Physicochemical Characterization and Bioactivity of an Improved...

_____________________________________________________________________________________________________ *Corresponding author: E-mail: [email protected];

Annual Research & Review in Biology 24(6): 1-16, 2018; Article no.ARRB.39648 ISSN: 2347-565X, NLM ID: 101632869

Physicochemical Characterization and Bioactivity of an Improved Chitosan Scaffold Cross-Linked With Polyvinyl Alcohol for Corneal Tissue Engineering

Applications

Mohamed Ali Seyed1* and Kavitha Vijayaraghavan2

1Department of Clinical Biochemistry, Faculty of Medicine, University of Tabuk, Tabuk, Saudi Arabia,

Tabuk 71491, Saudi Arabia. 2Department of Chemical Engineering, Agni College of Technology, Old Mahabalipuram Road,

Thalambur, Chennai, Tamil Nadu 600130, India.

Authors’ contributions

This work was carried out in collaboration between both authors. Author KV followed the protocol, executed all the experiments involved, performed the statistical analysis, and wrote the first draft of

the manuscript. Author MAS managed the analyses of the study, managed the literature searches and completed the manuscript until the final accepted format. Both authors read and approved the final

manuscript.

Article Information

DOI: 10.9734/ARRB/2018/39648 Editor(s):

(1) George Perry, Dean and Professor of Biology, University of Texas at San Antonio, USA. Reviewers:

(1) Anil Kumar Verma, India. (2) Asaad Ahmed Ghanem, Mansoura University, Egypt.

(3) C. Vasile, Institute of Macromolecular Chemistry Petru Poni, Romania. Complete Peer review History: http://www.sciencedomain.org/review-history/23539

Received 10th

December 2017 Accepted 1st March 2018

Published 9th

March 2018

ABSTRACT Background: Corneal blindness resulting from various medical condition affects millions worldwide. The rapid developing field of tissue engineering offers the potential to develop a tissue-engineered cornea that adheres very closely to the native cornea for transplantation. The design of a scaffold with mechanical properties and transparency similar to that of natural cornea is vital for the regeneration of corneal tissues. Hence, there is a need to investigate this relatively inexpensive but an improved scaffold to assist in human corneal stem cells delivery. Aim and Study Design: The present study aimed at to prepare and investigate the properties of

Original Research Article

Seyed and Vijayaraghavan; ARRB, 24(6): 1-16, 2018; Article no.ARRB.39648

2

poly vinyl alcohol (PVA)/chitosan blended scaffold by further cross-linking with 1-Ethyl-3-(3-dimethyl amino propyl)-carbodiimide (EDC), 2 N-Hydroxysuccinimide (NHS) as potential in vitro carrier for human limbal epithelial cells delivery. Results: After the viscosity measurement, the PVA/Chitosan scaffold was observed by Fourier transform infrared spectroscopy (FT-IR). The water absorbency of PVA/Chitosan was increased 361% by swelling. Compression testing demonstrated that by increasing the amount of chitosan, the strength of the scaffold could be increased to 16 × 10

−1 Mega Pascal Pressure Unit (MPa). Our

degradation results revealed by mass loss shows that scaffold degraded gradually implies slow degradation but shown enhanced the biomechanical properties. In vitro 3-(4, 5-dimethylthiazolyl-2)-2, 5-diphenyltetrazolium bromide (MTT) assay showed good cell proliferation and growth in the scaffold. Besides the above, the present study aimed at exploring the effects if any observed with PVA/chitosan and other cross linkers on cell morphology and phenotype using H&E staining. Our MTT assay results and the cells observed on these membranes confirmed that the safer and improved method of preparation of membrane could increase the cells adhesion and growth on the substrata. Conclusion: Hence, we strongly believe the use of this improved PVA/chitosan polymer scaffold has potential to cut down the disadvantages of human amniotic membrane (HAM) for corneal epithelium in ocular surface surgery in future after successful experimentation with clinical trials.

Keywords: Tissue engineering; biocompatibility; chitosan; poly (vinyl alcohol); corneal cells.

1. INTRODUCTION

The cornea is a clear, avascular, multi-laminar structure plays an important role in vision [1]. The World Health Organization (WHO) has identified corneal diseases as major cause of blindness worldwide, second only to cataract in overall importance and affects more than 10 million people [2,3]. Currently the corneal transplantation is the only available therapy of choice [4,5]. Besides, a severe shortage of fresh donated corneas [6] and an unknown risk of immune rejection had seen with traditional heterograft; therefore, it is very imperative and urgent to construct a corneal equivalent to replace pathologic corneal tissue. Corneal tissue engineering has emerged as a viable approach to develop corneal tissue substitutes [7-9]. The design of a scaffold with mechanical properties and transparency similar to that of natural cornea is vital for the regeneration of corneal tissues but also able to withstand the culture conditions, flexible to the shape of the cornea and quite tough for surgical manipulation including the suturing. A landmark report in 1997 by Pellegrini revealed a successful transplantation of ex vivo expanded limbal epithelium grown on a fibrin carrier [10]. Another commonly used substrate is the human amniotic membrane (HAM) [11], which includes the use of denuded HAM over an intact membrane [12]. However, some inherent problems still exists such as the sterile storage, wrinkling nature, early degradation, its potential danger for the

spread of viruses and bacteria and the risk of immune-mediated graft rejection etc. [13]. Since HAM has many disadvantages, there has been considerable amount of research to find a good alternative source for replacement. The major challenge in tissue engineering is the designing of an artificial extra cellular matrix (ECM) component because it has the capability to support cell growth and allow deposition of the natural ECM proteins over it during the initial stages [14]. The porous architectures of ECM, often-called scaffolds are biomaterials such as polymers, ceramics and metals [15] which have been successfully used to design sutures, bone plates and screws, acetabular cup, vascular grafts, heart valves, intraocular lens, ligaments, skin grafts, wound dressings and so on [16]. Recent years had also witnessed tremendous research interest towards the development of few other naturally derived biopolymers like silk [17] and purified ECM based molecules like collagen, elastin and glycosaminoglycan (GAGs) [18,19]. Besides the above, poly lactic acid (PLA), polycaprolactone (PCL) [20,21], and the PVA membranes as well as their blends, have been widely used in the production of scaffolds for various biomedical applications [20,21].

The development of chitosan-based biomaterial attracted much attention [22] recently for various applications because of its novel potentials like minimal foreign body reactions and intrinsic antibacterial property [23]. In addition, the biocompatibility, biodegradability and chitosan's


3

ability to mold into various forms and geometries make it to suitable for cell ingrowth and conduction [24,25]. Since chitosan alone is not sufficient to support cell growth, enhancing its mechanical strength needs another partner like poly vinyl alcohol (PVA), a biodegradable polymer/ or its blends often used in tissue engineering applications. The addition of chitosan to the PVA solution has an effect of thickener, increasing the viscosity and giving rise to uniform nano fibers, even for low PVA concentration [26]. These favorable intermolecular interactions between PVA and chitosan influence the culture of corneal epithelial stem cells. Chitosan containing hydroxyl and amine groups has therefore the potential to miscible with PVA due to the ability to form hydrogen bonds.

On the other hand, stem cells provide a potentially unlimited source of cells for treating a plethora of human diseases [27,28]. The corneal limbus, located at the corneoscleral junction, believed to harbour the cornea stem cells in the basal layer of the epithelium [29,30]. These limbal epithelial stem cells (LESCs) possess all of the properties of an adult stem cell population [31] and are responsible for maintaining and regenerating the corneal epithelium throughout the life. In addition, limbal stem cells also act as a "barrier" to conjunctival epithelial cells and normally prevent them from migrating on to the corneal surface [32]. Extensive studies performed to investigate the feasibility of explant culture method of cultivating corneal epithelial cells and their characteristics in comparison to the limbal explant culture [33]. Hence, the present study employed cultured corneal epithelial cells (HCEC), as an ideal substitute to test the ability of PVA cross-linked chitosan scaffold to facilitate their growth.

The present study objectives were as follows: (i). to develop a biodegradable and non-toxic PVA cross-linked chitosan scaffold by further cross-link with EDS and NHS. (ii). to characterize its physiochemical properties to support the growth of HCEC, so that it had the ability to facilitate enhanced adhesion, expansion and proliferation of HCEC; while maintaining its mechanical properties (iii). To investigate the corneal epithelial marker and antimicrobial peptide expression in the HCEC. With consideration of the ultimate goal to use the methods in clinical applications, we were mindful of the potential risks in using culture media containing defined or

undefined animal derivatives. Such components have the potential to transmit communicable diseases and/or provoke immunological problems during transplantation. To reduce the potential harmful complications and to minimize any risk for future patients, we used a culture medium that was free of supplements containing non-human animal derivatives.

2. MATERIALS AND METHODS 2.1 Materials Poly (vinyl alcohol) (87-89% higher hydrolysis grade), average molecular weight of 72000 gmol−1), acetic acid (AA 35% pure), and glutaraldehyde (GA) (25% aqueous solution) were purchased from Merck (Merck Specialities Pvt Limited Mumbai, India). Chitosan [poly (β-(1-4)-2-amino-2-deoxy-D-glucopyranose)] (75% degree of deacetylation) (medium molecular weight of 190,000–310,000) was purchased from Himedia, Mumbai, India. 2.1.1 Preparation of scaffold

The chitosan powder was separately dissolved in 1% acetic acid (20 mL) at room temperature. The PVA (4 g) was dissolved completely in Milli-Q water (20 mL) by heating. The chitosan was added to the PVA solution and mixed uniformly with a homogenizer at 300 rpm and at 90°C for 30 minutes until the mixture was in a colloidal state. After adding H2SO4 (10 mL) and formaldehyde (5 mL) and stirring, the sample was cooled to room temperature. Finally, the sample was poured into a tube and heated in an oven at 60°C for 50 minutes. Finally, samples were soaked in a cross-linking bath with 1-Ethyl-3-(3-dimethyl amino propyl)-carbodiimide (EDC), 2 N-Hydroxysuccinimide (NHS) and 0.1M NaOH (4mg/mL) in H2O/EtOH 2:1 for 24 h consecutively stirred to cross-link the polymeric chains, reduce degradation, and enhance the biomechanical properties of the scaffolds for delivery or tissue repair. After soaking in the bath, the samples were carefully washed with 2% glycine aqueous solution several times to remove the remaining amount of cross-linkers, followed by washed with water to remove residual agents. The present study have tried on trial base with few scaffolds sterilized with either ethylene oxide gas or with alcohol by complete immersion in 75%, 50%, 25%, 5% and 1% alcohol solution with incubation time of 10 min. Eventually, the scaffold was washed twice


4

with water and incubated for 10 min each, followed by dried, separated, and used for plating of cells. The scaffold preparation and related experiments were carried out at the Polymer Nanotechnology Center of B.S Abdur Rahman Crescent University (BSA), Vandalur, Chennai, India.

2.2 Characterization 2.2.1 Viscosity measurement Before the cross-linking process was begun, the viscosity of solutions (dissolved in an aqueous medium of acetic acid and sodium acetate; CH3COOH 0.3 mol/L/CH3COONa 0.2 mol/L) was measured by Brookfield Model DV-III viscometer (Brookfield Engineering Laboratories Inc, Stoughton, MA). 2.2.2 FTIR analysis

The samples were examined by Fourier transform infrared (FTIR) analysis with a Perkin Elmer, model 2000 spectroscopy. For IR analysis, 2-6 mg of the scraped samples (about 10 µm thick) were carefully mixed with 500 mg of KBr (infrared grade) and pelletized under vacuum. Then, pellets between 4000-400 cm−1 were analyzed with 120 scans averaging 4-cm

−1

resolution in attenuated total reflection (ATR) mode. The FTIR analysis was used to evidence the presence of specific chemical groups of PVA and chitosan, chemical interactions and the crosslinking effect in the polymeric scaffolds and to identify the effects of the above process on functional groups. 2.2.3 Optical clarity

Optical clarity of the scaffolds is a major pre-requisite for the scaffold platform as they serve the purpose of an artificial extracellular matrix for cornea, whose primary role to participate the visual activity [34]. Hence, the scaffold samples were examined for optical clarity by using Beckman DU-800 spectrophotometer and scanning was done within the visible range of wavelengths (400-800 nm). 2.2.4 Mechanical properties Three dumbbell-shaped specimens of 4 mm wide and 10 mm length were punched out from each scaffold using a die instrument. Mechanical properties such as tensile strength (MPa) and percentage of elongation at break (percentage)

were measured using a universal testing machine (INSTRON model 1405) at an extension rate of 5 mm/min.

2.2.5 Swelling ratio of PVA/chitosan scaffold

The quantity of water imbibed by a material is an important property, as it greatly contributes to biocompatibility of the end material and decides if the material may be useful for biomedical purposes. In order to access the water sorption potential of prepared scaffold, the PVA/Chitosan nanofibrous scaffolds were oven dried at 50ºC and placed in a 24-well plate. Each well-contained 1 mL of a phosphate buffered solution (PBS; pH 7.4). The scaffolds were incubated in vitro at 37ºC for different periods (1, 3, 7, and 10 days) [35]. After immersion of the scaffolds in PBS solution for these different periods, excess PBS was wiped from the swollen saturated PVA/Chitosan scaffold, the amount of fluid uptake was determined by weighing after the removal of excess fluid with filter paper. The swelling ratio value (S) was calculated using the following formula:

S = (Ww − Wd)/Wd × 100 (1) For this test, the samples were weighed for determination of the wet weight (Ww) as a function of immersion time and dried weight (Wd) of the samples. 2.2.6 Degradation test

The degradation study of the scaffolds was carried out in vitro by incubating the samples in PBS at pH 7.4, 37ºC for different periods. After each degradation period, the samples were washed and subsequently dried in a vacuum oven at room temperature for 24 hours. In order to find out the degradation index (Di.), the weight of the samples (Wt.) and the degradation index was calculated before and after the degradation, respectively based on the mass loss using equation:

Di. = (W0 − Wt.)/W0 × 100

2.2.7 Biological in vitro test Human corneal epithelial cells (HCEC) were obtained from the commercially available source as primary corneal epithelial cells (Normal, Human (ATCC® PCS-700-010). On every passage, cells obtained by trypsinisation using 0.5% trypsin ™ were cryopreserved as


5

secondary cells. The in vitro cytotoxicity of the prepared scaffolds was tested using both NIH3T3 fibroblasts cell line and HCEC. Cells (10

5) were seeded into each well of 24 wells

plate. The culture liquid contained DMEM (Dulbecco’s modified Eagle’s medium), 10% fortified bovine calf serum (FBS), and 1% penicillin streptomycin solution. The pH value was maintained at 7.4. The incubator settings were 37ºC with 5% CO2 and 95% relative humidity. The cell culture of PVA/Chitosan scaffold cycles lasted for three days. A growth curve was plotted based on the changes in cell number, which was counted every 24 hours. The cells that detached well when trypsinized were placed in a 15 mL centrifuge; the medium was added in an amount equal to that of trypsin. The mixture was centrifuged at 4ºC, 1200 rpm for 5 minutes. After removing the supernatant, 2 mL of medium was added to form the cell solution. Then, 6 mg/mL of synthesized scaffolds were placed in each well of a 24-well plate, and 500 of cell solution was added to the surface of the scaffold in each well. After 30-minute incubation the scaffold was removed from the incubator and placed onto another well with no additional agents; 2 mL of medium was added to initiate the cell attachment experiment. After 72 hours of incubation, MTT solution (5 mg/mL) (Sigma, Munich, Germany) was added into each well and incubated for 90-120 minutes. Then, all the media was discarded and 600 μL DMSO was added to each well. An ELISA reader at 590 nm measured the optical density (OD) values after 30 minutes with a reference filter of 620 nm. 2.2.8 Histological examination

Cells were formalin fixed and paraffin embedded for routine histological processing and stained with hematoxylin and eosin (H&E) to visualize the cell attachment and proliferation on the scaffold. Briefly, the scaffold was fixed with 95% alcohol for 30 minutes; H & E stain was added over the scaffold until the entire surface of the scaffold was immersed and incubated for 7 minutes. The excess stain was removed from the scaffold using running tap water, followed by scaffold was dipped in 1% alcohol, twice and washed briefly in tap water. Then they were placed in ammonia solution until they turned blue. After thorough washing in running tap water, scaffold was counter-stained with eosin solution for 30 seconds, followed by dehydrated and cleared using 97% alcohol, 100% alcohol and xylene. The processed samples were

observed by using a light microscope with specific image analysis software from Zeiss [36].

2.2.9 Cultured human corneal epithelial cells

(CHCE) and gene expression studies

The scaffold was washed thrice with PBS, followed by washed with Dulbecco’s Modified Eagle’s Medium (DMEM) twice and incubated at 37ºC in a CO2 incubator. After through checking HCEC cells viability, they were seeded onto the scaffold with 4ml of Epilife medium containing-10% FBS, 1X antibiotics and 5ml of human corneal growth supplement (HCGS) and incubated in CO2. The same procedure adopted for control. 2.2.10 RNA isolation and reverse trans-

criptase polymerase chain reaction analysis

After the plated cells reached confluency, they were trypsinised (0.02%) and ribonucleic acid (RNA) isolation was done (using QIAGEN kit method) for further expression studies. The RNA was quantified by its absorption at 260 nm and stored at -80°C before use. With a house keeping gene, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), as internal control, the mRNA expression of different molecular markers for corneal epithelial stem cells and antimicrobial peptides were analyzed by semiquantitative reverse transcriptase (RT) polymerase chain reaction (PCR) as described by previous reports [37,38]. Briefly, first-strand cDNAs were synthesized from 0.5 μg of total RNA with murine leukemia virus reverse transcriptase. PCR amplification of the first-strand cDNAs was performed with specific primer pairs, designed from published human gene sequences (Table 1) for different markers in a GeneAmp PCR System 9700 (Applied Biosystems). Semi-quantitative RT-PCR was established by terminating reactions at intervals of 20, 24, 28, 32, 36, and 40 cycles for each primer pair to ensure that the PCR products formed were within the linear portion of the amplification curve. The fidelity of the PCR products was verified by comparing their size to the expected cDNA bands and by sequencing the PCR products. PCR products were fractionated by electrophoresis using 2 per cent agarose gel containing 0.5 per cent ethidium bromide with molecular marker HinfI φX digest to confirm the size of resultant product of amplification and documented in BioRad gel documentation system; Bio-Rad Laboratories, UK.


6

2.3 Statistical Analysis All experiments were performed in triplicate. Summary of data were reported as as mean ± standard deviation (SD). To compare the different groups, the statistical unpaired Student's t-test was used, due to the small sample size, considering a significance level at p < 0.05.

3. RESULTS AND DISCUSSION

3.1 Viscosity The viscosities of the solutions were measured by Brookfield Model DV-III viscometer. The viscosity of PVA solution was 557 centipoise (cP). cP is a measurement unit of dynamic viscosity in the centimeter gram second (CGS) system of units and that of PVA/chitosan solution (with the weight ratio of 90/10) was 1726 centipoise. This is in line with the results by Paipitak et al. [39], who reported a linear increase in viscosity of PVA solution after blending with increasing amounts of chitosan. The high viscosity increases the interaction of two polymers, mainly through hydrogen bonding, and decreases the effects of surface tension. This will result in formation of fibers with uniform morphology [40].

3.2 Optical Clarity The optical clarity of the scaffold was done with the wavelength in the visible range of 400-800nm. Our results showed that PVA/chitosan scaffold was found to be highly transparent with 88% of optical transparency compared with standard cornea as positive control that showed a range of 72-82% of transparency, whereas, the human amniotic membrane (HAM) has an optical transmission of 78% only.

3.3 Chemical Bonding FTIR spectroscopy was used to assess the chemical groups of the polymers. Fig. 1a and 1b shows the FTIR spectra of PVA/chitosan, and HAM. Typical FTIR spectra of PVA/chitosan blended films having various absorption bands compared to IR spectra of denuded HAM. The specific intensity of absorption bands of chitosan/PVA blend and HAM are indicating the similar presence of protein. In Fig. 1a, for the chitosan sample, the major characteristic peaks around 611 and 1152 cm

−1 related to the

saccharide structure (as the repeating unit of chitosan) are clearly observable [41,42]. In addition, the strong absorption peaks at 1653, 1553 and 1346 cm

−1 are shown, which are

characteristic of chitosan and have been reported as amide I, II, and III peaks, respectively. The sharp peaks at 1335 and 1452 cm−1 could be assigned to the CH3 symmetrical deformation mode. In addition, the broad peaks at 1079 and 1152 cm−1 indicate the C–O stretching vibration in chitosan, and another broad peak at 3333.60 cm

−1 is caused by amine

N–H symmetrical vibration. The peak observed at around 2936 cm

−1 is due to the typical C–H

stretch vibrations [43]. Besides the above, all major peaks related to hydroxyl and acetate groups are shown in the FTIR spectrum of PVA. More specifically, the broad band observed at 3753.62 cm

−1 is associated with the O–H stretch

from the intermolecular and intramolecular hydrogen bonds. The vibrational band observed between 2936.82 and 2153.09 cm−1 is the result of the C–H stretch from alkyl groups and the peaks between 1653 and 11553 cm

−1 are due to

the C═O and C–O stretches from the remaining acetate groups in PVA (saponification reaction of polyvinyl acetate) [44-46]. These observations indicate the existence of good miscibility between chitosan and PVA and this is most likely due to the formation of intermolecular hydrogen bonds between the amino and hydroxyl groups in chitosan and the hydroxyl groups in PVA. Fig. 1b shows the FTIR spectra of HAM. The absorption band around 1600–1640 cm

−1 corresponds to amide-I protein

absorption band and is mainly attributed to C=O stretching mode, and the other absorption band around 1510–1560 cm

−1 corresponds to amide-II

protein absorption band which attributed to N–H bending mode and C–N stretching mode [47]. The peaks at around 1210–1300 and 1070–1080 cm

−1 attributed to protein (amide III) and

also to the phosphodiester group of nucleic acids, glyco- and phospho-lipids. The amide III band resulted from in-phase combination of C–N stretching and N–H in-plane bending, with some contribution from C–C stretching and C=O bending vibrations [48]. Compared with FTIR spectra of HAM, the peak intensity of PVA/chitosan blend related to the amide groups tends to decrease, suggesting the formation of intermolecular hydrogen bonds between the polymer chains [23]. Such result may explain the high stability of the cross-linked PVA with chitosan, during at least 1-2 weeks of immersion.


7

Fig. 1. FTIR spectra of the PVA/chitosan cross-linked (a) and HAM (b) scaffolds

3.4 Swelling Behavior Fluid uptake is an important parameter, which influences the chemical and physical characteristics of the scaffolds after and prior to cell seeding. Herein, swelling experiments were performed after cross-linking of PVA and PVA/chitosan and immersed in phosphate

buffered saline (PBS) for a defined time period, taken out and gently pressed in between the filter papers and weighed. A representative result of fluid uptake behavior is shown in Fig. 2 for PVA and PVA/Chitosan cross-linked scaffolds. Our results revealed that chitosan strongly influences the swelling of the scaffold and increases it from 440% to 1590% over the period of time (1-24 hr).

4000.0 3000 2000 1500 1000 400.0

0.0

5

10

15

20

25

30

35

40

45

50

55

60

65

69.6

cm-1

%T

BIOPOLYMER BLEND

3753.62

3333.60

2936.82

2153.09

1654.25

1553.04

1452.26

1335.97

1242.43

1153.22

1079.24 611.97

PVA/chitosan

HAM

a)

b)


8

Fig. 2. Degree of swelling ratio (%) as a function of PVA and chitosan scaffold at various composition (Wt. fraction) over the period of time (1-24h). Graphical data are presented as

mean (n=3) ± standard deviation of three independent experiments

Fig. 3. Measurement of degradation index of PVA/chitosan scaffolds. Dry weight remaining ratio (%) or degradation behavior of PVA and chitosan/PVA hydrogels in PBS at pH 7.4, 37ºC and 1 mg/ml lysozyme/PBS at 37°C at different time points. Graphical data are presented as

mean (n=3) ± standard deviation of three independent experiments

The increased swelling could be attributed to a more flexible or relaxed network formed by the inter- and intra-polymer reactions and also to the more of hydrophilic groups in PVA/Chitosan blend. The results may be attributed to the fact that chitosan is a cationic biopolymer, and its content in the scaffold results in loosening of the network chains due to existing repulsion between the cationic chains of chitosan. This observation is in agreement with previous studies which reported that chitosan increases the swelling degree/ratio when blended with PVA; however

increase or decrease of swelling ratio depends on various factors such as weight ratio of the components, pH, temperature, and so on [35,43-46].

3.5 Degradation Behavior

Degradation is the process through which useful physicochemical properties of the polymers are lost. This can include loss of polymer mass through mechanisms such as solvation and depolymerization. Degradation behavior of PVA

0

200

400

600

800

1000

1200

1400

1600

1800

Deg

ree

of

Swel

ling

Rat

io (

%)

PVA/Chitosan Wt. fraction

0

20

40

60

80

100

120

1 3 6 9 12 16

Deg

rad

atio

n in

dex

(%

)

Immersion time (Days)

PVA

PVA/chitosan


9

and PVA/Chitosan scaffolds using the PBS immersion method shown in Fig. 3. It was clearly observed that the degradation rate of PVA/Chitosan scaffold was much slower than of PVA samples. PVA/Chitosan scaffolds started to degrade from 6

th day onwards and this slow

degradation was continued until day 16. This could be due to higher density of chemical cross-linking between cross-linkers and amine groups of chitosan and leads to slower depolymerization [49,50].

3.6 Mechanical Properties

The mechanical properties (Young's modulus, tensile strength and elongation at break percentage (%) of PVA/Chitosan blend scaffold was investigated in dry and wet states, and the observation was shown in Table. 2. The mechanical properties of a scaffold used for tissue engineering are very important due to the need for the structural stability to oppose the various stresses incurred during culture in vitro or implantation in vivo while surgeon handling the membrane.

3.7 Cell Viability by MTT Assay The cytotoxicity of the pure PVA, Chitosan, PVA/chitosan blend scaffolds have been evaluated by MTT assay. This assay is based on the conversion of MTT to blue formazan by mitochondria in living cells. The amount of formazan formed indicates the level of cell metabolism. However, it does not accurately represent the number of living cells. Each experiment was repeated three times, and a low standard deviation of assay results was found. The optical density of formazan at 570 nm was measured for 24 h, 48 h and 72 h of incubation, respectively. The MTT assay indicated that both NIH3T3 and the cultured human corneal epithelial cells (HCECs) viability, was highest from days 3 to 5, and was not affected by the concentration of PVA used to prepare membranes. The viability of NIH 3T3 (90%) and HCECs cultured on PVA/chitosan (91%) was higher compared with either NIH3T3 or HCECs cultured on PVA alone (78% and 80%), however it was less when compared with non-treated control cells (98%). H & E stained cells further confirmed the cell viability (Fig. 4). Therefore, these results clearly showed that the PVA/Chitosan blend scaffolds are not deleterious for cell activity and may be safe for their use as delivery substrata, wound dressing or soft tissue repair [51-53].

In this study, we also investigated the expression of different molecular markers for corneal epithelial stem cells (ABCG2, connexin43 and cytokeratin 3) (Fig. 5a-c) and antimicrobial peptides (AMP) such as, hBD 1, 2, 3 and LL37 in cultured corneal epithelial cells (Fig. 6a-d). Our results show that culture corneal epithelial cells were expressed hBD 1, 2, 3 and LL37 and the stem cell markers confirming the corneal epithelial nature of the cells.

Tissue engineering in the cornea has often maintained the use of a carrier system for delivery of corneal stromal stem cells and corneal endothelial cell progenitors [54,55]. Natural materials, such as collagen, silk and gelatin, which have excellent biocompatibility, biodegradability and low immunogenicity have been extensively utilized for corneal tissue engineering [18-19]. Although, scaffolds are preferentially a biodegradable one, while providing a favorable microenvironment for cell adherence and proliferation but also expected to be degrade gradually, allowing surrounding tissues to replace and sustain the scaffold function [56,57].In this regard, cross-linking reagents commonly used to modify scaffolds for enhancing both physical and chemical stability. For instance, in recent years, fibrin [58], human amniotic membrane (HAM) [59], and cellular feeder layers such as 3T3 fibroblasts [58,60] have facilitated the expansion of corneal epithelial cells. However, each of these agents has their own merits and some drawbacks.

In this study, we have modified polyvinyl alcohol (PVA) fibers through blending with chitosan to fabricate a Nano fibrous scaffold by cross-linking with EDC and NHS. The PVA/chitosan scaffolds have been found to exhibit physicochemical and biological properties, which we compared with HAM scaffolds to better meet the requirements of cultured corneal epithelial cells. The FTIR spectra provide information about the functional groups of constituent polymers present in the scaffold. The IR spectra shown in Fig. 1 a indicate the presence of poly (vinyl) alcohol and chitosan, as evident from the peaks observed. It is clear from the IR results on the peaks that constituent polymers PVA and chitosan are present in the cross-linked scaffold. Whereas in the spectrum of denuded HAM (Fig.1b), nine characteristic absorption bands at the frequencies of 3306, 2954, 1651, 1548, 1451, 1394, 1241, 1077, and 645 cm

−1 were

observed.


10

Fig. 4. H&E staining of cultured HCEC in HAM and PVA/Chitosan scaffolds when the cells reached confluency the scaffold along with the culture was stained with Haematoxylin and

eosin (H&E) staining followed by visualization under the microscope

Fig.5. Semi-quantitative RT-PCR for SC-associated markers ABCG2 (379bp), differentiation associated markers, K3 (145bp), and connexin 43 (154 bp) expressed by corneal epithelial cells

(a-c). PCR reactions were performed for 38 cycles with cDNA derived from human corneal epithelial cells A 100 bp DNA ladder is shown in the first left lane. GAPDH, a housekeeping

gene, was used as an internal control (d)


11

Fig.6. Example of PCR amplification for AMPs expression by human corneal epithelial cells. Semi-quantitative RT-PCR for AMP-associated markers hBD1 (215bp), hBD2 (204bp), hBD3

(205bp) and LL-37 expressed by corneal epithelial cells (a-d). PCR reactions were performed for 38 cycles with cDNA. A 100 bp DNA ladder is shown in the first left lane. GAPDH, a

housekeeping gene, was used as an internal control (not shown)

Table 1. Human primer sequences used for semi-quantitative RT-PCR

Gene Name Primer sequence - 3’-5’ Annealing temperature (°C)

Base pair size (bp)

Corneal Epithelial Stem Markers ABCG2 FP: 5' AGTTCCATGGCACTGGCCATA 3'

RP: 5' TCAGGTAGGCAATTGTGAAGG 3' 62 379

Cytokeratin 3 FP: 5' GGCAGAGATCGAGGGTCTC 3' RP: 5'GTCATCCTTCGCCTGCTGTAG 3'

64 145

Connexin 43 FP:5´ CCTTCTTGCTGATCCAGTGC 3

´

RP 5´ ACCAAGGACACCACCAGCAT 3´ 63 150

Antimicrobial peptide – AMP hBD-1 FP: GCCTCCAAAGGAGCCAGCGT

RP: CTTCTGGTCACTCCCAGCTCA 54 287

hBD-2 FP: CAGCCATCAGCCATGAGG RP: TGGCTTTTTGCAGCATTTT

55 204

hBD-3 FP: AGCCTAGCAGCTATGAGGATC RP: CTTCGGCAGCATTTTCGGCCA

61 205

Table.2. shows the mechanical properties such as maximum load (N), ultimate tensile strength,

elongation at break, and modulus of PVA/Chitosan blend

S. No Scaffold Tensile strength MPa

Elongation at break (%)

Tearing strength maximum load (N)

1 PVA/Chitosan 4.38 ± 0.09 20.58 ± 0.36 2.87 ± 0.02 2. Positive control HAM 1.68 ± 0.08 10.09 ± 0.8 Nil


12

The water absorption capacity of scaffold results clearly show that water intake capacity constantly increases when the wt. fraction increases from 1 to 4.0, and thereafter the equilibrium swelling constantly decreases (data not shown). Thus, an optimum swelling is reached at a PVA/chitosan wt. fraction of 4.0. The results may be explained as follows, since both the constituents' polymers, that is PVA and chitosan, are hydrophilic in nature, their increasing wt. fraction results in enhanced hydrophilicity of the matrix, which results in an increased water sorption capacity. However, beyond 4.0 wt. fraction of PVA, the water sorption capacity falls, which may be explained by the fact that when the PVA content is high and the resulting scaffold is enriched in crystalline region of PVA, this accounts for lower water sorption tendency of the PVA. Similar observation was observed with chitosan. The results may be attributed to the fact that chitosan is a cationic biopolymer, and its increasing content in the scaffold results in loosening of the network chains due to existing repulsion between the cationic chains of chitosan. Previous studies [61,62] have shown that chitosan is a potential scaffold for in vitro bovine corneal epithelial cell culture with the ability to preserve the corneal epithelial cell phenotype to maintain biological function to a certain extent [63]. Hence, the cellular behavior of a biomaterial is an important factor determining the biocompatibility of a biomaterial [64]. After cells contact biomaterials, cells will undergo their morphological changes to stabilize the cell and material interface. In our study, we monitored cell viability on PVA cross-linked chitosan using an MTT assay and observed cell morphology periodically to assess any differences in cell morphology. No obvious difference noticed with HCEC and NIH3T3 morphology in cultured cells using light microscopy. Our result implies that HCEC could favorably attach and proliferate on the PVA/chitosan surface, and cells were able to infiltrate the scaffolds and successfully form a 3D corneal epithelium [65] with appropriate pre-clinical and clinical experimentation in future. In addition, the cultured epithelium displayed a phenotype similar to human corneal epithelium as stem cells have certain unique characteristics, which include longevity, high capacity of self-renewal with a long cell cycle time and a short S-phase duration, increased potential for error-free proliferation, and poor differentiation [66]. Semi-quantitative reverse transcriptase polymerase chain reaction (RT-PCR) was done on the

cultured cells at varying intervals of time for expression of ABCG2, connexin43 (Cnx43), and keratin 3 (K3). The cells cultured over PVA/chitosan were able to maintain the expression of putative stem cell markers ABCG2, Cnx43 and K3. Previous studies have shown that the connexins are gap junction proteins involved in cell–cell communication, and are important cell differentiating factors. To date, Cx-43 and Cx-50 are the only two gap junction proteins that have been identified in the corneal epithelium. Cx-43 is abundant on the corneal basal epithelium but is absent from limbal stem cells; thus, Cx-43 is proposed as a negative corneal stem cell marker [67]. Therefore, according to the phenotype of the HCECs cultured on the PVA/chitosan, they were HCE, but not limbal stem cells. Antimicrobial peptides (AMPs) form an integral part of the innate immune system and provide defense against a range of pathogens as well as modulating immune responses [68]. These help provide human body a first line of defense against invading pathogens and several are up-regulated in response to infection and inflammatory stimuli [69-71] and play a critical role as a microbial barrier [72]. The human β-defensins (hBD) and the cathelicidin LL37 [73] are peptides expressed by epithelia throughout the body including epithelia of oral cavity. There are now 28 known β-defensin genes found in human, however; expression of hBD1, 2, and 3 has been most investigated [74]. Despite constant threat from pathogenic microbes in the air and foreign objects around in the laboratory, the incidence of infection in the culture condition is expected amazingly low [75]. However, in spite of the presence of antibiotics in culture medium or having an intact sterile surface condition, our results found the expression of all three defensin group AMPs in oral epithelial cells. This model can serve as a useful basic tool for the study of tissue innate immune responses as a purely epithelial model.

4. CONCLUSION In summary, we modified chitosan by cross-linking its polymers with the naturally occurring cross-linker PVA in a safer and faster way and characterized the phenotypes of HCECs cultured on PVA/chitosan. We demonstrated that the improved development of PVA/chitosan showed good biocompatibility for cell adhesion, expansion, and proliferation. Besides the above,


13

this polymer scaffold will be promising scaffold alternative to AM for clinical usage in the future for the transplantation of cultivated limbal stem cells onto the ocular surface with successful clinical trial and experimentation. Therefore, future applications of safe and rapid development of PVA/chitosan membranes can be considered for reconstruction of the cornea and for other tissue engineering applications.With regard to biocompatibility, although PVA/Chitosan scaffold produced no or low toxic tissue response, it is yet to be determined whether they produce any inflammatory response, as they are clinically significant. Therefore, further studies are necessary to investigate to rule out the possibility of any possible concerns in their use.

ACKNOWLEDGEMENTS The authors are thankful to Deanship for Graduate Studies and Academic Research, University of Tabuk (UT), Kingdom of Saudi Arabia for partial support of this research project (0121-1438-S) in the form of institutional research grant.

COMPETING INTERESTS Authors have declared that no competing interests exist.

REFERENCES 1. Ambati BK, Nozaki M, Singh N, Takeda A,

Jani PD, Suthar T, Albuquerque RJC, Richter E, Sakurai E, Newcomb MT. Corneal avascularity is due to soluble VEGF receptor-1. Nature. 2006;443:993–997.

2. World Health Organization. Universal Eye Health: A Global Action Plan 2014-2019. Geneva: WHO; 2013.

3. VISION 2020: The Right to Sight. [Last cited on 2017 Jan 19]. Available: http://www.iapb.org/vision-2020/

4. McLaughlin CR, Tsai RJF, Latorre MA, Griffith M. Bioengineered corneas for transplantation and in vitro toxicology. Front Biosci. 2009;14: 3326–3337.

5. Ruberti JW, Zieske JD. Prelude to corneal tissue engineering-Gaining control of collagen organization. Prog. Retin. Eye Res. 2008;27:549–577.

6. Niethammer D, Kümmerle-Deschner J, Dannecker GE. Side-effects of long term

immunosuppression versus morbidity in autologous stem cell rescue: striking the balance. Rheumatology (Oxford). 1999;38: 747-750.

7. Wilson SL, Wimpenny I, Ahearne M, Rauz S, El Haj AJ, Yang Y. Chemical and topographical effects on cell differentiation and matrix elasticity in a corneal stromal layer model. Adv Funct Mater. 2012;22:3641–3649.

8. Ghezzi CE, Rnjak-Kovacina J, Kaplan DL. Corneal tissue engineering: recent advances and future perspectives. Tissue Eng Part B Rev. 2015;21(3):278-287.

9. Chen Z, You J, Liu X, Cooper S, Hodge C, Sutton G, Crook JM, Wallace GG. Biomaterials for corneal bioengineering. Biomed Mater; 2017. DOI:10.1088/1748-605X/aa92d2.

10. Pellegrini G, Traverso CE, Franzi AT, Zingirian M, Cancedda R, De Luca M. Long-term restoration of damaged corneal surfaces with autologous cultivated corneal epithelium. Lancet. 1997;349:990-993.

11. Nakamura T, Sotozono C, Bentley AJ, Mano S, Inatomi T, Koizumi N, Fullwood NJ, Kinoshita S. Long-term phenotypic study after allogeneic cultivated corneal limbal epithelial transplantation for severe ocular surface diseases. Ophthalmol. 2010;117:2247-2254.

12. Koizumi N, Fullwood NJ, Bairaktaris G, Inatomi T, Kinoshita S, Quantock AJ. Cultivation of corneal epithelial cells on intact and denuded human amniotic membrane. Invest Ophthalmol Visual Sci. 2000;41:2506-2513.

13. Kreft ME, Dragin U. Amniotic membrane in tissue engineering and regenerative medicine. Zdrav Vestn. 2010;79:707–715.

14. Liu C, Xia Z, Czernuszka J. Design and development of three-dimensional scaffolds for tissue engineering. Chem Engineer Res and Des. 2007;85:1051-1064.

15. Agrawal C, Ray RB. Biodegradable polymeric scaffolds for musculoskeletal tissue engineering. J biomed Mat Res 2001;55:141-150.

16. Shrivats R, McDermott MC, Hollinger JO. Bone tissue engineering: State of the union. Drug discovery today. 2014;19:781-786.

17. Kang KB, Lawrence BD, Gao XR, Luo Y, Zhou Q, Liu A, Guaiquil VH, Rosenblatt MI (2017). Micro- and nanoscale topographies on silk regulate gene


14

expression of human corneal epithelial cells. Invest Ophthalmol Vis Sci. 2017;58: 6388-6398.

18. Chong EJ, Phan TT, Lim IJ, Zhang YZ, Bay BH, Ramakrishna S, Lim CT. Evaluation of electrospun PCL/gelatin nanofibrous scaffold for wound healing and layered dermal reconstitution. Acta Biomater. 2007;3:321-330.

19. Gutiérrez MC, García-Carvajal ZY, Jobbágy M, Rubio F, Yuste L, Rojo F, Ferrer ML, Del Monte F. Poly(vinyl alcohol) scaffolds with tailored morphologies for drug delivery and controlled release. Adv Funct Mater. 2007;17:3505-3513.

20. Keane TJ, Badylak SF. Biomaterials for tissue engineering applications. Semin Pediatr Surg. 2014;23:112-118.

21. Kong B, Mi S. Electrospun scaffolds for corneal tissue engineering: A review. Materials. 2016;9:614.

22. Tang Q, Luo C, Lu B, Fu Q, Yin H, Qin Z, Lyu D, Zhang L, Fang Z, Zhu Y, Yao K. Thermosensitive chitosan-based hydrogels releasing stromal cell derived factor-1 alpha recruit MSC for corneal epithelium regeneration. Acta Biomater. 2017;61:101-113.

23. Bonilla J, Fortunati E, Atarés L, Chiralt A, Kenny JM. Physical, structural and antimicrobial properties of poly vinyl alcohol-chitosan biodegradable films. Food Hydrocoll. 2014;35:463-470.

24. Rinaudo M. Chitin and chitosan: Properties and applications. Prog Polym Sci. 2006;31:603-632.

25. Kim IY, Seo SJ, Moon HS, Yoo MK, Park IY, Kim BC, Cho CS. Chitosan and its derivatives for tissue engineering applications. Biotechnol Adv. 2008;26:1-21.

26. Lin T, Fang J, Wang H, Cheng T, Wang X. Using chitosan as a thickener for electrospinning dilute PVA solutions to improve fibre uniformity. Nanotechnol. 2006;17:3718-3723.

27. Potten CS, Loeffler M. Stem cells: Attributes, cycles, spirals, pitfalls and uncertainties. Lessons for and from the crypt. Develop. 1990;110:1001-1020.

28. Dąbrowska AM, Skopiński P. Stem cells in regenerative medicine - from laboratory to clinical application - the eye. Cent Eur J Immunol. 2017;42:173-180.

29. Sun TT, Tseng SC, Lavker RM. Location of corneal epithelial stem cells. Nature. 2010;463:10-11.

30. Perry KJ, Thomas AG, Henry JJ. Expression of pluripotency factors in larval epithelia of the frog Xenopus: Evidence for the presence of cornea epithelial stem cells. Dev Biol. 2013;374:281-294.

31. Ahmad S, Figueiredo F, Lako M. Corneal epithelial stem cells: Characterization, culture and transplantation. Regen Med. 2006;1:29-44.

32. Dua HS, Saini JS, Azuara-Blanco A, Gupta P. Limbal stem cell deficiency: Concept, aetiology, clinical presentation, diagnosis and management. Indian J Ophthalmol. 2006;48:83-92.

33. Nakamura T1, Inatomi T, Sotozono C, Koizumi N, Kinoshita S. Successful primary culture and autologous transplantation of corneal limbal epithelial cells from minimal biopsy for unilateral severe ocular surface disease. Acta Ophthalmol Scand. 2004;82:468-471.

34. Wang HY, Wei RH, Zhao SZ. Evaluation of corneal cell growth on tissue engineering materials as artificial cornea scaffolds. Int J Ophthalmol. 2013;6:873–878.

35. de Souza Costa-Júnior E, Pereira MM, Mansur HS. Properties and biocompatibility of chitosan films modified by blending with PVA and chemically crosslinked. J Mater Sci Mater Med. 2009;20:553-561.

36. Zonari E, Giacomo D, Carolina P, Boccalatte FE, Lidonnici MR, Anna KR, Alessandro A, Giuliana F, Luigi N, Bernhard G. Efficient ex vivo engineering and expansion of highly purified human hematopoietic stem and progenitor cell populations for gene therapy. Stem Cell Reports. 2017;8:977-990.

37. Li DQ, Lokeshwar BL, Solomon A, Monroy D, Ji Z, Pflugfelder SC. Regulation of MMP-9 production by human corneal epithelial cells. Exp Eye Res. 2001;73:449–459.

38. Sasirekha K, Geetha K, Krishnakumar S. Culture and characterisation of limbal epithelial cells and oral mucosal cells. Indian J Med Res. 2010;131:422-428.

39. Paipitak K, Pornpra T, Mongkontalang P, Techitdheer W, Pecharapa W. Characterization of PVA-chitosan nanofibers prepared by electrospinning. Procedia Eng. 2011;8: 101-105.

40. Bhattarai N, Edmondson D, Veiseh O, Matsen FA, Zhang M. Electrospun chitosan-based nanofibers and their


15

cellular compatibility. Biomaterials. 2005;26:6176-6184.

41. Mansur HS, Costa HS. Nanostructured poly(vinyl alcohol)/bioactive glass and poly(vinyl alcohol)/chitosan/bioactive glass hybrid scaffolds for biomedical applications. Chem Eng J. 2008a;137:72-83.

42. Costa EDS, Jr, Mansur HS. Preparation and characterization of chitosan/poly(vinylalcohol)blend chemically crosslinked by glutaraldehyde for tissue engineering application. Química Nova. 2008;31:1460–1466.

43. Don TM, King CF, Chiu WY, Peng CA. Preparation and characterization of chitosan-g-poly(vinyl alcohol)/poly(vinyl alcohol) blends used for the evaluation of blood-contacting compatibility. Carb Polym. 2006;63:331-339.

44. Shigemasa Y, Matsuura H, Sashiwa H, Saimoto H. Evaluation of different absorbance ratios from infrared spectroscopy for analyzing the degree of deacetylation in chitin. Int J Bio Macromol. 1996;18:237-242.

45. Mansur HS, Sadahira CM, Souza AN, Mansur AAP. FTIR spectroscopy characterization of poly (vinyl alcohol) hydrogel with different hydrolysis degree and chemically crosslinked with glutaraldehyde. Mater Sci Eng C. 2008b;28:539-548.

46. Wang C, Shen M, Zhang N, Wang S, Xu Y, Chen S, Chen F, Yang K, He T, Wang A, Su Y, Cheng T, Zhao J, Wang J. Reduction Impairs the Antibacterial Activity but Benefits the LPS Neutralization Ability of Human Enteric Defensin 5. Sci Rep. 2016;6:22875.

47. Socrates G. Infrared and Raman characteristic group frequencies. Tables and charts, 3rd edn. J Wiley & Sons, UK; 2004.

48. Grdadolnik J. Conformation of bovine serum albumin as a function of hydration monitored by infrared Spectroscopy. Int J Vibr Spec. 2002;6:1.

49. Suh JK, Matthew HW. Application of chitosan-based polysaccharide biomaterials in cartilage tissue engineering: A review. Biomaterials. 2000;21:2589-2598.

50. Berger J, Reist M, Mayer JM, Felt O, Peppas NA, Gurny R. Structure and interactions in covalently and ionically crosslinked chitosan hydrogels for

biomedical applications. Eur J Pharm Biopharm. 2004;57:19-34.

51. Duan B, Yuan X, Zhu Y, Zhang Y, Li X, Zhang Y, Yao K. A nanofibrous composite membrane of PLGA-chitosan/PVA prepared by electrospinning. Eur. Polym. J. 2006;42:2013-2022.

52. Huang HL, Yao ZH, Yang ZH, Wang Y, Shi DA, Yin JH. Preparation and characterization of chitosan/poly(vinyl alcohol) blend fibers. J Appl Poly. Sci. 2001;80:2558-2565.

53. Mansur HS, de E, Mansur AAP, Barbosa-Stancioli, EF. Cytocompatibility evaluation in cell-culture systems of chemically cross-linked chitosan/PVA hydrogels. Mater Sci Eng C. 2009;29:1574-1583.

54. Yuan S, Fan G. Stem cell-based therapy of corneal epithelial and endothelial diseases. Regen Med. 2015;10:495-504.

55. Kim KH, Mian S. Diagnosis of corneal limbal stem cell deficiency. Curr Opin Ophthalmol. 2017; 28: 355-362.

56. Deshpande P, Notara M, Bullett N, Daniels JT, Haddow DB, MacNeil S. Development of a surface-modified contact lens for the transfer of cultured limbal epithelial cells to the cornea for ocular surface diseases. Tissue Eng Part A. 2009;15:2889-2902.

57. Levis HJ, Brown RA, Daniels JT. Plastic compressed collagen as a biomimetic substrate for human limbal epithelial cell culture. Biomaterials. 2010;31:7726-7737.

58. Rama P, Bonini S, Lambiase A, Golisano O, Paterna P, De Luca M, Pellegrini. Autologous fibrin-cultured limbal stem cells permanently restore the corneal surface of patients with total limbal stem cell deficiency. Transplantation. 2001;72:1478-1485.

59. Sabater AL, Perez VL. Amniotic membrane use for management of corneal limbal stem cell deficiency. Curr Opin Ophthalmol. 2017;28:363-369.

60. Griffith LG, Naughton G. Tissue engineering--current challenges and expanding opportunities. Science. 2002;295:1009-1014.

61. Yeh LK, Chen YH, Chiu CS, Hu FS, Young TH, Wang IJ. The phenotype of bovine corneal epithelial cells on chitosan membrane. J Biomed Mater Res A. 2009;90:18-26.

62. Vázquez N, Chacón M, Meana Á, Menéndez-Menéndez Y, Ferrero-Gutierrez A, Cereijo-Martín D, Naveiras M, Merayo-Lloves J. Keratin-chitosan membranes as


16

scaffold for tissue engineering of human cornea. Histol Histopathol. 2015;30:813-821.

63. Li YH, Cheng CY, Wang NK, Tan HY, Tsai YJ, Hsiao CH, Ma DH, Yeh LK. Characterization of the modified chitosan membrane cross-linked with genipin for the cultured corneal epithelial cells. Colloids Surf B Biointerfaces. 2015;126:237-244.

64. Lin T, Fang J, Wang H, Cheng T, Wang X. Using chitosan as a thickener for electrospinning dilute PVA solutions to improve fibre uniformity. Nanotechnol. 2006;17:3718-3723.

65. Biazar E, Baradaran-Rafii A, Heidari-keshel S, Tavakolifard S. Oriented nanofibrous silk as a natural scaffold for ocular epithelial regeneration. J Biomat Sci Polym E. 2015;26:1139–1151.

66. Hong He, Samuel C. Yiu. Stem cell-based therapy for treating limbal stem cells deficiency: A review of different strategies. Saudi J Ophthalmol. 2014;28:188-194.

67. Chen Z, Evans WH, Pflugfelder SC, Li DQ. Gap junction protein connexin 43 serves as a negative marker for a stem cell-containing population of human limbal epithelial cells. Stem Cells. 2006;24:1265-1273.

68. da Costa JP, Cova M, Ferreira R, Vitorino R. Antimicrobial peptides: an alternative for innovative medicines? Appl Microbiol Biotechnol. 2015;99:2023-2040.

69. McDermott AM, Redfern RL, Zhang B, Pei Y, Huang L, Proske RJ. Defensin

expression by the cornea: multiple signalling pathways mediate IL-1 beta stimulation of hBD-2 expression by human corneal epithelial cells. Invest Ophth Vis Sci. 2003;44:1859-1865.

70. Narayanan S, Manning J, Proske R, McDermott AM. Effect of hyperosmolality on beta-defensin gene expression by human corneal epithelial cells. Cornea. 2006;25:1063-1068.

71. Huang LC, Proske RJ, McDermott AM. Expression of the peptide antibiotic LL-37/hCAP18 (Cathelicidin) by human corneal epithelial cells. Invest Ophthalmol Vis Sci. 2003;44:U319-U319.

72. Alison MM. Defensins and other antimicrobial peptides at the ocular surface. Ocul Surf. 2004;2:229-47.

73. Kolar SS, McDermott AM. Role of host-defense peptides in eye diseases. Cell Mol Life Sci. 2011;68:2201-2213.

74. Maltsevai A, Fleiszig SM, Evans DJ, Kerr S, Sidhu SS, McNamaran A, et al. Exposure of human corneal epithelial cells to contact lenses in vitro suppresses the upregulation of human β-defensin-2 in response to antigens of Pseudomonas aeruginosa. Exp Eye Res. 2007;85:142-153.

75. Jin X, Qin Q, Lin Z, Chen W, Qu J. Expression of toll-like receptors in the Fusarium solani infected cornea. Curr Eye Res. 2008;33:319-324.

_________________________________________________________________________________ © 2018 Seyed and Vijayaraghavan; This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Peer-review history: The peer review history for this paper can be accessed here:

http://www.sciencedomain.org/review-history/23539

Physicochemical Characterization and Bioactivity of an Improved...

Documents

Transcript of Physicochemical Characterization and Bioactivity of an Improved...