially double stranded. The genetic detection of HBV requires de-hybridization of
viral DNA.129, 130
5.2.3 Prevention of nonspecific binding
In the literature, most studies on HBV have demonstrated that serum HBV DNA
level is a direct reflection of the level of intrahepatic viral replication. However, direct
39
viral DNA detection and quantification is challenging. Detection in serum is complicated
because serum includes proteins (albumins and globulins), electrolytes, and hormones.
The most abundant protein in human serum is albumin (3% - 5%).131-133
In situ viral
DNA detection requires detection to be carried out in serum. Non-specific binding due to
protein in serum should also be prevented. In order to prevent the non-specific binding
due to proteins in human serum, 5% Bovine Serum Albumin (BSA) blocking which has
been demonstrated previously has been chosen and followed as blocking method.121
Human serum also contains cell-free circulating DNA at level of 6,000 – 60,000
copies/ml.134, 135
Non-specific binding due to human DNA should be prevented as well.
By designing an appropriate probe DNA, overlapping between viral DNA and human
DNA can be averted.
5.3 Approaches
5.3.1 Aim I: Investigation of MPS coating for better insulation
A prerequisite for electrically monitoring resonance frequency shift in situ
requires a PEPS to be electrically insulated in a manner that allows for complete
submersion of the sensor in a body fluid without shorting the circuit. In addition, the
insulation layer must be compatible with the subsequent receptor immobilization.
40
The growth of the MPS insulation coating layer relied on the hydrolysis (a
process in which a silane group is replaced by a silanol) and condensation (a process in
which two silanols react to form a Si−O−Si bond) reactions.114
It is also known that,
under basic conditions, hydrolysis can also occur with anionic hydroxyls directly
attacking the silicon atom.136
The hydrolysis and condensation reactions could be greatly affected by the MPS
concentration, the water content of the MPS solution, and the pH of the MPS solution. On
the other hand, it is known that the addition of water and a higher pH can accelerate both
the hydrolysis and condensation reactions.128, 136-138
It is the purpose of this study to optimize the solution coating method of the MPS
insulation coating by investigating the effect of water content, solution pH, and
concentration of the MPS solution in ethanol on the MPS coating thickness, morphology,
and insulation property on gold-coated glass slides. The coating rate of the MPS coating
will be measured in situ using a quartz crystal microbalance (QCM). The final coating
thickness and coating morphology will be evaluated using scanning electron microscopy
(SEM). The insulation properties of the MPS coating will be evaluated using cyclic
voltammetry (CV). Since the resonance frequency shift of a PEPS is used for detection,
the resonance frequency of a well insulated PEPS must be stable in a blank liquid
medium in order for the detection of a target to be reliable. Therefore, we will also assess
41
the insulation performance of the MPS coating by monitoring the resonance frequency
stability of MPS-coated PEPS in a phosphate buffer saline (PBS) solution.
It is important to control the water content, the solution pH, and the MPS
concentration so that the insulation layer is dense and smooth with optimal insulation
properties as well as effective surface stress induction for resonance frequency
enhancement by target molecule binding on the sensor surface.
5.3.2 Aim II: Direct detection of ssDNA, dsDNA and viral DNA in spiked
sera
Surface functionalization is an important factor for detection. To immobilize
probe DNA, which is complementary to target DNA, on sensor surface, a chemical
reagent used as a linker is needed. Surface distribution and number of linker molecule
and probe DNA will be evaluated by QCM to investigate whether surface is appropriate
for DNA detection.
In the literature, most studies on HBV have demonstrated that serum HBV DNA
level is a direct reflection of the level of intrahepatic viral replication. Besides, human
serum where eventually viral DNA detection will be carried out, contains proteins, and
the most abundant protein in human serum is albumin (3% - 5%).129, 131, 132, 139
42
Non-specific binding due to protein in serum can be prevented by using Bovine
Serum Albumine (BSA). Appropriate amount of BSA to prevent non-specific binding
will be studied.
In this aim, single stranded DNA (ssDNA), double stranded DNA (dsDNA), and
extracted viral DNA detection by PEPS will also be investigated. Additionally, length
effect of target DNA and volume effect of sample solutions will also be evaluated.
5.3.3 Aim III: Direct detection of viral particles in spiked sera
Hepatitis B virus (HBV) is a member of Hepadnaviridae viruses family and has a
partly double-stranded, relaxed circular (rc) DNA genome. The virus consists of an outer
lipid envelope and a capsid core composed of protein.129
In order to detect genetic material of HBV, the viruses must be lysed to release
genetic material. By using a chemical reagent which is an anionic surfactant (Sodium
Dodecyl Sulfite (SDS) and heating, outer lipid envelope and protein capsid can be
denatured.130
Optimal condition of lysing with SDS and heating and viral DNA detection
in viral particles spiked sera will be studied in this aim.
43
6. Chapter VI: Electrical Insulation and Receptor Immobilization
6.1 Electrical Insulation
6.1.1 Introduction
Thin ceramic layers such as MgO,140
Al2O3,141
Si3N4,142
Ta2O5,143
TiO2,144
BaTiO3,145
and SrTiO3146
have been demonstrated as effective insulation layers, they
require high vacuum chemical vapor deposition (CVD), which is expensive and slow.
Polymeric insulation coatings such as polyimides147, 148
and benzocyclobutene (BCB)149
can be deposited by the wet solution method. However, to be effective they require a
thickness of tens of micrometers, which is too thick for PEMS or PEPS applications.
Thinner polymeric layers such as parylene require CVD.150, 151
Additional disadvantages
of parylene include poor adhesion to the electrode surface123
and difficulty for subsequent
receptor immobilization.150
In earlier studies, a simple wet-chemical coating method involving MPS to
electrically insulate PEMS for in-liquid bio-detection was investigated.114
The insulation
coating entailed soaking a PEMS or a PEPS in a fresh 1% MPS solution in ethanol
titrated by acetic acid to pH 4.5 for 12 h three to four times where the PEMS or PEPS
was rinsed with ethanol and deionized (DI) water before it was immersed in a new MPS
solution.120-123
The advantages of so-derived MPS insulation were that the wet chemical
procedure was simple and economical, that the insulation was less than 100 nm thick, and
44
that the sulfhydryl group of the MPS readily permitted the immobilization of the
receptors on the surface of the insulation layer directly. However, the performance of the
insulation layers derived from the above coating scheme proved not reliable with the
resonance frequency of an insulated cantilever fluctuated over time.114, 120, 121
The
insulation property of the MPS coating has been found to be operator dependent.
For example, the noise level in Reference 3114
and 9120
seemed to be less than that
in Reference 10121
. We suspect the variability of the insulation performance of the MPS
coating was a result of varying drying process after the DI water rinsing and before a
sensor was reimmersed in the MPS coating solution as described in the Experimental
Section. Each operator may have waited for a different amount of time for the sensor to
dry. The temperature and humidity at the time of the experiment may also have been
different. As a result, a different amount of residual water may have been present on the
sensor. The presence of a different amount of residual water could greatly affect the
cross-linking of MPS.128, 152
While the sulfhydryl group of the MPS allowed the first
MPS layer to anchor on the gold surface,114, 152
the growth of the MPS insulation coating
layer relied on the hydrolysis (a process in which a silane group is replaced by a silanol)
and condensation (a process in which two silanols react to form a Si−O−Si bond)
reactions as illustrated by Figure 6.1 and 6.2, respectively.128
45
Figure 6.1 Hydrolysis Reaction of MPS Adsorbed on a Gold Surface
Figure 6.2 Condensation Reaction of Two Adjacent Hydrolyzed MPS on a Gold Surface
46
It is also known that, under basic conditions, hydrolysis can also occur with
anionic hydroxyls directly attacking the silicon atom as illustrated by Figure 6.3.136
Figure 6.3 Anionic Hydrolysis Reaction of MPS on a Gold Surface under Basic
Conditions
From Figure 6.1−6.3, one can see that the hydrolysis and condensation reactions
could be greatly affected by the MPS concentration, the water content of the MPS
solution, and the pH of the MPS solution. On one hand, it is known that the addition of
water and a higher pH can accelerate both the hydrolysis and condensation reactions.128,
136-138, 153 On the other hand, the rate of hydrolysis and condensation reaction may be too
high with the presence of water and at a high pH. This can result in excessive cross-
linking in the solution and the formation of large silica spheres.154-157
Our earlier studies
have shown that PEMS detection resonance frequency shift was enhanced by more than
300 times than can be accounted for by the mass change alone due to the polarization
orientation switching of the piezoelectric layer induced by the surface stress on the
47
piezoelectric layer due to the binding of the target molecules on the sensor surface.117-119
If these silica particles were on the sensor surface, target molecules bound on these large
silica particles would not transmit any surface stress to the piezoelectric layer to cause the
enhancement in resonance frequency shift. Therefore, it is important to control the water
content, the solution pH, and the MPS concentration so that the insulation layer is dense
and smooth with optimal insulation properties as well as effective surface stress induction
for resonance frequency enhancement by target molecule binding on the sensor surface.
It is the purpose of this study to optimize the solution coating method of the MPS
insulation coating by investigating the effect of water content, solution pH, and
concentration of the MPS solution in ethanol on the MPS coating thickness, morphology,
and insulation property on gold-coated glass slides. The coating rate of the MPS coating
will be measured in situ using a quartz crystal microbalance (QCM). The final coating
thickness and coating morphology will be evaluated using scanning electron microscopy
(SEM). The insulation properties of the MPS coating will be evaluated using cyclic
voltammetry (CV). Since the resonance frequency shift of a PEPS is used for detection,
the resonance frequency of a well insulated PEPS must be stable in a blank liquid
medium in order for the detection of a target to be reliable. Therefore, we will also assess
the insulation performance of the MPS coating by monitoring the resonance frequency
stability of MPS-coated PEPS in a phosphate buffer saline (PBS) solution.
48
6.1.2 Experimental Section
Glass slides were coated with a 100 nm thick gold electrode with a 10 nm thick
chromium bonding layer by thermal evaporation (Thermionics VE 90). These gold coated
glass slides were then cut into 3 mm by 4 mm strips. A gold wire was then attached to the
gold surface of a strip with a conductive glue (8331, MG Chemicals). The rear end of the
strip with the gold wire was then attached to a glass substrate and covered with a
nonconductive glue (LOCTITE) to form a “cantilever” shape. After soaking in a 100-fold
diluted piranha solution (3 parts sulfuric acid and one part 30% hydrogen peroxide
solution) for 1 min followed by rinsing by DI water and by ethanol, initially all gold-
coated glass cantilevers were soaked in a 0.1-mM MPS solution with 1% DI water in
ethanol for 30 min followed by rinsing in DI water and ethanol. Afterward, each gold-
coated glass cantilever was soaked in a MPS solution in ethanol of (1) 1% MPS and
without water, (2) 1% MPS and 1% water, or (3) 0.1% MPS and 0.5% water at a different
pH for 12 h three times with the pH ranged 4.5 to 9. To achieve the desired pH value, an
appropriate amount of acetic acid (99%, Sigma-Aldrich) or potassium hydroxide (100%,
Fisher) was added to the MPS solution. For example, to achieve pH 4.5, 5.5, and 6.5,
amounts of 228, 46, and 8 μL of acetic acid were added to 50 mL of a MPS solution,
respectively and to achieve pH 8.0 and 9.0, amounts of 7.7 and 11.7 mg of potassium
hydroxide were added to 50 mL of a MPS solution, respectively. To minimize the
possible MPS cross-linking in the solution, after each 12-h MPS solution soaking, a gold-
coated cantilever was rinsed with DI water and ethanol and replenished with a fresh MPS
solution of the same MPS concentration, water content, and pH. At the end of the third
49
MPS solution soaking, the cantilever was rinsed with DI water and ethanol and stored in
a refrigerator for further use.
Figure 6.4 Schematic of the setup for in situ measurement of MPS coating thickness on
the gold electrode surface of a QCM
The insulation performance of each MPS coating was characterized by cyclic
voltammetry (CV) tests in a 10 mM K3Fe(CN)6 and 0.1 M KCl solution with a
potentiostat (283, EG&G Instruments) with a scan rate of 100 mV/s. To determine the
capacitive effect of an insulation layer at different scan rates, CV tests in a 0.1 M KCl
solution were carried out. To characterize the rate of coating-thickness increase in situ,
we carried out MPS coating on the gold electrode of a 5 MHz quartz crystal microbalance
(QCM) using the setup as schematically shown in Figure 6.4 where the QCM was
enclosed in a flow cell connected to the reservoir containing the MPS solution with
50
tubing and the flow was driven by a peristaltic pump (7710-62, Masterflex C/L) at a flow
rate of 1.5 mL/min. The resonance frequency of the QCM was monitored with an
impedance analyzer (AIM4170C, Array Solutions) using an inhouse signal processing
algorithm that has enabled reliable detection of resonance frequency shifts of less than 10
Hz from the QCM.158
The increase in the coating thickness, Δt, was related to the QCM’s
resonance change, Δf, as114, 159
ff
ct
22, Equation 6.1
where f was the resonance frequency of the QCM, c = (μ/ρ)1/2
was the sound velocity in
quartz with μ = 2.947 × 1011
g/cm·s2 and ρ = 2.648 g/cm
3 being the shear modulus and
density of quartz, respectively. By monitoring the resonance frequency shift and by the
thickness change to the resonance frequency shift through Equation 6.1, a real-time
increase of thickness with time (coating rate) was obtained. In addition, scanning electron
microscopy (SEM; XL30, FEI) was used to determine the final thickness of the MPS
coating as well as to examine the surface morphology of the MPS coating.
To test the insulation performance, we monitored the width mode resonance
frequency of MPS-coated PEPSs in PBS. Briefly, the PEPSs used were made of 8 μm
thick PMN-PT films. Each PEPS was about 920−1070 μm long and 670−720 μm wide
with one of the long ends fixed on a substrate in a cantilever shape. A 100 nm thick gold
electrode was deposited on both major faces of the PMN-PT film with a 10 nm chromium
bonding layer by thermal evaporator (Thermionics VE 90). The gold-coated PMN-PT
51
films were then cut into 600−1000 μm × 2300 μm rectangular strips using a wire saw
(Princeton Scientific Precision, Princeton, NJ). Gold wires 10 μm in diameter were then
attached to the top and the bottom electrodes using a conductive glue (8331, MG
Chemicals). The rear end of the strip was then glued to a glass slide to form the final
plate geometry. The strips were poled at 15 kV/cm and 80 °C for 30 min on a hot plate.
The PEPSs were then insulated with different MPS coating conditions for resonance
frequency stability testing in PBS.
6.1.3 Result and Discussion
In Figure 6.5 (a) – (c) we show the resonance frequency shift, Δf, versus time of a
QCM at various pH due to the MPS coating on the gold electrode of the QCM obtained
in a MPS solution in ethanol with 1% MPS and 0% DI water at various pH, that in a MPS
solution with 1% MPS and 1% DI water at various pH, and that in a MPS solution with
0.1 MPS and 0.5% DI water at various pH, respectively. Also labeled on the right y axis
is the coating thickness as calculated using eq 1. Defining the least-squares fit of the
slopes of the curves in Figure 6.5 (a) – (c) as the coating rates in nm/h, we plotted coating
rate versus pH in Figure 6.6. Also plotted in Figure 6.6 as filled symbols was the coating
thickness of 36 h MPS coating as determined from available SEM micrographs (not
shown). As can be seen, with 1% MPS and 0% water, the coating rate remained at around
0.5 to 0.6 nm/h for all pH whereas with 1% MPS and 1% water, the coating rate
increased with an increasing pH from about 0.8 nm/h at pH = 4.5 to about 8 nm/h at pH =
9.0. With 0.1% MPS and 0.5% water, the coating rate increased from about 0.5 nm/h at
52
pH = 4.5 to about 2 nm/h at pH = 9. These results indicated that both the presence of
water and an increase of pH were important for the MPS coating layer to grow. It suffices
to say that the coating thickness at 36 h estimated by multiplying the coating rate
determined by QCM by 36 h generally agreed with that determined by SEM.
53
Figure 6.5 Δf versus time of a 5 MHz QCM undergoing MPS coating in (a) 1% MPS
solutions with 0% DI water in ethanol, (b) 1% MPS solutions with 1% DI water in
ethanol, and (c) 0.1% MPS solutions with 0.5% DI water in ethanol at various pH values.
The corresponding thickness in nm as determined by Eq 1 is labeled along the right y-
axis.
0 10 20 30 40 50 60-0.12
-0.10
-0.08
-0.06
-0.04
-0.02
0.00
9.4
7.8
6.2
4.7
3.1
1.6
0.0
Th
ickne
ss (nm
)
f (k
Hz)
Time (min)
pH=4.5
pH=5.5
pH=6.5
pH=7.0
pH=8.0
pH=9.0 1% MPS+ 1% DI water
(b)
0 10 20 30 40 50 60-0.030
-0.025
-0.020
-0.015
-0.010
-0.005
0.000
2.10
1.75
1.40
1.05
0.70
0.35
0.00
(c)
Th
ickn
ess (n
m)
f
(kH
z)
Time (min)
pH=4.5
pH=5.5
pH=6.5
pH=7.0
pH=8.0
pH=9.00.1% MPS + 0.5% DI water
0 10 20 30 40 50 60
-0.008
-0.006
-0.004
-0.002
0.000
0.6
0.5
0.3
0.2
0.0
Th
ickn
ess (
nm
)
f
(kH
z)
Time (min)
pH=4.5
pH=5.5
pH=6.5
pH=7.0
pH=8.0
pH=9.0
(a) 1%MPS + 0% DI water
54
Figure 6.6 Coating rate versus pH in 1% MPS and 1% DI water (open circles) and in
0.1% MPS with 0.5% DI water (open diamonds). The coating rate at each pH was
determined as the slope of the least-squares fit of the curve shown in Figure 6.5 (a) – (c)
of that pH. Labeled on the right y axis is the estimated 36 h coating thickness by
multiplying the QCM coating rate by 36. The filled symbols depict the 36 h coating
thickness obtained from the SEM.
4 5 6 7 8 9 100.0
1.4
2.8
4.2
5.6
6.9
8.3
9.7
0
50
100
150
200
250
300
350
Co
atin
g T
hic
kn
ess (n
m)
1% MPS+1% water--SEM
1% MPS+1% water--QCM
0.1% MPS+0.5% water--SEM
0.1% MPS+0.5% water--QCM
1% MPS+0% water--QCM
Co
atin
g R
ate
(n
m/h
r)
pH
55
The results in Figure 6.6 suggested that the thicker MPS coating layers obtained
with 1% MPS and 1% water at a higher pH might perform better as an insulating layer.
We examined the insulating performance of the MPS coating layer on gold surface after
36 h of coating by cyclic-voltammetry (CV). In Figure 6.7 (a) – (c) we show current
density, J, versus the potential at the gold electrode with MPS coatings obtained with 1%
MPS and 0% water at various pH, with 1% MPS and 1% water at various pH, and 0.1%
MPS and 0.5% water at various pH, respectively. The current density was the current
passing through the MPS-coated gold electrode divided by its surface area exposed to the
liquid. The insert in Figure 6.7 (a) is an optical micrograph of a gold-coated glass slide
used for the CV tests. As can be seen in all of the CV plots, the maximum amplitude of
current density which we denoted as Jmax, occurred at around a potential of 0.4 V. As can
be seen from Figure 6.7 (a), with 1% MPS and 0% water, Jmax remained at around 600
μA/cm2, whereas with 1% MPS and 1% water, Jmax decreased dramatically 400−800
μA/cm2 for pH ≤7 to 1.2 and 0.2 μA/cm
2 at pH 8.0 and 9.0, respectively (see the insert of
Figure 6.7 (b). This represented a 3 orders of magnitude decrease in Jmax due to the
combined effects of 1% water and the pH of 9.0. The decrease of Jmax is also consistent
with the rapid increase in the coating rate at pH 8.0 and 9.0 shown in Figure 6.6. With
0.1% MPS and 0.5% water, Jmax decreased dramatically 400− 600 μA/cm2 for pH ≤7 to 2
μA/cm2 at pH 9.0, respectively (see the insert of Figure 6.7 (c)). This indicated that
indeed Jmax decreased dramatically with an increasing coating thickness.
56
Figure 6.7 CV curve of 36 h MPS coating in (a) 1% MPS + 0% DI water (the insert
shows an optical micrograph of one of the gold-coated glass slides used for the
experiments), (b) 1% MPS + 1% DI water (the insert shows the blowup at pH 8.0 and
9.0), and (c) 0.1% MPS + 0.5% DI water (the insert shows the blowup at pH 9.0).
-0.4 0.0 0.4 0.8
-600
-400
-200
0
200
400
pH=7.0
pH=8.0
pH=9.0
Curr
en
t D
en
sity (A
/cm
2)
Potential (V)
pH=4.5
pH=5.5
pH=6.5
(a)
-0.4 0.0 0.4 0.8
-800
-400
0
400
-0.4 0.0 0.4 0.8-1.4
-0.7
0.0
Cu
rrent D
ensi
ty(
A/c
m2
)
Potential (V)
pH=8.0
pH=9.0
pH=7.0
pH=8.0
pH=9.0
(b)
Curr
en
t D
en
sity (A
/cm
2)
Potential (V)
pH=4.5
pH=5.5
pH=6.5
-0.4 0.0 0.4 0.8
-400
-200
0
200
-0.4 0.0 0.4 0.8-2
-1
0
1
Curr
ent
De
nsity
(A
/cm
2)
Potential (V)
pH=9.0
pH=7.0
pH=8.0
pH=9.0
Cu
rre
nt
De
nsity (A
/cm
2)
Potential (V)
pH=4.5
pH=5.5
pH=6.5
(c)
57
Although the above result indicated that MPS coatings obtained with 1% MPS
and 1% water at pH 8.0 and 9.0 exhibited excellent electrical insulation properties, close
examination of the coating morphology indicated that the coating surface was rough. As
an example, the cross-section and the top-view SEM micrographs of a 36-h MPS coating
in 1% MPS and 1% water are shown in Figure 6.8 (a), and (b). From 5.8 (a), one can see
that there was a MPS coating of about 300 nm thick that was consistent with the coating
rate of 8 nm/h measured by QCM as shown in Figure 6.6. However, on top of the smooth
300 nm thick MPS coating, there were large spherical particles. These large spheres were
formed in the solution presumably due to the favorable conditions, i.e., high hydrolysis
and condensation rates for forming silica spheres in the solution at this pH.154-157
In
Figure 6.8 (c), we show a cross-section SEM micrograph of a 36 h MPS coating obtained
in 1% MPS and 1% water at pH 8.0. As can be seen, at this pH, fewer spheres were
formed in the solution, they could still deposited on the coating surface, making the
coating surface bumpy.
58
Figure 6.8 (a) Cross-section view, (b) top-view SEM micrographs of MPS coating after
36 h coating in 1% MPS + 1% DI water at pH 9, and (c) cross-section view SEM of a
MPS after 36 h in 1% MPS + 1% water at pH 8.0
59
Figure 6.9 (a) Cross-section view and (b) top-view SEM micrographs of MPS coating
after 36 h in a 0.1% MPS solution in ethanol with 0.5% DI water at pH 9, which indicates
that the 36 h coating thickness was about 70 nm, consistent with the 72 nm thickness
estimated from the QCM result.
60
To minimize the formation of large spheres at pH 9.0, we examined MPS coatings
with 0.1% MPS and 0.5% water at various pH. In Figure 6.9 (a), and (b), we show the
SEM cross-section micrograph and the top-view micrograph of a MPS coating on a gold
surface after 36 h of MPS coating with 0.1% MPS and 0.5% water and at pH 9.0. As can
be seen, unlike the microsphere-covered MPS coating obtained with 1% MPS and 1%
water at pH 9.0, the MPS coating obtained in 0.1% MPS in ethanol with 0.5% water at
pH 9.0 looked smooth without the presence of spherical particles.
To put all of the results together, we plot Jmax versus pH with 1% MPS and 0%
water (black), 1% MPS and 1% water (red), and 0.1% MPS and 0.5% water (green) in
Figure 6.10. Clearly adding water and increasing the pH of the MPS solution to around
9.0 reduced the maximal current density by 2−3 orders of magnitude depending on the
MPS concentration and water content. The smooth coating is important for long-term
insulation stability of the coating as well as for effective binding stress transmission to
the piezoelectric layer for optimal detection resonance frequency enhancement.117, 118, 120
Therefore, the optimal coating conditions would be 0.1% MPS and 0.5% water at pH 9 so
that the coating surface was smooth while the coating rate was reasonable fast.
61
Figure 6.10 Jmax versus pH with 1% MPS and 0% DI water (black), 1% MPS and 1% DI
water (red), and 0.1% MPS and 0.5% DI water (green) where Jmax was the maximal
amplitude of current density.
4 5 6 7 8 90.1
1
10
100
1000
10000
Jm
ax (
10
-6 A
/cm
2)
pH
1% MPS+0% water
1% MPS+1% water
0.1% MPS +0.5% water
62
To examine whether the current approach improves the stability and reliability of
the sensor, we examine the stability of the resonance frequency of a MPS-coated PEPS.
As an example, the in-air (black) and in-PBS (red) phase angle versus frequency
resonance spectra of a PEPS insulated in 1% MPS with no water at pH 4.5 (PEPS A) is
shown in Figure 6.11 (a), that of the PEPS insulated in 1% MPS with 1% water at pH 9
(PEPS B) in Figure 6.11 (b), and that of the PEPS insulated in 0.1% MPS with 0.5%
water at pH 9.0 (PEPS C) in Figure 6.11 (c). An optical micrograph of an example PEPS
is shown in the insert of Figure 6.11 (a). As can be seen from Figure 6.11 (a), the baseline
of the in-PBS spectrum of the PEPS A insulated in 1% MPS with no water at pH 4.5 was
20° higher than that of the in-air spectrum, indicating that the insulation coating was still
conductive. In comparison, the baseline of the in-PBS resonance spectrum of PEPS B
(see Figure 6.11 (b)) and that of the in-PBS spectrum of PEPS C (see Figure 6.11 (c))
were both fairly close to that of their respective in-air spectrum, indicating that MPS
coating obtained in 1% MPS with 1% water at pH 9.0 and that obtained in 0.1% MPS
with 0.5% water at pH 9.0 were much less conductive. We then repeatedly immersed
PEPS A, B, and C in PBS for 24 h and monitored the stability of the resonance frequency
of the width extension mode (WEM) resonance peak at around 3 MHz (see Figure 6.11
(a) – (c)).
63
Figure 6.11 In-air and in-PBS phase angle versus frequency resonance spectra of PEPS
insulated in (a) 1% MPS with 0% water at pH 4.5, (b) 1% MPS with 1% water at pH 9.0,
and (c) 0.1% MPS with 0.5% water at pH 9.0. The insert in panel a shows an optical
micrograph of a PEPS.
-100
-80
-60
-40
-20
0
20
Length extension
mode
Width
extension
mode
Ph
aseA
ng
le (
Deg
ree
)
In Air
In PBS
(b)
0 1 2 3 4-100
-80
-60
-40
-20
0
Length extension
mode
Width
extension
mode
Ph
ase A
ngle
(D
eg
ree
)
Frequency(MHz)
in Air
in PBS
(c)
-100
-80
-60
-40
-20
0
20
Ph
ase
An
gle
(D
eg
ree
)
In Air
In PBS
(a)
Width extension
mode
Length extension
mode
64
In Figure 6.12, panels a and b, we show the WEM resonance frequency shift, Δf,
versus time of PEPS A seen in Figure 6.12 (a), and C seen in Figure 6.12 (b) in PBS for
24 h. The data shown in Figure 6.12, panels a and b, were the average of two independent
runs. Figure 6.12, panels a and b, shows that PEPS A had not only large frequency shifts
within each run but also large differences between the two runs, indicating PEPS A to be
unstable and unreliable in PBS. In contrast, PEPS C showed negligible resonance
frequency shift over the course of 24 h and negligible difference between two runs,
indicating much better stability and reliability of the MPS coating obtained at pH 9.0 and
with water. The results in Figure 6.12, panels a and b, clearly indicate that the new
insulation methods of high pH and with water created PEPS with stable resonance
frequency in PBS over time, whereas the old insulation method of low pH and without
water produced PEPS that did not have stable resonance frequency in PBS over time.
65
Figure 6.12 Stability performance in terms of resonance frequency shift versus time in
PBS of two different PEPS each with a different MPS coating: (a) PEPS A with MPS
coating in 1% MPS with no water at pH 4.5 and (b) PEPS C with MPS coating in 0.1%
MPS and 0.5% water at pH 9.0. Note that the data shown were the average of two
independent runs and panels a and b had different scales in terms of Hz.
0 4 8 12 16 20 24-5
0
5
10
15
20
f(
kH
z)
Time(Hour)
1% MPS+no water @ pH=4.5(a)
0 4 8 12 16 20 24
0
4
8
f(
Hz)
Time(Hour)
0.1% MPS+0.5% water @ pH=9.0
(b)
66
6.1.4 Conclusion
We have investigated the effect of MPS concentration, water content, and pH on
the thickness and insulation quality of a MPS coating layer on a gold electrode obtained
in an MPS solution in ethanol. We showed that both controlling the MPS concentration,
water content and pH were all important for the insulation coating. With 1%MPS and 0%
water, the coating rate remained well below 1 nm/h at all pH and to 2 and 8 nm/h in 0.1%
MPS with 0.5% water at pH 9 and in 1% MPS with 1% water at pH 9, respectively.
Furthermore, the surface of the MPS coating obtained with 0.1% MPS and 0.5% water at
pH 9 was smooth which can better define the surface area of the sensor for detection
quantitation. The width-mode resonance frequency of a piezoelectric plate sensor
insulated with a MPS coating obtained in 0.1% MPS with 0.5% water at pH 9 for 36 h
was shown to be stable for more than 24 h in PBS.
67
7. Chapter VII: Detection of ssDNA, dsDNA, and extracted viral DNA
7.1 Quantification on Receptor Immobilization
7.1.1 Introduction
One of important steps of bio-sensing is the receptor immobilization. Quality of
surface functionalization is effective on the detection sensitivity.160-162
Additionally,
homogeneity of receptor on sensor surface is another key factor on bio-sensing
applications.
Binding activity may be decreased because the binding sites are too close to each
other, and thus preventing them from binding to the ligand. In addition to the steric
effects, the micro-environment near the surface may negatively affecting binding
activity.163, 164
Also, non-homogenous immobilization can result in adaptive changes or
denaturation.165, 166
The heterogeneity of surface functionalization and the decreased binding activity
are malefic to biosensors. These harmful effects on biosensors restrict the sensor
sensitivity and its reproducibility. According to several studies on bio-sensing,
heterogeneity and randomness of receptors on sensor surface limit the sensitivity.166-168
68
The more uniformed receptor distribution on sensor surface shows more identical
affinity, and thus the sensitivity is increased.166
QCMs were used for measuring mass after the theory and experiments related to a
change in resonance frequency of oscillating crystal due to mass adsorbed on the surface
was demonstrated by Sauerbrey in 1959. 169, 170
The linear relationship between the
change in resonance frequency (∆f) and the mass adsorbed on the surface (∆m) is
governed by:
, Equation 7.1
where f0 was the resonance frequency of the QCM, A was the crystal area, μq = 2.947 ×
1011
g/cm·s2 was the shear modulus of quartz, and ρq = 2.648 g/cm
3 was the density of
quartz.
The thickness of Sulfo-SMCC and probe DNA was determined by a 5-MHz QCM
to show the homogeneity and density of receptors on sensor surface and quantify the
number of available probe DNA on sensor surface by using Equation 7.1. In addition, the
frequency shifts of QCM and PEPS due to immobilization were compared in terms of
sensitivity.
69
7.1.2 Experimental Section
7.1.2.1 PMN-PT PEPS fabrication
A PMN-PT PEPS with a k31 of 0.31 is used in this detection. The PEPS was
fabricated from a PMN-PT freestanding film 8 µm in thickness. First, 150 nm thick gold
electrodes were deposited on both sides of the PMN-PT film with a 50 nm chromium
bonding layer by thermal evaporator (Thermionics VE 90). The gold-coated PMN-PT
films were then cut into 0.5 mm 2 mm rectangular strips using a wire saw (Princeton
Scientific Precision, Princeton, NJ). Gold wires with a 10 µm diameter were then
attached to the top and the bottom electrodes towards one of the longitudinal ends of the
strip using conductive glue. The ends with gold electrodes were glued to a glass slide to
form the final plate shape 1.1 mm in length and 0.5 mm in width. The PMN-PT PEPS
was then poled at electric field of 15 kV/cm at 80◦C on a hot plate for 30 min. After
poling the dielectric constant of the PEPS was measured to be 1800 at 1 kHz using an
impedance analyzer (4294A, Agilent). A PEPS has two extension modes which are
length extension mode (LEM) and width extension modes (WEM). In this study,
frequency shift in WEM was monitored for detection.
The in-air and in PBS resonance spectra are shown in Figure 7.1. As can be seen,
the in-air and in PBS spectra closely resemble each other, indicating the MPS insulation
method is effective in electrically insulating the PEPS from the salty liquid environment.
70
Figure 7.1 In air (black) and in PBS (red) phase angle versus frequency spectra of a
PEPS.
0 1 2 3 4 5-100
-80
-60
-40
-20
0
Ph
ase A
ngle
(D
eg
ree
)
Frequency(MHz)
in Air before Insulation
in PBS after Insulation
a)
71
7.1.2.2 Target DNAs, probe DNA, and reporter DNAs
pDNASgene1 which targets the HBsAg gene of the virus expressing the surface
antigens was provided Dr Guo’s group in the Department of Microbiology and
Immunology, Drexel University at Doylestown, PA and purchased from Sigma. This
probe also perfectly matches human DNA. pDNASgene2 which also targets the HBsAg
gene of the virus expressing the surface antigens was designed by Mehmet C. Soylu and
purchased from Sigma. Some parts of this probe overlap with human DNA, but not
perfectly matches. t1DNASgene1 was 5’ amine-activated, synthesized, 100nt single
stranded DNA and designed chosen from the hepatitis B virus’s genome (Sigma).
t2DNASgene1 was 5’ amine-activated, synthesized, 90bp double stranded DNA and
designed by choosing from the hepatitis B virus’s genome (Sigma). Extracted viral DNA
was provided by Dr. Guo’s group. Upstream and downstream reporter DNAs for Sgene1
and Sgene2 which targets the upstream and downstream regions of viral DNA captured
by probe DNA were designed accordingly. All the DNAs were stored in a fridge at -
20°C, and their sequences and melting temperature can be seen in Table 7.1.
72
Table 7.1 The sequences and lengths of the probe DNAs, target DNAs, reporter DNAs,
and their corresponding melting temperatures, TM. (*Heating at 95°C denatures double
stranded DNA regardless its length.171
)
DNA Sequence Strands Length TM
(°C)
pDNASgene1 NH2_5'-TGCCTCATCTTCTTGT-3' Single 16-nt 52
pDNASgene2 NH2_5'-GTTCAGTGGTTCGTAGGG
CTT TCC-3'
Single 24-nt 69
Upstream
Reporter
DNASgene1
5’-
TGGTTCTTCTGGACTACCAAGGTAT
GTTGC-3’_ NH2
Single 30-nt 72
Downstream
Reporter
DNASgene1
NH2_5’-
TTTATCATATTCCTCTTCATCCTGCT
GCTA-3’
Single 30-nt 68
Upstream
Reporter
DNASgene2
5’-
CCCACTGTTTGGCTTTCAGCTATAT
GGATG-3’_ NH2
Single 30-nt 73
Downstream
Reporter
DNASgene2
NH2_5’-
TTCTCCTGGCTCAGTTTACTAGTGC
CATTT-3’
Single 30-nt 71
t1DNASgene1 5’-…ACAAGAAGATGAGGCA...-3’ Single 100-nt 95*
t2DNASgene1 5’-…ACAAGAAGATGAGGCA...-3’ Double 90-bp 95*
Viral
DNASgene1
(422-437)
5’-…ACAAGAAGATGAGGCA...-3’ Partially
Double
3215-bp 95*
Viral
DNASgene2
(692-715)
5’-
…GGAAAGCCCTACGAACCACTGA
AC…-3’
Partially
Double
3215-bp 95*
73
7.1.2.3 Immobilization on PEPS
We covalently immobilized pDNASgene2 on the PEPS surface via the bi-functional
linker, sulfosuccinimidyl-4-(N-maleimidomethyl)cyclohexane-1-carboxylate (Sulfo-
SMCC) (Pierce), First, the PEPS was dipped in 300µl of a 3 mg/ml sulfo-SMCC solution
in phosphate buffer saline (PBS) solution for 30 min. The maleimide of the sulfo-SMCC
reacted with the sulhydro of the MPS insulation coating on the PEPS surface to
covalently bond the SMCC on the PEPS surface. The SMCC-coated PEPS was then
dipped in a 10-8
M of pDNASgene2 solution in PBS for 30 min. The NHS ester end of the
SMCC reacted with the amine at the 5’ end of the probe DNA to covalently bond the
probe DNA on the PEPS surface as seen in Figure 7.2.
74
boyl
Figure 7.2 Immobilization scheme
75
7.1.2.4 Immobilization on QCM
5 MHz QCM was used in this study. It was insulated with the insulation method
as explained previously (0.1% MPS and 0.5% water at pH 9 for 1 hour three times). 10
mg of Sulfo-SMCC in 300µl of PBS was added into QCM cell, and then 10-8
M of
pDNASgene2 (will be described in detail in Chapter X). Sulfo-SMCC and pDNASgene2
immobilization steps were done in QCM cell.
7.1.3 Results and Discussion
The thicknesses of sulfo-SMCC and probe DNA were measured by using the 5
MHz QCM. Surface functionalization of amine activated probe DNA was achieved by
using sulfo-SMCC as a linker molecule between sulfhydryl groups on MPS on gold
surface and primary amine on probe DNA. Frequency shifts due to sulfo-SMCC and
probe DNA can be seen in Figure 7.3. By using Eq (2), the distribution of the sulfo-
SMCC and the probe DNA on the MPS surface were determined by using a 5 MHz QCM
as 27 Å2 and 36 Å
2, respectively. In other words, there are approximately 4 sulfo-SMCCs
and 3 pDNAs on every 10 nm2 of surface. These numbers are consistent with the density
of uniformly functionalized surface.
76
Figure 7.3 QCM frequency shift due to sulfo-SMCC and probe DNA binding
0 15 30 45 60 75 90
-140
-120
-100
-80
-60
-40
-20
0
Probe DNA
f(
Hz)
Time(Minute)
Sulfo-SMCC
77
PMN-PT PEMS and PMN-PT PEPS have been exhibited to be a sensitive
platform for detection of chemical172
and biological targets.124, 151
For detection, target
analytes binds to the receptors immobilized on the sensor, and it causes shifts in PEMS’s
or PEPS’s resonance frequency.
It has been known that soft piezoelectric ferroelectric domains can be switched by
electric field or stress as shown in Figure 7.4.126, 173, 174
As a result, both electric field and
stress can considerably change a soft piezoelectric’s Young’s modulus.175, 176
Possibly,
PEPS’s remarkably large change in its resonance frequency during detection may be a
result of a Young’s modulus change due to the binding-induced stress.
Recent studies have shown that PMN–PT-based PEMS or PEPS indicates the two
orders of magnitude detection sensitivity enhancement was a result of the Young’s
modulus change in the PMN–PT layer due to polarization domain switching in the PMN–
PT layer caused by the binding of target analytes.177
78
Figure 7.4 A schematic of how the polarization direction changes with electric field (E):
a) for E>0, and b) for E<0 (Zhu, Q.; Shih, W. Y.; Shih, W. H., Mechanism of the flexural
resonance frequency shift of a piezoelectric microcantilever sensor in a dc bias electric
field. Applied Physics Letters 2008, 92, (3).)178
79
The changes in resonance frequencies of QCM and PEPS due to the bindings of
Sulfo-SMCC and probe DNA have also been investigated as seen in Figure 7.5. It has
been clearly seen that the frequency shift in PEPS is 30-times bigger than that in QCM.
Polarization switching in PEPS during detection induces this amplification in frequency
shift. This makes PEPS unique in terms of sensitivity.
80
Figure 7.5 Comparison of PEPS and QCM frequency shifts due to sulfo-SMCC and
probe DNA binding
0 20 40 60 80-10
-5
0
pDNAPEPS
Sulfo-SMCCPEPS
pDNAQCM
f(
kH
z)
Time(Minute)
PEPS
QCM
Sulfo-SMCCQCM
81
7.1.4 Conclusion
The density of the sulfo-SMCC and that of the pDNA on the MPS surface has
been determined by using a 5 MHz QCM. It was shown that there are approximately 4
sulfo-SMCCs and 3 pDNAs on every 10 nm2 of surface. Results have clearly shown that
surface was well-functionalized, and by considering the result of 4 sulfo-SMCCs and 3
pDNAs per 10nm2 it can be said that probe DNAs on sensor surface were homogeneous
and dense. Additionally, when the shifts in resonance frequencies of QCM and PEPS due
to immobilization are compared, the sensitivity of PEPS because of its polarization
switching has been proved.
7.2 Introduction to Viral DNA Detection with PEPS
In literature, it has been known that there are a few piezoelectric microcantilever
sensors for ssDNA detection. PZT piezoelectric-exited cantilever sensor (PEMS) is one
of those sensors, and has been used for extracted ssDNA detection at 700 copies/ml
sensitivity limit. However, it requires extraction and concentration of genomic DNA for
detection purpose. On the other hand, it also needs DNA de-hybridization in other place
before detection. Whereas it is sensitive, extraction, concentration and de-hybridization
steps PEMS requires makes ssDNA as time-consuming as PCR.99
Another PZT
microcantilever is able to detect PCR products de-hybridized in other place at 13.8 x 106
copies/ml sensitivity level by using silica nanoparticles to amplify the signal for
sensitivity enhancement. This method’s sensitivity level is not appropriate for DNA
82
detection which requires high sensitivity. Additionally, it uses silica nanoparticles to
improve the detection limit only up to several millions copies/ml.100
In previous studies,
it is known that denaturation of double stranded DNA has been carried out in other
chamber or place, not in situ.
In this study, the performance of a PEPS on both single stranded and double
stranded DNA detection in situ has been investigated. We have shown that PEPS is able
to detect both single and double stranded DNA in situ at 60 copies/ml of sensitivity
without need of isolation, concentration, and amplification.
7.2.1 5% BSA solution as simulated serum
In vertebrates, plasma is composed of blood cells suspended in blood. Plasma,
which is 92% water by volume, contains 55% of blood fluid. It contains proteins,
glucose, mineral ions, hormones, and carbon-dioxide and clotting factors. The only
difference between plasma and serum is that serum does not have clotting factors.179
Serum albumin is the most abundant protein in serum accounting for 4-5% of
serum. Serum albumin is also known to bind nonspecifically on most surfaces. Therefore,
it is important to prevent serum albumin to bind to the PEPS surface during detection.
Since serum contains 4-5% serum albumin, we used 5% bovine serum albumin (BSA)
solution in phosphate buffer saline (PBS - 0.137 M Sodium Chloride, 0.0027 M
83
Potassium Chloride, and 0.0119 M Phosphates, pH=7.3 - 7.5 at room temperature)
solution as the simulated serum. We spiked double stranded HB viral DNA in simulated
serum for detection.
7.2.2 BSA blocking
Following the probe DNA immobilization, the PEPS was then immersed in a 5%
BSA solution. This step would saturate the nonspecific binding of BSA on the PEPS
surface such that there would be no additional BSA binding during PEPS detection as
schematically seen in Figure 7.6.
84
Figure 7.6 A schematic illustration of 5% BSA blocking.
85
7.2.3 Setup for double stranded HB viral DNA detection
The detection setup included a high-temperature (HT) chamber where the
temperature was maintained at about 95oC so that double-stranded viral DNA could be
de-hybridized, a low-temperature (LT) detection cell where the temperature was at a
lower value such that the detection of the target DNA is specific against, and narrow
tubing surrounded by water to cool the sample liquid coming out of the HT chamber
while passing it to the LT detection cell. Currently the temperature of the HT chamber
was maintained by a hot water bath and the temperature of the LT detection cell was
maintained by an incubator.158
A schematic of the current double-stranded viral DNA
detection setup is shown in Figure 7.7. The sample containing double stranded viral DNA
was heated in a hot-water bath for 10 min to de-hybridize the double-stranded DNA. The
heated sample was then pumped through the cooling tubing to the detection cell. The
sensor was located in the center of the detection cell and the center of the flow. The
detection cell was maintained at a lower, desired temperature for specific target DNA
signature detection. From the detection cell, the serum was recycled back to the HT
chamber. The flow of the liquid was driven by a peristaltic pump at a flow rate of around
1.5 ml/min. The innovation of such a detection scheme is that cooling the sample in a
narrow passage prevents DNA from re-hybridization and allows the DNA to remain
single-stranded to be detected by the PEPS. The constant temperature of the detection cell
ensures that the detection is stable and reliable. The advantage of PEPS detection method
is that there is no need for DNA isolation, concentration, or amplification. The high
sensitivity of PEPS allows viral DNA to be detected directly from a simulated serum at a
86
concentration as low as 30 copies/ml in 30 min without isolation, concentration, or
amplification.
87
Figure 7.7 An illustration of detection setup
88
7.2.4 In situ validation of specific target DNA detection with reporter
microspheres (MS)
Furthermore, we have validated viral DNA detection using the detection signal of
fluorescent reporter microspheres 6-µm in diameter (Polysciences). The reporter MS was
coated with reporter DNAs (Upstream and Downstream reporter DNASgene1) 30-nt long
that are complementary to target DNA but different from probe DNA. After the detection
of target DNA in serum-like medium, we have flown a suspension of 105 MS/ml in PBS
with appropriate blocking agents. The scheme of fluorescent microspheres validation can
be seen in Figure 7.8.
89
Figure 7.8 A scheme of the fluorescent microspheres validation
90
7.3 Results and discussion
7.3.1 ssDNA, dsDNA, and extracted viral DNA detection
Figure 7.9 shows that the resonance frequency shift, ∆f, of the PEPS at various
stages of PEPS surface preparation that led to the final double-stranded viral DNA
detection in simulated serum. The steps included binding of sulfo-SMCC to the PEPS
surface followed by binding of the probe DNA, followed by 5% BSA blocking, which
was followed by testing in the negative control, blank simulated serum (or 5% BSA
solution), and finally the detection of the double-stranded target DNA at 1×10-18
M in
simulated serum. Note that the sulfo-SMCC and Probe DNA binding steps were done
without flow whereas the BSA blocking and DNA detection were carried out with flow at
a flow rate of 1.5 ml/min. As can be seen, the PEPS showed a substantial resonance
frequency shift in the Sulfo-SMCC and probe DNA binding steps, indicating that sulfo-
SMCC, and subsequently the probe DNA were indeed immobilized on the PEPS surface.
In addition, the BSA blocking step also resulted in a significant resonance frequency shift
indicating BSA adsorption on the PEPS surface. In the following negative control step
(blank simulated serum), there was negligible resonance frequency shift, indicating the
BSA blocking step indeed saturated the PEPS surface and that further exposure of the
PEPS surface to a high concentration of BSA such as 5% in the simulated serum did not
result in addition BSA binding to the PEPS surface.
91
Detection of viral DNA in simulated serum was carried out at various
concentrations. Figure 7.10 (a) shows the resonance frequency shift, ∆f, of the PEPS at
various viral DNA concentrations. As can be seen, there was no discernible ∆f with the
control, whereas there was a sizable ∆f that increased with an increasing concentration,
indicating that the viral DNA detection was indeed specific. Also, the comparison of
relative frequency shifts of ssDNA, dsDNA, and viral DNA detections at various
concentrations can be seen in Figure 7.10 (b).
92
Figure 7.9 Resonance frequency shift during several steps of immobilization and
detection.
0 20 40 60 80 100 120 140 160 180
-12
-10
-8
-6
-4
-2
0
Flow Method
10-18
M
viral
DNABSA
Bloc-
king
Probe
DNA
Sulfo
SMCC
Ne
ga
tiv
e C
on
tro
l
f
(kH
z)
Time (Minutes)
PBS
Dipping Method
b)
93
Figure 7.10 a) Dose-response of extracted Hepatitis B Virus DNA detections in 7.5ml of
5%BSA+PBS, b) Comparison of relative frequency shifts versus concentrations of
synthesized single and double stranded DNA and viral DNA
0 5 10 15 20 25 30
-5
-4
-3
-2
-1
0
6x104
copies/mL
6x106
copies/mL
6x107
copies/mL
f(
kH
z)
Time(Minute)
Negative
30 copies/mL
60 copies/mL
6x102
copies/mL
101
102
103
104
105
106
107
108
0.00
0.02
0.04
0.06
0.08
0.10
0.12
0.14
0.16
-f/f(
%)
Concentration(copies/mL)
ssDNA
dsDNA
HB Viral DNA
a)
b)
94
7.3.2 Effect of target DNA length
In this study, synthesized ssDNA, dsDNA and viral DNA, extracted from
Hepatitis B viruses by Dr. Guo’s group, detections in different sample volumes (3.5ml,
7.5ml, and 50mL) have been made using the dehybridization system with flow explained
below to investigate the effects of target DNA length and sample volume on DNA
detection. In clinical experiments, since 50ml sample volume of serum will not
practically be taken from patients with Hepatitis B, sample volume is supposed to be
reduced to the range of 3ml-10ml of serum. For this reason, the sample volume in our
experiments has been reduced to 7.5ml.
100-nt long ssDNA, 90-bp dsDNA and 3200-bp HB viral DNA have been used as
targets to investigate the effect of length of DNA on detection by using PEPS which has
the same probe length for all the experiments. All the experiments have been run in
5%BSA+PBS of sample solution. In Figure 7.10 (b), relative frequency shifts due to
various concentrations of ssDNA, dsDNA and extracted viral DNA are shown.
Consequently, there is no length effect of target DNA on DNA detection in
5%BSA+PBS using PEPS, except the type of target. The results of double stranded target
DNA including 90-bp dsDNA and 3200-bp extracted HB viral DNA were almost the
same as can be seen in Table 7.2. However, the result of 100-nt single stranded DNA was
considerably different. The reason why the targets with different length have the same -
95
∆f/f value at the certain concentrations can be explained by electrostatic repulsion. Due to
the electrostatic repulsion of sugar phosphate backbone with negative charge, target
DNAs hybridized with probe DNAs on sensor surface repulse upward each others. Thus,
there is no mass effect on the shift in resonance frequency. The resonance frequency
totally changes with surface stress due to target DNAs hybridization with probe DNAs on
sensor surface.
Table 7.2 Percentages of relative frequency shifts at various concentrations due to
dsDNA and viral DNA over relative frequency shift due to ssDNA and percentage of
relative frequency shift at various concentrations due to viral DNA over relative
frequency shift due to dsDNA
Concentration
(copies/mL)
∆f/fdsDNA/∆f/fssDNA
(%)
∆f/fHBV
DNA/∆f/fssDNA
(%)
∆f/fHBV
DNA/∆f/fdsDNA
(%)
30 68.9 ±12.4 47.6 ±3.5 68.9 ±11.9
60 55.41 ±5.8 54.2 ±6.7 97.9 ±12.2
600 70.3 ±11.0 67.4 ±12.3 95.8 ±11.9
60,000 76.3 ±3.5 73.3 ±6.8 96.1 ±9.3
6,000,000 82.8 ±3.4 84.6 ±7.6 102.2 ±8.6
60,000,000 97.9 ±2.6 95.3 ±3.5 97.2 ±4.0
96
7.3.3 Fluorescent Microspheres Validation
In this study, the validation of the viral DNA detection has been demonstrated by
using fluorescence microspheres. The reason of using fluorescence microspheres (FM) is
to validate the viral DNA detection electrically in Figure 7.11 and visually in Figure 7.12.
Target DNA detection using the detection signal of fluorescent reporter
microspheres 6 µm in diameter has been demonstrated. The reporter MS was coated with
reporter DNAs seen below.
Downstream Reporter: NH2_5’-TTTATCATATTCCTCTTCATCCTGCTGCTA-3’
Upstream Reporter: 5’-TGGTTCTTCTGGACTACCAAGGTATGTTGC-3_ NH2
97
Figure 7.11 Electrical confirmation for the viral DNA detection by using fluorescent
micrographs
0 30 60 90
-5
-4
-3
-2
-1
0
30 copies/mL
60 copies/mL
600 copies/mL
60,000 copies/mL
ControlFRMHBV DNA
f(
kH
z)
Time(Minute)
98
Figure 7.12 Fluorescent images of FRMs for the confirmation of viral DNA detections at
a) 30 copies/ml, b) 60 copies/ml, c) 600 copies/ml, and d) 60,000 copies/ml of
concentrations
30 copies/ml 600 copies/ml
60 copies/ml 60,000 copies/ml
99
Viral DNA detection has been enhanced by using reporter DNA conjugated to
carboxylated fluorescent polystrene microspheres and confirmed both electrically and
visually.
As an example, in Figure 7.11, we show ∆f/f versus time of 30 min detection of
spiked viral DNA at 30, 60, 600, and 60,000 copies/ml in serum-like medium with 5%
BSA+PBS at room temperature for 30 min, in situ validated by the following fluorescent
reporter MS detection in PBS with 5% BSA+PBS at room temperature. As can be seen, -
∆f/f of reporter MS detection increases with increasing viral DNA concentration in
serum-like medium and remained negligible following the detection in blank serum-like
medium, validating that the observed ∆f/f during detection in serum-like medium was
indeed due to the specific binding of target DNA to the probe DNA on the PEPS surface.
By counting the number of fluorescent microspheres on sensor surface at various
target concentrations, relative frequency shift due to fluorescent microspheres has been
calculated. As seen in Figure 7.13, there is a correlation between the relative frequency
shifts due to fluorescent microspheres and the number of fluorescent microspheres.
Approximately, a fluorescent microsphere binding on sensor surface causes 100 Hz shift
in resonance frequency of PEPS.
100
Figure 7.13 Relative frequency shifts due to fluorescent microspheres at certain
concentrations.
100 1000 10000 100000
0.00
0.01
0.02
0.03
0.04
0.05
0.06
0.07
0.08 f/f(%) of Microspheres
# of Microspheres
Concentration(copies/mL)
f/f(
%)
du
e t
o F
RM
s
0
5
10
15
20
25
# o
f m
icro
sp
he
res
101
7.4 Conclusion
In this study, the feasibility of viral DNA detection in 5% BSA + PBS solution
has been demonstrated. However, samples should be spiked to the serum instead of
BSA+PBS to simulate the human serum. In addition to this, HB virus spiked samples
should be used to detect viral DNA. This study would lead to clinical applications.
The results indicates that PEPS coated with a 16-nucleotide probe targeting the
small surface antigen (HBsAg) gene can detect single stranded DNA, double stranded
DNA, and extracted HB viral DNA spiked in serum simulated by BSA at a concentration
of 30 copies/ml in less than 30 min at room temperature after the initial de-hybridization
at 95 degree C and cooling in a flow setting.
102
8. Chapter VIII: Effect of Sample Volume at Extremely Low Concentrations
8.1 Introduction
Due to medical phobias and blood loss of venesection, the amount of blood taken
from patients for diagnostic laboratory purpose needs to be restricted. Generally, 5 ml to
10 ml of blood is collected for laboratory works. Volume of blood for phlebotomy in
adult patients should form an extremely small percentage of total blood volume so that
patients can tolerate the blood loss.179
In the future, the ultimate goal will be viral DNA detection and quantification in
human serum by using PEPS. The sample volume limitations in phlebotomy should be
considered. In clinical experiments, since 50ml sample volume of serum will not
practically be taken from patients with Hepatitis B, sample volume is supposed to be
reduced to the range of 3ml-10ml of serum. For this reason, the sample volume in our
experiments was reduced to 7.5ml.
In this study, the effect of sample volume on extracted viral DNA detection in
serum-like medium was investigated. Additionally, the number of target DNA captured
by sensor was estimated analytically.
103
8.2 Experimental Section
The setup explained in previous chapters includes a hot water bath to heat the
sample to 95oC, tubing connecting the sample to the cooling bath, to the detection cell,
and finally to the sample again. The detection cell is inside an incubator to keep the
sample temperature at room temperature. The hot water bath and cooling water bath are
outside the incubator.
The sample will be placed in the hot water bath and held by a sample holder on a
stand. A thermometer is also inserted through the aluminum foil and held by a holder to
monitor the sample temperature.
The sample containing viral DNA in different volumes of 5% Bovine Serum
Albumin (BSA) + Phosphate Buffered Saline (PBS) at various concentrations was heated
in a hot-water bath for 10 min to denature the DNA. The heated sample was then be
pumped through tubing to the following tubing in the cooling water bath, and to the
detection cell where the sensor is located and to again the sample container. The heated
sample and the detection cell are properly connected with tubing. The flow rate will be
around 1.5ml/min and detection will take about 30 min.
In the volume effect experiments, the sequence shown below was used as probe.
104
16mer ssDNA Probe: Amine_Activated-5'- TGCCTCATCTTCTTGT -3'
The sensor was insulated with the new insulation method explained previously.
10mg of Sulfo-SMCC in 300µl of PBS was immobilized on the insulated sensor surface,
and then 10-8
M of probe DNA in 300µl of PBS was applied on Sulfo-SMCC immobilized
sensor surface. Probe DNA and Sulfo-SMCC immobilization steps were done by dipping
method mentioned previously. BSA blocking and single stranded DNA detection were
made via flow method. After immobilization, sensor surface was blocked with 5% of
BSA in PBS to prevent non-specific binding.
8.3 Results
8.3.1 The Effect of Sample Volume
In this study, the volume effect of sample solution that DNA samples are spiked
into has been investigated as well. Extracted HB viral DNA was spiked into sample
solutions with different volumes, 3.5mL, 7.5mL and 50mL respectively at various
concentrations. Results can be seen in Figure 8.1.
105
Figure 8.1 Comparison of relative frequency shifts versus concentrations of viral DNA
detections in 3.5ml, 7.5ml, and 50ml of sample solutions.
101
102
103
104
105
106
107
108
0.00
0.04
0.08
0.12
0.16
-f/f(
%)
Concentration(copies/mL)
3.5 mL
7.5 mL
50 mL
10 100 1000
0.000
0.005
0.010
0.015
0.020
0.025
0.030
0.035
f/
f(%
)
Concentration (copies/mL)
3.5mL
7.5mL
50mL
106
In terms of volume, we can mention about loss of sensitivity at lower
concentrations for different volumes. However, we cannot mention about the effect of
sample volume for higher concentrations.
8.3.2 The Estimation of captured DNA on PEPS
Quantification of DNA plays an important role for biological studies. It is also
critical for hepatitis B viral DNA count to diagnose the disease, monitor the replication of
virus and evaluate the treatment type and process. 180-183
In this study, the number of target DNA captured on sensor surface at lower
concentrations of HB viral DNA in 3.5 mL and 7.5 mL of 5% BSA + PBS has been
investigated and estimated by using the results as shown in Figure 8.2.
When a target DNA binds the probe, actual concentration in solution does not
change at high concentrations and large volumes. At very low concentrations and small
volumes, actual concentration changes.
If we consider ‘X’ as the number of captured DNA on sensor surface, the actual
number of target DNA in solution would be C17.5-X1 and C23.5-X2. C1 and C2 are the
concentrations for the detections in 7.5 mL and 3.5 mL, respectively. For lower
107
concentrations, the total numbers of target DNA captured on sensor surface should be the
same for the same relative frequency change at different concentrations. According to
this hypothesis, the actual concentrations in the solutions at the same relative frequency
change should be
Equation 8.1
• x: # of captured target DNA on sensor surface
• C1 or C2: concentration
• Volumes: 7.5 or 3.5 mL
• Total # of target DNA: 7.5.C or 3.5.C
• Actual # of target DNA in solution: 7.5.C1-x or 3.5.C2-x
108
Figure 8.2 ∆f/f values of viral DNA detections in 3.5 and 7.5mL of sample solutions vs.
concentrations
40 60
0.000
0.005
0.010
f/
f(%
)
Concentration(copies/mL)
3.5 ml
7.5 ml
109
• Hypothesis:
– Actual concentration is the same; C1-x/7.5=C2-x/3.5
By using Equation 8.1, we can calculate the total number of target DNA captured
on sensor surface theoretically as seen below and in Table 8.1.
• x=54 for 0.002804 of ∆f/f (93 Hz of ∆f)
• x=56 for 0.002908 of ∆f/f (97 Hz of ∆f)
• x=58 for 0.003004 of ∆f/f (100 Hz of ∆f)
• x=61 for 0.003149 of ∆f/f (105 Hz of ∆f)
• x=63 for 0.003293 of ∆f/f (109 Hz of ∆f)
• x=65 for 0.003390 of ∆f/f (113 Hz of ∆f)
• x=68 for 0.003486 of ∆f/f (116 Hz of ∆f)
110
Table 8.1 ∆f due to DNA captured by PEPS at extremely low concentrations
As can be seen in the calculations above, for the extremely low concentrations it
is possible to estimate the number of target DNA captured on sensor surface. Binding of
one copy of target DNA approximately causes 1.7 Hz shift in the resonance frequency of
PEPS as seen in Figure 8.3.
∆f due to DNA
captured by
PEPS (Hz)
# of DNA captured
by PEPS
93 54
97 56
100 58
105 61
109 63
113 65
116 68
111
52 54 56 58 60 62 64 66 68 7090
95
100
105
110
115
120
f due to tDNA
Linear fitting
f
du
e t
o t
DN
A (
Hz)
# of tDNA
Equationy = a + b*x
Adj. R-Square
0.99287
Value Standard Error
Delta_F Slope 1.68679 0.0583
Figure 8.3 ∆f due to DNA captured by PEPS and linear fitting
112
8.4 Conclusion
In this chapter, it has been shown that viral DNA detection at extremely low
concentrations was affected in terms of sensitivity. The less volume of sample causes less
sensitivity at lower concentrations. However, this trend was not observed at higher
concentrations because of the excess amount of target in sample. Even though the volume
is low, the number of target DNA in low volume sample with higher concentration can
compensate the low volume effect.
It also has been exhibited that the number of target DNA captured by sensor can
be estimated analytically. These encouraging results show that PEPS has a potential in
quantification of DNA.
113
9. Chapter IX: Genetic Detection of HB viral particles
9.1 Introduction
Hepatitis B virus (HBV) is a member of Hepadnaviridae viruses family and has a
partly double-stranded, relaxed circular (rc) DNA genome.129
The virus consists of an
outer lipid envelope and a capsid core composed of protein.
In order to detect genetic material of HBV, the viruses must be lysed to release
genetic material. Outer lipid envelope of HBV can be denatured by heating. By using a
chemical reagent which is an anionic surfactant, the protein capsid can be lysed.130
It is
clearly known that the nucleocapsid (core) of HBV can be disrupted by Sodium Dodecyl
Sulfite (SDS).184
Heating in SDS is quite effective on denaturation of HBV proteins.185
Addition of
heat and low concentrations of agents such as SDS destabilizes protein structure of HBV
capsid. High temperature chamber at 95 degree Celsius and SDS can lyse the viral
envelope and capsid, and de-hybridize double stranded DNA.130
Previous experiments on genetic detection of E.coli O157:H7 have demonstrated
that 5% SDS with heating at 95 degree Celsius for 10 min was efficient to lyse the
membrane and release bacterial DNA.
114
In this study, effect of SDS amount and heating time on denaturation of HBV and
releasing viral DNA has been investigated.
9.2 Experimental Section
9.2.1 Setup for viral particles detection
The sample containing viral particles is heated in a hot-water bath with SDS at
various concentrations (5%, 10%, and 15%) at 95 degree Celsius for 10 min to denature
the outer lipid envelope and de-hybridize the double-stranded DNA. The processed
sample is then pumped through the cooling tubing to the detection cell. The sensor is
located in the center of the detection cell and the center of the flow. The detection cell is
maintained at a lower, desired temperature for specific target DNA signature detection.
From the detection cell, the serum is recycled back to the sample container. The flow of
the liquid is driven by a peristaltic pump at a flow rate of around 1.5 ml/min. The
innovation of such a detection scheme is that cooling the sample in a narrow passage
prevents DNA from re-hybridization and allows the DNA to remain single-stranded to be
detected by the PEPS. The constant temperature of the detection cell ensures that the
detection is stable and reliable. The advantage of PEPS detection method is that there is
no need for DNA isolation, concentration, or amplification.158
115
PEPS was insulated as mentioned previously, and 24-nt probe DNA targeting the
gene expressing Hepatitis B surface Antigen (HBsAg) was immobilized on sensor
surface by Sulfo-SMCC.
9.3 Results
pDNASgene1 targeting the gene expressing HBsAg was exactly matching with
human DNA. Overlapping of probe DNA with human DNA might affect genetic
detection of HBV in human serum containing human DNA. As seen in Figure 9.1, in
experiments with pDNASgene1 non-specific binding due to human DNA was not
prevented. Firstly, the detection was carried out in a sample viral DNA spiked.
Afterward, the same detection was repeated in a sample having only human DNA in it. In
both cases, the sensor with pDNASgene1 was unable to differentiate the viral and human
DNA.
116
Figure 9.1 Viral and human DNA detection by pDNASgene1
0 5 10 15 20 25 30-2500
-2000
-1500
-1000
-500
0
f(H
z)
Time(Minute)
6,000 copies/ml of Human DNA
60,000 copies/ml of Viral DNA
117
In order to prevent non-specific binding due to human DNA, a new probe has
been designed. The new probe named as pDNASgene2 has 69 degree Celsius melting
temperature. As the maximum melting temperature of some parts on the probe matching
human DNA is 51 degree Celsius, running experiment at 55 degree Celsius would be able
to prevent non-specific binding human DNA as shown in Figure 9.2.
118
Figure 9.2 Viral and human DNA detection by pDNASgene2
0 5 10 15 20 25 30
-2500
-2000
-1500
-1000
-500
0
f(
Hz)
Time(Minute)
6,000 copies/ml of Human DNA
60,000 copies/ml of Viral DNA
119
Figure 9.3 shows that by using pDNASgene2 extracted viral DNA detection in 6000
copies/ml of human DNA spiked serum-like samples with 5% BSA is possible.
120
0 5 10 15 20 25 30-2.5
-2.0
-1.5
-1.0
-0.5
0.0
f(
kH
z)
Time(Minute)
Control
30 copies/ml
60 copies/ml
300 copies/ml
600 copies/ml
6,000 copies/ml
60,000 copies/ml
Figure 9.3 Dose-response results of extracted HBV DNA detections with pDNASgene2
121
In the following experiments, viral DNA detection in viral particles spiked
samples has been studied by adding 5% SDS into sample solution to lyse the virus and
release the genetic materials of virus as shown in Figure 9.4.
122
0 10 20 30-1000
-800
-600
-400
-200
0
f(
Hz)
Time (Minute)
Control
600 copies/ml
6,000 copies/ml
60,000 copies/ml
Figure 9.4 Dose-response results of viral DNA detections in viral particles spiked
samples
123
In these experiments, it has been seen that 5% SDS was not sufficient for lysing
the virus. To optimize the heating time and amount of SDS for lysing the virus, viral
DNA detections have been investigated at various SDS amounts and heating times.
Additionally, the effect of NP-40 non-ionic surfactant which is effective on denaturation
of outer lipid envelope has been studied.
As seen in the Table 9.1, there was almost no effect of heating duration on lysing
the virus in the experiment done at 600 copies/ml. Each data shows the percentage of ∆f/f
due to viral particles over ∆f/f due to extracted viral DNA.
124
Table 9.1 The effect of heating time on lysing the virus
By keeping the heating time as 10 minutes, several experiments on the effects of
SDS alone and the combination of SDS and NP-40 have been done. According to those
experiments, the optimum condition to lyse the virus and release the viral DNA has been
chosen as 10% SDS with 10 minutes heating seen in Table 9.2.
Table 9.2 The effect of detergents on lysing the virus
Heating Time 10% SDS 15% SDS
10 65% 63%
15 64% 54%
Concentration
(copies/ml)
5% SDS 10% SDS 1% NP-40 +
10% SDS
300 -- 34% 29%
600 11% 65% 62%
6,000 13% 102% --
60,000 49% 126% --
125
It has been clearly observed that in the experiments carried out under the optimum
lysing condition (10% SDS with 10 minutes heating) viral DNA in viral particles and
human DNA at 6,000 copies/ml spiked samples with 5% BSA + 10% SDS is detectable
down to 300 copies/ml seen in Figure 9.5.
126
0 5 10 15 20 25 30
-5000
-4000
-3000
-2000
-1000
0
f(
kH
z)
Time(Minute)
Control
3x102 copies/ml
6x102 copies/ml
6x103 copies/ml
6x104 copies/ml
6x105 copies/ml
Figure 9.5 Dose-response results of viral DNA detections in viral particles spiked
samples with 10% SDS
127
Increasing amount of SDS in detection solution has a positive effect on viral DNA
detection in viral particles spiked samples in terms of sensitivity. As seen in Figure 9.6,
increased SDS not only effectively lyses the virus and make releasing the genetic
material of the virus easier, but also enhances the sensitivity at higher concentrations.
128
102
103
104
105
106
100
1000
10000
viral DNA
viral particles
f (H
z)
Concentration (copies/ml)
Figure 9.6 Comparison of ∆f values due to viral DNA with 0% SDS and viral particles
detections with 10% SDS
129
In this study, the doability of the viral DNA detection in viral particles spiked
samples has been demonstrated by using fluorescence microspheres. The reason of using
fluorescence microspheres (FM) is to validate the viral DNA detection electrically in
Figure 9.7.
Target DNA detection using the detection signal of fluorescent reporter
microspheres 6 µm in diameter has been demonstrated. The reporter MS was coated with
reporter DNAs seen below.
Upstream Reporter: 5’-CCCACTGTTTGGCTTTCAGCTATATGGATG-3’_NH2
Downstream Reporter: NH2_5’-TTCTCCTGGCTCAGTTTACTAGTGCCATTT-3’
130
Figure 9.7 Electrical validation for the detection of viral particles by using fluorescent
microspheres
0 10 20 30 40 50 60-3500
-3000
-2500
-2000
-1500
-1000
-500
0
Control
3x102 copies/ml
6x102 copies/ml
6x103 copies/ml
tDNA
f(
kH
z)
Time(Minute)
FRM
131
The viral particle detection has also been confirmed by taking a fluorescent
micrograph of the sensor surface after each detection. Figure 9.8 shows that the viral
particles detection by using PEPS has been validated.
132
Figure 9.8 The fluorescent micrographs of sensor surface after fluorescent microsphere
validation of viral particles detection at a) 300 copies/ml, b) 600 copies/ml, and c) 6000
copies/ml of concentrations
300 copies/ml
6000 copies/ml
300 copies/ml 600 copies/ml
a) b)
c)
133
9.4 Discussion
To confirm the DNA detection with PEPS, blinded tests for viral and bacterial DNA were
carried out by using the samples with blinded by a PhD student, Giang Au, in our group spiking
bacterial DNA in 10 times diluted stool samples. Also, the estimated and actual results of
bacterial blinded test were accurately validated by PCR, which was carried out by Dr. Joshi’s
Group, Department of Surgery, College of Medicine, Drexel University, PA, except one of them
(B2). That sample was actually negative; however, estimated result and PCR result was positive.
The reason of false positive result would be contamination due to the previous sample (B1). The
estimated and PCR results can be seen in Table 9.3, and the gel electrophoresis pictures of PCR
for samples A and B can be seen in Figure 9.9 and Figure 9.10, respectively.
Table 9.3 Estimated and PCR results for bacterial blinded tests
Blinded
Samples
Actual (copies/ml) Estimated
(copies/ml)
PCR
A1 600,000 370,000 Positive
A2 0 0 Negative
A3 6,000 4,000 Positive
A4 60,000 45,000 Positive
B1 1000 5,000 Positive
B2 0 3,000 Positive
B3 30.000 50,000 Positive
B4 6,000 9,000 Positive
134
Figure 9.9 Gel electrophoresis picture of PCR results for blinded sample A,
1) DI water as a negative control
2) E.coli 25922 (non-pathogenic) genomic DNA as a negative control
3) E.coli O157:H7 (pathogenic) genomic DNA (100ng) as positive control
4) Sample A3 (6000 copies/mL)
5) Sample A4 (60,000 copies/mL)
6) Sample A1 (600,000 copies/mL)
7) 100 bp ladder
135
Figure 9.10 Gel electrophoresis picture of PCR results for blinded sample B,
1) Sample B1 (1000 copies/ml)
2) Sample B2 (0 copies/ml)
3) Sample B3 (30,000 copies/ml)
4) Sample B4 (6000 copies/ml)
5) Known sample1 (20,000 copies/ml)
6) Known sample2 150 copies/ml
7) Known sample3 600 copies/ml
8) Control
9) O157:H7 gDNA (100ng)
10) Nonpath E.coli (100ng) -
11) Water
12) 100bp ladder
136
In order to control whether detections at low concentrations are real, or not, t-test
has been carried out to obtain p-values. Results can be seen in Table 9.4. Results clearly
exhibits that data obtained from viral particles detection and control are completely
different by considering the confident level as 5%.
Table 9.4 p-values of t-test for the viral particles detection
Detection of viral particles with PEPS by using a model study (viral particles
spiked in simulated serum) should also be repeated by using real patient samples. The
number of samples which will be used in clinical study can be determined by statistical
power analysis. In Figure 9.11, the confident level of power analysis was chosen as 0.9.
For the lowest concentration of viral particles detection (300 copies/ml), the minimum
Concentration
(copies/ml)
p value
300 0.0025
600 0.00017
6,000 0.0025
60,000 0.00038
600,000 0.000027
137
sample size would be 4. The power to detect a difference of μ − μ0 with two-sided
significance level α is given by Equation 9.1 as seen below;
Equation 9.1
where
Tdf ( . |θ) : the cumulative distribution function of the noncentral t-distribution
df : degrees of freedom
: noncentrality parameter θ
tp,df : the point of the central t-distribution with df degrees of freedom corresponding to an
upper-tail probability of p.
138
2 3 4 5 60.2
0.3
0.4
0.5
0.6
0.7
0.8
0.9
1.0
1.1
Po
we
r
N = Sample size
Figure 9.11 Sample size determination with 0.9 confidence level
139
9.5 Conclusion
In this study, the feasibility of viral DNA detection in viral particles spiked
serum-like samples with 5% BSA + 10% SDS solution has been demonstrated. However,
samples should be spiked to the serum instead of BSA+SDS+PBS to simulate the human
serum. In addition to this, samples obtained from real patients should be used to detect
viral DNA. These studies would lead to clinical applications.
The results indicates that PEPS coated with a 24-nucleotide probe targeting the
small surface antigen (HBsAg) gene can detect HB viral DNA in viral particles spiked
serum-like samples with 5% BSA + 10% SDS solution at a concentration of 300
copies/ml in less than 30 min at room temperature after the initial denaturation and de-
hybridization by using SDS and heating at 95 degree Celsius for 10 minutes and cooling
in a flow setting. Also, the results have been confirmed by fluorescent microspheres
electrically and visually.
140
10. Chapter X: Conclusion
10.1 Investigation of MPS coating for better insulation
• 0.1% MPS and 0.5% water at pH 9 is a better coating condition that resulted in
– 2−3 orders reduced maximal current density
– 1000 times reduced noise
– 3 times enhanced coating thickness
• Sensor with such insulation coating was stable in 1x phosphate buffered saline
(PBS) for >24 hours.
• The surface of the coating was also smooth, optimal for PEPS binding stress
induced detection resonance shift.
10.2 Investigation of direct detection of ssDNA, dsDNA and viral DNA in
spiked sera
• By QCM, density of Sulfo-SMCC and Probe DNA on surface were determined to
be 4 per 10 nm2,
and 3 per 10nm2, respectively.
• 5% BSA blocking prevents non-specific binding effectively.
• 30 copies/ml of analytical sensitivity in less than 40 min was achieved by PEPS in
detecting extracted viral DNA in simulated serum.
• One copy of target DNA was determined to correspond 1.7 Hz of frequency shift
at extremely low concentrations of 40-60 copies/ml.
141
10.3 Investigation of direct detection of viral particles in spiked sera
• By using 95 degree Celsius heating with 10% SDS for 10 min, the virus was lysed
to exposure DNA with almost 100% recovery concentrations to 10000 copies/ml
and >34% recovery at 300 copies/ml.
• A larger-than-8 SNR was achieved for the lowest concentration in viral particles
detection.
• Viral DNA detection of viral particles spiked in simulated serum at concentrations
as low 300 copies/ml has been validated by in situ reporter fluorescent
microspheres detection and by the visualization of the captured reporter
fluorescent microspheres .
142
LIST OF REFERENCES
1. Nebbia, G.; Peppa, D.; Maini, M. K., Hepatitis B infection: current concepts and
future challenges. Qjm-an International Journal of Medicine 2012, 105, (2), 109-113.
2. Ott, J. J.; Stevens, G. A.; Groeger, J.; Wiersma, S. T., Global epidemiology of
hepatitis B virus infection: New estimates of age-specific HBsAg seroprevalence and
endemicity. Vaccine 2012, 30, (12), 2212-2219.
3. Mutimer, D. J.; Lok, A., Management of HBV- and HCV-induced end stage liver
disease. Gut 2012, 61, 59-67.
4. Juon, H. S.; Park, B. J., Effectiveness of a culturally integrated liver cancer
education in improving HBV knowledge among Asian Americans. Preventive Medicine
2013, 56, (1), 53-58.
5. Ganem, D.; Prince, A. M., Hepatitis B virus infection--natural history and clinical
consequences. N Engl J Med 2004, 350, (11), 1118-29.
6. Safioleas, M.; Lygidakis, N. J.; Manti, C., Hepatitis B today. Hepato-
Gastroenterology 2007, 54, (74), 545-548.
7. Koff, R. S., Hepatitis-B Today - Clinical and Diagnostic Overview. Pediatric
Infectious Disease Journal 1993, 12, (5), 428-432.
8. Aspinall, E. J.; Hawkins, G.; Fraser, A.; Hutchinson, S. J.; Goldberg, D., Hepatitis
B prevention, diagnosis, treatment and care: a review. Occup Med (Lond) 2011, 61, (8),
531-40.
9. Ott, J. J.; Stevens, G. A.; Wiersma, S. T., The risk of perinatal hepatitis B virus
transmission: hepatitis B e antigen (HBeAg) prevalence estimates for all world regions.
Bmc Infectious Diseases 2012, 12.
10. Al-Mahtab, M.; Akbar, S. M. F.; Rahman, S.; Kamal, M.; Khan, M. S. I.,
Biochemical, Virological, Immunological and Histopathological Features of 702
Incidentally Detected Chronic Hepatitis B Virus Carriers in Bangladesh. Digestion 2012,
86, (1), 1-5.
143
11. Lok, A. S. F.; Ward, J. W.; Perrillo, R. P.; McMahon, B. J.; Liang, T. J.,
Reactivation of Hepatitis B During Immunosuppressive Therapy: Potentially Fatal Yet
Preventable. Annals of Internal Medicine 2012, 156, (10), 743-U140.
12. Pan, C. V. Q.; Duan, Z. P.; Bhamidimarri, K. R.; Zou, H. B.; Liang, X. F.; Li, J.;
Tong, M. J., An Algorithm for Risk Assessment and Intervention of Mother to Child
Transmission of Hepatitis B Virus. Clinical Gastroenterology and Hepatology 2012, 10,
(5), 452-459.
13. Namululi, B. A.; Guerrieri, C.; Dramaix, M. W., Prevalence and incidence of HIV
and hepatitis B among blood donors and estimated residual risk of transmission of HIV
and HBV virus by blood transfusion. A study at the Provincial General Referee Hospital
Bukavu, Democratic Republic of the Congo. Revue D Epidemiologie Et De Sante
Publique 2013, 61, (2), 139-144.
14. Cassino, L.; Torres, C.; Mbayed, V.; Laufer, N.; Campos, R. H.; Quarleri, J.,
Comparative analysis of hepatitis B virus genotype a molecular evolution in patients
infected with HBV and in patients co-infected with HBV and HIV. Journal of Medical
Virology 2012, 84, (4), 562-569.
15. Resnick, L.; Veren, K.; Salahuddin, S. Z.; Tondreau, S.; Markham, P. D., Stability
and Inactivation of Htlv-Iii Lav under Clinical and Laboratory Environments. Jama-
Journal of the American Medical Association 1986, 255, (14), 1887-1891.
16. Bar-Gal, G. K.; Kim, M. J.; Klein, A.; Shin, D. H.; Oh, C. S.; Kim, J. W.; Kim, T.
H.; Kim, S. B.; Grant, P. R.; Pappo, O.; Spigelman, M.; Shouval, D., Tracing hepatitis B
virus to the 16th century in a Korean mummy. Hepatology 2012, 56, (5), 1671-1680.
17. Chang, J. J.; Lewin, S. R., Immunopathogenesis of hepatitis B virus infection.
Immunology and Cell Biology 2007, 85, (1), 16-23.
18. Dienstag, J. L., Drug therapy - Hepatitis B virus infection. New England Journal
of Medicine 2008, 359, (14), 1486-1500.
19. Cai, D.; Nie, H.; Yan, R.; Guo, J.-T.; Block, T.; Guo, H., A Southern Blot Assay
for Detection of Hepatitis B Virus Covalently Closed Circular DNA from Cell Cultures.
In Antiviral Methods and Protocols, Gong, E. Y., Ed. Humana Press: 2013; Vol. 1030, pp
151-161.
144
20. Seeger, C.; Ganem, D.; Varmus, H. E., Biochemical and genetic evidence for the
hepatitis B virus replication strategy. Science 1986, 232, (4749), 477-84.
21. Gerlich, W. H., Medical Virology of Hepatitis B: how it began and where we are
now. Virology Journal 2013, 10.
22. Ning, X.; Nguyen, D.; Mentzer, L.; Adams, C.; Lee, H.; Ashley, R.; Hafenstein,
S.; Hu, J., Secretion of genome-free hepatitis B virus--single strand blocking model for
virion morphogenesis of para-retrovirus. PLoS Pathog 2011, 7, (9), e1002255.
23. Rehermann, B.; Nascimbeni, M., Immunology of hepatitis B virus and hepatitis C
virus infection. Nature Reviews Immunology 2005, 5, (3), 215-229.
24. den Brouw, M. L. O.; Binda, R. S.; Geijtenbeek, T. B. H.; Janssen, H. L. A.;
Woltman, A. M., The mannose receptor acts as hepatitis B virus surface antigen receptor
mediating interaction with intrahepatic dendritic cells. Virology 2009, 393, (1), 84-90.
25. Lau, J. Y. N.; Wright, T. L., Molecular Virology and Pathogenesis of Hepatitis-B.
Lancet 1993, 342, (8883), 1335-1340.
26. D'Souza, R.; Foster, G. R., Diagnosis and treatment of chronic hepatitis B.
Journal of the Royal Society of Medicine 2004, 97, (7), 318-321.
27. Lok, A. S.; McMahon, B. J., Chronic hepatitis B. Hepatology 2007, 45, (2), 507-
39.
28. Lee, J. H.; Kim, S. J.; Ahn, S. H.; Lee, J.; Park, Y.; Kim, H. S., Correlation
between quantitative serum HBsAg and HBV DNA test in Korean patients who showed
high level of HBsAg. Journal of Clinical Pathology 2010, 63, (11), 1027-1031.
29. Chen, C. J.; Yang, H. I., Natural history of chronic hepatitis B REVEALed. J
Gastroenterol Hepatol 2011, 26, (4), 628-38.
30. Lok, A. S.; Heathcote, E. J.; Hoofnagle, J. H., Management of hepatitis B: 2000 -
Summary of a workshop. Gastroenterology 2001, 120, (7), 1828-1853.
31. Lai, C. L.; Chien, R. N.; Leung, N. W.; Chang, T. T.; Guan, R.; Tai, D. I.; Ng, K.
Y.; Wu, P. C.; Dent, J. C.; Barber, J.; Stephenson, S. L.; Gray, D. F., A one-year trial of
145
lamivudine for chronic hepatitis B. Asia Hepatitis Lamivudine Study Group. N Engl J
Med 1998, 339, (2), 61-8.
32. Valsamakis, A., Molecular testing in the diagnosis and management of chronic
hepatitis B. Clin Microbiol Rev 2007, 20, (3), 426-39.
33. Chen, J. D.; Yang, H. I.; Iloeje, U. H.; You, S. L.; Lu, S. N.; Wang, L. Y.; Su, J.;
Sun, C. A.; Liaw, Y. F.; Chen, C. J.; Load, R. E. V., Carriers of Inactive Hepatitis B
Virus Are Still at Risk for Hepatocellular Carcinoma and Liver-Related Death.
Gastroenterology 2010, 138, (5), 1747-U38.
34. Post, A Simulation Shows That Early Treatment Of Chronic Hepatitis B Infection
Can Cut Deaths And Be Cost-Effective (vol 30, pg 340, 2011). Health Affairs 2011, 30,
(3).
35. Lok, A. S.; McMahon, B. J.; Practice Guidelines Committee, A. A. f. t. S. o. L.
D., Chronic hepatitis B. Hepatology 2001, 34, (6), 1225-41.
36. Yuen, M. F.; Seto, W. K.; Fung, J.; Wong, D. K. H.; Yuen, J. C. H.; Lai, C. L.,
Three Years of Continuous Entecavir Therapy in Treatment-Naive Chronic Hepatitis B
Patients: VIRAL Suppression, Viral Resistance, and Clinical Safety. American Journal of
Gastroenterology 2011, 106, (7), 1264-1271.
37. Brechot, C.; Scotto, J.; Charnay, P.; Hadchouel, M.; Degos, F.; Trepo, C.;
Tiollais, P., Detection of Hepatitis-B Virus-DNA in Liver and Serum - a Direct Appraisal
of the Chronic Carrier State. Lancet 1981, 2, (8250), 765-768.
38. Hadziyannis, S. J.; Lieberman, H. M.; Karvountzis, G. G.; Shafritz, D. A.,
Analysis of Liver-Disease, Nuclear Hbcag, Viral Replication, and Hepatitis-B Virus-
DNA in Liver and Serum of Hbeag Vs Anti-Hbe Positive Carriers of Hepatitis-B Virus.
Hepatology 1983, 3, (5), 656-662.
39. Kinoshita, R.; Miura, K.; Uchino, H.; Konishi, A.; Nakagawa, T.; Imai, Y.,
Chronic Hepatitis-B - Correlation between Viral Replication and Clinical Course.
Journal of Infectious Diseases 1981, 144, (4), 303-306.
40. Pontisso, P.; Bortolotti, F.; Fattovich, G.; Ruvoletto, M. G.; Realdi, G.; Alberti,
A., Hepatitis-B Virus-DNA Forms in the Liver of Chronically Infected Individuals -
Relation to Replication Profile. Journal of Hepatology 1989, 9, (1), 29-35.
146
41. Pontisso, P.; Stenico, D.; Diodati, G.; Marin, G.; Caldironi, M. V.; Giacchino, R.;
Realdi, G.; Alberti, A., Hbv-DNA Sequences Are Rarely Detected in the Liver of Patients
with Hbsag-Negative Chronic Active Liver-Disease and with Hepatocellular-Carcinoma
in Italy. Liver 1987, 7, (4), 211-215.
42. Yates, S.; Penning, M.; Goudsmit, J.; Frantzen, I.; van de Weijer, B.; van Strijp,
D.; van Gemen, B., Quantitative detection of hepatitis B virus DNA by real-time nucleic
acid sequence-based amplification with molecular beacon detection. Journal of Clinical
Microbiology 2001, 39, (10), 3656-3665.
43. Wilkins, T.; Zimmerman, D.; Schade, R. R., Hepatitis B: diagnosis and treatment.
Am Fam Physician 2010, 81, (8), 965-72.
44. Abe, A.; Inoue, K.; Tanaka, T.; Kato, J.; Kajiyama, N.; Kawaguchi, R.; Tanaka,
S.; Yoshiba, M.; Kohara, M., Quantitation of hepatitis B virus genomic DNA by real-
time detection PCR. Journal of Clinical Microbiology 1999, 37, (9), 2899-2903.
45. Sablon, E.; Shapiro, F., Advances in Molecular Diagnosis of HBV Infection and
Drug Resistance. Int J Med Sci 2005, 2, (1), 8-16.
46. Hochberger, S.; Althof, D.; Gallegos de Schrott, R.; Nachbaur, N.; Rock, H.;
Leying, H., Fully automated quantitation of hepatitis B virus (HBV) DNA in human
plasma by the COBAS AmpliPrep/COBAS TaqMan system. J Clin Virol 2006, 35, (4),
373-80.
47. Yuan, H. J.; Yuen, M. F.; Wong, D. K. H.; Sum, S. S. M.; Lai, C. L., Clinical
evaluation of the Digene Hybrid Capture II test and the COBAS AMPLICOR monitor
test for determination of hepatitis B virus DNA levels. Journal of Clinical Microbiology
2004, 42, (8), 3513-3517.
48. Kao, J. H.; Chen, P. J.; Lai, M. Y.; Chen, D. S., Occult hepatitis B virus infection
and clinical outcomes of patients with chronic hepatitis C. Journal of Clinical
Microbiology 2002, 40, (11), 4068-4071.
49. Kim, H.; Shin, S.; Oh, E. J.; Kahng, J.; Kim, Y.; Lee, H. K.; Kwon, H. J.,
Comparison of the AdvanSure HBV Real-time PCR Test with Three Other HBV DNA
Quantification Assays. Annals of Clinical and Laboratory Science 2013, 43, (2), 230-237.
50. Pawlotsky, J. M., Hepatitis B virus (HBV) DNA assays (methods and practical
use) and viral kinetics. Journal of Hepatology 2003, 39, S31-S35.
147
51. Hammond, D. M.; Manetto, A.; Gierlich, J.; Azov, V. A.; Gramlich, P. M. E.;
Burley, G. A.; Maul, M.; Carell, T., DNA photography: An ultrasensitive DNA-detection
method based on photographic techniques. Angewandte Chemie-International Edition
2007, 46, (22), 4184-4187.
52. Passamano, M.; Pighini, M., QCM DNA-sensor for GMOs detection. Sensors and
Actuators B: Chemical 2006, 118, (1–2), 177-181.
53. Feng, K.; Li, J. S.; Jiang, J. H.; Shen, G. L.; Yu, R. Q., QCM detection of DNA
targets with single-base mutation based on DNA ligase reaction and biocatalyzed
deposition amplification. Biosensors & Bioelectronics 2007, 22, (8), 1651-1657.
54. Gasparac, R.; Taft, B. J.; Lapierre-Devlin, M. A.; Lazareck, A. D.; Xu, J. M.;
Kelley, S. O., Ultrasensitive electrocatalytic DNA detection at two- and three-
dimensional nanoelectrodes. Journal of the American Chemical Society 2004, 126, (39),
12270-12271.
55. Park, S. J.; Taton, T. A.; Mirkin, C. A., Array-based electrical detection of DNA
with nanoparticle probes. Science 2002, 295, (5559), 1503-1506.
56. He, L.; Musick, M. D.; Nicewarner, S. R.; Salinas, F. G.; Benkovic, S. J.; Natan,
M. J.; Keating, C. D., Colloidal Au-enhanced surface plasmon resonance for
ultrasensitive detection of DNA hybridization. Journal of the American Chemical Society
2000, 122, (38), 9071-9077.
57. Husale, S.; Persson, H. H. J.; Sahin, O., DNA nanomechanics allows direct digital
detection of complementary DNA and microRNA targets. Nature 2009, 462, (7276),
1075-U138.
58. Margolis, H. S.; Alter, M. J.; Hadler, S. C., Hepatitis-B - Evolving Epidemiology
and Implications for Control. Seminars in Liver Disease 1991, 11, (2), 84-92.
59. Hadler, S. C.; Margolis, H. S., Hepatitis B immunization: vaccine types, efficacy,
and indications for immunization. Curr Clin Top Infect Dis 1992, 12, 282-308.
60. Nielsen, J. O.; Dietrichson, O.; Elling, P.; Christoffersen, P., Incidence and
meaning of persistence of Australia antigen in patients with acute viral hepatitis:
development of chronic hepatitis. N Engl J Med 1971, 285, (21), 1157-60.
148
61. Redeker, A. G., Viral hepatitis: clinical aspects. Am J Med Sci 1975, 270, (1), 9-
16.
62. Ganem, D., Persistent Infection of Humans with Hepatitis-B Virus - Mechanisms
and Consequences. Reviews of Infectious Diseases 1982, 4, (5), 1026-1047.
63. Hyams, K. C., Risks of Chronicity Following Acute Hepatitis-B Virus-Infection -
a Review. Clinical Infectious Diseases 1995, 20, (4), 992-1000.
64. Ganem, D., Hepatitis B virus infection - Natural history and clinical consequences
(vol 350, pg 1118, 2004). New England Journal of Medicine 2004, 351, (12), 1268-1268.
65. Koff, R. S., Hepatitis B today: clinical and diagnostic overview. Pediatr Infect
Dis J 1993, 12, (5), 428-32.
66. Safioleas, M.; Lygidakis, N. J.; Manti, C., Hepatitis B today.
Hepatogastroenterology 2007, 54, (74), 545-8.
67. Wong, V. W. S.; Chan, H. L. Y., Severe acute exacerbation of chronic hepatitis B:
A unique presentation of a common disease. Journal of Gastroenterology and
Hepatology 2009, 24, (7), 1179-1186.
68. Lim, S. G.; Mohammed, R.; Yuen, M. F.; Kao, J. H., Prevention of hepatocellular
carcinoma in hepatitis B virus infection. Journal of Gastroenterology and Hepatology
2009, 24, (8), 1352-1357.
69. Ayoub, W. S.; Keeffe, E. B., Review article: current antiviral therapy of chronic
hepatitis B. Alimentary Pharmacology & Therapeutics 2011, 34, (10), 1145-1158.
70. Papatheodoridis, G. V.; Hadziyannis, S. J., Diagnosis and management of pre-
core mutant chronic hepatitis B. Journal of Viral Hepatitis 2001, 8, (5), 311-321.
71. Livingston, S. E.; Simonetti, J. P.; Bulkow, L. R.; Homan, C. E.; Snowball, M.
M.; Cagle, H. H.; Negus, S. E.; Mcmahon, B. J., Clearance of hepatitis B e antigen in
patients with chronic hepatitis B and genotypes A, B, C, D, and F. Gastroenterology
2007, 133, (5), 1452-1457.
149
72. Palumbo, E., Hepatitis B genotypes and response to antiviral therapy: a review.
Am J Ther 2007, 14, (3), 306-9.
73. Kerman, K.; Kobayashi, M.; Tamiya, E., Recent trends in electrochemical DNA
biosensor technology. Measurement Science & Technology 2004, 15, (2), R1-R11.
74. Diamond, D., Principles of chemical and biological sensors. Wiley: New York,
1998; p xxvii, 334 p.
75. Zhai, J.; Cui, H.; Yang, R., DNA based biosensors. Biotechnology Advances
1997, 15, (1), 43-58.
76. Stromberg, M.; Goransson, J.; Gunnarsson, K.; Nilsson, M.; Svedlindh, P.;
Stromme, M., Sensitive molecular diagnostics using volume-amplified magnetic
nanobeads. Nano Lett 2008, 8, (3), 816-21.
77. Donatin, E.; Buffet, S.; Leroy, Q.; Raoult, D.; Drancourt, M., A DNA microarray
for the versatile diagnosis of infectious diarrhea. APMIS 2013, 121, (7), 634-42.
78. Wang, J., From DNA biosensors to gene chips. Nucleic Acids Research 2000, 28,
(16), 3011-3016.
79. Pividori, M. I.; Merkoci, A.; Alegret, S., Electrochemical genosensor design:
immobilisation of oligonucleotides onto transducer surfaces and detection methods.
Biosensors & Bioelectronics 2000, 15, (5-6), 291-303.
80. Teles, F. R. R.; Fonseca, L. R., Trends in DNA biosensors. Talanta 2008, 77, (2),
606-623.
81. Seefeld, T. H.; Halpern, A. R.; Corn, R. M., On-Chip Synthesis of Protein
Microarrays from DNA Microarrays via Coupled In Vitro Transcription and Translation
for Surface Plasmon Resonance Imaging Biosensor Applications. Journal of the
American Chemical Society 2012, 134, (30), 12358-12361.
82. Jha, S. K.; Chand, R.; Han, D.; Jang, Y. C.; Ra, G. S.; Kim, J. S.; Nahm, B. H.;
Kim, Y. S., An integrated PCR microfluidic chip incorporating aseptic electrochemical
cell lysis and capillary electrophoresis amperometric DNA detection for rapid and
quantitative genetic analysis. Lab on a Chip 2012, 12, (21), 4455-4464.
150
83. Penchovsky, R., Programmable and automated bead-based microfluidics for
versatile DNA microarrays under isothermal conditions. Lab on a Chip 2013, 13, (12),
2370-2380.
84. Chen, J.; Huang, Y.; Shi, M.; Zhao, S. L.; Zhao, Y. C., Highly sensitive
multiplexed DNA detection using multi-walled carbon nanotube-based multicolor
nanobeacon. Talanta 2013, 109, 160-166.
85. Xuan, F.; Luo, X.; Hsing, I. M., Ultrasensitive Solution-Phase Electrochemical
Molecular Beacon-Based DNA Detection with Signal Amplification by Exonuclease III-
Assisted Target Recycling. Analytical Chemistry 2012, 84, (12), 5216-5220.
86. Delport, F.; Pollet, J.; Janssen, K.; Verbruggen, B.; Knez, K.; Spasic, D.;
Lammertyn, J., Real-time monitoring of DNA hybridization and melting processes using
a fiber optic sensor. Nanotechnology 2012, 23, (6).
87. Amin, R.; Kulkarni, A.; Kim, T.; Park, S. H., DNA thin film coated optical fiber
biosensor. Current Applied Physics 2012, 12, (3), 841-845.
88. Candiani, A.; Sozzi, M.; Cucinotta, A.; Selleri, S.; Veneziano, R.; Corradini, R.;
Marchelli, R.; Childs, P.; Pissadakis, S., Optical Fiber Ring Cavity Sensor for Label-Free
DNA Detection. Ieee Journal of Selected Topics in Quantum Electronics 2012, 18, (3),
1176-1183.
89. Wood, S. J., DNA DNA Hybridization in Real-Time Using Biacore.
Microchemical Journal 1993, 47, (3), 330-337.
90. Feriotto, G.; Ferlini, A.; Ravani, A.; Calzolari, E.; Mischiati, C.; Bianchi, N.;
Gambari, R., Biosensor technology for real-time detection of the cystic fibrosis W1282X
mutation in CFTR. Human Mutation 2001, 18, (1), 70-81.
91. Mariotti, E.; Minunni, M.; Mascini, M., Surface plasmon resonance biosensor for
genetically modified organisms detection. Analytica Chimica Acta 2002, 453, (2), 165-
172.
92. Vercoutere, W.; Akeson, M., Biosensors for DNA sequence detection. Current
Opinion in Chemical Biology 2002, 6, (6), 816-822.
151
93. Fritzsche, W., DNA-gold conjugates for the detection of specific molecular
interactions. J Biotechnol 2001, 82, (1), 37-46.
94. Reynolds, R. A.; Mirkin, C. A.; Letsinger, R. L., A gold nanoparticle/latex
microsphere-based colorimetric oligonucleotide detection method. Pure and Applied
Chemistry 2000, 72, (1-2), 229-235.
95. Spain, E.; Kojima, R.; Kaner, R. B.; Wallace, G. G.; O'Grady, J.; Lacey, K.;
Barry, T.; Keyes, T. E.; Forster, R. J., High sensitivity DNA detection using gold
nanoparticle functionalised polyaniline nanofibres. Biosensors & Bioelectronics 2011,
26, (5), 2613-2618.
96. Hohng, S.; Ha, T., Single-molecule quantum-dot fluorescence resonance energy
transfer. Chemphyschem 2005, 6, (5), 956-960.
97. Feng, C. L.; Zhong, X. H.; Steinhart, M.; Caminade, A. M.; Majoral, J. P.; Knoll,
W., Graded-bandgap quantum-dot-modified nanotubes: A sensitive biosensor for
enhanced detection of DNA hybridization. Advanced Materials 2007, 19, (15), 1933-+.
98. Liu, Y.; Luo, M.; Yan, J.; Xiang, X.; Ji, X.; Zhou, G.; He, Z., An ultrasensitive
biosensor for DNA detection based on hybridization chain reaction coupled with the
efficient quenching of a ruthenium complex to CdTe quantum dots. Chemical
Communications 2013, 49, (67), 7424-7426.
99. Rijal, K.; Mutharasan, R., A method for DNA-based detection of E. coli O157:H7
in a proteinous background using piezoelectric-excited cantilever sensors. Analyst 2013,
138, (10), 2943-2950.
100. Cha, B. H.; Lee, S. M.; Park, J. C.; Hwang, K. S.; Kim, S. K.; Lee, Y. S.; Ju, B.
K.; Kim, T. S., Detection of Hepatitis B Virus (HBV) DNA at femtomolar concentrations
using a silica nanoparticle-enhanced microcantilever sensor. Biosensors & Bioelectronics
2009, 25, (1), 130-135.
101. deLumleyWoodyear, T.; Campbell, C. N.; Heller, A., Direct enzyme-amplified
electrical recognition of a 30-base model oligonucleotide. Journal of the American
Chemical Society 1996, 118, (23), 5504-5505.
102. Wang, C.; Zhou, H.; Zhu, W. P.; Li, H. B.; Jiang, J. H.; Shen, G. L.; Yu, R. Q.,
Ultrasensitive electrochemical DNA detection based on dual amplification of circular
152
strand-displacement polymerase reaction and hybridization chain reaction. Biosensors &
Bioelectronics 2013, 47, 324-328.
103. Millan, K. M.; Mikkelsen, S. R., Sequence-Selective Biosensor for DNA-Based
on Electroactive Hybridization Indicators. Analytical Chemistry 1993, 65, (17), 2317-
2323.
104. Liu, M. Q.; Luo, C. H.; Peng, H., Electrochemical DNA sensor based on
methylene blue functionalized polythiophene as a hybridization indicator. Talanta 2012,
88, 216-221.
105. Wang, Q. X.; Ding, Y. T.; Wang, L. H.; Ni, J. C.; Yu, Z. L.; Lin, H. B.; Gao, F.,
Low-Background, Highly Sensitive DNA Biosensor by Using an Electrically Neutral
Cobalt(II) Complex as the Redox Hybridization Indicator. Chemistry-an Asian Journal
2013, 8, (7), 1455-1462.
106. Wang, J.; Grundler, P.; Flechsig, G. U.; Jasinski, M.; Rivas, G.; Sahlin, E.; Paz, J.
L. L., Stripping analysis of nucleic acids at a heated carbon paste electrode. Analytical
Chemistry 2000, 72, (16), 3752-3756.
107. Merkoci, A.; Aldavert, M.; Marin, S.; Alegret, S., New materials for
electrochemical sensing V: Nanoparticles for DNA labeling. Trac-Trends in Analytical
Chemistry 2005, 24, (4), 341-349.
108. Zheng, G. F.; Patolsky, F.; Cui, Y.; Wang, W. U.; Lieber, C. M., Multiplexed
electrical detection of cancer markers with nanowire sensor arrays. Nature Biotechnology
2005, 23, (10), 1294-1301.
109. Manbachi, A.; Cobbold, R. S. C., Development and application of piezoelectric
materials for ultrasound generation and detection. Ultrasound 2011, 19, (4), 187-196.
110. Birkholz, M., Crystal-Field Induced Dipoles in Heteropolar Crystals .2. Physical
Significance. Zeitschrift Fur Physik B-Condensed Matter 1995, 96, (3), 333-340.
111. Safari, A.; Akdogan, E. K., Piezoelectric and Acoustic Materials for Transducer
Applications. Springer: New York, 2008; p x, 479 p.
153
112. Gautschi, G., Piezoelectric sensorics : force, strain, pressure, acceleration and
acoustic emission sensors, materials and amplifiers. Springer: Berlin ; New York, 2002;
p xiii, 264 p.
113. Capobianco, J. A.; Shih, W. Y.; Shih, W. H., Methyltrimethoxysilane-insulated
piezoelectric microcantilevers for direct, all-electrical biodetection in buffered aqueous
solutions. Review of Scientific Instruments 2006, 77, (12).
114. Capobianco, J. A.; Shih, W. Y.; Shih, W. H., 3-mercaptopropyltrimethoxysilane
as insulating coating and surface for protein immobilization for piezoelectric
microcantilever sensors. Review of Scientific Instruments 2007, 78, (4).
115. Capobianco, J. A.; Shih, W. Y.; Yuan, Q. A.; Adams, G. P.; Shih, W. H., Label-
free, all-electrical, in situ human epidermal growth receptor 2 detection. Review of
Scientific Instruments 2008, 79, (7).
116. McGovern, J. P.; Shih, W. Y.; Shih, W. H., In situ detection of Bacillus anthracis
spores using fully submersible, self-exciting, self-sensing PMN-PT/Sn piezoelectric
microcantilevers. Analyst 2007, 132, (8), 777-783.
117. Zhu, Q.; Shih, W. Y.; Shih, W. H., Mechanism of flexural resonance frequency
shift of a piezoelectric microcantilever sensor during humidity detection. Applied Physics
Letters 2008, 92, (18).
118. Zhu, Q.; Shih, W. Y.; Shi, W. H., Enhanced detection resonance frequency shift
of a piezoelectric microcantilever sensor by a DC bias electric field in humidity detection.
Sensors and Actuators B-Chemical 2009, 138, (1), 1-4.
119. Shih, W. Y.; Zhu, Q.; Shih, W. H., Length and thickness dependence of
longitudinal flexural resonance frequency shifts of a piezoelectric microcantilever sensor
due to Young's modulus change. Journal of Applied Physics 2008, 104, (7).
120. Capobianco, J. A.; Shih, W. H.; Leu, J. H.; Lo, G. C. F.; Shih, W. Y., Label free
detection of white spot syndrome virus using lead magnesium niobate-lead titanate
piezoelectric microcantilever sensors. Biosensors & Bioelectronics 2010, 26, (3), 964-
969.
121. Loo, L.; Capobianco, J. A.; Wu, W.; Gao, X. T.; Shih, W. Y.; Shih, W. H.;
Pourrezaei, K.; Robinson, M. K.; Adams, G. P., Highly Sensitive Detection of HER2
154
Extracellular Domain in the Serum of Breast Cancer Patients by Piezoelectric
Microcantilevers. Analytical Chemistry 2011, 83, (9), 3392-3397.
122. Loo, L.; Wu, W.; Shih, W. Y.; Shih, W. H.; Borghaei, H.; Pourrezaei, K.; Adams,
G. P., A Rapid Method to Regenerate Piezoelectric Microcantilever Sensors (PEMS).
Sensors 2011, 11, (5), 5520-5528.
123. Capobianco, J. A.; Shih, W. Y.; Adams, G. P.; Shih, W. H., Label-free Growth
Receptor-2 Detection and Dissociation Constant Assessment in Diluted Human Serum
Using a Longitudinal Extension Mode of a Piezoelectric Microcantilever Sensor. Sens
Actuators B Chem 2011, 160, (1), 349-356.
124. Wu, W.; Kirimli, C. E.; Shih, W. H.; Shih, W. Y., Real-time, in situ DNA
hybridization detection with attomolar sensitivity without amplification using
(pb(Mg1/3Nb2/3)O3)0.65-(PbTiO3)0.35 piezoelectric plate sensors. Biosens Bioelectron
2013, 43, 391-9.
125. Shen, Z. Y.; Shih, W. Y.; Shih, W. H., Self-exciting, self-sensing
PbZr0.53Ti0.47O3/SiO2 piezoelectric microcantilevers with femtogram/Hertz sensitivity.
Applied Physics Letters 2006, 89, (2).
126. Shih, W. Y.; Luo, H. Y.; Li, H. D.; Martorano, C.; Shih, W. H., Sheet geometry
enhanced giant piezoelectric coefficients. Applied Physics Letters 2006, 89, (24).
127. Biermann, H., Important Factors that Influence the Determination of Detection
Limits. State of California, Department of Food and Agriculture: Sacramento, California,
1989; p ii, 40 p.
128. Witucki, G. L., A Silane Primer: Chemistry and Applications of AIkoxy Silanes.
Journal of Coatings Technology 1993, 65, (822), 57-60.
129. Block, T. M.; Guo, H.; Guo, J.-T., Molecular Virology of Hepatitis B Virus for
Clinicians. Clinics in Liver Disease 2007, 11, (4), 685-706.
130. Teschke, C. M.; McGough, A.; Thuman-Commike, P. A., Penton release from
p22 heat-expanded capsids suggests importance of stabilizing penton-hexon interactions
during capsid maturation. Biophysical Journal 2003, 84, (4), 2585-2592.
155
131. Mommeja-Marin, H.; Mondou, E.; Blum, M. R.; Rousseau, F., Serum HBV DNA
as a marker of efficacy during therapy for chronic HBV infection: Analysis and review of
the literature. Hepatology 2003, 37, (6), 1309-1319.
132. Martin, E. A.; Oxford University Press., Concise medical dictionary. 8th ed.;
Oxford University Press: Oxford ; New York, 2010; p 832 p.
133. Wang, W. S., S., Serological Markers. The Gale Group Inc., Macmillan
Reference USA: New York, 2002.
134. Zhang, P.; Ren, J. C.; Shen, Z. J., A new quantitative method for circulating DNA
level in human serum by capillary zone electrophoresis with laser-induced fluorescence
detection. Electrophoresis 2004, 25, (12), 1823-1828.
135. Wong, D. K.; Yuen, M. F.; Yuan, H.; Sum, S. S.; Hui, C. K.; Hall, J.; Lai, C. L.,
Quantitation of covalently closed circular hepatitis B virus DNA in chronic hepatitis B
patients. Hepatology 2004, 40, (3), 727-37.
136. Brinker, C. J., Hydrolysis and Condensation of Silicates - Effects on Structure.
Journal of Non-Crystalline Solids 1988, 100, (1-3), 31-50.
137. Brinker, C. J.; Keefer, K. D.; Schaefer, D. W.; Ashley, C. S., Sol-Gel Transition
in Simple Silicates. Journal of Non-Crystalline Solids 1982, 48, (1), 47-64.
138. Brinker, C. J.; Keefer, K. D.; Schaefer, D. W.; Assink, R. A.; Kay, B. D.; Ashley,
C. S., Sol-Gel Transition in Simple Silicates .2. Journal of Non-Crystalline Solids 1984,
63, (1-2), 45-59.
139. Breslow, L., Encyclopedia of public health. Macmillan Reference USA/Gale
Group Thomson Learning: New York, 2002.
140. Bondoux, C.; Prene, P.; Belleville, P.; Guillet, F.; Lambert, S.; Minot, B.; Jerisian,
R., MgO insulating films prepared by sol-gel route for SiC substrate. Journal of the
European Ceramic Society 2005, 25, (12), 2795-2798.
141. Katiyar, P.; Jin, C.; Narayan, R. J., Electrical properties of amorphous aluminum
oxide thin films. Acta Materialia 2005, 53, (9), 2617-2622.
156
142. Cahill, B. P.; Giannitsis, A. T.; Land, R.; Gastrock, G.; Pliquett, U.; Frense, D.;
Min, M.; Beckmann, D., Reversible electrowetting on silanized silicon nitride. Sensors
and Actuators B-Chemical 2010, 144, (2), 380-386.
143. Li, Y. F.; Parkes, W.; Haworth, L. I.; Ross, A. W. S.; Stevenson, J. T. M.; Walton,
A. J., Room-Temperature Fabrication of Anodic Tantalum Pentoxide for Low-Voltage
Electrowetting on Dielectric (EWOD). Journal of Microelectromechanical Systems 2008,
17, (6), 1481-1488.
144. Sandell, A.; Anderson, M. P.; Alfredsson, Y.; Johansson, M. K. J.; Schnadt, J.;
Rensmo, H.; Siegbahn, H.; Uvdal, P., Titanium dioxide thin-film growth on silicon(111)
by chemical vapor deposition of titanium(IV) isopropoxide. Journal of Applied Physics
2002, 92, (6), 3381-3387.
145. Lemee, N.; Dubourdieu, C.; Delabouglise, G.; Senateur, J. P.; Laroudie, F.,
Semiconductive Nb-doped BaTiO3 films grown by pulsed injection metalorganic
chemical vapor deposition. Journal of Crystal Growth 2002, 235, (1-4), 347-351.
146. Wilk, G. D.; Wallace, R. M.; Anthony, J. M., High-kappa gate dielectrics: Current
status and materials properties considerations. Journal of Applied Physics 2001, 89, (10),
5243-5275.
147. Nguyen, L. T. T.; Nguyen, H. N.; La, T. H. T., Synthesis and characterization of a
photosensitive polyimide precursor and its photocuring behavior for lithography
applications. Optical Materials 2007, 29, (6), 610-618.
148. Cho, S. H.; Kim, S. H.; Lee, N. E.; Kim, H. M.; Nam, Y. W., Micro-scale
metallization on flexible polyimide substrate by Cu electroplating using SU-8 photoresist
mask. Thin Solid Films 2005, 475, (1-2), 68-71.
149. Ohnmacht, M.; Seidemann, V.; Buttgenbach, S., Microcoils and microrelays - an
optimized multilayer fabrication process. Sensors and Actuators a-Physical 2000, 83, (1-
3), 124-129.
150. Feili, D.; Schuettler, M.; Doerge, T.; Kammer, S.; Stieglitz, T., Encapsulation of
organic field effect transistors for flexible biomedical microimplants. Sensors and
Actuators a-Physical 2005, 120, (1), 101-109.
157
151. Hwang, K. S.; Lee, J. H.; Park, J.; Yoon, D. S.; Park, J. H.; Kim, T. S., In-situ
quantitative analysis of a prostate-specific antigen (PSA) using a nanomechanical PZT
cantilever. Lab on a Chip 2004, 4, (6), 547-552.
152. Hu, M. H.; Noda, S.; Okubo, T.; Yamaguchi, Y.; Komiyama, H., Structure and
morphology of self-assembled 3-mercaptopropyltrimethoxysilane layers on silicon oxide.
Applied Surface Science 2001, 181, (3-4), 307-316.
153. Brinker, C. J.; Scherer, G. W., Sol-gel science : the physics and chemistry of sol-
gel processing. Academic Press: Boston, 1990; p xiv, 908 p.
154. Stöber W.; Fink, A. B., E., Controlled Growth of Monodisperse Silica Spheres in
the Micron Size Range. Journal of Colloid and Interface Science 1968, 26, 62-69.
155. Ibrahim, I. A. M. Z., A. A. F.; Sharaf, M. A., Preparation of spherical silica
nanoparticles: Stober silica. Journal of American Science 2010, 6, (11), 985-989.
156. Flores, J. C.; Torres, V.; Popa, M.; Crespo, D.; Calderon-Moreno, J. M.,
Preparation of core-shell nanospheres of silica-silver: SiO2@Ag. Journal of Non-
Crystalline Solids 2008, 354, (52-54), 5435-5439.
157. Venkatathri, N., Synthesis of silica nanosphere from homogeneous and
heterogeneous systems. Bulletin of Materials Science 2007, 30, (6), 615-617.
158. Kirimli, C. E. In situ detection of transrenal gene mutations without DNA
isolation and amplification using Array Piezoelectric Plate Sensor (PEPS). Ph D, Drexel
University,
Drexel University, Philadelphia, Pa., 2013.
159. Lin, Z. X.; Yip, C. M.; Joseph, I. S.; Ward, M. D., Operation of an Ultrasensitive
30-Mhz Quartz-Crystal Microbalance in Liquids. Analytical Chemistry 1993, 65, (11),
1546-1551.
160. Cauda, V.; Schlossbauer, A.; Bein, T., Bio-degradation study of colloidal
mesoporous silica nanoparticles: Effect of surface functionalization with organo-silanes
and poly(ethylene glycol). Microporous and Mesoporous Materials 2010, 132, (1-2), 60-
71.
158
161. Chung, Y. I.; Kim, J. C.; Kim, Y. H.; Tae, G.; Lee, S. Y.; Kim, K.; Kwon, I. C.,
The effect of surface functionalization of PLGA nanoparticles by heparin- or chitosan-
conjugated Pluronic on tumor targeting. Journal of Controlled Release 2010, 143, (3),
374-382.
162. Spinke, J.; Liley, M.; Schmitt, F. J.; Guder, H. J.; Angermaier, L.; Knoll, W.,
Molecular Recognition at Self-Assembled Monolayers - Optimization of Surface
Functionalization. Journal of Chemical Physics 1993, 99, (9), 7012-7019.
163. Yeung, C.; Leckband, D., Molecular level characterization of microenvironmental
influences on the properties of immobilized proteins. Langmuir 1997, 13, (25), 6746-
6754.
164. Yeung, C.; Purves, T.; Kloss, A. A.; Kuhl, T. L.; Sligar, S.; Leckband, D.,
Cytochrome c recognition of immobilized, orientational variants of cytochrome b(5):
Direct force and equilibrium binding measurements. Langmuir 1999, 15, (20), 6829-
6836.
165. Firestone, M. A.; Shank, M. L.; Sligar, S. G.; Bohn, P. W., Film architecture in
biomolecular assemblies. Effect of linker on the orientation of genetically engineered
surface-bound proteins. Journal of the American Chemical Society 1996, 118, (38), 9033-
9041.
166. Vijayendran, R. A.; Leckband, D. E., A quantitative assessment of heterogeneity
for surface-immobilized proteins. Analytical Chemistry 2001, 73, (3), 471-480.
167. Narang, U.; Anderson, G. P.; Ligler, F. S.; Burans, J., Fiber optic-based biosensor
for ricin. Biosensors & Bioelectronics 1997, 12, (9-10), 937-945.
168. Anderson, G. P.; Jacoby, M. A.; Ligler, F. S.; King, K. D., Effectiveness of
protein A for antibody immobilization for a fiber optic biosensor. Biosensors &
Bioelectronics 1997, 12, (4), 329-336.
169. Sauerbrey, G., Verwendung von Schwingquarzen zur wägung dünner schichten
und zur mikrowägung. Zeitschrift für Physik 1959, 155, 206-222.
170. Dixon, M. C., Quartz Crystal Microbalance with Dissipation Monitoring:
Enabling Real-Time Characterization of Biological Materials and Their Interactions.
Journal of Biomolecular Techniques 2008, 19, (3), 151-158.
159
171. Lin, Y.-T.; Luo, J.-D.; Chiou, C.-C.; Yang, C.-M.; Wang, C.-Y.; Chou, C.; Lai,
C.-S., Detection of KRAS mutation by combination of polymerase chain reaction (PCR)
and EIS sensor with new amino group functionalization. Sensors and Actuators B:
Chemical 2013, 186, (0), 374-379.
172. Zhao, Q.; Zhu, Q.; Shih, W. Y.; Shih, W.-H., Array adsorbent-coated lead
zirconate titanate (PZT)/stainless steel cantilevers for dimethyl methylphosphonate
(DMMP) detection. Sensors and Actuators B: Chemical 2006, 117, (1), 74-79.
173. Su, W. S.; Chen, Y. F.; Shih, W. Y.; Luo, H. Y.; Shih, W. H., Domain switching
in lead magnesium niobate-lead titanate polycrystalline sheets at single grain level.
Applied Physics Letters 2007, 91, (11).
174. Shang, J. K.; Tan, X., Indentation-induced domain switching in
Pb(Mg1/3Nb2/3)O-3-PbTiO3 crystal. Acta Materialia 2001, 49, (15), 2993-2999.
175. Masys, A. J.; Ren, W.; Yang, G.; Mukherjee, B. K., Piezoelectric strain in lead
zirconate titante ceramics as a function of electric field, frequency, and dc bias. Journal
of Applied Physics 2003, 94, (2), 1155-1162.
176. Alguero, M.; Jimenez, B.; Pardo, L., Rayleigh type behavior of the Young's
modulus of unpoled ferroelectric ceramics and its dependence on temperature. Applied
Physics Letters 2003, 83, (13), 2641-2643.
177. Hsieh, C.-Y.; Chen, Y.-F.; Shih, W. Y.; Zhu, Q.; Shih, W.-H., Direct observation
of two-step polarization reversal by an opposite field in a substrate-free piezoelectric thin
sheet. Applied Physics Letters 2009, 94, (13), 131101-3.
178. Zhu, Q.; Shih, W. Y.; Shih, W. H., Mechanism of the flexural resonance
frequency shift of a piezoelectric microcantilever sensor in a dc bias electric field.
Applied Physics Letters 2008, 92, (3).
179. McPherson, R. A., Blood sample volumes: emerging trends in clinical practice
and laboratory medicine. Clin Leadersh Manag Rev 2001, 15, (1), 3-10.
180. Georgiou, C. D.; Papapostolou, I., Assay for the quantification of
intact/fragmented genomic DNA. Analytical Biochemistry 2006, 358, (2), 247-256.
160
181. Huang, C. Z.; Fan, M. K.; Li, Y. F., Fluorescence microscopic quantification of
DNA with alpha,beta,gamma,delta-tetrakis[4-(trimethylammonium)phenyl]porphine by a
ring-like deposition technique. Analytica Chimica Acta 2002, 466, (2), 193-200.
182. Numnuam, A.; Kanatharana, P.; Mattiasson, B.; Asawatreratanakul, P.;
Wongkittisuksa, B.; Limsakul, C.; Thavarungkul, P., Capacitive biosensor for
quantification of trace amounts of DNA. Biosens Bioelectron 2009, 24, (8), 2559-65.
183. Prem Kumar, A. A.; Mani, K. R.; Palaniappan, C.; Bhau, L. N.; Swaminathan, K.,
Purification, potency and immunogenicity analysis of Vero cell culture-derived rabies
vaccine: a comparative study of single-step column chromatography and zonal centrifuge
purification. Microbes Infect 2005, 7, (9-10), 1110-6.
184. Gao, W. F.; Hu, J. M., Formation of hepatitis B virus covalently closed circular
DNA: Removal of genome-linked protein. Journal of Virology 2007, 81, (12), 6164-
6174.
185. Petit, M. A.; Maillard, P.; Capel, F.; Pillot, J., Immunochemical structure of the
hepatitis B surface antigen vaccine--II. Analysis of antibody responses in human sera
against the envelope proteins. Mol Immunol 1986, 23, (5), 511-23.
186. Rose, K.; Mason, J. O.; Lathe, R., Hybridization parameters revisited: Solutions
containing SDS. Biotechniques 2002, 33, (1), 54-+.
