Photograph of a gel showing PCR analysis of DNA isolated ...

36

Transcript of Photograph of a gel showing PCR analysis of DNA isolated ...

Page 1: Photograph of a gel showing PCR analysis of DNA isolated ...
Page 2: Photograph of a gel showing PCR analysis of DNA isolated ...
Page 3: Photograph of a gel showing PCR analysis of DNA isolated ...
Page 4: Photograph of a gel showing PCR analysis of DNA isolated ...
Page 5: Photograph of a gel showing PCR analysis of DNA isolated ...
Page 6: Photograph of a gel showing PCR analysis of DNA isolated ...
Page 7: Photograph of a gel showing PCR analysis of DNA isolated ...
Page 8: Photograph of a gel showing PCR analysis of DNA isolated ...
Page 9: Photograph of a gel showing PCR analysis of DNA isolated ...
Page 10: Photograph of a gel showing PCR analysis of DNA isolated ...
Page 11: Photograph of a gel showing PCR analysis of DNA isolated ...
Page 12: Photograph of a gel showing PCR analysis of DNA isolated ...
Page 13: Photograph of a gel showing PCR analysis of DNA isolated ...
Page 14: Photograph of a gel showing PCR analysis of DNA isolated ...
Page 15: Photograph of a gel showing PCR analysis of DNA isolated ...
Page 16: Photograph of a gel showing PCR analysis of DNA isolated ...
Page 17: Photograph of a gel showing PCR analysis of DNA isolated ...
Page 18: Photograph of a gel showing PCR analysis of DNA isolated ...
Page 19: Photograph of a gel showing PCR analysis of DNA isolated ...
Page 20: Photograph of a gel showing PCR analysis of DNA isolated ...
Page 21: Photograph of a gel showing PCR analysis of DNA isolated ...
Page 22: Photograph of a gel showing PCR analysis of DNA isolated ...
Page 23: Photograph of a gel showing PCR analysis of DNA isolated ...
Page 24: Photograph of a gel showing PCR analysis of DNA isolated ...
Page 25: Photograph of a gel showing PCR analysis of DNA isolated ...
Page 26: Photograph of a gel showing PCR analysis of DNA isolated ...
Page 27: Photograph of a gel showing PCR analysis of DNA isolated ...
Page 28: Photograph of a gel showing PCR analysis of DNA isolated ...
Page 29: Photograph of a gel showing PCR analysis of DNA isolated ...
Page 30: Photograph of a gel showing PCR analysis of DNA isolated ...
Page 31: Photograph of a gel showing PCR analysis of DNA isolated ...
Page 32: Photograph of a gel showing PCR analysis of DNA isolated ...
Page 33: Photograph of a gel showing PCR analysis of DNA isolated ...
Page 34: Photograph of a gel showing PCR analysis of DNA isolated ...
Page 35: Photograph of a gel showing PCR analysis of DNA isolated ...
Page 36: Photograph of a gel showing PCR analysis of DNA isolated ...

Today Do you have PCR amplicons? Run gel Background DNA and our PCRs Interpretation of PCR results What to do next?

Today Do you have PCR amplicons? Run gel Background DNA and our PCRs Interpretation of PCR results What to do next?

DNA Sequencing. ? DNA extraction PCR Gel electrophoresis Insect identification ACAGATGTCTTGTAATCCGGC CGTTGGTGGCATAGGGAAAG GACATTTAGTGAAAGAAATTG ATGCGATGGGTGGATCGATG.

DNA Sequencing. ? DNA extraction PCR Gel electrophoresis Insect identification ACAGATGTCTTGTAATCCGGC CGTTGGTGGCATAGGGAAAG GACATTTAGTGAAAGAAATTG ATGCGATGGGTGGATCGATG.

HiYield™ Gel/PCR Fragments Extraction Kit · HiYield ™ Gel/PCR DNA Fragments Extraction Kit 2 Description The HiYield ™ Gel / PCR DNA Fragments Extraction Kit is designed to

HiYield™ Gel/PCR Fragments Extraction Kit · HiYield ™ Gel/PCR DNA Fragments Extraction Kit 2 Description The HiYield ™ Gel / PCR DNA Fragments Extraction Kit is designed to

Gel PCR/DNA fragments extraction kit(ydf) protocol v3.0 (1)

Gel PCR/DNA fragments extraction kit(ydf) protocol v3.0 (1)

Today HK DNA samples (gel and spec) PCR background PCR targets – snail 16S and CO1 – parasite rDNA 18S and 28S Compose PCR reactions AmpliTaq Gold (ABI)

Today HK DNA samples (gel and spec) PCR background PCR targets – snail 16S and CO1 – parasite rDNA 18S and 28S Compose PCR reactions AmpliTaq Gold (ABI)

Morgan Ruhle Ptc Pcr Re Gel 2

Morgan Ruhle Ptc Pcr Re Gel 2

Polymorphism Analysis of (PCR-RFLP) and Gel ... · 318 Gel Electrophoresis Principles and Basics PCR-RFLP is an extremely valuable technique fo r genotyping of species-specific variations.

Polymorphism Analysis of (PCR-RFLP) and Gel ... · 318 Gel Electrophoresis Principles and Basics PCR-RFLP is an extremely valuable technique fo r genotyping of species-specific variations.

PCR clean-up Gel extraction - mn-net.com · MACHEREY-NAGEL – 02/2017, Rev. 04 3 PCR clean-up, gel extraction Table of contents 1 Components 4 1.1 Kit contents 4 1.2 Reagents, consumables,

PCR clean-up Gel extraction - mn-net.com · MACHEREY-NAGEL – 02/2017, Rev. 04 3 PCR clean-up, gel extraction Table of contents 1 Components 4 1.1 Kit contents 4 1.2 Reagents, consumables,

Overview - Boston University 3 PCR... · •Gel Electrophoresis –Set up PCR • Day 2: Wednesday –Make and Run Agarose Gel –More Background •Polymerase Chain Reaction (PCR)

Overview - Boston University 3 PCR... · •Gel Electrophoresis –Set up PCR • Day 2: Wednesday –Make and Run Agarose Gel –More Background •Polymerase Chain Reaction (PCR)

Introduction to Techniques Restriction Enzymes, PCR and Gel Electrophoresis.

Introduction to Techniques Restriction Enzymes, PCR and Gel Electrophoresis.

PCR- Optimization of Annealing Temperature · PCR optimization Post-PCR analysis results using agarose gel electrophoresis (AGE) ... Step Temperature Duration Cycle Initial denaturation

PCR- Optimization of Annealing Temperature · PCR optimization Post-PCR analysis results using agarose gel electrophoresis (AGE) ... Step Temperature Duration Cycle Initial denaturation

Polymorphism Analysis of (PCR-RFLP) and Gel ... · 2. PCR-restriction fragment length polymorphism (RFLP) analy sis 2.1 Overview PCR-restriction fragment length polymorphism (RFLP)-based

Polymorphism Analysis of (PCR-RFLP) and Gel ... · 2. PCR-restriction fragment length polymorphism (RFLP) analy sis 2.1 Overview PCR-restriction fragment length polymorphism (RFLP)-based

DNA-Fingerprint1 Detection of PCR Products by Agarose Gel Electrophoresis.

DNA-Fingerprint1 Detection of PCR Products by Agarose Gel Electrophoresis.

Alu Polymorphysims as Identity Markers Using PCR and Gel Electrophoresis.

Alu Polymorphysims as Identity Markers Using PCR and Gel Electrophoresis.

MBG-487 Real-Time Quantitative RT-PCR. Agarose EtBr Gel.

MBG-487 Real-Time Quantitative RT-PCR. Agarose EtBr Gel.

PCR clean-up Gel extraction - Takara Bio · 4 MACHEREY-NAGEL – 02/2017, Rev. 04 PCR clean-up, gel extraction 1 Components 1.1 Kit contents NucleoSpin® Gel and PCR Clean-up REF

PCR clean-up Gel extraction - Takara Bio · 4 MACHEREY-NAGEL – 02/2017, Rev. 04 PCR clean-up, gel extraction 1 Components 1.1 Kit contents NucleoSpin® Gel and PCR Clean-up REF

PCR clean-up Gel extraction - Macherey-Nagel AG · 3 PCR clean-up, gel extraction MACHEREY-NAGEL – 03 / 2014, Rev. 06 Table of contents 1 Components 4 1.1 Kit contents 4 1.2 Consumables

PCR clean-up Gel extraction - Macherey-Nagel AG · 3 PCR clean-up, gel extraction MACHEREY-NAGEL – 03 / 2014, Rev. 06 Table of contents 1 Components 4 1.1 Kit contents 4 1.2 Consumables

PCR, Gel Electrophoresis, and Southern Blotting

PCR, Gel Electrophoresis, and Southern Blotting

Slide 1 1.HospitalHospital 2.PCR gelPCR gel 3.ResultsResults 4.EppendorfEppendorf 5.EB gelEB gel 6.K MullisK Mullis 7.Big issueBig issue 8.PCR 1-2PCR 1-2.

Slide 1 1.HospitalHospital 2.PCR gelPCR gel 3.ResultsResults 4.EppendorfEppendorf 5.EB gelEB gel 6.K MullisK Mullis 7.Big issueBig issue 8.PCR 1-2PCR 1-2.

PTC PCR II: Restriction Enzymes & Gel Electrophoresisintro.bio.umb.edu/OLLM/111F98/pdfs/PTCII.pdf · PTC PCR II: Restriction Enzymes & Gel Electrophoresis ... The following diagram

PTC PCR II: Restriction Enzymes & Gel Electrophoresisintro.bio.umb.edu/OLLM/111F98/pdfs/PTCII.pdf · PTC PCR II: Restriction Enzymes & Gel Electrophoresis ... The following diagram