photodynamic inactivation by 405±5 nm light emitting diode against foodborne pathogens on ready

PHOTODYNAMIC INACTIVATION BY 405±5 NM

LIGHT EMITTING DIODE AGAINST FOODBORNE

PATHOGENS ON READY-TO-EAT FOODS AND

ITS ANTIBACTERIAL MECHANISM

KIM MIN-JEONG

NATIONAL UNIVERSITY OF SINGAPORE

2016

PHOTODYNAMIC INACTIVATION BY 405±5 NM

LIGHT EMITTING DIODE AGAINST FOODBORNE

PATHOGENS ON READY-TO-EAT FOODS AND

ITS ANTIBACTERIAL MECHANISM

KIM MIN-JEONG

(M. Sc. Kyungnam University)

A THESIS SUBMITTED

FOR THE DEGREE OF DOCTOR OF PHILOSOPHY

DEPARTMENT OF CHEMISTRY

NATIONAL UNIVERSITY OF SINGAPORE

2016

i

Declaration

I hereby declare that this thesis is my original work and it has been

written by me in its entirety, under the supervision of Dr. Yuk Hyun-Gyun, (in

the Food Science and Technology research laboratory, S13-05), Chemistry

Department, National University of Singapore, between August 2012 and July

2016.

I have duly acknowledged all the sources of information which have

been used in the thesis.

This thesis has also not been submitted for any degree in any university

previously.

The content of the thesis has been partly published in:

1. Kim, M.J., Mikš-Krajnik, M., Kumar, A., Ghate, V., Yuk, H.G. 2015.

Antibacterial effect and mechanism of high-intensity 405±5nm light

emitting diode on Bacillus cereus, Listeria monocytogenes, and

Staphylococcus aureus under refrigerated condition. Journal of

Photochemistry and Photobiology B: Biology, 153, 33-39.

2. Kim, M.J., Mikš-Krajnik, M., Kumar, A., Yuk, H.G. 2016.

Inactivation by 405±5 nm light emitting diode on Escherichia coli

O157: H7, Salmonella Typhimurium, and Shigella sonnei under

refrigerated condition might be due to the loss of membrane integrity.

Food Control, 59, 99-107.

ii

3. Kim, M.J., Bang, W.S., Yuk, H.G. 2017. 405±5 nm light emitting

diode illumination causes photodynamic inactivation of Salmonella

spp. on fresh-cut papaya without deterioration. Food Microbiology, 62,

124-132.

4. Kim, M.J., Yuk, H.G. 2016. Elucidation of antibacterial mechanism of

405±5 nm light emitting diode against Salmonella spp. at refrigeration

temperature. Applied and Environmental Microbiology (In press).

Kim Min-Jeong 28 July 2016

Name Signature Date

iii

Acknowledgements

I would like to express my sincere appreciation to my supervisor, Dr.

Yuk Hyun-Gyun, for his continuous support, guidance, encouragement, and

patience throughout my Ph.D. study period. His inspiring and friendly

mentorship helped me to think deeper and more extensively on how to

improve and enhance my research work. Without his encouragement, I would

not have been able to complete my research project.

I would like to extend my gratitude to the faculty members and staff of

Food Science and Technology Programme. I would also like to thank Prof.

Liu Shao Quan, Dr. Yang Hongshun, and Dr. Larry R. Beuchat for their

valuable time and critical comments during my Ph.D. examination.

My sincere gratitude goes to Dr Mikš-Krajnik Marta and Dr. Amit

Kumar for their valuable advice and suggestion in several experiments and

manuscripts of my research project. I also thank my previous honours students,

Mr. Zwe Ye Htut who was my first honours student and is one of my present

labmates, Ms. Ng Bao Xian Adeline, and Ms. Kartikasari Lianto Dian, my

previous FST 2nd

year student for UROPS, Mr. Tang Chee Hwa, and my

current internship student from South Korea, Ms. Jeong Da-Min, for their

assistance and commitment in conducting several experiments. Thanks to all

my previous and present labmates, Dr. Zheng Qianwang, Dr. Yang Yishan, Dr.

Ghate Vinayak, Mrs. Lim Sin Yue Hazel, Ms. Pang Xinyi, Ms. Yuan Wenqian,

Ms. Li Xinzhi, and Ms. Josewin Sherrill Wesley, for their kindness and

support.

Finally, I would like to thank my parents, Mr. Kim Hong-Soo and Mrs.

Jung Hye-Sook, my brother, Mr. Kim Dong-Jun, and my husband, Mr. Lee

Tae-Hwa, for their constant love, consideration, and support throughout my

Ph.D. study period in Singapore and my life.

iv

List of Publications and Manuscripts

Journal

1. Kim, M.J., Mikš-Krajnik, M., Kumar, A., Ghate, V., Yuk, H.G. 2015.

Antibacterial effect and mechanism of high-intensity 405±5nm light

emitting diode on Bacillus cereus, Listeria monocytogenes, and

Staphylococcus aureus under refrigerated condition. Journal of

Photochemistry and Photobiology B: Biology, 153, 33-39.

2. Kim, M.J., Mikš-Krajnik, M., Kumar, A., Yuk, H.G. 2016.

Inactivation by 405±5 nm light emitting diode on Escherichia coli

O157: H7, Salmonella Typhimurium, and Shigella sonnei under

refrigerated condition might be due to the loss of membrane integrity.

Food Control, 59, 99-107.

3. Kim, M.J., Bang, W.S., Yuk, H.G. 2017. 405±5 nm light emitting

diode illumination causes photodynamic inactivation of Salmonella

spp. on fresh-cut papaya without deterioration. Food Microbiology, 62,

124-132.

4. Kim, M.J., Ng, B.X.A., Zwe, Y.H., Yuk, H.G. 2016. Photodynamic

inactivation of Salmonella enterica Enteritidis by 405±5 nm light

emitting diode and its application to control salmonellosis on cooked

chicken. Food Microbiology (Under review).

5. Kim, M.J., Tang, C.H., Yuk, H.G. 2016. Antibacterial effect of 405±5

nm light emitting diode illumination against Escherichia coli O157:H7,

Listeria monocytogenes, and Salmonella on the surface of fresh-cut

mango and its influence on fruit quality. International Journal of Food

Microbiology (Under review).

6. Kim, M.J., Yuk, H.G. 2016. Elucidation of antibacterial mechanism of

405±5 nm light emitting diode against Salmonella spp. at refrigeration

temperature. Applied and Environmental Microbiology (In press).

v

Conference

1. Kim, M.J., Mikš-Krajnik, M., Kumar, A., Yuk, H.G. 2014. Effects of

high-intensity 405 nm light emitting diode on inactivation of Gram-

negative foodborne pathogens. International Association for Food

Protection’s European Symposium on Food Safety, Budapest, Hungary.

2. Kim, M.J., Mikš-Krajnik, M., Kumar, A., Chung, H.J., Yuk, H.G.

2015. Antibacterial effect and mechanism of high-intensity 405 nm

light emitting diode on Bacillus cereus, Listeria monocytogenes, and

Staphylococcus aureus under refrigerated condition. International

Association for Food Protection, Oregon, USA.

3. Kim, M.J., Chung, H.J., Yuk, H.G. 2016. Photodynamic inactivation

of Salmonella spp. on fresh-cut papayas and their physicochemical and

nutritional quality changes during 405 nm light emitting diode

illumination at different storage temperatures. International

Association for Food Protection, Missouri, USA.

4. Kim, M.J., Yuk, H.G. 2016. Antibacterial effect of 405 nm light

emitting diode illumination against Escherichia coli O157:H7, Listeria

monocytogenes, and Salmonella on the surface of fresh-cut mango and

its influence on fruit physicochemical and nutritional qualities.

International Union of Food Science and Technology, Dublin, Ireland.

vi

Table of Contents

Declaration ................................................................................................................ i

Acknowledgements ............................................................................................. iii

List of Publications and Manuscripts ............................................................ iv

Table of Contents .................................................................................................. vi

Summary ................................................................................................................ xii

List of Tables ......................................................................................................... xv

List of Figures ...................................................................................................... xvi

List of Abbreviations ........................................................................................ xxii

List of Symbols ................................................................................................... xxv

Chapter 1 .................................................................................................................. 1

Introduction ............................................................................................................ 1

1.1 Objectives ................................................................................................................... 3

Chapter 2 .................................................................................................................. 5

Literature review .................................................................................................. 5

2.1 LED as a novel food preservation technology ................................................... 5

2.1.1 LED .................................................................................................................................. 5

2.1.2 LED application in agriculture ................................................................................ 6

2.1.3 Clinical application of LED and its antibacterial efficacy .............................. 7

2.1.4 Proposed mechanism of photodynamic inactivation (PDI) ..........................12

2.2 Bacterial defense responses to oxidative stress .............................................. 13

2.3 Foodborne pathogens and their outbreaks related to ready-to-eat (RTE)

foods ................................................................................................................................. 15

2.2.1 Bacillus cereus ............................................................................................................17

2.2.2 Escherichia coli O157:H7 .......................................................................................17

2.2.3 Listeria monocytogenes ............................................................................................18

2.2.4 Salmonella species .....................................................................................................19

2.2.5 Shigella species ...........................................................................................................21

vii

2.2.6 Staphylococcus aureus .............................................................................................22

Chapter 3 ................................................................................................................ 24

Inactivation by 405±5 nm light emitting diode of Escherichia coli

O157:H7, Salmonella Typhimurium, and Shigella sonnei under

refrigeration may be due to the loss of membrane integrity .............. 24

3.1 Introduction............................................................................................................ 24

3.2 Materials and methods ........................................................................................ 26

3.2.1 Bacterial strains and culture conditions ..............................................................26

3.2.2 LED source ..................................................................................................................26

3.2.3 LED illumination system .........................................................................................27

3.2.4 Bacterial inactivation by 405±5 nm LED illumination ..................................27

3.2.5 Weibull model for bacterial inactivation kinetics ............................................28

3.2.6 Bacterial sensitivity to bile salts and NaCl ........................................................29

3.2.7 Determination of cell membrane permeability .................................................30

3.2.8 Comet assay .................................................................................................................31

3.2.9 DNA ladder analysis .................................................................................................32

3.2.10 Statistical analysis ...................................................................................................32

3.3 Results ...................................................................................................................... 32

3.3.1 Changes in temperature during 405±5 nm LED illumination ......................32

3.3.2 Antibacterial effect of 405±5 nm LED ...............................................................33

3.3.3 Bacterial sensitivity to bile salts and NaCl by 405±5 nm LED illumination

......................................................................................................................................................36

3.3.4 Loss of cell membrane permeability by 405±5 nm LED illumination......36

3.3.5 Effect of 405±5 nm LED illumination on DNA damage ..............................40

3.4 Discussion ................................................................................................................ 41

3.5 Conclusions ............................................................................................................. 46

Chapter 4 ................................................................................................................ 48

Antibacterial effect and mechanism of high intensity 405±5 nm LED

on Bacillus cereus, Listeria monocytogenes, and Staphylococcus

aureus under refrigeration .............................................................................. 48

4.1 Introduction............................................................................................................ 48



viii

4.2.2 LED source ..................................................................................................................49


4.2.4 Bacterial inactivation by 405±5 nm illumination ............................................49

4.2.5 Weibull model for bacterial inactivation kinetics ............................................49

4.2.6 Bacterial sensitivity to NaCl by LED illumination .........................................50

4.2.7 Determination of bacterial membrane integrity ...............................................50

4.2.8 Determination of DNA degradation .....................................................................50

4.2.9 Statistical analysis ......................................................................................................50

4.3 Results ....................................................................................................................... 51

4.4 Discussion ................................................................................................................ 59

4.5 Conclusions ............................................................................................................. 62

Chapter 5 ................................................................................................................ 64

405 ±5 nm LED illumination causes photodynamic inactivation of

Salmonella on fresh-cut papaya without deterioration ........................ 64

5.1 Introduction............................................................................................................ 64



5.2.2 LED source and illumination system ...................................................................66

5.2.3 Preparation of fresh-cut papaya .............................................................................66

5.2.4 Inoculation on fresh-cut papaya ............................................................................67

5.2.5 LED illumination on fresh-cut papaya ................................................................67

5.2.6 Analysis of cellular lipid peroxidation ................................................................68

5.2.7 Analysis of DNA oxidation ....................................................................................69

5.2.8 Colour analysis ...........................................................................................................70

5.2.9 Texture analysis ..........................................................................................................71

5.2.10 Antioxidant capacity ...............................................................................................71

5.2.11 Total flavonoid content ..........................................................................................72

5.2.12 Ascorbic acid ............................................................................................................72

5.2.13 β-carotene and lycopene ........................................................................................73


5.3 Results ...................................................................................................................... 74

5.3.1 Change in temperature of fruit surface and PBS during LED illumination

......................................................................................................................................................74

5.3.2 Behavior of Salmonella on fruit surface during LED illumination ............75

ix

5.3.3 Oxidative damage to membrane lipid and DNA in Salmonella cells ........78

5.3.4 Changes in colour and texture of cut papaya by LED illumination ...........80

5.3.5 Effect of LED illumination on antioxidant capacity, flavonoid content

and nutrients of fruit ..............................................................................................................81

5.4 Discussion ................................................................................................................ 83

5.5 Conclusions ............................................................................................................. 86

Chapter 6 ................................................................................................................ 88

Antibacterial effect of 405 ±5 nm light emitting diode illumination

against Escherichia coli O157:H7, Listeria monocytogenes, and

Salmonella on the surface of fresh-cut mango and its influence on

fruit quality ........................................................................................................... 88

6.1 Introduction............................................................................................................ 88




6.2.3 Preparation of mango and inoculation .................................................................90

6.2.4 LED illumination .......................................................................................................91

6.2.5 Modified Weibull model for bacterial inactivation kinetics .........................91

6.2.6 Firmness analysis .......................................................................................................91

6.2.7 Colour analysis ...........................................................................................................91

6.2.8 DPPH assay..................................................................................................................92

6.2.9 Total flavonoid content ............................................................................................92

6.2.10 Ascorbic acid content .............................................................................................92

6.2.11 β-carotene content ...................................................................................................92


6.3 Results ...................................................................................................................... 92

6.4 Discussion .............................................................................................................. 101

6.5 Conclusions ........................................................................................................... 105

Chapter 7 ............................................................................................................. 106

Photodynamic inactivation of Salmonella enterica Serovar

Enteritidis by 405±5 nm LED and its application to control

salmonellosis on cooked chicken ............................................................... 106

7.1 Introduction.......................................................................................................... 106

x

7.2 Materials and methods ...................................................................................... 107

7.2.1 Bacterial strains and culture conditions ........................................................... 107

7.2.2 LED system and illumination .............................................................................. 108

7.2.3 LED illumination of cell suspension................................................................. 108

7.2.4 Preparation of cooked chicken and inoculation ............................................. 109

7.2.5 LED illumination on cooked chicken ............................................................... 109

7.2.6 Cell injury .................................................................................................................. 109

7.2.7 Cellular damage in S. Enteritidis cells caused by LED illumination ...... 110

7.2.8 Statistical analysis ................................................................................................... 111

7.3 Results .................................................................................................................... 111

7.3.1 Temperature change of PBS and cooked chicken surface during

illumination ........................................................................................................................... 111

7.3.2 Antibacterial effect of 405±5 nm LED illumination against S. Enteritidis

in PBS ..................................................................................................................................... 112

7.3.3 Behavior of S. Enteritidis on cooked chicken surface during LED

illumination ........................................................................................................................... 114

7.3.4 Injury of S. Enteritidis on cooked chicken treated with LED illumination

................................................................................................................................................... 117

7.3.5 Sites of cellular damage caused by LED illumination ................................ 119

7.4 Discussion .............................................................................................................. 121

7.5 Conclusions ........................................................................................................... 127

Chapter 8 ............................................................................................................. 129

Elucidation of antibacterial mechanism of 405±5 nm LED against

Salmonella at refrigeration temperature ................................................ 129

8.1 Introduction.......................................................................................................... 129

8.2 Materials and methods ...................................................................................... 130

8.2.1 Bacterial culture conditions ................................................................................. 130

8.2.2 LED illumination system ...................................................................................... 130

8.2.3 Sensitivity of Salmonella strains to LED illumination ................................ 130

8.2.4 LED illumination on bacterial suspension and enumeration ..................... 131

8.2.5 Analysis of intracellular coproporphyrin content ......................................... 131

8.2.6 Analysis of cellular DNA oxidation .................................................................. 132

8.2.7 Determination of damage to bacterial membrane function ........................ 132

8.2.8 Transmission electron microscopy (TEM) ..................................................... 134

xi

8.2.9 Total RNA isolation and real-time qRT-PCR ................................................ 135

8.2.10 Statistical analysis ................................................................................................ 136

8.3 Results .................................................................................................................... 137

8.3.1 Temperature changes by LED illumination .................................................... 137

8.3.2 Antibacterial efficacy of LED illumination against different Salmonella

strains ...................................................................................................................................... 137

8.3.3 Intracellular coproporphyrin contents .............................................................. 139

8.3.4 DNA oxidation ......................................................................................................... 140

8.3.5 Damage to bacterial membrane function ......................................................... 141

8.3.6 Transmission electron microscopy analysis ................................................... 144

8.3.7 Changes in gene expression levels by LED illumination ........................... 145

8.4 Discussion .............................................................................................................. 146

8.5 Conclusions ........................................................................................................... 153

Chapter 9 ............................................................................................................. 155

Conclusions ........................................................................................................ 155

BIBLIOGRAPHY ................................................................................................. 160

xii

Summary

The use of light emitting diodes (LEDs) has emerged as a promising

food preservation technology in the last few years. However, little information

is available on the efficacy of 405±5 nm LED technology in controlling

foodborne pathogens. The objectives in this study were to evaluate the

antibacterial effects of 405±5 nm LED illumination against pathogenic

bacteria in phosphate-buffered saline (PBS) and on ready-to-eat (RTE) foods

at different temperatures and to elucidate its mechanism of action.

The antibacterial effect of LED illumination against Bacillus cereus,

Escherichia coli O157:H7, Listeria monocytogenes, Salmonella Typhimurium,

Shigella sonnei, and Staphylococcus aureus in PBS was evaluated at a set

temperature of 4 °C for 7.5 h (0.49 kJ/cm2). The potential of LED in

controlling E. coli O157:H7, L. monocytogenes, or Salmonella on fresh-cut

papaya and mango and cooked chicken and its influence on fruit qualities was

also examined at different temperatures for 20–48 h (0.86–3.82 kJ/cm2).

Results showed that LED illumination inactivated 0.8–2.1 log CFU/mL of

bacterial populations during treatment for 7.5 h in PBS. On fresh-cut fruits at 4

and 10 °C, LED illumination inactivated E. coli O157:H7, L. monocytogenes,

or Salmonella, while bacterial growth was inhibited or delayed by LED

illumination at room temperature. Unlike these fruits, only three S. Enteritidis

strains on cooked chicken surface were inactivated at 4 °C by LED

illumination, whereas bacterial inhibition and delay of growth were observed

at 10 and 20 °C, respectively. Furthermore, no significant differences were

xiii

found in physicochemical and nutritional qualities between LED-illuminated

and non-illuminated fruits.

The antibacterial mechanism of 405±5 nm LED illumination against

Salmonella at a set temperature of 4 °C in PBS was elucidated. Results

showed that eighteen Salmonella strains responded differently to LED

illumination, revealing that S. Enteritidis (ATCC 13076) and S. Saintpaul were

more susceptible and resistant, respectively, among the strains. However, there

was no difference in the amount of endogenous coproporphyrin between the

two strains. In illuminated cells, DNA oxidation levels increased and loss of

membrane potential and integrity, glucose uptake activity, and efflux pump

activity were observed, compared to non-illuminated cells. Transmission

electron microscopic images revealed disorganization of chromosome and

ribosome due to LED illumination. Furthermore, oxyR, recA, rpoS, sodA, and

soxR genes in S. Saintpaul cells were upregulated, while only oxyR gene in S.

Enteritidis cells were upregulated at a set temperature of 4 °C in PBS without

LED illumination, indicating that an increased gene expression levels might be

due to temperature-shift and nutritious deficiency rather than LED

illumination. Thus, different sensitivities of the two strains to LED

illumination might be attributed to differences in gene regulation.

Through these studies, the efficacy of 405±5 nm LED illumination in

inactivating foodborne pathogens on RTE foods at refrigerated temperatures

was demonstrated. Overall results suggest that a food chiller equipped with

405±5 nm LEDs could preserve RTE foods at food service establishments.

Moreover, these data provide detailed insights into the antibacterial

xiv

mechanism of 405±5 nm LED illumination on Salmonella cells and their

response to it.

xv

List of Tables

Table 2-1 Photodynamic inactivation on various microorganisms in buffered

solution or food matrix by LED illumination with photosensitizers. ......... 9

Table 2-2 Antibacterial effects of blue LED illumination without the addition

of photosensitizers against various microorganisms in PBS and broth. . 11

Table 2-3 Summary of foodborne outbreaks associated with fruits, vegetables,

and chicken. .............................................................................................................. 16

Table 3-1 Weibull model parameters1 for the inactivation of E. coli O157:H7,

S. Typhimurium, and S. sonnei by 405±5 nm LED illumination. ............. 35

Table 4-1 Weibull model parameters1 for the inactivation of B. cereus, L.

monocytogenes, and S. aureus by 405 nm LED illumination. ................... 54

Table 5-1 Colour and texture changes1 in fresh-cut papaya by 405±5 nm LED

illumination. .............................................................................................................. 80

Table 5-2 Effects of 405±5 nm LED illumination on antioxidant capacity1 and

ascorbic acid, flavonoid, β-carotene, and lycopene contents1 in fresh-cut

papaya at varying storage temperatures. .......................................................... 82

Table 6-1 Comparison of the tR-values1 of E. coli O157:H7, L. monocytogenes,

and Salmonella by 405±5 nm LED illumination at refrigeration

temperatures using Weibull model parameters1. ........................................... 97

Table 6-2 Effect of 405±5 nm LED illumination on antioxidant capacity1 and

ascorbic acid, β-carotene, and flavonoid contents1 of fresh-cut mangoes

stored at different temperatures. ....................................................................... 101

Table 7-1 Comparison of the decimal reduction dose (D-values)1 of three S.

Enteritidis strains treated with 405±5 nm LED illumination at 4 and 10

°C. .............................................................................................................................. 114

Table 8-1 Gene functions and primer sequences. ................................................. 136

xvi

List of Figures

Figure 2-1 Reactive oxygen species (ROS) generated during photodynamic

inactivation (PDI). PS, photosensitizer; 1PS

* and

3PS

*, excited

photosensitizer in singlet and triplet states, respectively, from ground

state; 3O2, ground state triplet oxygen (Mikš-Krajnik et al., 2015). ......... 13

Figure 3-1 Inactivation of E. coli O157:H7 (a), S. Typhimurium (b) and S.

sonnei (c) during the illumination with 405±5 nm LED at 4 °C. Asterisk

(*) indicates significant (P ≤ 0.05) difference between LED-illuminated

and non-illuminated cell counts. ......................................................................... 34

Figure 3-2 Changes in the sensitivity of E. coli O157:H7 (a), S. Typhimurium

(b) and S. sonnei (c) to 1% bile salts during 405±5 nm LED illumination.

Different letters (A-B or a-b) within the same bar indicate that the mean

values are significantly (P ≤ 0.05) different from each other. Asterisk (*)

indicates significant (P ≤ 0.05) difference between LED-illuminated and

non-illuminated cell counts. ................................................................................. 37

Figure 3-3 Changes in sensitivity of E. coli O157:H7 (a), S. Typhimurium (b)

and S. sonnei (c) to NaCl (2% for S. sonnei, and 3% for E. coli O157:H7

and S. Typhimurium) during 405±5 nm LED illumination. ....................... 38

Figure 3-4 The microscopic images of E. coli O157:H7 (a), S. Typhimurium

(b) and S. sonnei (c) cells stained with LIVE/DEAD® BacLight

TM before

and after LED illumination at the dose of 486 J/cm2. .................................. 39

Figure 3-5 Comet assay of DNA extracted from healthy, non-illuminated and

LED-illuminated E. coli O157:H7 (a), S. Typhimurium (b) and S. sonnei

(c) at the dose of 486 J/cm2. ................................................................................. 40

Figure 3-6 Agarose gel electrophoresis profiles of DNA extracted from

healthy, non-illuminated and LED-illuminated cells at the dose of 486

J/cm2. Lane: 1, healthy S. Typhimurium; 2, S. Typhimurium without LED

illumination for 7.5 h; 3, LED-illuminated S. Typhimurium for 7.5 h; 4,

healthy E. coli O157:H7; 5, E. coli O157:H7 without LED illumination

for 7.5 h; 6, LED-illuminated E. coli O157:H7 for 7.5 h; 7, healthy S.

sonnei; 8, S. sonnei without LED illumination for 7.5 h; 9, LED-

illuminated S. sonnei for 7.5 h. ........................................................................... 41

xvii

Figure 4-1 Antibacterial effect of B. cereus (a), L. monocytogenes (b) and S.

aureus (c) during the illumination with 405 nm LED at a set temperature

of 4 °C. Asterisk (*) indicates significant (P ≤ 0.05) differences between

LED-illuminated and non-illuminated cell counts. ....................................... 52

Figure 4-2 Percentage of the sensitive B. cereus (a), L. monocytogenes (b) and

S. aureus (c) cells to NaCl (4% for B. cereus and L. monocytogenes, and

7% for S. aureus) during 405 nm LED illumination. Different letters

within the same curve indicate that mean values are significantly (P ≤

0.05) different from each other. .......................................................................... 56

Figure 4-3 Epifluorescent micrographs of B. cereus (a), L. monocytogenes (b)

and S. aureus (c) cells stained with LIVE/DEAD® BacLight

TM before and

after LED illumination at a dose of 486 J/cm2. .............................................. 57


LED-illuminated B. cereus (a), L. monocytogenes (b) and S. aureus (c) at

a dose of 486 J/cm2. ................................................................................................ 58


healthy, non-illuminated and LED-illuminated cells at a total dose of 486

J/cm2. Lane: 1, healthy S. aureus; 2, S. aureus without LED illumination

for 7.5 h; 3, LED-illuminated S. aureus for 7.5 h; 4, healthy L.

monocytogenes; 5, L. monocytogenes without LED illumination for 7.5 h;

6, LED-illuminated L. monocytogenes for 7.5 h; 7, healthy B. cereus; 8,

B. cereus without LED illumination for 7.5 h; 9, LED-illuminated B.

cereus for 7.5 h. ....................................................................................................... 58

Figure 5-1 Surface temperature profile of buffered solution (a) in an

acrylonitrile butadiene styrene (ABS) housing at a distance of 2.3 cm and

fresh-cut papaya (b) in an ABS housing at a distance of 4.5 cm recorded

during 405±5 nm LED illumination at 4 °C.................................................... 75

Figure 5-2 Effects of 405±5 nm LED illumination on survival of S. Agona (a),

S. Newport (b), S. Saintpaul (c), and S. Typhimurium (d) on the surface

of fresh-cut papaya at 4 °C (actual temperature of 7.2 °C). Asterisk (*)

indicates significant (P ≤ 0.05) difference between LED-illuminated and

non-illuminated bacterial cell counts. ............................................................... 76



of fresh-cut papaya at 10 °C (actual temperature of 13.2 °C). ................... 77

xviii



of fresh-cut papaya at 20 °C (actual temperature of 23.2 °C). ................... 78

Figure 5-5 Log reduction (a) in S. Agona (SA) and S. Typhimurium (ST) and

lipid peroxidation (b) by 405±5 nm LED illumination at 4 °C for 7 h (a

total dose of 0.9 kJ/cm2) in PBS. ........................................................................ 79


the level of 8-hydroxydeoxyguanosine (8-OHdG) (b) by 405±5 nm LED

illumination at 4 °C for 7 h (a total dose of 0.9 kJ/cm2) in PBS. .............. 79

Figure 6-1 Temperature profile on the surface of fresh-cut mango during

405±5 nm LED illumination at set temperatures of 4, 10, and 20 °C,

respectively. .............................................................................................................. 93

Figure 6-2 Survival of E. coli O157:H7 (a), L. monocytogenes (b), and

Salmonella (c) on the surface of fresh-cut mango at a set temperature of 4

°C (actual temperature of 7.2 °C) by 405±5 nm LED illumination.

Asterisk (*) indicates significant (P ≤ 0.05) difference between LED-

illuminated and non-illuminated bacterial cell counts. Different letters (A–

C or a–c) in the same bar are significantly (P ≤ 0.05) different one another.

...................................................................................................................................... 94


Salmonella (c) on the surface of fresh-cut mango at a set temperature of

10 °C (actual temperature of 13.2 °C) by 405±5 nm LED illumination. 95


Salmonella (c) on the surface of fresh-cut mango at a set temperature of

20 °C (actual temperature of 23.2 °C) by 405±5 nm LED illumination. 96

Figure 6-5 Comparison of yellowness index (YI) between 405±5 nm LED

illuminated and non-illuminated mangoes at set temperatures of 4 °C (a),

10 °C (b), and 20 °C (c). A letter (a)

in the same bar did not differ

significantly (n=6; P ≥ 0.05). .............................................................................. 99

Figure 6-6 Change in firmness (N) of fresh-cut mango by 405±5 nm LED

illumination at set temperatures of 4 °C (a), 10 °C (b), and 20 °C (c). . 100

Figure 7-1 Schematic diagrams of a 405±5 nm LED illumination system. . 108

Figure 7-2 Inactivation curves for S. Enteritidis 124 (a), 125 (c), and 130 (e)

at 4 °C and S. Enteritidis 124 (b), 125 (d), and 130 (f) at 20 °C for 7.5 h

xix

(a total dose of 0.45 kJ/cm2) in PBS. Asterisk (

*) indicates significant (P

≤ 0.05) difference between non-illuminated control and illuminated cell

counts........................................................................................................................ 113

Figure 7-3 The effectiveness of 405±5 nm LED illumination on survival of S.

Enteritidis 124 (a), 125 (b), and 130 (c) on the surface of cooked chicken

at 4 °C. ...................................................................................................................... 115



at 10 °C. ................................................................................................................... 116



at 20 °C. ................................................................................................................... 117

Figure 7-6 Percentage of injured S. Enteritidis 124 (a), 125 (b), and 130 (c)

cells on the surface of cooked chicken at a set temperature of 4 °C. ..... 118


cells on the surface of cooked chicken at a set temperature of 10 °C. .. 119

Figure 7-8 Changes in metabolic inhibition of S. Enteritidis 130 caused by

ampicillin (Amp), chloramphenicol (Chl), nalidixic acid (Nal), and

rifampicin (Rif), respectively, after LED illumination on the chicken

surface at 4 °C for 22 h. Different letters (A–C)

within the same antibiotic

differ significantly (n=6; P ≤ 0.05). ................................................................ 120

Figure 8-1 Cellular target sites for fluorescent probes. A loss of specific

membrane functions is measured with fluorescent probes equipped with

flow cytometry; efflux pump activity with EtBr; glucose uptake activity

[glucose-specific phosphoenolpyruvate-phosphotransferase system (PEP-

PTS)] with 2-NBDG; depolarisation with DiBAC4(3); permeability with

PI; and total counts with SYTO®9. .................................................................. 133

Figure 8-2 Antibacterial effect of 405±5 nm LED illumination against 18

Salmonella spp. for 4 h at 4 °C (actual temperature at 9.5 °C) on TSA

plates; non-illuminated Salmonella spp. (a) and LED-illuminated

Salmonella spp. (b). Lane: 1, S. Agona; 2, S. Enteritidis ATCC 13076; 3,

S. Enteritidis 109; 4, S. Enteritidis 124; 5, S. Enteritidis 125; 6, S.

Enteritidis 130; 7, S. Gaminara; 8, S. Heidelberg; 9, S. Montevideo; 10, S.

Newport; 11, S. Poona; 12, S. Saintpaul; 13, S. Tennessee; 14, S.

Typhyimurium ATCC 14028; 15, S. Typhimurium ATCC 13311; 16, S.

xx

Typhimurium ATCC 25241; 17, S. Typhimurium ATCC 29269; 18, S.

Typhimurium ATCC 51812............................................................................... 138

Figure 8-3 Survival curves of S. Enteritidis ATCC 13076 (a) and S. Saintpaul

ATCC 9712 (b) during 405±5 nm LED illumination at a set temperature

of 4 °C for 8 h (a total dose of 576 J/cm2) in PBS. The detection limit was

1 CFU/mL. Asterisk (*) indicates significant (P ≤ 0.05) difference

between illuminated and non-illuminated control cells. ............................ 139

Figure 8-4 The amount of coproporphyrin extracted from stationary phase

bacterial cells. A letter (a)

between the two strains did not differ

significantly (n=6; P > 0.05).............................................................................. 140

Figure 8-5 Change in the level of 8-hydroxydeoxyguanosine (8-OHdG) of S.

Enteritidis (a) and S. Saintpaul (b) by 405±5 nm LED illumination at a

set temperature of 4 °C. Different letters (a–b)

in the same bar are

significantly (P ≤ 0.05) different from each other. ..................................... 141

Figure 8-6 Flow cytometry plots of S. Enteritidis cells stained with

SYTO®9/EtBr, SYTO

®9/PI, DiBAC4(3), or 2-NBDG after 405±5 nm

LED illumination at a set temperature of 4 °C. ............................................ 142

Figure 8-7 Changes in cellular functions of S. Enteritidis and S. Saintpaul

during 405±5 nm LED illumination at a set temperature of 4 °C. Loss of

efflux pump activity with SYTO®9/EtBr (a); loss of glucose uptake

activity with 2-NBDG (b); Loss of membrane potential with DiBAC4(3);

loss of membrane integrity stained with SYTO®9/PI (d). Uppercase

letters (A–C)

in the same bar and lowercase letters (a–c)

in the same

exposure time are significantly (P ≤ 0.05) different one another. .......... 143

Figure 8-8 Micrographs of non-illuminated and LED-illuminated S.

Enteritidis cells at a set temperature of 4 °C for 10 h (a total dose of 720

J/cm2): (a), non-illuminated control cells at 10,000 ×; (b), non-

illuminated control cells at 40,000 ×; (c), LED-illuminated cells at 10,000

×; (d), LED-illuminated cells at 40,000 ×. The morphological change in

illuminated cells is highlighted by an arrow. ................................................ 144

Figure 8-9 Relative expression levels of oxyR, sodA, soxR, recA, and rpoS of

non-illuminated and LED-illuminated cells of S. Enteritidis (a) and S.

Saintpaul (b) at a set temperature of 4 °C for 1 h (a total dose of 72

J/cm2). Asterisk (*) indicates significant (P ≤ 0.05) difference between

illuminated and non-illuminated control counts. ......................................... 145

xxi

Figure 9-1 Illustration of the proposed bacterial mechanism of 405±5 nm

LED illumination at a refrigeration temperature. ROS generated during

LED illumination might attack DNA and bacterial membrane (A–E). PC,

porphyrin compound; Cyt, cytochrome complexes; PEP-PTS,

phosphoenolpyruvate: sugar phosphotransferase system. ......................... 159

xxii

List of Abbreviations

ABS Acrylonitrile butadiene styrene

ALA Aminolevulinic acid

ATCC American Type Culture Collection

BHT Butylated hydroxytoluene

CDC Centers for Disease Control and Prevention

cDNA Complementary DNA

CFU Colony-forming units

Chl Chlorophyllin

DAEC Diffusely adherent Escherichia coli

DCIP Dichloroindophenol sodium salt

DiBAC4(3) bis-(1,3-dibutylbarbituric acid) trimethine oxonol

DPPH Diphenyl-1-picrylhydrazyl

EAEC Enteroaggregative Escherichia coli

EFSA European Food Safety Authority

EIEC Enteroinvasive Escherichia coli

ELISA Enzyme-linked immunosorbent assay

EDTA Ethylenediaminetetraacetic acid

EtBr Ethidium bromide

ETEC Enterotoxigenic Escherichia coli

F Forward

FDA Food and Drug Administration

FL Fluorescent filter

FSC Forward scatter

FW Fresh weight

HPLC High performance liquid chromatography

HUS Hemolytic uremic syndrome

Hyp Hypericin

LED Light emitting diode

LPS Lipopolysaccharide

xxiii

LSD Least significant difference

MDA Malondialdehyde

MOH Ministry of Health in Singapore

MRSA Methicillin resistant Staphylococcus aureus

2-NBDG 2-[N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl) amino]-

2-deoxy-D-glucose

NIR-UV Near-infrared heating and UV

8-OHdG 8-Hydroxydeoxyguanosine

PBS Phosphate-buffered saline

PBP Penicillin-binding proteins

PDI Photodynamic inactivation

PI Propidium iodide

PW Peptone water

QE Quercetin equivalents

qRT-PCR Quantitative reverse transcription-polymerase

chain reaction

R Reverse

ROS Reactive oxygen species

RTE Ready-to-eat

SDS Sodium dodecyl sulfate

SE Salmonella Enteritidis

SEs Staphylococcal enterotoxins

SFP Staphylococcal food poisoning

SOD Superoxide dismutase

SSC Side scatter

STEC Shiga toxin-producing Escherichia coli

TAE Tris-acetate-EDTA

TBA Thiobarbituric acid

TBARS Thiobarbituric acid reaction substance

TCA Trichloroacetic acid

TE Trolox equivalents

TEM Transmission electron microscopy

TSA Tryptone soy agar

xxiv

TSB Tryptone soy broth

UV Ultraviolet

WHO World Health Organization

XLD Xylose-lysine-desoxycholate agar

YI Yellow index

xxv

List of Symbols

H2O2 Hydrogen peroxide

●OH Hydroxyl radicals

O2●―

Superoxide anion

E Dose in J/cm2

P Irradiation in W/cm2

t Time in second or hour

N Microbial population in CFU/mL

N0 Initial inoculation level in CFU/mL

tR Reliable life in Weibull model (hour)

α Scale parameter in Weibull model (hour)

β Shape parameter in Weibull model

% Percent

° Degree

°C Degree Celsius

ng Nanogram

μg Microgram

mg Milligram

g Gram

μL Microliter

mL Milliliter

L Liter

mm Millimeter

cm Centimeter

cm2 Square centimeter

nM Nanomolar

μM Micromolar

mM Millimolar

s Second

min Minute

xxvi

h Hour

bp Base pair

R2 Coefficient of determination

ΔE Colour difference

N Newton

1

Chapter 1

Introduction

Concerns about microbiological food safety have dramatically increased

recently since foods contaminated with pathogenic bacteria can threaten our

daily life by causing serious illnesses. In the data released by the United States

Centers for Disease Control and Prevention (CDC) in 2013, 287 outbreaks

caused by foodborne pathogens were reported, resulting in a total of 5,430

confirmed cases of illnesses, 872 hospitalizations, and 13 deaths in the United

State (US) (CDC, 2015). Listeria monocytogenes, Shiga toxin-producing

Escherichia coli (STEC) and Salmonella spp. were among the top five

foodborne pathogens causing death in these outbreaks (CDC, 2015). Besides

these pathogens, Bacillus cereus and Staphylococcus aureus have been

identified as major causative agents of the foodborne outbreaks in the

European Union (EU) (EFSA, 2014).

Pathogenic bacteria are widely existent in the environment and can

survive and/or grow at a wide range of temperatures. In particular, survival

and growth of these pathogenic bacteria in foods at refrigeration temperature

is of great concern with regard to safety. This is because pathogens, for

instance, E. coli O157:H7 and Salmonella spp., are capable of surviving at

chilling temperatures during storage and transportation. Moreover, outbreaks

of L. monocytogenes, a psychrotrophic pathogen, have been linked to cold-

2

stored ready-to-eat (RTE) products such as smoked fish, deli meat, and soft

cheese due to its ability to grow at refrigerated temperatures (Lianou and

Sofos, 2007). For this reason, cold storage, which is one of the most widely

used preservation techniques, should not be applied alone as a mean to

minimize the risk of foodborne disease. Therefore, it is necessary to

implement another technology as a second hurdle with low temperature

control to enhance microbiological safety of foods during storage (Ghate et al.,

2013; Lim et al., 2013).

A light emitting diode (LED) of visible wavelengths has recently

received increased attention as an emerging food preservation technology due

to its antibacterial effect, called photodynamic inactivation (PDI). The

proposed mechanism of PDI requires three components: visible light in the

wavelength range of 400–430 nm, photosensitizers, and oxygen (Luksienė and

Zukauskas, 2009). Once bacterial cells are exposed to light, the

photosensitizer, such as intracellular porphyrin compounds, absorbs light

energy and then is excited, resulting in the production of reactive oxygen

species (ROS) by transferring energy to oxygen. ROS can bring about a

cytotoxic effect by interacting with adjacent intracellular components, such as

DNA, proteins, and lipids, resulting in bacterial death (Luksienė and

Zukauskas, 2009).

Based on this proposed antibacterial mechanism of LED illumination,

some previous studies have shown the antibacterial efficacy of blue LEDs

against pathogenic bacteria in buffered solutions or food matrices with the

addition of exogenous photosensitizers, such as chlorophyllin and porphyrin

(Luksienė and Zukauskas, 2009; Luksienė and Paskeviciute, 2011; Maclean et

3

al., 2009). However, little research has been performed to investigate the

antibacterial effect of 405±5 nm LED illumination on pathogenic bacteria in

various foods without the aid of exogenous photosensitizers. Furthermore, to

the best of my knowledge, its detailed antimicrobial mechanism against

foodborne pathogens without an additional exogenous photosensitizer has not

been fully understood.

1.1 Objectives

The overall objective of this project was to evaluate the mechanism

responsible for inactivation of foodborne pathogens by 405±5 nm LED as well

as its application to RTE foods to enhance their microbiological safety during

storage. The specific aims for the entire duration of the PhD candidature are

listed as follows:

(1) Investigate the antibacterial effects of 405±5 nm LED on the selected

Gram-negative and –positive foodborne pathogens in PBS solution

(Chapters 3 and 4);

(2) Evaluate the potential of 405±5 nm LED on inhibition or inactivation

of E. coli O157:H7, L. monocytogenes, or Salmonella spp. on RTE

foods at different storage temperatures (Chapters 5, 6, and 7);

(3) Investigate the influence of long-term LED illumination on

physicochemical and nutritional qualities of RTE foods (Chapters 5

and 6);

(4) Elucidate the antibacterial mechanism of 405±5 nm LED illumination

against foodborne pathogens at refrigeration temperatures by

determining endogenous coproporphyrin content, damage to bacterial

4

DNA, membrane function, and metabolism, morphological change,

and regulatory gene expression level (Chapters 3,4, 5, 7, and 8).

5

Chapter 2

Literature review

2.1 LED as a novel food preservation technology

Ultraviolet (UV) light is able to inactivate microorganisms on the

surfaces of foods during storage. However, UV light leads to discolourization

in certain food products during long-term exposure and has harmful effects on

skin tissue and eyes of the operator, resulting in limitation of UV light as a

preservation technology in the food industry (Maclean et al., 2009; Murdoch

et al., 2010). To overcome these shortcomings of UV light, LEDs of visible

wavelengths have been investigated as an alternative.

2.1.1 LED

A LED is a solid-state semiconductor device able to emit light by an

electric current (Gupta and Jatothu, 2013). Its construction generally

compromises a p–n junction between two semiconductors, namely a p–side

(anode) and an n–side (cathode). Current flows only from the p–side where a

carrier is positively charged holes to the n–side at which current is carried

through mobile electrons (Gupta and Jatothu, 2013; Dume, 2006). These

electrons and holes recombine in the junction when a suitable voltage is

applied, and then fall into a lower energy level, followed by release of photon

6

energy. This process, called electroluminescence, emits light and the colour of

the emitted light is determined by the energy band gap of the semiconducting

materials (Gupta and Jatothu, 2013). Therefore, LEDs emit visible light within

a narrow and specific wavelength spectrum.

LEDs have several advantages such as lower energy consumption, high

durability, reduced heat output, and long life compared to traditional visible

light sources (Ghate et al., 2013; Mori et al., 2007). LEDs can also be

fabricated in small sizes and various shapes, which could be applied to most

designs (Ghate et al., 2013; Mori et al., 2007). For these reasons, LED

technology has been widely used in various industries such as lighting,

electronics, and agriculture.

2.1.2 LED application in agriculture

Since light is a key component to influence the growth and development

of plants undergoing photosynthesis (Ma et al., 2011), LEDs have attracted the

attention of researchers in agriculture to promote the growth of plants and

flowering. Red light is absorbed by plant pigments such as chlorophyll that is

near 660 nm of the absorption peak (Massa et al., 2008). It is also known that

blue light plays an essential role in photomorphogen of plants, thereby

influencing stem elongation, chloroplast development, and exchange of carbon

dioxide and water retention through stomata (pores) (Ma et al., 2011; Massa et

al., 2008). In particular, blue (430–450 nm) and/or red (650–670 nm) LEDs

contribute to the photosynthesis in plants, resulting in the improvement of

nutritional quality of vegetables (Olle and Viršile, 2013). For example, 660 nm

LED illumination on flavedo increases the amount of β-cryptoxanthin as one

7

of carotenoids abundant in citrus fruits compared to controls in the dark

condition (Ma et al., 2011). Another study demonstrated higher flavonoid and

β-carotene contents in a variety of plants and fruits as a result of 440 nm LED

illumination compared levels held in the dark (Hong et al., 2015).

2.1.3 Clinical application of LED and its antibacterial efficacy

Some previous studies demonstrated the potential for application of blue

LEDs as a light therapy to inactivate medically important bacterial pathogens

(Elman et al., 2003; Maclean, 2010). For instance, Elman et al. (2003)

reported that treatment with blue light (405–420 nm) resulted in a reduction of

59 – 67% of Propionibacterium acnes, the major cause of acne on the face.

Maclean et al. (2010) demonstrated that methicillin-resistant S. aureus

(MRSA) isolated from infected burn patients is reduced by 56% to 86% of

surface bacterial levels in a hospital room by 405 nm LED illumination. Based

on the antibacterial effects of blue light, the Food and Drug Administration

(FDA) in the US approved several blue light devices for the treatment of

inflammatory acne vulgaris (Gold, 2008).

Blue light at 405–420 nm with the aid of 5-aminolevulinic acid (5-ALA)

has been proven to be antibacterial to Clostridium, Pseudomonas,

Staphylococcus, and Streptococcus (Nitzan et al., 2004). Vaitonis and

Luksienė (2010) reported that the populations of B. cereus, L. monocytogenes,

and Salmonella enterica in PBS solution were inactivated by 4–6.5 log within

20 min due to 410 nm LED illumination with the addition of 5-ALA, a

precursor of the endogenous heme. Another study showed that illumination of

405 nm LED with chlorophyllin (Chl) inactivated by 6.5 log for L.

8

monocytogenes within 4 min and 2 log for S. Typhimurium within 40 min,

revealing that L. monocytogenes was more sensitive to LED illumination in

the presence of Chl (Luksienė et al., 2013). Nakamura et al. (2015) have

shown that 400 nm LED with the addition of chlorogenic acid in PBS

inactivated about 5 logs of E. coli, P. aeruginosa, and S. aureus.

Several studies have demonstrated the efficacy of LED illumination in

eliminating pathogenic bacteria on foods with the addition of photosensitizers

and their results are summarized in Table 2–1. For example, 400 nm LED

illumination with Chl Na-salt (Na-Chl) for 20 min resulted in 1.8 log reduction

for L. monocytogenes on the surface of strawberries (Luksienė and

Paskeviciute, 2011). Similarly, Aponiene et al. (2015) have shown that the

antibacterial action of 585 nm LED illumination with the addition of 15 μM

hypericin (Hyp) for 30 min reduced the populations of B. cereus on the surface

of apricots, cauliflowers, and plumes by 1.1, 1.3, and 0.8 log CFU/g,

respectively. The population of B. cereus in PBS at 0.1 μM Hyp decreased by

4.4 log CFU/mL for 40 min of LED illumination in the same study.

Due to consumer demand for additive free foods regardless whether

natural or not, recent studies have focused on a potential use of blue LED

technology without the addition of exogenous photosensitizers. The results

obtained from previous studies are summarized in Table 2–2.

9

Table 2-1 Photodynamic inactivation on various microorganisms in buffered solution or food matrix by LED illumination with photosensitizers.

Light Photosensitizer Matrix Microorganism Log reduction Dose (J/cm2) Reference

400 nm Chl

ALA

PBS L. monocytogenes

S. Typhimurium

L. monocytogenes

S. Typhimurium

7.0

2.2

3.8

6.6

3.6

29

14

29

Luksienė et al.,

2012

400 nm Chlorogenic acid

Caffeic acid

PBS

E. coli

Enterococcus faecalis

Pseudomonas aeruginosa

Streptococcus mutans

E. coli

E. faecalis

P. aeruginosa

S. aureus

S. mutans

3.2

1.0

5.0

5.0

5.0

2.6

5.0

5.0

5.0

78

Nakamura et

al., 2015

400 nm ALA PBS L. monocytogenes 3.7 18 Buchovec et

al., 2010

400 nm Na-Chl Cherry tomatoes

Chinese cabbage

Iceberg lettuce

B. cereus 2.3

1.8

1.7

6 Paskeviciute &

Luksienė 2009

405 nm ALA PBS

Plastic food-related

packaging

B. cereus spores 3.7

2.7

18

Luksienė et al.,

2009

10

Table 2–1 Continued.

Light Photosensitizer Matrix Microorganism Log reduction Dose (J/cm2) Reference

405 nm Chl

ZnO nanoparticles

PBS E. coli O157:H7

3.0

4.6

380

380

Aponiene &

Luksienė, 2015

405 nm Chl

Chl-chitosan

PBS

Strawberries

PBS

Strawberries

S. Typhimurium 1.8

1.3

7.0

2.2

38

38

19

38

Buchovec et

al., 2016

407–420 nm ALA PBS Acinetobacter baumannii

B. cereus

E. coli

S. aureus

S. epidermidis

S. faecalis

1.4

1.9

1.4

7.0

7.0

0.0

100 Nitzan et al.,

2004

410 nm ALA PBS B. cereus

L. monocytogenes

Salmonella

6.5

4.0

6.5

24 Vaitonis &

Luksienė, 2010

462 nm Flavin

mononucleotide

PBS E. coli 1.4 14 Liang et al.,

2015

585 nm

Hyp PBS

Apricots

Cauliflowers

B. cereus 4.4

1.1

1.3

9.2

6.9

6.9

Aponiene et

al., 2014

11

Table 2-2 Antibacterial effects of blue LED illumination without the addition

of photosensitizers against various microorganisms in PBS and broth.

Light Microorganism

Reduction

(log CFU/mL)

Dose

(J/cm2) Reference

405 nm A. baumannii

Clostridium perfringens

E. coli

E. faecalis

P. aeruginosa

S. aureus MRSA

S. epidermidis

S. pyogenes

4.2

4.4

3.1

2.6

4.2

5.0

4.6

5.0

108

45

180

216

180

36

45

54

Maclean

et al.,

2009

405 nm C. jejuni

E. coli O157:H7

S. Enteritidis

5.3

5.3

3.0

18

288

288

Murdoch

et al.,

2010

405 nm E. coli O157:H7

L. monocytogenes

S. Enteritidis

S. sonnei

5.0

5.0

3.5

5.0

288

108

288

180

Murdoch

et al.,

2012

405 nm E. coli

L. ivanovii

L. monocytogenes

L. seeligeri

S. Enteritidis

S. sonnei

4.5

4.1

3.7

3.3

1.4

3.9

555

185

185

185

740

555

Endarko et

al., 2012

461 nm E. coli O157:H7

L. monocytogenes

S. Typhimurium

S. aureus

4.9

4.3

5.0

5.2

597 Ghate et

al., 2013

A study conducted by Ghate et al. (2013) showed an antibacterial effect of 461

nm LED against E. coli O157:H7, L. monocytogenes, S. Typhimurium, and S.

aureus in trypticase soy broth (TSB) without the addition of photosensitizers

under chilling conditions. Murdoch et al. (2012) reported inactivation of E.

coli O157:H7 and L. monocytogenes by 5 log CFU/mL and S. Enteritidis by

3.5 log CFU/mL due to 405 nm LED alone at the intensity of 10 mW/cm2

within 8 h (until 288 J/cm2) in PBS. Another study showed that 405 nm LED

12

illumination (intensity, 85.6 mW/cm2) reduced populations of L.

monocytogenes and S. Enteritidis in PBS by 3.7 and 1.4 log CFU/mL for 36

min (total dose, 184.9 J/cm2) and 144 min (total dose, 739.6 J/cm

2),

respectively (Endarko et al., 2012). These discrepant results could be due to

different designs in experiments such as set temperature, intensity of LED,

total volume and depth of bacterial suspension, and distance between light

source and sample surface.

2.1.4 Proposed mechanism of photodynamic inactivation (PDI)

PDI is a non-thermal photophysical and photochemical reaction that

requires visible lights, particularly in the 400–430 nm wavelength range, and

photosensitizers such as porphyrin molecules in the presence of oxygen

(Luksienė and Zukauskas, 2009; Dai et al., 2012) (Figure 2–1). The proposed

photodynamic bacterial inactivation mechanism of blue LED is that once

photosensitizer molecules absorb photons of visible lights, the molecules are

excited to a singlet or triplet state from the ground state in the presence of

oxygen, resulting in induction of two pathways: Type 1 and Type 2. The type

1 pathway involves an electron transfer to yield superoxide anions (O2●―

),

which react further with oxygen to produce other ROS, such as hydrogen

peroxide (H2O2) and hydroxyl radicals (●OH). In the type 2 pathway, absorbed

energy is transferred directly to molecular oxygen by the ground state triplet

oxygen (3O2) to produce singlet oxygen molecules (

1O2). These ROS and

singlet oxygen generated from the reactions may attack cellular components,

such as DNA, lipids, and proteins, resulting in bacterial death (Luksienė and

Zukauskas, 2009; Dai et al., 2012).

13

Figure 2-1 Reactive oxygen species (ROS) generated during photodynamic

inactivation (PDI). PS, photosensitizer; 1PS

* and

3PS

*, excited photosensitizer

in singlet and triplet states, respectively, from ground state; 3O2, ground state

triplet oxygen (Mikš-Krajnik et al., 2015).

2.2 Bacterial defense responses to oxidative stress

To obtain energy, aerobic bacteria utilize molecular oxygen (O2) during

respiration or oxidation of nutrients, resulting in continuous production of

ROS (Cabiscol, Tamarit, and Ros, 2000). Aerobic and facultative anaerobic

bacteria are capable of catalyzing ROS through their defense mechanisms,

such as nonenzymatic antioxidants (e.g., glutathione) and enzymatic activities

[e.g., catalase and superoxide dismutases (SOD)] (Cabiscol, Tamarit, and Ros,

2000). However, the production of ROS is much enhanced in certain

environments, such as near-UV irradiation, LED illumination of visible

wavelengths and ionizing which can cause oxidative stress (Cabiscol, Tamarit,

and Ros, 2000; Nakamura et al., 2015). Oxygen toxicity occurs when the

oxidative stress level is beyond the capability of bacterial defense systems

(Farr and Kogoma, 1991).

14

It is known that Salmonella can enhance its resistance to oxidative

stress through the induction of regulators such as OxyR, SodA, SoxRS, and

RpoS (Farr and Kogoma, 1991). The oxyR gene constitutes an OxyR regulator

that is activated via the formation of disulfide bonds under hydrogen peroxide

stress (Farr and Kogoma, 1991). The oxidized OxyR also activates the

expression of katG (encoding catalase hydroperoxidase I), dps (encoding non-

specific DNA-binding proteins), gorA (encoding glutathione reductase), and

oxyS (encoding small regulatory RNA) involved in the bacterial resistance to

oxidative stress (Farr and Kogoma, 1991; Hamblin and Hasan, 2004; Janssen

et al., 2003).

Bacteria possess at least two superoxide dismutases (SODs), Mn–SOD

encoded by sodA and Fe–SOD encoded by sodB, which can convert

superoxide anion to hydrogen peroxide. The SoxRS regulator encoded by two

regulatory genes of soxR and soxS regulates SODs under high levels of

superoxide stress (Farr and Kogoma, 1991; Hamblin and Hasan, 2004; Janssen

et al., 2003). The oxidized SoxR activates several genes, including sodA, fpr

(encoding ferredoxin-NADP reductase), nfo (encoding DNA repair

endonuclease IV), and zwf (encoding glucose-6-phosphate dehydrogenase)

(Kim and Park, 2014).

The rpoS-encoded σS subunit of RNA polymerase is another regulator to

survive under oxidative stress as well as general stress conditions, including

low temperature and starvation (Michán et al., 1999; Battesti, Majdalani, and

Gottesman, 2011). It is also known that UV light and hydrogen peroxide (low

and high concentrations) are able to induce recA as a global regulator of SOS

response (Farr and Kogoma, 1999). recA expression is associated with DNA

15

topological change, DNA gyrase, and single-stranded DNA (Fark and

Kogoma, 1999; Oh and Kim, 1999). Therefore, the presence of different

regulators could stimulate the coordinated transcription of different sets of

genes and thereby augment bacterial resistance to oxidative stress. Although

the cellular response of Salmonella to general oxidative stress is well

understood as described above, little information is available on its defense

response to LED illumination under chilling conditions.

2.3 Foodborne pathogens and their outbreaks related to ready-

to-eat (RTE) foods

Markets for refrigerated fresh-cut fruit products have dramatically

increased in recent years due to consumer demand for fresh, convenient,

additive-free, and minimally processed fruits that are nutritious and safe

(James and Nagramsak, 2011). In addition, RTE meats such as cooked chicken

and ham are sold in many salad bars and large supermarkets and are mostly

stored at refrigerated temperatures to control bacterial growth. However, these

RTE foods can be easily exposed to unhygienic environmental conditions

during processing, such as washing, peeling and cutting, leading to cross-

contamination with pathogenic bacteria from raw foods or equipment.

Moreover, many organisms on RTE foods may grow due to temperature

fluctuations during storage at food establishments (Raybaudi-Massilia et al.,

2013; Sim et al., 2013). Since most of RTE foods require no further step to

eliminate bacteria, if contaminated, they can cause foodborne illness outbreaks.

Some outbreaks associated with fruits, vegetables, and chicken are

summarized in Table 2–3.

16

Table 2-3 Summary of foodborne outbreaks associated with fruits, vegetables, and chicken.

Food Product Pathogen No of case Country Year Reference

Apple Prepackaged L. monocytogenes 35 US 2016 CDCa

Cantaloupe Whole

Whole

Whole

S. Litchfield

L. monocytogenes

S. Newport & S. Typhimurium

51

146

261

US

US

US

2008

2011

2012

CDCa

CDC, 2012

CDCa

Mango Whole S. Braenderup 127 US 2012 CDC, 2012

Mixed berries Frozen S. sonnei 21 Sweden 1996 Tavoschi et al., 2015

Pineapple Fresh-cut S. Weltevreden Singapore 1996 Ooi, 1997

Papaya Fresh-cut

Fresh-cut

Whole

S. Weltevreden

S. Litchfield

S. Agona

26

106

Singapore

Australia

US

1996

2006

2011

Ooi, 1997

Gibbs et al., 2009

CDC, 2011

Watermelon Fresh-cut S. Newport 63 UK 2012 Byrne et al., 2014

Cucumbers Whole

Whole

Whole

S. Saintpaul

S. Newport

S. Poona

84

275

907

US

US

US

2013

2014

2016

CDCa

CDCa

CDCa

Mixed vegetables Prepackaged salad L. monocytogenes 19 US 2016 CDCa

Chicken RTE salad

Raw

Salad

Raw, frozen & stuffed

E. coli O157:H7

S. Heidelberg

E. coli O157:H7

S. Enteritidis

33

634

19

15

US

US

US

US

2013

2015

2015

2015

CDCa

CDCa

CDCa

CDCa

a Data obtained from CDC website on foodborne outbreaks (http://www.cdc.gov/foodsafety/outbreaks/multistate-outbreaks/outbreaks-list.html)

http://www.cdc.gov/foodsafety/outbreaks/multistate-outbreaks/outbreaks-list.html

17

2.2.1 Bacillus cereus

Bacillus cereus is a Gram-positive, large rod-shaped, endospore forming,

facultative anaerobic bacterium (Granum, 2007). B. cereus is widely

distributed in soil and on foods of plant origins (especially rice and pasta), and

thus it is frequently found in foods (Granum, 2007). RTE foods contaminated

with B. cereus have been reported (Rosenquist et al., 2005). Two types of B.

cereus are a well-known causative agents for foodborne illness: the diarrheal

type caused by enterotoxins and the emetic (vomiting) type caused by toxins

produced during cell growth on foods (Granum, 2007). In the US, over 60,000

laboratory-confirmed cases have been caused by B. cereus, but only 0.4% has

required hospitalization and no deaths have occurred annually (Scallan et al.,

2011a). Although illness caused by B. cereus is not commonly reported due to

the mostly mild symptoms, a heat-stable toxin produced by B. cereus has the

potential for causing severe symptoms especially to immunocompromised

individuals who have consumed foods containing high amounts of toxins.

2.2.2 Escherichia coli O157:H7

Escherichia coli, member of the family Enterobacteriaceae, is a Gram-

negative, rod-shaped, non-spore forming, facultative anaerobic bacterium

found in the intestinal tract of warm-blooded animals and humans (Meng et al.,

2007). E. coli commonly detected on foods are non-pathogenic; however,

several E. coli strains are able to cause distinctive clinical illness such as

diarrhea. According to virulence properties, clinical symptoms, and

mechanism of pathogenicity, these pathogenic E. coli strains are categorized

into six pathotypes including entertopathogenic E. coli (EPEC),

18

enterotoxigenic E. coli (ETEC), enteroinvasive E. coli (EIEC),

enterohemorrhagic E .coli (EHEC), enteroaggregative E. coli (EAEC), and

diffusely adherent E. coli (DAEC) (Meng et al., 2007).

Of these pathotypes, EHEC is responsible for the majority of outbreaks

in the US and causes the most acute disease (Scallan et al., 2011b). E. coli

O157:H7 belonging to the EHEC pathotype is the predominant causative agent

of hemolytic uremic syndrome (HUS), resulting in a considerable health

burden (Brooks et al., 2005; Meng et al., 2007). In the US, RTE salads were

associated with an E. coli O157:H7 outbreak in 2013, resulting in 33

infections, 7 hospitalizations, and 2 HUS (CDC, 2013). E. coli O157:H7, as a

major public health concern, has been increasingly recognized since the first

outbreak that occurred in 1982 (Meng et al., 2007).

2.2.3 Listeria monocytogenes

Listeria monocytogenes is one of ten species in the genus Listeria, which

is a Gram-positive, short rod-shaped, non-spore forming, facultative anaerobic

bacterium (Jami et al., 2014; Swaminathan et al., 2007). Of the ten species,

two L. ivanovii and L. monocytogenes species are pathogenic to mammalians;

however, only L. monocytogenes is responsible for human cases of listeriosis.

L. monocytogenes has 13 serotypes, namely 1/2a, 1/2b, 1/2c, 3a, 3b, 3c, 4a,

4ab, 4b, 4c, 4d, 4e, and 7, which is useful when tracking L. monocytogenes

strains associated with outbreaks (FDA, 2011). Among these serotypes, 1/2a,

1/2b, and 4b serotypes are predominant causative agents for most human cases

of listeriosis (Liu, 2006). Listeriosis is a crucial public health concern due to

19

the high mortality rate of 20–30% in newborns, pregnant women, the elderly,

and immunocompromised people (Jami et al., 2014).

Several listeriosis outbreaks have occurred over the last two decades

globally. It is estimated that listeriosis results in 1,520 hospitalizations and 266

deaths annually in the US (Scallan et al., 2011a). Although many food

products have contributed to these outbreaks, refrigerated RTE food products,

including pre-packed fresh fruits and vegetables, soft cheeses, smoked fish,

and seafood salad, are high-risk vehicles for transmission of human listeriosis

because these products have a long shelf life and are generally consumed

without heating (Jami et al., 2014; Swaminathan et al., 2007). For example,

146 illness and 32 deaths were reported in the US due to a L. monocytogenes

outbreak associated with consumption of cantaloupes in 2011 (CDC, 2012). In

the EU, 2,161 human cases of listeriosis were reported in 2014, including that

several small outbreaks and one large outbreak that occurred in Denmark, with

the highest notification rate among the countries in the EU (EFSA, 2015).

Moreover, the presence of L. monocytogenes was detected in 2.8% out of

3,272 units of RTE fruits and vegetables, while 10.6% of 11,324 units of RTE

fish and fishery products were positive with L. monocytogenes (EFSA, 2015).

2.2.4 Salmonella species

The genus Salmonella is a Gram-negative, flagellated, rod-shaped, non-

spore forming, facultative anaerobic bacterium, which belongs to the family

Enterobacteriaceae (D’Aoust and Maurer, 2007). Salmonella is divided into

two species, namely S. bongory and S. enterica. The latter one is subdivided

into six subspecies: arizonae, enterica, diarizonae, houtenae, and indica

20

(D’Aoust and Maurer, 2007). Salmonella enterica subspecies enterica has

over 2,500 serotypes associated with diseases in humans and animals,

including typhoid (invasive) of S. Typhi and S. Paratyphi, and non-typhoid

(non-invasive) of S. Enteritidis and S. Typhimurium as the most well-known

serotypes (Issenhuth-Jeanjean et al., 2014; Park et al., 2009).

Non-typhoidal Salmonella is one of the major causative agents for

salmonellosis worldwide, resulting in 10 million cases of infection and

100,000 deaths annually (Yang et al., 2014; WHO, 2013). In Singapore,

Salmonella has been identified as the top contributory agent, accounting for

more than half of reported foodborne illness cases during 2001–2010

(Kondakci and Yuk, 2012). It is estimated that the annual health-related cost

of non-typhoidal salmonellosis is $4.4 billion in the US (Scharff, 2012). The

CDC has reported that among the 147 confirmed outbreaks caused by

Salmonella, S. Enteritidis is identified as the most common serotype, followed

by S. Typhimurium, S. Heidelberg, S. Newport, and other serotypes in 2013

(CDC, 2015). Chicken, pork, seed sprouts, and beef contaminated with

Salmonella are listed in the top 4 pathogen-food category pairs contributing to

infections in the US (CDC, 2015). Fruits are also included in the top five

pathogenic-food category pairs associated with deaths due to salmonellosis

(CDC, 2015). Several outbreaks of salmonellosis have been associated with

consumption of fresh fruits, including cantaloupe and mango. For instance, in

2012, cantaloupes were linked to an outbreak caused by S. Typhimurium and S.

Newport, resulting in 261 infections, 94 hospitalizations, and 3 deaths in the

US (CDC, 2012). Thus, these fresh-cut fruits could be vehicles of human

salmonellosis.

21

2.2.5 Shigella species

The genus Shigella is a Gram-negative, rod-shaped, non-motile, non-

spore forming, and facultative anaerobic bacterium (Lampel and Maurelli,

2007). As Shigella spp. also belong to the family Enterobacteriaceae, they are

genetically similar to E. coli and are closely associated with Salmonella spp.

Shigellosis is an acute enteric infection caused by Shigella and it is estimated

that the number of around 80–165 million cases of shigellosis and 600,000

deaths occurs annually throughout the world (Browne, 2015). Transmission

occurs by the fecal-oral route through person-to-person contact or

consumption of water or food fecally contaminated with infectious levels (as

few as ten cells) (Nygren et al., 2015).

Based on the O antigens, there are four species of Shigella, including S.

boydii, S. dysenteriae, S. flexneri, and S. sonnei. S. dysenteriae type 1, capable

of producing shiga-toxin, occurs often in Sub-Saharan Africa and South Asia

and has the potential for epidemic dysentery (Lampel and Maurelli, 2007;

Nygren et al., 2015). S. sonnei is a predominant causative agent in

industrialized countries, accounting for approximately 80% of shigellosis

infections in the US (Nygren et al., 2015). S. sonnei is commonly transmitted

via interpersonal contact, especially to young children and their caregivers

(Browne, 2015). S. flexneri is the dominant species in developing countries

and rare infection caused by S. boydii accounts for 2–6% of shigellosis

infection globally (Browne, 2015; Nygren et al., 2015).

Shigellosis is not associated with any specific food, although shigellosis

outbreaks have been associated with raw and cooked foods such as shellfish

22

and chicken salad, and potato salad (Lampel and Maurelli, 2007). Shigellosis

outbreaks have been reported in various locations, including homes,

restaurants, picnics, airlines, social gatherings, and cruise ships (Lampel and

Maurelli, 2007; Nygren et al., 2015). The source of contamination often

originates from infected food handlers (Nygren et al., 2015). Although

shigellosis outbreaks have recently decreased, it is still a major concern for

public health.

2.2.6 Staphylococcus aureus

The genus Staphylococcus, called staphylococci, is a Gram-positive,

spherical-shaped, facultative anaerobic bacterium (Seo and Bohach, 2007).

According to the European Food Safety Authority (EFSA), 393 cases of

staphylococcal intoxification were reported in 2014 (EFSA, 2015).

Staphylococcus is frequently found in unpasteurized milk and raw milk cheese

and can grow in salty foods such as ham due to its salt-tolerance (CDC, 2010).

Food poisoning caused by Staphylococcus, namely staphylococcal food

poisoning (SFP) results from consumption of foods contaminated with one or

more pre-formed staphylococcal enterotoxins (SEs) (Seo and Bohach, 2007).

Although more than one species of Staphylococcus is able to produce SEs, the

incidence of SEs produced by S. aureus is relatively high than other species

(Seo and Bohach, 2007). Outbreaks caused by SFP have been linked to sliced

meat, pastries, puddings, sandwiches, salad vegetables, and seed sprouts (CDC,

2010; Ramos et al., 2013). Contamination of foods with S. aureus usually

occurs during food processing (Castro et al., 2015). Since S. aureus is able to

colonize the skin and the nares of humans, a food handler carrying S. aureus is

23

partly responsible for these outbreaks through direct contact of foods (Castro

et al., 2015; CDC, 2010). Thus, the presence of S. aureus in foods has the

potential for producing SEs, which can cause foodborne intoxification in

amounts as low as 0.1–1 μg, corresponding to >105 viable cells/g (Seo and

Bohach, 2007). These SEs are not completely destroyed by heating even at

100 °C for 30 min and thus cooking may not be sufficient to improve food

safety (Seo and Bohach, 2007).

24

Chapter 3

Inactivation by 405±5 nm light emitting diode of Escherichia

coli O157:H7, Salmonella Typhimurium, and Shigella sonnei

under refrigeration may be due to the loss of membrane

integrity

3.1 Introduction

Consumption of foods contaminated with infectious levels of bacterial

pathogens cause serious illness in humans. According to the data estimated by

CDC, a total of 48 million cases of infection, 127,839 hospitalizations, and

3,037 deaths were caused by major pathogens and unspecified agents

transmitted via food every year in the US. The number of infection caused by

three major Gram-negative pathogens was as follows: 1 million by

Salmonella, 131,254 by Shigella, 112,752 by non-O157 STEC, and 63,153 by

O157 STEC (Scallan et al., 2011a; 2011b). It was also estimated that annual

health-related costs due to foodborne disease in the US range from $51 billion

to $77.7 billion (Scharff, 2012). In Singapore, the Ministry of Health (MOH)

estimates that about 0.1 million people per annum seek medical care due to

acute diarrheal illnesses (MOH, 2010). Among causative agents, non-

typhoidal Salmonella spp. have been identified as major pathogenic bacteria

25

that cause foodborne illness, followed by Campylobacter, Hepatitis A and E

viruses, and Shigella spp. during the last decade (Kondakci and Yuk, 2012).

To inhibit or inactivate these pathogenic bacteria in food products

during storage, food processors and handlers have manipulated intrinsic and

extrinsic factors such as temperature, pH, water activity, and antimicrobial

agents (Lim et al., 2013; Yuk and Geveke, 2011). Among these, the most

widely used preservation technique is cold storage; however, some pathogenic

bacteria such as E. coli O157:H7 and Salmonella spp. are able to survive at

refrigeration temperature during transportation and storage. For this reason,

refrigeration should not be used as the sole preservation method. Therefore, to

ensure food safety and to extend the shelf life of perishable foods such as RTE

foods, an additional hurdle with refrigeration should be developed and

employed for better food preservation without loss of food quality (Lim et al.,

2013; Ghate et al., 2013).

One emerging food preservation technology is the use of LED of visible

wavelengths, which has been recently receiving increased attention due to its

antibacterial effect. Recent studies with 405±5 nm LED have shown its

antibacterial effect on many bacterial species (see Chapter 2). However, little

information is available on the effectiveness of 405±5 nm LED on the

inactivation of various foodborne pathogens and its antibacterial mechanism

by endogenous photosensitizers. The objective of this study was to investigate

the antibacterial effect of 405±5 nm LED on E. coli O157:H7, S.

Typhimurium and S. sonnei. Its antibacterial mechanism was also elucidated

by determining sensitivity to bile salts and NaCl as well as by examining loss

26

of cell membrane permeability and DNA degradation. Gram-negative

pathogens were used in this study since they have similar membrane structure.

3.2 Materials and methods

3.2.1 Bacterial strains and culture conditions

E. coli O157:H7 (EDL 933) used in this study was provided by Dr.

Henry Mok from the Department of Biological Sciences at the National

University of Singapore. S. Typhimurium (ATCC 14028) and S. sonnei

(ATCC 29031) were obtained from the American Type Culture Collection

(ATCC; Manassas, VA, USA) and stored at –70 °C. Frozen stock cultures

were activated in 10 mL of sterile tryptone soya broth (TBS; Oxoid,

Basingstoke, UK) for 18–24 h at 37 °C. After two consecutive transfers for

18–24 h at 37 °C, a working culture in the stationary phase was used for

experiments.

3.2.2 LED source

A high intensity 405±5 nm LED device was purchased from Shenzhen

Getian Opto-Electronics Co., Ltd. (Shenzhen, Guangdong, China). The lamp

had a square 8 × 8 mm shape and the irradiance (W/cm2) of light emitted from

the 405±5 nm LED unit was measured at the surface of bacterial suspensions

using a 405±5 nm radiometer (UHC405, UVATA Ltd., Hong Kong). The

irradiance of the 405±5 nm LED was 18±2 mW/cm2. The dosage received by

each bacterial suspension was calculated using the following equation

(Maclean et al., 2009):

27

E = Pt (3.1)

where E = dose (energy density) in J/cm2, P = Irradiance (power density) in

W/cm2, and t = time in sec.

3.2.3 LED illumination system

The 405±5 nm LED was attached to a cooling fan and a heat sink to

dissipate the heat generated from the LED. A resistance of 5 Ω was used in the

circuit in order to protect the LEDs from excessive current. Each LED system

was placed in an acrylonitrile butadiene styrene (ABS) housing for the

illumination to prevent the entry of external light. The distance between the

LED source and the bacterial suspension in a sterile glass Petri dish (60 mm

diameter) was adjusted to 4.5 cm to illuminate the upper surface of the Petri

dish. A Fluke 5.4 thermocouple (Everett, WA, USA) was used to monitor the

temperature of the bacterial suspension during LED illumination.

3.2.4 Bacterial inactivation by 405±5 nm LED illumination

One mL of the working culture was centrifuged at 6,000 × g for 10 min

at 4 °C. Cells in the obtained pellet were washed with 1 mL of phosphate-

buffered saline (PBS; Vivantis Technologies Sdn. Bhd., Malaysia) and

centrifuged again. Cells in the resultant pellet were resuspended in 1 mL of

PBS and diluted to a final concentration of approximately 108 CFU/mL in

PBS. Ten milliliters of the bacterial suspension in a glass Petri dish was placed

under the LED system and illuminated at 4±1 °C for 7.5 h (a total dose of 486

J/cm2) in a temperature controlled incubator (MIR-154, Panasonic Healthcare

28

Co., Ltd., Osaka, Japan). The illumination time was arbitrarily chosen based

on a previous study (Ghate et al., 2013). Non-illuminated bacterial

suspensions were also set up in the dark as a control in the incubator. An

aliquot of 0.5 mL was withdrawn after every 1.5 h (dose of 97.2 J/cm2). LED-

illuminated and non-illuminated cells were serially diluted with PBS, if

necessary, and plated on tryptone soya agar (TSA; Oxoid) by spiral plating

(WASP 2, Don Whitley Scientific Ltd., West Yorkshire, UK), followed by

incubation at 37 °C for 24–48 h. The number of viable cells was enumerated

with an automated colony counting system (Acolyte, Synbiosis, Frederick,

MD, USA) and expressed as log CFU/mL.

3.2.5 Weibull model for bacterial inactivation kinetics

The modified Weibull model was used to determine bacterial

inactivation and to compare the sensitivity of test strains to LED illumination

since it describes several types of inactivation such as concave, convex, and

linear shapes due to its flexibility (Ferrario et al., 2013; Mare et al., 2009). The

parameters of Weibull distribution consist of α and β (Bialka et al, 2008;

Unluturk et al., 2010; van Boekel, 2002):

log10

=

α β

(3.2)

where t is the exposure time to LED in hours, N is the microbial population

after LED exposure (CFU/mL), N0 is initial inoculation level (CFU/mL), α and

β are the scale and shape parameters of the Weilbull model. The reliable life

(tR) was calculated using the following equation (Bialka et al., 2008):

29

tR = α

β (3.3)

Values were analyzed with Origin 9.0 software (OriginLab Co.,

Northampton, MA, USA). The reliable life (tR) indicates the time (h) needed

for 90% reduction in population based on the scale (α) and shape (β)

parameters of Weibull distribution, which is the same concept with the D-

value for the first-order inactivation kinetics (Bialka et al., 2008).

3.2.6 Bacterial sensitivity to bile salts and NaCl

To investigate a loss of cytoplasmic or outer membrane functionality of

cells caused by LED illumination, the sensitivities of illuminated and non-

illuminated cells to bile salts and NaCl were determined. An increase in

sensitivity to bile salts and NaCl implies losses of outer membrane function as

a permeability barrier to hydrophobic compounds and to osmotic functionality

of cytoplasmic membrane, respectively (Ait-Ouazzou et al., 2012; Jasson et

al., 2007; Somolinos et al., 2008).

Sensitivity was measured by comparing the difference in the number of

colonies grown on TSA (non-selective agar) and TSA supplemented with

NaCl (Goodrich Chemical Enterprise, Singapore) or ox-bile (Sigma-Aldrich,

St. Louis, MO, USA) (selective agar). LED illuminated or non-illuminated

cells were plated onto TSA with 2% (w/v) NaCl for S. sonnei or 3% (w/v)

NaCl for E. coli O157:H7 and S. Typhimurium and onto TSA containing 1%

(w/v) bile salts. After incubation at 37 °C for 24–48 h, the number of colonies

30

was enumerated and the sensitivity was calculated with the following equation

(Ghate et al., 2013):

(3.4)

The concentrations of NaCl and bile salts used for each bacterial strain

were determined to be the maximum non-inhibitory concentrations for

stationary phase cells. The maximum non-inhibitory concentration is defined

as the maximum concentration of NaCl or bile salts that does not inhibit the

growth of healthy and intact cells. To determine these concentrations,

stationary phase cells grown at 37 °C for 24 h were plated onto both TSA and

TSA containing various concentrations of NaCl (1–4%) or bile salts (1–3%)

and the sensitivity was compared as described above.

3.2.7 Determination of cell membrane permeability

Cell membrane permeability after LED illumination was observed using

the LIVE/DEAD® BacLight Viability Kit L-7007 (Molecular Probes

™,

Eugene, OR, USA) according to the manufacturer’s instructions. The kit

consists of two dyes, SYTO®9 (green fluorescence) and propidium iodide (PI)

(red fluorescence). Briefly, 3 μL of the dye mixture was added into 1 mL of

non-illuminated control or LED-illuminated bacterial suspension exposed to

486 J/cm2. The mixture was incubated in the dark for 15 min at room

temperature. Five microliters of the suspension were placed on a slide and

covered with a square coverslip. Slides were immediately examined under oil

immersion in Olympus BX51 epifluorescent microscope (Melville, NY, USA)

31

equipped with an Olympus DP71 camera, an U-RFL-T mercury lamp and a set

of fluorochrome filters: SYTO®9 (WB, 450–480 nm) and PI (WG, 510–550

nm).

3.2.8 Comet assay

The alkaline version of the comet assay was performed with the

OxiSelect™ Comet Assay Kit (Cell Biolabs, San Diego, CA, USA) according

to the manufacturer’s instructions with a minor modification. A10-μL aliquot

of non-illuminated or LED-illuminated cell suspension for 7.5 h was mixed

with 90 μL of Comet Agarose, 5 μg/mL RNase A solution (Sigma-Aldrich),

0.25% N-lauroylsarcosine sodium salt solution (Sigma-Aldrich) and 0.5

mg/mL lysozyme (Sigma-Aldrich). The mixture (75 μL) was placed on Comet

slides and refrigerated for 15 min at 4 °C in the dark to solidify the agarose.

Slides were incubated at 37 °C for 20 min, followed by immersing in 1 × lysis

buffer (pH 10) for 1 h at 4 °C in the dark. Slides were then immersed in the

alkaline solution for 30 min at 4 °C in the dark and electrophoresed in alkaline

electrophoresis buffer for 20 min at 12 V and 100 mA. After single cell gel

electrophoresis, the slides were rinsed three times with distilled water for 2

min, dehydrated with cold 70% (v/v) ethanol for 10 min and air-dried. The

slides were stained by adding 100 μL of Vista Green DNA Dye per well and

visualized by an Olympus BX51 epifluorescent microscope equipped with an

Olympus DP71 camera, an U-RFL-T mercury lamp and a fluorochrome filter:

Vista Green DNA Dye (WB, 450–480 nm).

32

3.2.9 DNA ladder analysis

Genomic DNA from non-illuminated and LED-illuminated cells for 7.5

h was extracted and purified by GenElute™

Bacterial Genomic DNA Kit

(Sigma-Aldrich) according to manufacturer’s instructions. The purified DNA

was dissolved in 100 μL of Tris-EDTA (TE) buffer and treated with RNase.

Tris-acetate-EDTA (TAE; 40 mM Tris-acetate, 1 mM EDTA, pH 8.0) was

used as a buffer for electrophoresis. Two microliters of purified DNA extract

were solubilized in Tri-Color 6x DNA Loading Dye (1st BASE, Singapore)

and electrophoresed in 1% (w/v) agarose gel containing FloroSafe DNA Stain

(1st BASE, Singapore) at 100 V for the analysis of DNA fragmentation. The

gel was visualized with G:Box EF2 Fluorescence Imaging System (Syngene,

Frederick, MD, USA).

3.2.10 Statistical analysis

All experiments were performed in independent triplicate trials, with

duplicate sampling or plates (n=6). All data were expressed by mean ±

standard deviation and were analyzed using analysis of variance (ANOVA)

and least significant difference (LSD) to compare any significant difference

(P ≤ 0.05) using an IBM SPSS statistical software (version 20; SPSS Inc.,

IBM Co., Armonk, NY, USA).

3.3 Results

3.3.1 Changes in temperature during 405±5 nm LED illumination

To determine heat transfer from the LED to the cell suspension, the

temperature of the suspension was monitored for 300 min at 1-min intervals

33

during 405±5 nm LED illumination (data not shown). It was observed that the

temperature of the suspension increased by 6–7 °C during LED illumination

and remained constant until the end of measurement, when the set temperature

of incubator was 4 °C. Based on this observation, non-illuminated controls

were held at a temperature of 10 °C to compensate for the effect of the

elevated temperature during the illumination.

3.3.2 Antibacterial effect of 405±5 nm LED

In order to evaluate the antibacterial effect of 405±5 nm LED, E. coli

O157:H7, S. Typhimurium and S. sonnei were treated with 405±5 nm LED for

7.5 h up to a final dose of 486 J/cm2 at intensity of 18 mW/cm

2 (Figure 3–1).

Regardless of the bacterial strain, no significant (P > 0.05) change in the

number of non-illuminated cells was observed after 7.5 h at a temperature of

10 °C. Compared to the control cells, populations of E. coli O157:H7, S.

Typhimurium and S. sonnei were significantly (P ≤ 0.05) reduced by 1.0, 2.0,

and 0.8 log CFU/mL, respectively, at the end of 405±5 nm LED illumination.

The Weibull survival model was used to compare sensitivity of cells to

LED illumination with the reliable life (tR). The scale (α) parameter indicates

the mean of the distribution describing inactivation time (h) of the cell

population, whereas the parameter β determines the shape of Weibull

distribution and represents an effect on the predicted inactivation rate (Couvert

et al., 2005; Ferrario et al., 2013). A value of β > 1 indicates an increase in

accumulated damaging and killing rates of 405±5 nm LED with an increase

light dose (Couvert et al., 2005). On the other hand, when β < 1, higher rates

of inactivation occurs at lower light dose (McKenzie et al., 2013).

34

Figure 3-1 Inactivation of E. coli O157:H7 (a), S. Typhimurium (b) and S.

sonnei (c) during the illumination with 405±5 nm LED at 4 °C. Asterisk (*)

indicates significant (P ≤ 0.05) difference between LED-illuminated and non-

illuminated cell counts.

Among the three bacterial pathogens, S. Typhimurium had the lowest α value

upon exposure to LED, while values for E. coli O157:H7 and S. sonnei were

not significantly (P > 0.05) different (Table 3–1). The tR-values predicted by

the Weibull model were significantly (P ≤ 0.05) different for each pathogen

studied, achieving 10.36, 7.64 and 4.78 h for S. sonnei, E. coli O157:H7 and S.

Typhimurium respectively. These results indicate that S. Typhimurium was

the most sensitive pathogen to 405±5 nm LED illumination followed by E.

coli O157:H7 and S. sonnei. Results correspond with the highest inactivation

observed for S. Typhimurium in Figure 3–1.

(0) (97) (194) (292) (389) (486) Dose (J/cm2)

Time (h)

35

Table 3-1 Weibull model parameters1 for the inactivation of E. coli O157:H7, S. Typhimurium, and S. sonnei by 405±5 nm LED illumination.

Bacterial strain

α (h) β

tR (h) R2

95% confidence intervals

Average


Average Lower Upper Lower Upper

E. coli O157:H7 4.58±0.14b 4.36 4.98 1.68±0.34

a 0.83 2.52 7.64±0.48

b 0.98±0.07

S. Typhimurium 2.63±0.302a 1.89 3.36 1.39±0.12

a 1.09 1.70 4.78±0.32

a 1.00±0.01

S. sonnei 4.87±1.11b 2.11 7.62 1.11±0.19

a 0.63 1.59 10.36±1.10

c 0.99±0.03

1All measurements were done in triplicate with replication, and all values are means ± standard deviation. Different letters within the same

column are significantly (P ≤ 0.05) different.

36

3.3.3 Bacterial sensitivity to bile salts and NaCl by 405±5 nm LED

illumination

Changes in the bacterial sensitivity to bile salts and NaCl were used to

determine if cell membranes were damaged by LED illumination. The

percentage of cells sensitive to bile salts increased to approximately 60% for

E. coli 0157:H7 treated for 6 h, while the same degree of sensitivity for S.

Typhimurium and S. sonnei was achieved after 3 h illumination (Figure 3–2).

For NaCl, the maximum percentages were 87% for E. coli 0157:H7, 92% for

S. Typhimurium, and 99% for S. sonnei after LED illumination for 4.5–6 h.

Although there was no significant (P > 0.05) increase in sensitivity with

increased exposure time (Figure 3–3), LED-illuminated cells were

significantly (P ≤ 0.05) more sensitive to bile salts and NaCl than were non-

illuminated control cells regardless of the bacterial strain. These data

demonstrate that LED illumination resulted in malfunction of outer and

cytoplasmic membranes of cells.

3.3.4 Loss of cell membrane permeability by 405±5 nm LED illumination

LIVE/DEAD® BacLight

TM is dual nucleic acid staining method used to

evaluate cellular viability based on the changes in their membrane

permeability. Images are shown in Figure 3–4. Green fluorochrome SYTO®9

(480/500 nm) of low molecular weight (~10 Da) is able to penetrate both

intact and damaged cell membranes, whereas red fluorochrome PI (490/635

nm) of higher molecular weight (668 Da) can penetrate only damaged

membranes, displacing SYTO®9 with red fluorescence (Bleichert et al., 2014;

37

Figure 3-2 Changes in the sensitivity of E. coli O157:H7 (a), S. Typhimurium

(b) and S. sonnei (c) to 1% bile salts during 405±5 nm LED illumination.

Different letters (A-B or a-b) within the same bar indicate that the mean values

are significantly (P ≤ 0.05) different from each other. Asterisk (*) indicates

significant (P ≤ 0.05) difference between LED-illuminated and non-

illuminated cell counts.

*

(0) (97) (194) (292) (389) (486)

Time (h)

Dose (J/cm2)

*

* * *

* * *

* *

* * * *

38

Figure 3-3 Changes in sensitivity of E. coli O157:H7 (a), S. Typhimurium (b)

and S. sonnei (c) to NaCl (2% for S. sonnei, and 3% for E. coli O157:H7 and

S. Typhimurium) during 405±5 nm LED illumination.

* *

(0) (97) (194) (292) (389) (486)

Time (h)

Dose (J/cm2)

* *

*

* *

*

*

*

* * * *

*

39

Figure 3-4 The microscopic images of E. coli O157:H7 (a), S. Typhimurium

(b) and S. sonnei (c) cells stained with LIVE/DEAD® BacLight

TM before and

after LED illumination at the dose of 486 J/cm2.

Joux and Lebaron, 2000; Lecombe et al., 2013). In this study, non-illuminated

cells showed green fluorescence of SYTO®9 stain, indicating that they

maintained intact cell membranes over the exposure time (7.5 h) at 10 °C. On

the other hand, some LED-illuminated cells revealed red fluorescence,

indicating that these cells underwent a loss in the physical membrane integrity

due to exposure to 405±5 nm LED treatment.

40

3.3.5 Effect of 405±5 nm LED illumination on DNA damage

Comet assay was performed to determine if ROS produced by 405±5

nm LED illumination causes DNA degradation by rupturing the

phosphodiester bonds in its primary structure of base sequence. As shown in

Figure 3–5, regardless of the bacterial strain, no tails (comets) were observed

in LED-illuminated and non-illuminated cells, indicating that LED treatment

did not cause DNA fragmentation. All photomicrographs of single cell

electrophoresis showed clear zones of the nucleoid without the presence of

DNA tailing. In parallel, DNA ladder analysis was performed in order to

confirm the results obtained with the comet assay. There was only one band

present in all profiles (1–9) of agarose gel electropherograms, indicating no

differences in the total genomic DNA among healthy, non-illuminated and

LED-illuminated cells (Figure 3–6). No shorter DNA fragments were

observed in the gel in the DNA ladder profile, and migration of bands was


LED-illuminated E. coli O157:H7 (a), S. Typhimurium (b) and S. sonnei (c) at

the dose of 486 J/cm2.

41

similar for all samples. These results indicate that 405±5 nm LED illumination

did not induce DNA fragmentation.


healthy, non-illuminated and LED-illuminated cells at the dose of 486 J/cm2.

Lane: 1, healthy S. Typhimurium; 2, S. Typhimurium without LED

illumination for 7.5 h; 3, LED-illuminated S. Typhimurium for 7.5 h; 4,

healthy E. coli O157:H7; 5, E. coli O157:H7 without LED illumination for 7.5

h; 6, LED-illuminated E. coli O157:H7 for 7.5 h; 7, healthy S. sonnei; 8, S.

sonnei without LED illumination for 7.5 h; 9, LED-illuminated S. sonnei for

7.5 h.

3.4 Discussion

The present study investigated cell membrane and DNA damage to

provide insights into the antibacterial mechanism of 405±5 nm LED and

evaluated the effectiveness of 405±5 nm LED in inactivating major Gram-

negative foodborne pathogens to determine if the LED technology has

potential for food preservation applications.

The antibacterial efficacy of 405±5 nm LED was evaluated at a set

temperature of 4 °C, which simulated refrigeration conditions. A previous

study has shown that the antibacterial effect of 460 nm LED was enhanced at

lower temperature, having two to three times more observed lethality at 10 °C

than 15 °C, while no antibacterial activity at 20 °C (Ghate et al., 2013).

Approximately 0.5–1 mL of bacterial suspension was evaporated due to the

42

temperature increase during the LED illumination for 7.5 h. In addition, the

depth of bacterial suspensions was reduced by 0.2 cm by taking samples (0.5

mL/1.5 h). However, these changes were negligible compared to the total

sample volume (10 mL) and depth (1.2 cm), and thus not thought to influence

inactivation of test pathogens.

Results show that 405±5 nm LED illumination inactivated 0.8–2 log

CFU/mL of E. coli O157:H7, S. Typhimurium, and S. sonnei during storage at

a set temperature of 4 °C for 7.5 h (a total dose of 486 J/cm2). A comparison

of inactivation rates revealed that S. Typhimurium was the most susceptible to

LED illumination, followed by E. coli O157:H7 and S. sonnei. A possible

explanation for the different sensitivities to LED treatment could be due to

variations in the amounts and the types of endogenous porphyrin compounds

present in bacterial cells, which play a major role in photodynamic

inactivation (PDI) (Kumar et al., 2015). The study conducted by Hamblin et

al. (2005) showed that Propionibacterium acnes and Helicobacter pylori

produce and accumulate porphyrins inside the cells, which might make them

more susceptible to visible light. Nitzan et al. (2004) suggested that different

types of porphyrin compounds might contribute to differences in bacterial

inactivation rates when cells are exposed to 405 nm blue light. This might be

also due to the differences in repair mechanisms of cells under the oxidative

stress (Demidova and Hamblin, 2004).

Contrary to observation in the present study, Endarko et al. (2012)

reported that 405 nm LED inactivated E. coli O157:H7 by 4.5 log and S.

sonnei by 3.9 log at a total dose of 554.7 J/cm2 (for 1.8 h at the irradiance of

85.6 mW/cm2). Another study carried by Murdoch et al. (2012) with 405 nm

43

LED at the irradiance of 10 mW/cm2 demonstrated that 5-log reductions of S.

sonnei and E. coli O157:H7 were achieved at 180 and 288 J/cm2 (5 and 8 h),

respectively. These differences in the effectiveness of 405 nm LED

illumination might be due to the different experimental designs such as the

distance between LED and bacterial suspension, total volume and depth of

bacterial suspension, initial population and set temperature (Endarko et al.,

2012; Murdoch et al., 2010). In particular, previous studies used a magnetic

stirring plate to agitate bacterial suspension during illumination, probably

maximizing its antibacterial effect (Endarko et al., 2012; Murdoch et al.,

2010). To simulate a food matrix, bacterial suspensions were not agitated

during illumination in the present study. Moreover, it seems that the

antibacterial efficacy of 405 nm LED might be strain-dependent. For example,

a 2-log reduction of S. Typhimurium was achieved at a total dose of 486 J/cm2

in this study, whereas in the study conducted by Endarko et al. (2012) the

population of S. Enteritidis was reduced by 1.4 log at a total dose of 739 J/cm2,

while the number of S. Enteritidis decreased by 3–5 log at 288 J/cm2

in a study

carried out by Murdoch et al. (2010).

Bacterial sensitivity to bile salts and NaCl was studied to determine if

LED illumination causes damage to outer and cytoplasmic cell membranes.

Results showed that 405±5 nm LED illumination significantly enhanced the

cell sensitivity to bile salts and NaCl compared to non-illuminated control

cells. It is known that Gram-negative bacteria have a lipopolysaccharide (LPS)

in the outer membrane, which provides a permeability barrier to hydrophobic

molecules such as bile salts in the external environment. Moreover, the

cytoplasmic membrane is responsible for the regulation of osmotic pressure

44

(Ait-Ouazzou et al., 2012; Jasson et al., 2007; Somolinos et al., 2008). Thus,

these results indicate that both outer and cytoplasmic membranes of bacteria

might become damaged and suffer loss of their functionality during 405±5 nm

LED illumination. Similarly, Ait-Ouazzou et al. (2012) reported that the

combined treatment of heat and acid makes E. coli cells more sensitive to bile

salts and NaCl. Outer and cytoplasmic membranes were sublethally injured by

the treatment.

A loss of cell membrane integrity due to LED illumination was

observed by LIVE/DEAD® BacLight

TM assay as evidenced by some of the

LED-illuminated cells showing red fluorescence. Significant damage of cell

membranes may result in loss of physiological functions such as permeability

barrier, membrane potential, and efflux pump activity. However, this study

directly indicates that that LED illumination altered the permeability of cell

membranes, since PI (red fluorescence) with high molecular weight can only

enter into cells with loss of membrane function as a permeability barrier

(Bleichert et al., 2014; Joux and Lebaron, 2000; Lacombe et al., 2013). A

similar observation on cytoplasmic membrane damage was observed in E. coli

cells exposed to the oxidizing effects of copper alloy, UV light, and TiO2 due

to lipid peroxidation (Hong et al., 2012). Thus, free radicals generated by

405±5 nm LED illumination could physically or chemically damage the

components of the bacterial membrane (Lukšiene, 2003).

Genomic DNA is also one of the major targets of ROS generated from

oxidization, UV light and ionizing radiation. The ROS can attack both the

sugar moieties and the base, causing DNA breakage, formation of oxidized

base derivatives such as 8-OHdG (8-hydroxy-deoxyguanosine) and cross-

45

linking of DNA–protein (Nitzan and Ashkenazi, 2001; Prasad et al., 2013).

The superoxide anion (O2-) can bind to DNA and hydrogen peroxide (H2O2)

directly oxidizes free ferrous iron, forming the hydroxyl radical (OH∙) as a

strong oxidant that attacks adjacent DNA (Henle et al., 1999; Keyer and

Imlay, 1996; Park and Imlay, 2003). The damaged DNA may also result in

DNA breakage by oxidative destruction of deoxyribose residues or replication

forks (Kumari et al., 2008). Thus, it was hypothesized that bacterial DNA can

fragment by the attack of ROS generated during LED illumination. To test this

hypothesis, the comet assay and DNA ladder analysis were carried out. The

comet assay is a simple and fast technique for assessment of DNA damage in

all cell types and it is used to detect the breakage of single- or double-stranded

DNA. Single cell electrophoresis results in a microscopic image, showing a

clear head composed of intact DNA within the nucleoid and a tail consisting

of broken or damaged DNA (comet). The comet assay is based on

quantification of DNA strand fragmentation migrating out of the nucleoid of

individual cells during electrophoresis under alkaline conditions (Liao et al.,

2009).

In the present study, no DNA tailing and no difference in total genomic

DNAs were observed, indicating that bacterial DNA was not fragmented by

ROS. Probably, the concentration of ROS generated during LED illumination

was not high enough to break down bacterial DNA. Thus, the low

concentration of ROS might only oxidize DNA and other intracellular

components such as proteins and lipids (Imlay, 2008). Sies and Menck (1992)

reported that 8-OHdG, an oxidized base derivative, was formed as a product of

deoxyguanosine oxidation by methylene blue plus light illumination. This

46

might be due to the fact that guanine residues have been reported to be most

easily oxidized (Hamblin and Hasan, 2004). Similar to the present results,

Nitzan and Ashkenazi (2001) reported that no DNA breakage in E. coli and

Acinetobacter baumannii was observed by visible light of various wavelengths

(400–450, 480–550, and 600–700 nm) with the addition of a photosensitizer,

whereas cytoplasmic membrane damage was observed.

Illumination with 405±5 nm LED gave only 1 – 2 log reductions in an

aqueous system in this study, but effectiveness may be less if pathogens on

foods. In addition, long-term exposure of bacteria to LED was required for

significant changes in populations, and thus this technology may be applicable

to the storage conditions during displaying foods. However, it would be still

worthy to evaluate the bacteriostatic effect of the LED for food industry

applications because LED technology can easily be applied to the food

showcase by replacing the fluorescent lights and saving energy. For its

application for food preservation, further research on the effect of LED on

physiochemical and sensory quality of foods is also necessary.

3.5 Conclusions

This study investigated the antibacterial effect and mechanism of 405±5

nm LED on E. coli O157:H7, S. Typhimurium and S. sonnei. Results show

that 405±5 nm LED illumination inactivated 0.8–2.0 log CFU/mL of the

pathogens under refrigerated conditions. Among test strains, S. Typhimurium

was the most sensitive to 405±5 nm LED illumination. In addition, LED

illumination increased cell sensitivity to bile salts and NaCl. Loss of

membrane integrity upon exposure to LED illumination was confirmed,

47

whereas no DNA fragmentation was observed. Thus, inactivation of three test

pathogens by 405±5 nm LED illumination might be partly due to physical

damage of membranes. This study also indicates that 405±5 nm LED

illumination under refrigerated conditions may be a useful technology to

control foodborne pathogens in foods during storage.

48

Chapter 4

Antibacterial effect and mechanism of high intensity 405±5 nm

LED on Bacillus cereus, Listeria monocytogenes, and

Staphylococcus aureus under refrigeration

4.1 Introduction

In the EU, a total of 55,453 confirmed cases of infection, 5,118

hospitalizations, and 41 deaths were caused by foodborne outbreaks in 2012

(EFSA, 2014). The CDC reported that 48 million Americans get sick every

year due to foodborne illnesses caused by pathogenic microorganisms. Among

31 known pathogens, S. aureus and Listeria monocytogenes are among the top

five pathogens responsible for foodborne illnesses and deaths, respectively, in

the US (CDC, 2011).

Chapter 3 demonstrated the antibacterial effect of 405±5 nm LED

illumination on Gram-negative E. coli O157:H7, S. Typhimurium, and S.

sonnei. Although previous studies have shown the antibacterial effect of LEDs

between 405–420 nm on inactivation of B. cereus, L, monocytogenes, and S.

aureus in combination with δ-ALA as an exogenous photosensitizer (Nitzan et

al., 2004; Vaitonis and Lukšiene, 2010), little research has been reported on its

effect on Gram-positive pathogens without the addition of an exogenous

photosensitizer, which might be applicable and reflect real food storage

49

conditions. Moreover, it is necessary to elucidate which cellular components

are directly affected by ROS for a better understanding of its antibacterial

mechanism. Thus, the objective of this study was to examine the antibacterial

effect of 405±5 nm LED on B. cereus, L monocytogenes, and S. aureus

without the addition of an exogenous photosensitizer and to elucidate its

antibacterial mechanism by determining membrane and DNA damage.



B. cereus (ATCC 14579), L. monocytogenes (BAA-679), and S. aureus

(ATCC 6538) were obtained from the ATCC and stored at -70 °C. The culture

conditions are as described in Chapter 3.2.1.

4.2.2 LED source

LED source is described in Chapter 3.2.2.


LED illumination system is described in Chapter 3.2.3.

4.2.4 Bacterial inactivation by 405±5 nm illumination

The detailed procedures for bacterial inactivation are described in

Chapter 3.2.4.

4.2.5 Weibull model for bacterial inactivation kinetics

The modified Weibull model is described in Chapter 3.2.5.

50

4.2.6 Bacterial sensitivity to NaCl by LED illumination

In order to determine the damage of cytoplasmic membranes of cells

caused by LED illumination, sensitivity to NaCl was demonstrated by

comparing differences in the counts (CFU/mL) of pathogens grown on TSA

(non-selective agar) and TSA supplemented with NaCl as selective agar. Non-

illuminated and LED-illuminated cells were plated onto TSA with 4% (w/v)

NaCl for B. cereus and L. monocytogenes or 7% (w/v) NaCl for S. aureus. The

percentage of sensitive cells was calculated as described in Chapter 3.2.6.

4.2.7 Determination of bacterial membrane integrity

The membrane integrity of non-illuminated and LED-illuminated cells

was determined using the LIVE/DEAD® BacLight Viability. The detailed

procedures are described in Chapter 3.2.7.

4.2.8 Determination of DNA degradation

After LED illumination, bacterial DNA degradation was determined

using the OxiSelect™ Comet Assay Kit as described in Chapter 3.2.8.

For DNA ladder analysis, genomic DNA prepared from non-illuminated

cells and LED-illuminated cells treated at a total dose of 486 J/cm2 was

extracted and purified using GenElute™

Bacterial Genomic DNA Kit as

described in Chapter 3.2.9.


Statistical analysis is described in Chapter 3.2.10.

51

4.3 Results

Changes in temperature of cell suspensions were monitored during

LED illumination to design a control experiment. The temperature of

suspensions rapidly increased to 9–10 °C within 1 h of illumination at a set

temperature of 4 °C (data not shown). Thus, non-illuminated control

experiments were carried out at a temperature of 10 °C to eliminate

temperature at an effect on the inactivation by the 405±5 nm LED illumination.

To evaluate the antibacterial effect of 405±5 nm LED, three Gram-

positive foodborne pathogens were exposed to 405±5 nm LED for 7.5 h until

486 J/cm2 at a set temperature of 4 °C. Illumination resulted in 1.9-, 2.1-, and

0.9-log reductions for B. cereus, L. monocytogenes and S. aureus,

respectively, at a total dose of 486 J/cm2

(Figure 4–1). On the other hand, no

significant (P > 0.05) inactivation was observed for non-illuminated cells held

for 7.5 h at 10 °C, regardless of test pathogen.

The sensitivity of pathogens to LED illumination was compared using

reliable life (tR), analogues to D-value, calculated with a modified Weibull

model based on the α and β parameters (Table 4–1). The α value (scale

parameter) corresponds to the mean of distribution, explaining inactivation

times (h) of microbial populations, and is generally considered as measure of

the bacterial resistance to LED illumination with exposure time, while

coefficient β determines the shape of Weibull distribution, indicating the

influence on predicted death rate (Bialka et al., 2008; Unluturk et al., 2010;

van Boekel, 2002). Among the bacterial strains tested, the α value of L.

52

Figure 4-1 Antibacterial effect of B. cereus (a), L. monocytogenes (b) and S.

aureus (c) during the illumination with 405 nm LED at a set temperature of 4

°C. Asterisk (*) indicates significant (P ≤ 0.05) differences between LED-

illuminated and non-illuminated cell counts.

*

*

*

*

0

1

2

0 1.5 3 4.5 6 7.5

Red

uc

tio

n (

log

CF

U/m

L)

(a)

Control 405 nm

* *

*

0

1

2

0 1.5 3 4.5 6 7.5

Re

du

cti

on

(lo

g C

FU

/mL

)

(b)

Control 405 nm

* *

*

0

1

2

0 1.5 3 4.5 6 7.5

Re

du

cti

on

(lo

g C

FU

/mL

)

(c)

Control 405 nm

(0) (97) (194) (292) (389) (486)

Time (h)

Dose (J/cm2)

53

monocytogenes was two times less than those of B. cereus and S. aureus. The

result corresponds with the highest inactivation observed for L.

monocytogenes in Figure 4–1. The β value of L. monocytogenes was nearby 1,

which means that the rate of inactivation was not dependent on the light dose

(Table 4–1). The β values of B. cereus and S. aureus were larger than 1,

indicating higher accumulated damage and kill rates of the LED illumination

to the cells with an increase in light dose (Couvert et al., 2005). If β < 1, high

inactivation rate would be observed at lower light dose; however, inactivation

rates would gradually decrease with increasing light dose (McKenzie et al.,

2013). However, when the β coefficient is not equal to 1, both α and β

parameters are necessary to assess the sensitivity of cells to 405±5 nm LED

illumination, and thus tR values based on these two parameters were

calculated. The tR values of the three pathogens were significantly (P ≤ 0.05)

different, revealing that L. monocytogenes was identified as the most

susceptible pathogen to the 405±5 nm LED illumination, followed by B.

cereus and S. aureus.

Changes in cell sensitivity to NaCl were evaluated to determine if LED

illumination causes damage to the cytoplasmic membrane of cells. Results

showed that the percentage of cells sensitive to NaCl reached more than 90%

after 3 h for B. cereus and L. monocytogenes and after 4.5 h for S. aureus

(Figure 4–2). The maximum percentages were 98.2% for B. cereus, 92.3% for

L. monocytogenes, and 99.6% for S. aureus after exposure to 405±5 nm LED

for 6–7.5 h. However, no significant (P > 0.05) increase in bacterial sensitivity

54

Table 4-1 Weibull model parameters1 for the inactivation of B. cereus, L. monocytogenes, and S. aureus by 405 nm LED illumination.

Bacterial strain

α (h) β

tR (h) R2


Average


Average Lower Upper Lower Upper

B. cereus 3.35 ± 0.05b 3.22 3.48 1.75 ± 0.13

b 1.52 2.14 5.30 ± 0.11

b 0.99±0.02

L. monocytogenes 1.49 ± 0.37a 0.57 2.41 0.95 ± 0.12

a 0.66 1.24 3.57 ± 0.56

a 1.00±0.01

S. aureus 3.63 ± 0.29b 2.91 4.36 1.11 ± 0.12

a 0.81 1.42 7.72 ± 0.05

c 1.00±0.01

1All measurements were done in triplicate with replication, and all values are means ± standard deviation. Different letters within the same

column indicate significant (P ≤ 0.05) difference.

55

to NaCl was observed in LED-illuminated cells with an increase in exposure

time.

To obtain concrete evidence that cellular membrane damage occurred

cell membrane permeability of B. cereus, L. monocytogenes, and S. aureus

was examined using the LIVE/DEAD® BacLight

TM assay. LIVE/DEAD

staining by SYTO®9 and propidium iodide (PI) bound to nucleic acid

distinguishes between damaged and intact bacterial membranes. Green

fluorescing SYTO®9 (485/500 nm) penetrates the cytoplasmic membranes of

both intact and damaged cells due to low molecular weight (~10 Da), while

red fluorescing PI (490/635 nm) of higher molecular weight (668 Da) is only

able to permeate the damaged cytoplasmic membranes, resulting in a

reduction in the intensity of SYTO®9 when two stains coexist within the cell

(Bleichert et al., 2014; Joux and Lebaron, 2000; Lacombe et al., 2013). In this

study, healthy and non-illuminated cells held at 10 °C for 7.5 h revealed green

fluorescent signal of SYTO®9, whereas some LED-illuminated cells showed

red fluorescence (Figure 4–3).

Cellular DNA damage was examined to determine if ROS produced

during LED illumination attack DNA. The comet assay, also called single-cell

gel electrophoresis (SCGE), is a simple and fast technique to detect damage

such as single- or double-strand breakage in DNA at the individual cell level.

The fragments of DNA migrate during electrophoresis and can be visualized

by fluorescent microscopy. Microscopic images in the comet assay show a

56

Figure 4-2 Percentage of the sensitive B. cereus (a), L. monocytogenes (b) and

S. aureus (c) cells to NaCl (4% for B. cereus and L. monocytogenes, and 7%

for S. aureus) during 405 nm LED illumination. Different letters within the

same curve indicate that mean values are significantly (P ≤ 0.05) different

from each other.

A A

A A

A

aA

b b b b b

0

20

40

60

80

100

0 1.5 3 4.5 6 7.5

Se

nsit

ivit

y (

%)

(a) Control 405 nm

A A

A A A

aA

b

c c c c

0

20

40

60

80

100

0 1.5 3 4.5 6 7.5

Se

nsit

ivit

y (

%)

(b) Control 405 nm

A

A

A A

A

aA

b

c

c c c

0

20

40

60

80

100

0 1.5 3 4.5 6 7.5

Se

nsit

ivit

y (

%)

(c) Control 405 nm

(0) (97) (194) (292) (389) (486)

Time (h)

Dose (J/cm2)

57

Figure 4-3 Epifluorescent micrographs of B. cereus (a), L. monocytogenes (b)

and S. aureus (c) cells stained with LIVE/DEAD® BacLight

TM before and after

LED illumination at a dose of 486 J/cm2.

comet with a clear head composed of intact DNA and a tail including

degraded fragments of DNA strands (Liao et al., 2009). In this study, only

clear heads were observed in non-illuminated cells and LED-illuminated cells

without the presence of tails, regardless of test pathogen (Figure 4–4).

To confirm the results obtained from the comet assay, DNA ladder

analysis was also carried out. Regardless of test pathogen, only one band was

observed in all the DNA ladder profiles (Lanes 1–9) of healthy, non-

illuminated, and LED-illuminated cells (Figure 4–5). Moreover, there was no

58

difference in total genomic DNA among healthy, non-illuminated, and LED-

illuminated cells.


LED-illuminated B. cereus (a), L. monocytogenes (b) and S. aureus (c) at a

dose of 486 J/cm2.


healthy, non-illuminated and LED-illuminated cells at a total dose of 486

J/cm2. Lane: 1, healthy S. aureus; 2, S. aureus without LED illumination for

7.5 h; 3, LED-illuminated S. aureus for 7.5 h; 4, healthy L. monocytogenes; 5,

L. monocytogenes without LED illumination for 7.5 h; 6, LED-illuminated L.

monocytogenes for 7.5 h; 7, healthy B. cereus; 8, B. cereus without LED

illumination for 7.5 h; 9, LED-illuminated B. cereus for 7.5 h.

59

4.4 Discussion

The study conducted in Chapter 3 has demonstrated the antibacterial

effect of 405±5 nm LED against Gram-negative pathogens, E. coli O157:H7, S.

Typhimurium, and S. sonnei. To evaluate the efficacy of LED illumination on

Gram-positive pathogens, B. cereus, L. monocytogenes, and S. aureus, were

illuminated with 405±5 nm LED in the absence of a photosensitizer at a set

temperature of 4 °C. The refrigeration temperature was chosen in this study to

simulate storage conditions for RTE foods. Another reason is that the

antibacterial effect of blue LED is enhanced at lower temperatures rather than

at ambient temperature (Ghate et al., 2013).

Results showed that the populations of three Gram-positive bacteria

were reduced by 0.9 – 2.1 log CFU/mL at the end of LED illumination. S.

aureus was found to be the most resistant strain to 405±5 nm LED

illumination among the test pathogens. Differences in sensitivity to LED

illumination might be due to the differences in repair systems and defense

mechanisms caused by oxidative stress (Hamblin and Hasan, 2004) as well as

to variations in types and the amounts of endogenous porphyrin compounds

generated in cells (Kumar et al., 2015; Nitzan et al., 2004). For example,

Nitzan et al. (2004) reported that two Staphylococcus strains produced higher

amounts of coproporphyrin than did B. cereus after exposure to blue light

(407–420 nm), which caused high level of inactivation of both.

Unlike observation in the present study, Maclean et al. (2009) showed

that S. aureus was inactivated at the highest level of about 5-logs during the

405 nm LED illumination at a total dose of 36 J/cm2. Another study performed

by Endarko et al. (2012) reported that 5-log reduction of L. monocytogenes

60

was achieved by 405 nm LED illumination at a dose of 185 J/cm2. Such a

large difference in the effectiveness of the 405 nm LED illumination might be

due to difference in design of experiments such as initial population, depth and

total volume of cell suspension, the distance between LED and the suspension,

and treatment temperature (Endarko et al., 2012; Murdoch et al., 2010). For

example, the experimental design of Endarko et al. (2012) was done using a 2-

mL volume of cell suspension (7 mm depth) with an initial population of 105

CFU/mL and a 2-cm distance between the suspension and LED as well as a

stirring bar to agitate the suspension, which probably maximized its

bactericidal effect. However, in this study the LED illumination system was

designed to simulate realistic food storage conditions under refrigeration.

Therefore, higher volume and distance as well as no stirring were applied to

avoid agitation of the cell suspension under the LED illumination.

Bacterial sensitivity to NaCl was examined to determine damage to

cellular cytoplasmic membrane by LED illumination. In theory, cells with

membrane damage would be incapable of recovering on media containing

sublethal concentration of NaCl due to a loss of osmotic functionality (Ait-

Ouazzou et al., 2012; Somolinos et al., 2008). Results demonstrated that

changes in cell sensitivity to NaCl was significantly observed after LED

illumination compared to non-illuminated control cells, regardless of the test

pathogen. This raises the possibility of damage in cellular membrane by the

405±5 nm LED illumination since cells become more sensitive than the non-

illuminated control cells to NaCl. Similarly, Ghate et al. (2013; 2015a)

reported that L. monocytogenes and S. aureus in TSB were sensitive to NaCl

61

after treatment with 461 and 521 nm LEDs under the different illumination

temperature and pH conditions.

To get a better understanding of cellular membrane damage by LED

illumination, loss of cellular membrane integrity was examined using

LIVE/DEAD® BacLight

TM assay. Results show that some of LED-illuminated

cells lost their membrane integrity, whereas no noticeable damage was

observed in non-illuminated cells. It is known that there are several

mechanisms affecting loss of membrane integrity due to the physical functions

such as permeability barrier, enzyme activity, membrane potential, and pump

activity (Joux and Lebaron). However, the present results strongly suggest that

the alteration of membrane permeability by 405±5 nm LED illumination might

be the main reason for loss of membrane integrity due to the fact that only PI

is capable of entering inside the cells with loss of a permeability barrier (Joux

and Lebaron). Cellular membrane damage by the LED illumination may be

associated with membrane lipids which are one of major targets of ROS under

oxidative stress conditions. ROS generated by the LED illumination may

interact directly with unsaturated fatty acids in membranes and cause lipid

peroxidation, resulting in decreased fluidity and then changing membrane

components as well as disrupting membrane bound proteins (Cabiscol,

Tamarit, and Ros, 2000). Similar results were also obtained by Bleicher et al.

(2014) who reported that cytoplasmic membrane damage in Yersinia pestis

and Burkholderia strains was caused by metallic copper surfaces due to

oxidative damage.

Similar to changes in cell membranes, genomic DNA is also a crucial

target of ROS produced under the oxidative stress conditions such as ionizing

62

radiation and UV light (Imlay, 2008; Kumari et al., 2008). ROS are known to

cause DNA damage by attacking guanine bases and forming oxidized

derivatives, such as 8-hydroxy-deoxyguanosine (8-OHdG) (Nitzan and

Ashkenazi, 2001). Therefore, the comet assay and DNA ladder analysis were

carried out to determine if DNA degradation by ROS generated from the LED

illumination occurs. Results demonstrated that no noticeable damage to DNA

was observed in non-illuminated and LED-illuminated cells, suggesting that

405±5 nm LED illumination might not cause bacterial DNA breakage. Most

likely, the amounts of ROS generated by the LED illumination are not

sufficient to break down DNA strands. ROS could feasibly target and oxidize

other cellular components such as lipids or proteins. Similarly, the study

conducted by Nitzan and Ashkenazi (2001) demonstrated that visible light

(400–450, 480–550, and 600–700 nm) in the presence of an exogenous

photosensitizer resulted in cytoplasmic membrane damage in A. baumannii

and E. coli, while the DNA was still intact.

4.5 Conclusions

This is the first report on the antibacterial effect and mechanism of

405±5 nm LED on major Gram-positive foodborne pathogens held at

refrigeration temperature. The present results demonstrate that the 405±5 nm

LED illumination reduces population of B. cereus, L. monocytogenes and S.

aureus. L. monocytogenes was the most sensitive pathogen to the LED

illumination. Sensitivity to NaCl was enhanced and loss of membrane

permeability was occurred, while DNA breakage was not observed after LED

illumination. These findings suggest antibacterial effect of 405±5 nm LED on

63

these Gram-positive pathogens is due to physical damage to cellular

membranes rather than DNA. This study also proposes that 405±5 nm LED in

combination with refrigeration is a promising technology for eliminating

pathogens on foods during storage.

64

Chapter 5

405 ±5 nm LED illumination causes photodynamic inactivation

of Salmonella on fresh-cut papaya without deterioration

5.1 Introduction

Papaya is one of the most popular fresh-cut fruit products worldwide,

especially in Southeast Asia, due to its large size and high nutrient contents,

but it perishes easily after harvest and during storage. Fresh-cut papayas have

been linked to Salmonella outbreaks in Australia (2006) (Gibbs et al., 2009)

and Singapore (1996) (Ooi et al., 1997). In the former case, papaya was

washed using river water prior to sale, resulting in contamination with

Salmonella (Gibbs et al., 2009). A total of 106 confirmed cases of S. Agona

infection have been linked to whole and fresh imported papayas have been

reported from 25 states of the US (Raybaudi-Massilia et al., 2013; CDC,

2011). Thus, implementation of proper preservation technologies in the fresh

fruit supply chain is necessary to minimize the risk of salmonellosis.

A LED technology has recently received attention in the field of food

microbiology due to its antibacterial effect on foodborne pathogens. For

example, the antibacterial effect of 400 nm LED has been reported to be

effective against L. monocytogenes and S. Typhimurium in buffered solution

containing exogenous photosensitizers, chlorophyllin or 5-ALA (Luksienė et

65

al., 2013). In previous studies, 405 and 461 nm LEDs without photosensitizers

have demonstrated antibacterial activity against various foodborne pathogens

in PBS and TSB, resulting in 1–5 log reductions after LED illumination for

7.5 h (see Chapters 3 and 4; Ghate et al., 2013; Kumar et al., 2015).

To the best of my knowledge, studies have not been conducted to

explore the effectiveness of 405±5 nm LED on the inhibition of bacterial

growth on fresh-cut fruits without exogenous photosensitizers. The objective

of this study was to assess the potential of 405±5 nm LED for inhibiting or

killing Salmonella on fresh-cut papaya stored at different storage

temperatures. The physicochemical and nutritional qualities of illuminated

fruits were also analyzed to determine if long-term exposure of fruits to LED

illumination influences food quality. Lastly, the extent of oxidative damage to

cell membranes and DNA was investigated to better understand the

antibacterial mechanism of LED illumination.



Four Salmonella enterica serovars were used in this study: S. Agona

(BAA-707) (SA), S. Newport (ATCC 6962) (SN), S. Saintpaul (ATCC 9712)

(SS), and S. Typhimurium (ATCC 14028) (ST). All serovars were purchased

from the ATCC. Frozen stock cultures stored at -70 °C were revived in 10 mL

of sterile TSB at 37 °C for 24 h. All Salmonella cultures were adapted to 200

μg/mL of nalidixic acid (Sigma-Aldrich) by successive culturing with

incremental increases in concentrations of nalidixic acid in 10 mL of TSB to

enable enumeration of Salmonella free from background microbiota in fresh-

66

cut papaya. The working cultures in the stationary phase were prepared by

incubation in 10 mL of TSB supplemented with 200 μg/mL of nalidixic acid at

37 °C for 18–24 h, with two consecutive transfers.

5.2.2 LED source and illumination system

Detailed information for the LED source and illumination system is

presented as described in Chapters 3.2.2 and 3.2.3, respectively. To illuminate

papaya, two fresh-cut fruit samples in a sterile Petri dish (60 mm diameter)

were placed directly below the LEDs at a distance of 4.5 cm. The irradiance of

405±5 nm LED on the fruit surface was 10±1 mW/cm2, which was measured

by a Compact Power and Energy Meter Console (PM100D; Thorlabs GmbH,

Dachau, Germany). To determine the antibacterial properties of the LED,

suspensions of Salmonella in a sterile Petri dish (35 mm diameter) were placed

directly below the LED at a distance of 2.3 cm. Irradiance was 35±3 mW/cm2

at the surface of suspensions.

5.2.3 Preparation of fresh-cut papaya

Fresh papayas (Carica papaya) were purchased from a local

supermarket in Singapore. Papayas were washed with tap water, surface-

sterilized with 30% (v/v) commercial bleach (0.9±0.05% (v/w) sodium

hypochlorite) for 30 min, rinsed three times with sterile deionized water, and

dried with Kimwipes (Kimtech Science, Kimberly Clark Professional,

Roswell, GA, USA). The dried papayas were peeled aseptically and cut into

approximately 10-g slices in a semicircle shape (60 mm diameter) in a

biosafety cabinet.

67

5.2.4 Inoculation on fresh-cut papaya

One mL of each Salmonella serovar adapted to nalidixic acid was

centrifuged at 6,000 × g for 10 min at 4 °C and washed twice with 1 mL of

sterilized PBS. Cells in the resultant pellet were resuspended in 1 mL of PBS

and diluted to approximately 105 CFU/mL in PBS. A 10-µL aliquot of the

diluted suspension was spot-inoculated at 10 sites on the fruit surface to reach

a final concentration of approximately 103 CFU/cm

2, and the inoculated fruits

were dried for 30 min in a biosafety cabinet. Then, the fruits were individually

packed with cling wrap to simulate packaging conditions of cut fruit in retail

stores.

5.2.5 LED illumination on fresh-cut papaya

The inoculated cut papayas were placed directly into the LED system as

previously described, and illuminated by 405±5 nm LED at set temperatures

of 4, 10, or 20 °C, for 24–48 h (a total dose of 0.9–1.7 kJ/cm2) in a

temperature controlled incubator. A non-illuminated control sample was also

placed in an incubator under dark conditions. For duplicate samples, two fruits

were illuminated simultaneously.

Illuminated and non-illuminated fruits were taken at selected time

intervals, immediately transferred into sterile stomacher bags containing 90

mL of 0.1% (v/w) peptone water, and homogenized for 2 min using a paddle

blender (Silver Masticator, IUL Instruments GmbH, Königswinter, Germany).

The homogenized samples were serially diluted in 0.1% peptone water if

necessary, and samples were plated onto TSA supplemented with 200 μg/mL

68

of nalidixic acid, followed by incubation at 37 °C for 24–48 h. The number of

colonies was enumerated manually with a colony counter (Rocker Scientific

Co. Ltd., Taipei, Taiwan) and reported in log CFU/cm2.

5.2.6 Analysis of cellular lipid peroxidation

A thiobarbituric acid reaction substance (TBARS) assay was performed

to analyze oxidative damage by 405±5 nm LED illumination to membrane

lipids in S. Agona and S. Typhimurium chosen as models. Malondialdehyde

(MDA) is produced naturally by lipid peroxidation and is a reliable indicator

of lipid peroxidation (Joshi et al., 2011).

Fifty milliliters of stationary phase Salmonella culture in TSB were

centrifuged at 8,000 × g for 10 min at 4 °C and washed twice with 5 mL of

PBS. Cells in the resultant pellet were resuspended in 2 mL of PBS to provide

a final population of approximately 1011

CFU/mL to enable determination of

cellular lipid peroxidation (Carré et al., 2014). Two milliliters of suspension

were illuminated to 405±5 nm at a set temperature of 4 °C for 7 h (a total dose

of 0.9 kJ/cm2) in the incubator. A bacterial suspension incubated for 7 h

without LED illumination served as non-illuminated control.

To quantify lipid peroxidation, LED-illuminated and non-illuminated

cells were centrifuged at 9,000 × g for 10 min. Cells in the resultant pellet

were resuspended in 100 μL of PBS containing 5 μL of 100× butylated

hydroxytoluene (BHT; Sigma-Aldrich) to prevent further oxidation and

subsequently added to 200 μL of 5% sodium dodecyl sulfate (SDS) lysis

buffer (Sigma-Aldrich). After incubation of the mixture for 30 min at room

temperature, 900 μL of freshly prepared TBA reagent (5.2 mg TBA per 1 mL

69

of 10% trichloroacetic acid, TCA; Sigma-Aldrich) were added to the mixture

and incubated at 95 °C for 1 h, followed by cooling in an ice bath for 10 min

before centrifugation at 3,000 × g for 15 min. The supernatant (200 μL) was

transferred in duplicate to a 96-well plate and measured at 532 nm using a

Synergy HT multi-detection Microplate reader (Bio-Tek Instruments Inc.,

Winooski, VT, USA). The degree of peroxidation of cellular lipids was

calculated based on a standard curve between 0 and 62.5 μM MDA (Merck,

Darmstadt, Germany). Results were expressed in nM MDA equivalents per

1011

cells.

5.2.7 Analysis of DNA oxidation

A 2-mL cell suspension containing approximately109 CFU/mL was

prepared as previously described and illuminated at 4 °C for 7 h (a total dose

of 0.9 kJ/cm2). LED-illuminated and non-illuminated cells were collected and

centrifuged at 9,000 × g for 10 min at 4 °C. Cells in the resultant pellet were

used for DNA extraction with a GeneJET Genomic DNA Purification Kit

(Thermo Scientific, Waltham, MA, USA) according to the manufacturer’s

instructions. The purified DNA was dissolved in 100 μL of elution buffer. The

concentration of purified DNA was measured using a BioDrop Touch Duo

Spectrophotometer (BioDrop, Cambridge, UK).

The degree of oxidation of purified DNA was measured using an

OxiSelect™

Oxidative DNA Damage ELISA kit (Cell Biolabs) according to

the manufacturer’s instructions with minor modifications. Briefly, the purified

DNA (2–5 μg) was converted into single-stranded DNA by incubating at 95

°C for 5 min and immediately chilling in an ice bath. The denatured DNA was

70

incubated with 6 units of nuclease P1 (Wako, Osaka, Japan) in 20 mM of

sodium acetate buffer (pH 5.2) (Sigma- Aldrich) at 37 °C for 2 h. After

incubation, 2 units of E. coli alkaline phosphatase (Takara Bio Inc., Shiga,

Japan) and a 10% volume of 10× alkaline phosphatase buffer (Takara Bio

Inc.) were added, followed by incubation at 37 °C for 1 h. The reaction

mixture was centrifuged at 6,000 × g for 5 min and the supernatant was used

for 8-hydroxydeoxyguanosine (8-OHdG) quantification as described in the

assay protocol. The resulting sample was measured at 450 nm using the

microplate reader. The amount of 8-OHdG was quantified using a standard

curve (0–20 ng/mL) and expressed as ng 8-OHdG per mg of DNA.

5.2.8 Colour analysis

The colour of fresh-cut papaya illuminated with 405±5 nm LED was

measured using a reflectance spectrometer (CM-3500d; Konica Minolta

Sensing Inc., Osaka, Japan) set to a D65 illuminant at a 10° observation. The

parameters of colour distribution consisted of L* (lightness, black = 0, white =

100), a* (red > 0, green < 0), and b

* (yellow > 0, blue < 0). The L

*a

*b

* values

obtained from papaya samples were used to determine the colour difference

(ΔE) between LED-illuminated and the non-illuminated control fruits using

the following equation (Mohammadi et al., 2008).

(4.1)

71

5.2.9 Texture analysis

The texture of LED-illuminated fruits was measured using a puncture

test using a TA-XT2 Texture Analyser (Stable Micro Systems Ltd., Surrey,

UK). Samples were punctured with a 6 mm cylindrical probe (P6) at a speed

of 3 mm/sec and at a distance of 6 mm. The force at the maximum peak is

expressed in Newton (N).

5.2.10 Antioxidant capacity

To determine antioxidant capacity, LED-illuminated and non-

illuminated samples were extracted according to González‐Aguilar et al.

(2007a) with minor modifications. LED-illuminated and non-illuminated fruits

(ca. 10 g) were homogenized in 25 mL of 80% methanol containing 0.5%

sodium bisulfate (Sigma-Aldrich) and sonicated for 60 min at room

temperature. Ice was added to inhibit temperature increase. After sonication,

the homogenates were centrifuged at 3,000 × g for 10 min at room

temperature. The supernatant was filtered using Whatman™

No. 1 filter paper

(GE Healthcare, Little Chalfont, Buckinghamshire, UK). Extracts were stored

at – 20 °C prior to determining antioxidant capacity and total flavonoid

content.

Extract (20 μL) was added to 280 μL of 2,2-diphenyl-1-picrylhydrazyl

(DPPH; Sigma-Aldrich) solution freshly prepared by dissolving 1.42 mg of

DPPH in 10 mL of methanol. The mixture was incubated for 30 min at room

temperature in darkness. The mixture (200 μL) was transferred in duplicate to

a 96-well plate and measured at 515 nm using the microplate reader.

Antioxidant capacity was calculated on the basis of a standard curve between

72

0 and 800 μM Trolox (Sigma-Aldrich). Results were expressed in mg trolox

equivalents (TE)/100 g fresh weight (FW).

5.2.11 Total flavonoid content

Flavonoids were extracted as described above. Flavonoid measurement

was performed according to the method of Sultana et al. (2012) with minor

modifications. Extract (50 μL) was added to 200 μL of deionized water and 15

μL of 5% sodium nitrite (Sigma-Aldrich). After equilibration for 5 min, 15 μL

of a 10% aluminum chloride (Sigma-Aldrich) solution were added and

equilibrated for 5 min, followed by addition of 100 μL of 1 M sodium

hydroxide. The final volume was adjusted to 500 μL with deionized water. A

200-μL mixture was loaded in a 96-well plate in duplicate, followed by

reading at 415 nm using the microplate reader. A standard curve was prepared

in the concentration range of 0–250 μM Quercetin (Sigma-Aldrich). The total

flavonoid content was expressed in mg quercetin equivalents (QE)/100 g FW.

5.2.12 Ascorbic acid

Ascorbic acid was extracted as described by Barros et al. (2007) and

Spilimbergo et al. (2013) with minor modifications. Fruit samples (ca. 5 g)

were added to 10 mL of 2.5% meta-phosphoric acid (Sigma-Aldrich),

incubated for 45 min at room temperature, and centrifuged at 3,000 × g for 2

min. The supernatant was filtered using Whatman™

No. 1 filter paper and

filtrate was stored at 4 °C until analysis.

A stock solution (0.025% DCIP) was freshly prepared by dissolving

12.5 mg of 2,6-dichloroindophenol (DCIP) sodium salt (Sigma-Aldrich) in 50

73

mL of deionized water containing 1 mg of sodium bicarbonate (Sigma-

Aldrich). Extract (120 μL) was mixed with 80 μL of stock solution in a 96-

well plate and the mixture was measured at 515 nm using the microplate

reader (Barros et al., 2007; Freed, 1996). A standard curve was prepared using

250–700 μM L-ascorbic acid (Sigma-Aldrich). The concentration of ascorbic

acid was calculated and expressed as mg ascorbic acid/100 g FW.

5.2.13 β-carotene and lycopene

Preparation of fruit samples for β-carotene and lycopene measurements

was performed according to the methods of Barros et al. (2007) and Nagata

and Yumashita (1992) with minor modifications. Illuminated and non-

illuminated fruit samples (ca. 5 g) in 50-mL Falcon tubes were vigorously

shaken with 10 mL of acetone-hexane mixture (4:6, v/v) for 2 min. The

mixture was centrifuged for 2 min at 3,000 × g and filtered through

Whatman™

No. 1 filter paper. The filtrates were kept in 4 °C until analysis.

Filtrates (200 μL) were added in duplicate to a 96-well plate and

measured at 663, 645, 505, and 453 nm using the microplate reader. Results

were expressed as mg β-carotene/100 g FW or mg lycopene/100 g FW and

calculated using the following equations (Nagata and Yamashita, 1992):

β-carotene (mg/100 g) = 0.216 A663 – 1.22 A645 – 0.304 A505 + 0.452 A453 (4.2)

Lycopene (mg/100 g) = –0.0458 A663+0.204 A645+0.372 A505–0.0806 A453 (4.3)


Statistical analysis is described in Chapter 3.2.10

74

5.3 Results

5.3.1 Change in temperature of fruit surface and PBS during LED

illumination

To measure heating the effect caused by LED illumination, temperatures

of the surface of fresh-cut papaya and PBS were monitored during the 405±5

nm LED illumination. Results show that LED illumination increased the

temperatures of the fruit surface and PBS by approximately 3.2 and 5.6 °C,

respectively, within 1 h when incubator temperatures were set at 4 °C (Figure

5–1). Differences in temperature increase might be explained by different

LED intensities, which were adjusted by the distance between the cell

suspension or the fruit surface and the LED source, indicating that lower LED

intensities result in less variance in temperature. Similar temperature increases

were also observed at 10 and 20 °C (data not shown). Thus, non-illuminated

control experiments were performed at 3.2 and 5.6 °C higher than those for

illuminated samples for fruits and PBS, respectively, to minimize the influence

of temperature increase on inactivation or growth of Salmonella during LED

illumination.

75

Figure 5-1 Surface temperature profile of buffered solution (a) in an

acrylonitrile butadiene styrene (ABS) housing at a distance of 2.3 cm and

fresh-cut papaya (b) in an ABS housing at a distance of 4.5 cm recorded

during 405±5 nm LED illumination at 4 °C.

5.3.2 Behavior of Salmonella on fruit surface during LED illumination

The behaviors of S. Agona, S. Newport, S. Saintpaul, and S.

Typhimurium on the surface of fresh-cut papaya were monitored during 405±5

nm LED illumination at different storage temperatures. At 4 °C (actual surface

temperature of 7.2 °C), populations of all Salmonella serovars were

significantly (P ≤ 0.05) reduced by 1.0–1.2 log CFU/cm2 during LED

illumination (a total dose of 1.7 kJ/cm2), whereas no significant (P > 0.05)

change was observed in populations on non-illuminated fruits for 48 h at 7.2

°C (Figure 5–2). Non-illuminated populations on fruits gradually increased to

4.6, 4.3, 4.0, and 3.8 log CFU/cm2 for S. Agona, S. Newport, S. Saintpaul, and

76


S. Newport (b), S. Saintpaul (c), and S. Typhimurium (d) on the surface of

fresh-cut papaya at 4 °C (actual temperature of 7.2 °C). Asterisk (*) indicates

significant (P ≤ 0.05) difference between LED-illuminated and non-

illuminated bacterial cell counts.

S. Typhimurium, respectively, for 36 h at 13.2 °C (Figure 5–3) compared to 4

°C. In contrast, LED illumination resulted in 0.3-, 0.6-, and 1.3-log reductions

for S. Newport, S. Saintpaul, and S. Typhimurium, respectively, while LED-

illumination inhibited the growth of S. Agona cells for 36 h (a total dose of 1.3

kJ/cm2) at 10 °C. At a set temperature of 20 °C for 24 h (a total dose of 0.9

* *

* *

1

2

3

4

0 12 24 36 48 Su

rvio

vrs

(lo

g C

FU

/cm

2)

Exposure time (h)

(a)

Control 405 nm

* *

* *

1

2

3

4

0 12 24 36 48

Exposure time (h)

(b)

Control 405 nm

* *

*

* *

1

2

3

4

0 12 24 36 48

Su

rvio

vrs

(lo

g C

FU

/cm

2)

Exposure time (h)

(c)

Control 405 nm

* * * *

*

1

2

3

4

0 12 24 36 48

Exposure time (h)

(d)

Control 405 nm

77



fresh-cut papaya at 10 °C (actual temperature of 13.2 °C).

kJ/cm2), non-illuminated S. Agona, S. Newport, S. Saintpaul, and S.

Typhimurium cells rapidly grew to 8.1, 7.5, 8.2, and 8.4 log CFU/cm2, while

the number of LED-illuminated cells reached 6.7, 6.3, 7.0, and 6.8 log

CFU/cm2 during the same period, revealing LED illumination delayed the

growth of Salmonella cells on fresh-cut papaya at room temperature (Figure

5–4).

* * * * *

1

3

5

0 6 12 18 24 30 36

Su

rviv

ors

(lo

g C

FU

/cm

2)

Expsoure time (h)

(a)

Control 405 nm

* * * * *

1

3

5

0 6 12 18 24 30 36

Exposure time (h)

(b)

Control 405 nm

* * * * *

1

3

5

0 6 12 18 24 30 36

Su

rviv

ors

(lo

g C

FU

/cm

2)

Exposure time (h)

(c)

Control 405 nm

* * * * * 1

3

5

0 6 12 18 24 30 36

Exposure time (h)

(d)

Control 405 nm

78



fresh-cut papaya at 20 °C (actual temperature of 23.2 °C).

5.3.3 Oxidative damage to membrane lipid and DNA in Salmonella cells

The degrees of lipid peroxidation and DNA oxidation were analyzed to

determine if ROS generated by LED illumination oxidized these two cellular

components. Populations of S. Agona and S. Typhimurium were similarly

inactivated by 2.0–2.7 log CFU/mL at initial population densities of 1011

and

109

CFU/mL for lipid peroxidation and DNA oxidation, respectively, at 0.9

kJ/cm2 (for 7 h) at 4 °C (actual temperature of 9.6 °C) (Figure 5–5a and 5–6a),

* *

*

1

4

7

10

0 6 12 18 24 Su

rviv

ors

(lo

g C

FU

/cm

2)

Exposure time (h)

(a)

Control 405 nm * *

*

*

1

4

7

10

0 6 12 18 24

Exposure time (h)

(b)

Control 405 nm

* *

*

1

4

7

10

0 6 12 18 24 Su

rviv

ors

(lo

g C

FU

/cm

2)

Exposure time (h)

(c)

Control 405 nm *

* *

*

1

4

7

10

0 6 12 18 24

Exposure time (h)

(d)

Control 405 nm

79


lipid peroxidation (b) by 405±5 nm LED illumination at 4 °C for 7 h (a total

dose of 0.9 kJ/cm2) in PBS.


the level of 8-hydroxydeoxyguanosine (8-OHdG) (b) by 405±5 nm LED

illumination at 4 °C for 7 h (a total dose of 0.9 kJ/cm2) in PBS.

whereas no reduction was observed in non-illuminated cells. There was no

significant (P > 0.05) difference in lipid peroxidation between non-

illuminated controls and illuminated cells, regardless of serotype (Figure 5–

5b). For DNA oxidation, the levels of 8-OHdG in illuminated S. Agona and S.

Typhimurium were 1.7–1.8 times higher than those of non-illuminated control

* *

0

1

2

3

4

SA ST

Red

uc

tio

n (

log

CF

U/m

L)

(a)

Control 405 nm

0

2

4

6

8

SA ST

TB

AR

S

(nM

MD

A e

qu

iva

len

ts/1

01

1 c

ell

s)

(b)

Control 405 nm

*

*

0

1

2

3

4

SA ST

Red

uc

tio

n (

log

CF

U/m

L)

(a)

Control 405 nm

* *

0

10

20

30

SA ST

ng

8-O

Hd

G /

mg

DN

A

(b)

Control 405 nm

80

cells, indicating that ROS preferentially oxidizes DNA rather than lipids in the

cell membrane (Figure 5–6b).

5.3.4 Changes in colour and texture of cut papaya by LED illumination

Changes in colour and texture of fresh-cut papaya illuminated by 405±5

nm LED were measured to determine if LED illumination negatively

influences these sensorial qualities. As shown in Table 5–1, no significant (P >

0.05) differences were observed between colour difference (ΔE), although the

mean ΔE values of LED-illuminated fruits were higher than those of non-

illuminated fruits. A similar trend was observed with firmness (N) between

non- illuminated and LED-illuminated cut fruits, regardless of storage

temperature. However, a loss of firmness was observed in both non-

illuminated and LED-illuminated cut fruits during storage compared to fresh-

cut fruit at 0 h, probably due to cut processing and ripening.

Table 5-1 Colour and texture changes1 in fresh-cut papaya by 405±5 nm LED

illumination.

Temperature

(°C)

Time

(h)

Dose

(kJ/cm2)

Sample Colour difference

(ΔE)

Firmness

(N)

20 0 0 control 2.60 ± 0.27a

24 0 dark 30.31 ± 2.45a 1.18 ± 0.45

b

1.56 405 nm 32.90 ± 1.45a 1.00 ± 0.16

b

10 0 0 control 3.99 ± 0.90a

36 0 dark 33.33 ± 4.13a 1.65 ± 0.07

b

2.33 405 nm 36.86 ± 8.91a 1.77 ± 0.25

b

4 0 0 control 2.60 ± 0.27a

48 0 dark 25.09 ± 6.10a 1.22 ± 0.39

b

3.11 405 nm 30.80 ± 8.23a 1.06 ± 0.25

b

1 Different letters within the same column at the same storage temperature

differ significantly (n=6; P ≤ 0.05).

81

5.3.5 Effect of LED illumination on antioxidant capacity, flavonoid

content and nutrients of fruit

Table 5–2 shows changes in antioxidant capacity and flavonoid,

ascorbic acid, β-carotene, and lycopene contents in LED-illuminated and non-

illuminated fruits during storage at different temperatures. There were no

significant (P > 0.05) changes in the antioxidant capacity of cut fruits,

regardless of LED illumination, whereas the total flavonoid content in all

illuminated fruits was 1.5–1.9 times higher than that in fruit at 0-h storage.

However, the total flavonoid content in LED-illuminated fruits was found to

increase significantly (P ≤ 0.05) during storage at 20 and 4 °C, compared to

non-illuminated fruits.

No significant changes in the levels of ascorbic acid, β-carotene, and

lycopene were observed between LED-illuminated and non-illuminated fruits.

On the other hand, higher contents of β-carotene and lycopene were found in

LED-illuminated and non-illuminated fruits stored at 20 °C. Overall, 405±5

nm LED illumination did not negatively influence the physicochemical and

nutritional qualities of fresh-cut papaya.

82

Table 5-2 Effects of 405±5 nm LED illumination on antioxidant capacity1 and ascorbic acid, flavonoid, β-carotene, and lycopene contents

1 in

fresh-cut papaya at varying storage temperatures.

Storage

Temperature (°C) Time (h) Sample

Antioxidant capacity

(mg TE/100 g FW)

Flavonoid

(mg QE/100 g FW)

Ascorbic acid

(mg/100 g FW)

β-carotene

(mg/100 g FW)

Lycopene

(mg/100 g FW)

20 0 control 45.43 ± 3.43a 1.85 ± 0.30

a 18.00 ± 1.89

a 0.29 ± 0.11

a 0.34 ± 0.22

a

24 dark 45.85 ± 3.38a 2.67 ± 0.39

a 17.78 ± 1.56

a 0.48 ± 0.07

b 0.74 ± 0.18

ab

405 nm 41.87 ± 5.47a 3.53 ± 0.53

b 17.54 ± 2.73

a 0.50 ± 0.02

b 0.90 ± 0.32

b

10 0 control 39.08 ± 5.97a 1.85 ± 0.30

a 16.85 ± 2.77

a 0.29 ± 0.11

a 0.34 ± 0.22

a

36 dark 36.95 ± 4.75a 3.14 ± 0.88

b 17.20 ± 1.22

a 0.36 ± 0.18

a 0.64 ± 0.09

ab

405 nm 34.63 ± 3.96a 3.36 ± 0.53

b 16.23 ± 1.53

a 0.30 ± 0.13

a 0.75 ± 0.14

b

4 0 control 45.63 ± 3.43a 1.85 ± 0.30

a 18.00 ±1.89

a 0.29 ± 0.11

a 0.34 ± 0.22

a

48 dark 46.05 ± 1.41a 1.85 ± 0.08

a 14.62 ± 3.37

ab 0.37 ± 0.19

a 0.52 ± 0.11

ab

405 nm 44.22 ± 3.23a 2.84 ± 0.59

b 13.26 ± 0.77

b 0.38 ± 0.15

a 0.64 ± 0.06

b

1Different letters within the same column at the same storage temperature differ significantly (n=6; P ≤ 0.05).

83

5.4 Discussion

Studies described in Chapter 3 revealing that antibacterial effect of

405±5 nm LED against S. Typhimurium in PBS prompted me to design this

study to determine the effectiveness of LED illumination on inactivation of

Salmonella on fresh-cut papaya at different storage temperatures. Its effect on

fruit quality, cellular lipid peroxidation, and DNA oxidation were also

quantified. Different storage conditions at 4, 10, and 20 °C were selected to

simulate the ideal refrigeration temperature, temperature fluctuation in retail

stores, and room temperature in tropical countries or in summer.

Four Salmonella serotypes inoculated on the surface of fresh-cut fruits

were inactivated or their growth was greatly inhibited during the 405±5 nm

LED illumination at 4 and 10 °C, whereas the effectiveness of LED

illumination was not apparent at 20 °C. Similar to these results, a previous

study demonstrated that S. Typhimurium in TSB was more sensitive to 461

nm LED at 10 and 15 °C than at 20 °C (Ghate et al., 2013). Inactivation of

Salmonella by LED illumination at refrigeration temperatures might be due to

inhibition of its oxidative stress response, enzymatically removing ROS

(Beales, 2004). Another possible explanation could be a decrease in the

capacity to transport solutes into cells by altering membrane fluidity of the

lipid bilayer at lower temperatures, consequently inhibiting energy yield

metabolism, which could make cells more sensitive to LED illumination

(Beales, 2004). Unlike behavior at refrigeration temperatures, LED-

illuminated Salmonella cells as well as non-illuminated cells rapidly grew on

the fruit surface at 20 °C, although LED illumination initially delayed growth

of the pathogen on cut fruits. This indicates that LED-illuminated cells likely

84

require an acclimatization period to new environments such as LED

illumination (Dickson et al., 1992). Once illuminated cells adapt to the

conditions, their growth rate might be similar to that of non-illuminated cells.

Based on the results obtained in this study, storage temperature plays an

important role in controlling Salmonella on fresh-cut fruit during 405±5 nm

LED illumination. In contrast, Ghate et al. (2016) reported that the

antibacterial efficacy of 460 nm LED on Salmonella cells in orange juice was

enhanced at higher temperatures, indicating that the type of food matrix might

be another factor influencing its antibacterial efficacy.

It is known that the antibacterial mechanism of blue LEDs is due to the

generation of ROS by the reaction of light, endogenous porphyrin compounds,

and oxygen. Thus, it is hypothesized that ROS may oxidize guanine residues

in genomic DNA and fatty acids in bacterial membranes, resulting in the

production of oxidized derivatives such as 8-OHdG and MDA, respectively

(Joshi et al., 2011; Sies and Menck, 1992). To test this hypothesis, the degrees

of oxidative damage to Salmonella cell membrane lipids and DNA were

measured by analyzing MDA and 8-OHdG contents in S. Agona and S.

Typhimurium. Results show there was no lipid peroxidation in serotype after

LED illumination, whereas LED illumination significantly increased levels of

8-OHdG compared to non-illuminated cells. Similarly, Hamano et al. (2007)

reported that oxidative DNA damage in S. Typhimurium occurred after

illumination with 365 nm LED. Another study has shown that illumination at

407 nm with cationic terta-meso (N-methylpyridyl) porphine resulted in

genomic DNA damage to E. coli (Salmon-Divon et al., 2004). Contrary to the

findings in this chapter, a previous study demonstrated phospholipid oxidation

85

in E. coli and Staphylococcus warneri illuminated with light wavelengths

between 380–700 nm in the presence of a tricationic porphyrin derivative for

90 min (21.6 J/cm2) in PBS (Alves et al., 2013). This discrepancy in lipid

peroxidation findings between present and previous studies might be

explained by the presence of an exogenous photosensitizer.

It is well established that different cellular components may be targeted

by ROS based on the cellular localization of the photosensitizer (Alves et al.,

2014). It is speculated that the cell wall is a major target of ROS generated

from exogenous photosensitizers when they bind to the cell membrane (Alves

et al., 2014). Protoporphyrin IX produced by the addition of 5-ALA, for

example, which has a higher affinity for bacterial membrane phospholipids,

could cause damage to cell membranes by ROS generated from the

photosensitizer (Alves et al., 2014). By contrast, the lack of lipid peroxidation

observed in the present study might be attributed to the small amount of

intracellularly generated ROS from low levels of endogenous porphyrin

compounds in Salmonella cells by LED illumination (Kumar et al., 2015).

Thus, the amount of ROS might be insufficient to oxidize lipids generally

located in membranes after attacking DNA molecules adjacent to porphyrin

compounds in the cytoplasm. However, the results reported in Chapter 3 show

that LED illumination increases membrane permeability under similar

conditions to those reported herein. Thus, further research is necessary to

elucidate the detailed antibacterial mechanism of 405±5 nm LED illumination

at both molecular and physiological levels.

The impact of 405±5 nm LED illumination on quality of cut papaya was

evaluated, as physicochemical and nutritional quality parameters such as

86

colour and ascorbic acid are known to be sensitive to light. Results show that

all quality parameters tested in this study were well preserved during LED

illumination. Moreover, LED illumination had a positive effect on the total

flavonoid content in cut papaya at 4 and 20 °C. Similar to the present results,

Hong et al. (2015) reported that 440 nm LED illumination resulted in higher

contents of flavonoid and β-carotene in various plants and fruits compared to

contents of controls stored in the dark. Another study showed a positive effect

of blue light on Chinese bayberry, resulting in accumulation of anthocyanin

compared to non-illuminated controls (Shi et al., 2014). These positive effects

of LEDs on fruit quality might be attributable to the stimulation effect of light

on the production of primary and secondary metabolites, which are involved in

defense against ROS generated during LED illumination (Darko et al., 2014).

In contrast, mature green tomatoes had lower lycopene content during

blue LED illumination for 7 days compared to red LED- and non-illuminated

fruits, but after blue light illumination, tomatoes gradually changed in colour,

ripened, and accumulated lycopene during storage, revealing inhibition of the

ripening process and consequently a long-term shelf life (Dhakal and Baek,

2014). Overall, these data indicate that the effects of LEDs on quality vary by

fruit and ripening conditions. However, detailed mechanisms affecting

nutritional quality of fruits as affected by LEDs have yet to be established.

5.5 Conclusions

This is the first study to evaluate the efficacy of 405±5 nm LED in

controlling Salmonella on fresh-cut papaya at different storage temperatures.

Results demonstrated that LED illumination inactivates Salmonella cells on

87

cut fruits at refrigeration temperatures, but was not effective at room

temperature. These findings confirmed that bacterial genomic DNA is

oxidized by R0S generated from LED illumination, partially contributing to

inactivation of Salmonella cell, while cell membrane lipid peroxidation is

unlikely to occur. Furthermore, LED illumination did not negatively impact on

the physicochemical and nutritional qualities of cut papaya, regardless of

storage temperature. Thus, this study proposes that 405±5 nm LED, combined

with refrigeration conditions, can be useful to control Salmonella on fresh-cut

fruits without any deterioration, helping to reduce the risk of salmonellosis.

88

Chapter 6

Antibacterial effect of 405 ±5 nm light emitting diode

illumination against Escherichia coli O157:H7, Listeria

monocytogenes, and Salmonella on the surface of fresh-cut

mango and its influence on fruit quality

6.1 Introduction

Concerns about bacterial contamination in fresh-cut fruits have greatly

increased since fresh-cut fruits became popular because there is no treatment

to effectively eliminate bacteria in fresh-cut fruit processing. Numerous

salmonellosis have been recently associated with consumption of fresh fruits

such as cantaloupe and watermelon. For example, a Salmonella Newport

outbreak in RTE cut watermelons was reported in the United Kingdom (UK)

in 2012 (Byrne et al., 2014). Whole cantaloupes were also linked to a L.

monocytogenes outbreak, resulting in 146 illnesses and 32 deaths in the US in

2011 (CDC, 2012). In addition, a total of 127 confirmed cases of infection

with S. Braenderup and 33 hospitalizations were linked to imported mangoes

in 15 states of US in 2012 (CDC, 2012). Therefore, fresh fruits can be a

vehicle for pathogenic bacteria, resulting in potentially hazardous foods to

humans.

89

Although several studies have been published describing the efficacy of

LED in inactivating pathogenic bacteria on fresh produce by adding

exogenous photosensitizers (Luksienė and Paskeviciute, 2011), to my

knowledge, little work has been done on the efficacy of LED alone against

foodborne pathogens on cut fruits and its impact on fruit quality. Thus, the aim

of this study was to evaluate the effectiveness of 405±5 nm LED illumination

on E. coli O157:H7, L. monocytogenes, and Salmonella spp. on fresh-cut

mango during storage at different temperatures and to investigate changes in

physicochemical and nutritional qualities of fresh-cut mangos after long-term

LED illumination.



Three strains of E. coli O157:H7 (ATCC 35150, C7927, and F12), 3

serotypes of L. monocytogenes (1/2a ATCC BAA-679, 1/2b ATCC BAA-839,

and 4b ATCC 13932), and 5 serotypes of Salmonella (S. Agona ATCC BAA-

707, S. Newport ATCC 6962, S. Saintpaul ATCC 9712, S. Tennessee ATCC

10722, and S. Typhimurium ATCC 14028) were used in this study. Two E.

coli O157:H7 strains (C7927 and F12) were obtained from Dr Kun-Ho Seo of

Konkuk University in Republic of Korea. All cultures were adapted to 200

μg/mL of nalidixic acid by adding step-by-step incremental concentrations of

nalidixic acid after a transfer of each culture in order to isolate inoculated cells

from naturally existing microbiota in fresh-cut mangoes. The working culture

is described in Chapter 5.2.1.

90


Detailed information for the illumination system is described in Chapter

3.2.2. The irradiance of 405±5 nm LED at the fruit surface (20±2 mW/cm2

was measured that using a Compact Power and Energy Meter Console. Two

fresh-cut mango samples in a sterile Petri dish (60 mm diameter) were placed

in the LED system at a distance of 4.5 cm to illuminate the entire fruit

samples.

6.2.3 Preparation of mango and inoculation

Fresh mangoes (Mangifera indica) were purchased from a local

supermarket in Singapore. For each trial, mangoes were washed with tap

water, sanitized by spraying with 70% ethanol solution, rinsed three times

with sterile deionized water, and finally dried with Kimwipe. The dried

mangoes were peeled and cut into ca. 10 g of each piece with half-moon shape

(60 mm diameter).

Each cocktail culture of E. coli O157:H7, L. monocytogenes, or

Salmonella was prepared by combining equal portions of each strain or

serotype, centrifuging at 6,000 × g for 10 min at 4 °C and washing twice with

PBS. The cocktail (ca. 109 CFU/mL) was serially diluted in PBS and a 10-µL

aliquot (ca. 105 CFU/mL) was inoculated at 10 sites on the surface of mangoes

to give concentration of ca. 103 CFU/cm

2. The inoculated mangoes were dried

for 30 min in a biosafety cabinet and individually packed with cling wrap to

simulate the conditions found in retail stores.

91

6.2.4 LED illumination

Petri dishes, each containing two inoculated or uninoculated mangoes,

were placed in the LED illumination system and were exposed to 405±5 nm

LED, for 24–48 h (a total dose of 1.7–3.5 kJ/cm2) in an incubator at 4, 10, or

20 °C. LED-illuminated and non-illuminated fruits were taken at selected time

intervals and analyzed as described in Chapter 5.2.5.

6.2.5 Modified Weibull model for bacterial inactivation kinetics

The modified Weibull model is described in Chapter 3.2.5.

6.2.6 Firmness analysis

Firmness of illuminated or non-illuminated mangoes was analyzed as

described in Chapter 5.2.9.

6.2.7 Colour analysis

Colour of illuminated and non-illuminated mangoes was measured as

described in Chapter 5.2.8. The values of L*and b

* were used to calculate the

yellow index (YI) using the following equation (Anyasi, Jideani, and Mchau,

2014).

(6.1)

YI is useful to quantify the effects of degradation processes such as

exposure to light (Anyasi, Jideani, and Mchau, 2014).

92

6.2.8 DPPH assay

Detailed procedures for monitoring change in antioxidant capacity of

fresh-cut mangoes are described in Chapter 5.2.10.

6.2.9 Total flavonoid content

Detailed procedures for measuring total flavonoid content are described

in Chapter 5.2.11.

6.2.10 Ascorbic acid content

Detailed procedures for measuring ascorbic acid content are described

in Chapter 5.2.12.

6.2.11 β-carotene content

Detailed procedures for measuring β-carotene content are described in

Chapter 5.2.13.


Procedures for statistical analysis are described in Chapter 3.2.10.

6.3 Results

Because 405±5 nm LED illumination could possibly have a heating

effect, the surface temperature of fresh-cut mango was monitored for 8 h at 1-

min intervals during LED illumination to select the temperature condition for

the control experiments. Temperature increased by about 3.2 °C from the

incubator set temperature within 1 h, regardless of set temperature (Figure 6–

93

1). Thus, non-illuminated control fruits were stored at 7.2, 13.2, and 23.2 °C

for set temperatures of 4, 10, and 20 °C, respectively, to eliminate the effect of

temperature difference between LED illumination and non-illumination on

inactivation or growth of test pathogens.

Figure 6-1 Temperature profile on the surface of fresh-cut mango during

405±5 nm LED illumination at set temperatures of 4, 10, and 20 °C,

respectively.

The antibacterial effect of 405±5 nm LED illumination on E. coli

O157:H7, L. monocytogenes, and Salmonella spp. on cut mango was evaluated

at set temperatures of 4 and 10 °C for 48 and 36 h, respectively (Figure 6–2

and 6–3). With the exception of L. monocytogenes on non-illuminated mango,

which significantly (P ≤ 0.05) increased to 4.1 log CFU/cm2 at a set

temperature of 10 °C, the number of viable cells on non-illuminated mangoes

remained unchanged during storage,. On the other hand, LED illumination

significantly reduced the populations of the pathogens to less than 1.6 log

CFU/cm2 for 36–48 h (a total dose of 2.6–3.5 kJ/cm

2). In particular, LED

illumination inactivated E. coli O157:H7 and Salmonella to below the

detection limit (1.0 log) after 36 h at 4 and 10 °C.

0

10

20

30

0 1 2 3 4 5 6 7 8

Te

mp

era

ture

(°C

)

Time (h)

20 °C 10 °C 4 °C

94


Salmonella (c) on the surface of fresh-cut mango at a set temperature of 4 °C

(actual temperature of 7.2 °C) by 405±5 nm LED illumination. Asterisk (*)

indicates significant (P ≤ 0.05) difference between LED-illuminated and non-

illuminated bacterial cell counts. Different letters (A–C or a–c)

in the same bar are

significantly (P ≤ 0.05) different one another.

At room temperature, E. coli O157:H7, L. monocytogenes, and

Salmonella grew to 4.6, 7.3, and 4.3 log CFU/cm2, respectively, on non-

illuminated mangoes within 24 h (Figure 6–4). In contrast, LED illumination

significantly (P ≤ 0.05) reduced populations of all three species, exhibiting its

different effectiveness. For example, growth of E. coli O157:H7 was

completely inhibited and the number of Salmonella cells significantly

decreased to 1.2 log CFU/cm2 during LED illumination for 24 h

a a ab ab ab b A

B*

BC* BC* C BC*

1

2

3

4

0 12 17 24 36 48

Lo

g C

FU

/cm

2

Exposure time (h)

(a)

Control 405 nm

a a a a a a A

AB

AB* B* B*

B*

1

2

3

4

0 12 17 24 36 48

Lo

g C

FU

/cm

2

Exposure time (h)

(b)

Control 405 nm

a a a a a a

A

B B

BC*

C*

C* 1

2

3

4

0 12 17 24 36 48

Lo

g C

FU

/cm

2

Exposure time (h)

(c)

Control 405 nm

95



(actual temperature of 13.2 °C) by 405±5 nm LED illumination.

(a total dose of 1 .7 kJ/cm2), whereas the population of L. monocytogenes was

inhibited during LED exposure during the first 12 h of storage, but gradually

increased to 4.6 log CFU/cm2 at the end of LED illumination.

To compare pathogen sensitivity to LED illumination, the reliable life

(tR) was calculated based on log reductions at 4 and 10 °C using scale (α) and

shape (β) parameters of the Weibull model (Table 6–1). The α value can be

a a a a a a A

B* B*

B* B*

C*

1

2

3

4

5

0 12 16 20 24 36 Su

rviv

ors

(lo

g C

FU

/cm

2)

Exposure time (h)

(a)

Control 405 nm

a a a

a a

b

A

B* B*

B* B* B*

1

2

3

4

5

0 12 16 20 24 36

Su

rviv

ors

(lo

g C

FU

/cm

2)

Exposure time (h)

(b)

Control 405 nm

a a a

a a a A A

AB AB*

B*

C*

1

2

3

4

5

0 12 16 20 24 36

Su

rviv

ors

(lo

g C

FU

/cm

2)

Expsoure time (h)

(c)

Control 405 nm

96

used as a measure of bacterial resistance to LED illumination and is consistent

in the mean of the distribution accounting for bacterial inactivation time (h),

while β values indicate an efficacy on predicted inactivation rate (Bilaka et al.,

2008; see Chapters 3 and 4). At 4 °C, all three test pathogens had β values of

less than 1, which means a higher inactivation rate at a lower dose of LED

illumination. Salmonella had a significantly higher β value of 2.1 at 10 °C

compared to values for other pathogens, indicating that the rate of inactivation

increased with increasing light dose (Bilaka et al., 2008; see Chapters 3 and 4).



(actual temperature of 23.2 °C) by 405±5 nm LED illumination.

a a a a

a

b

A A A A A*

A*

1

3

5

7

0 3 6 9 12 24 Su

rviv

ors

(lo

g C

FU

/cm

2)

Exposure time (h)

(a)

Control 405 nm

a a a

ab

ab

b

A A A* A*

A*

B*

1

3

5

7

0 3 6 9 12 24 Su

rviv

ors

(lo

g C

FU

/cm

2)

Exposure time (h)

(b)

Control 405 nm

a a a a a

b

A B*

BC* C*

C* C*

1

3

5

7

0 3 6 9 12 24 Su

rviv

ors

(lo

g C

FU

/cm

2)

Exposure time (h)

(c)

Control 405 nm

97

Table 6-1 Comparison of the tR-values1 of E. coli O157:H7, L. monocytogenes, and Salmonella by 405±5 nm LED illumination at refrigeration

temperatures using Weibull model parameters1.

Temperature Species α (h) β t R (h) R2

4 °C E. coli O157:H7 1.36±0.37aA

0.38±0.25aA

6.85±5.94aA

0.95±0.03

L. monocytogenes 1.92±1.50aA

0.46±0.12aA

10.02±6.23aA

0.94±0.05

Salmonella 3.65±2.43aA

0.64±0.23aA

12.54±4.24aA

0.96±0.04

10 °C E. coli O157:H7 4.46±1.25aA

0.69±0.12aA

14.85±1.48aA

0.91±0.07

L. monocytogenes 4.61±2.72aA

0.79±0.25aA

13.21±3.58aA

0.96±0.03

Salmonella 17.24±1.84bB

2.10±0.11bB

25.63±2.36bB

0.95±0.05

1Lowercase letters

(a–b) in the same column at the same temperature and uppercase letters

(A–B) within the same species in the same column differ

significantly (n=6; P ≤ 0.05).

98

Salmonella also had the highest α and tR values at 10 °C among the three

pathogens. The three pathogens showed statistically similar (P > 0.05)

sensitivities to LED illumination at 4 °C based on the tR values, although the

mean tR value for E. coli O157:H7 was lower. In contrast, the tR value for

Salmonella at 10 °C was 1.7–1.9 times higher than values for E. coli O157:H7

and L. monocytogenes, indicating that Salmonella was the most resistant

pathogen to 405±5 nm LED illumination under temperature abuse conditions.

However, the number of surviving Salmonella cells was similar to that of E.

coli O157:H7 and L. monocytogenes at the end of illumination (Figure 6–3).

To determine the impact of long-term LED illumination on

physicochemical and nutritional qualities of cut mangoes, colour, texture,

antioxidant capacity, and ascorbic acid, β-carotene, and flavonoid contents

were determined. No significant (P > 0.05) difference in yellow index (YI)

was observed between non-illuminated and illuminated fruits stored for 24–48

h, regardless of storage temperature, although the mean YI values of

illuminated mangoes were slightly lower than those of non-illuminated

mangoes (Figure 6–5).

99

Figure 6-5 Comparison of yellowness index (YI) between 405±5 nm LED

illuminated and non-illuminated mangoes at set temperatures of 4 °C (a), 10

°C (b), and 20 °C (c). A letter (a)

in the same bar did not differ significantly

(n=6; P ≥ 0.05).

Similarly, LED illumination at all temperatures did not significantly (P

> 0.05) influence firmness (N) of cut mangoes (Figure 6–6). However,

firmness of both non-illuminated and illuminated mangoes significantly (P ≤

0.05) decreased after storage compared to firmness of fresh-cut mango at 0 h,

probably due to ripening and cut processing. For nutritional qualities, results

show no significant (P > 0.05) differences in levels of ascorbic acid, β-

carotene, and flavonoid between non-illuminated and illuminated cut mangoes

at all storage temperatures (Table 6–2).

a a

a a

0

50

100

0 48 Y

I

Exposure time (h)

(a)

Control 405 nm

a a a a

0

50

100

0 36

YI

Exposure time (h)

(b)

Control 405 nm

a a a a

0

50

100

0 24

YI

Exposure time (h)

(c)

Control 405 nm

100

Figure 6-6 Change in firmness (N) of fresh-cut mango by 405±5 nm LED

illumination at set temperatures of 4 °C (a), 10 °C (b), and 20 °C (c).

a

b

a

b

0

1

2

3

0 48 F

irm

nes

s (

N)

Exposure time (h)

(a)

Control 405 nm

a

b

a

b

0

1

2

3

0 36

Fir

mn

es

s (

N)

Exposure time (h)

(b)

Control 405 nm

a

b

a

b

0

1

2

3

0 24

Fir

mn

es

s (

N)

Exposure time (h)

(c)

Control 405 nm

101

Table 6-2 Effect of 405±5 nm LED illumination on antioxidant capacity1 and

ascorbic acid, β-carotene, and flavonoid contents1 of fresh-cut mangoes stored

at different temperatures.

Quality parameters

Storage

temperature

Control (0 h)

mango

Non-

illuminated

mango

LED

illuminated

mango

Antioxidant

activity

(mg TE/100 g FW)

4 °C 75.75±12.04a 78.84±6.02

a 79.00±15.12

a

10 °C 79.21±13.22a 96.58±16.83

a 90.74±26.56

a

20 °C 74.91±10.78a 77.88±13.30

a 82.39±11.51

a

Ascorbic acid

(mg/100g FW)

4 °C 10.65±1.59a 7.87±2.11

a 7.74±2.98

a

10 °C 10.65±1.59a 8.26±3.93

a 7.97±2.50

a

20 °C 10.65±1.59a 9.11±2.09

a 9.28±1.64

a

β-carotene

(mg/100 g FW)

4 °C 0.79±0.14a 0.58±0.16

a 0.61±0.11

a

10 °C 0.96±0.25a 0.96±0.25

a 0.77±0.26

a

20 °C 0.79±0.14a 0.57±0.19

a 0.56±0.14

a

Flavonoid

(mg QE/100 g FW)

4 °C 9.00±1.32a 11.46±3.06

a 10.94±3.89

a

10 °C 7.62±1.07a 8.77±3.35

a 7.67±1.16

a

20 °C 9.00±1.82a 9.71±3.16

a 10.58±1.44

a

1A letter

(a) in a row at same storage temperature did not differ significantly

(n=6; P > 0.05).

6.4 Discussion

LED illumination at 405±5 nm has recently been demonstrated to have

an antibacterial effect against various foodborne pathogens in the absence of

exogenous photosensitizers in PBS (Kumar et al., 2015; see Chapters 3 and 4).

To validate the effectiveness of LED illumination on the preservation of fresh-

cut fruits, E. coli O157:H7, L. monocytogenes, and Salmonella on the surface

of fresh-cut mango were illuminated at different storage temperatures of 4, 10,

and 20 °C which simulated ideal refrigeration, temperature abuse in a retail

store, and room temperature conditions, respectively.

102

Results show that 405±5 nm LED illumination at refrigeration

temperatures can inactivate three foodborne pathogens tested in this study. On

the other hand, except for Salmonella, only growth inhibition or delay was

observed at room temperature during LED illumination, indicating that the

effect of LED illumination was highly species dependent. Similarly, a

previous study reported that 461 nm LED illumination inactivated E. coli

O157:H7, L. monocytogenes and S. Typhimurium in TSB at 10 and 15 °C, but

only inhibited growth at 20 °C (Ghate et al., 2013). These results indicate that

the antibacterial effect of blue LED is enhanced at lower temperatures. This

may be associated with an inability to transport sugars inside cells by changing

fluidity of the bacterial lipid membrane at refrigeration temperatures, resulting

in a restriction of energy uptake and consequently an increase in cellular

susceptibility to LED illumination (Beales, 2004). Another possible reason

might be the inactivity of cellular defense systems such as superoxide

dismutase and catalase at lower temperatures, resulting in failure to remove

intracellular ROS (Beales, 2004).

The fruit surface pH could also affect bacterial behavior on fresh-cut

mangoes during storage. The pH of mango is to 3.8–4.2 and its major organic

acid is citric acid, resulting in its inability to support growth on non-

illuminated mangoes, depending on the storage temperatures (González-

Aguilar et al., 2000; Ma et al., 2016). The lower pH of mango could have a

synergistic effect on bacterial inactivation by LED illumination at refrigeration

conditions. Ghate et al. (2015a; 2015b) reported that E. coli O157:H7, L.

monocytogenes, and S. Typhimurium were more sensitive to 460 nm LED

illumination in TSB when applied at a pH of 4.5 or citric acid, than sensitive at

103

pH 7.3 and 15 °C. Similar to the present results, a previous study demonstrated

that 460 nm LED illumination was more efficacious in inactivating Salmonella

in orange juice containing citric acid as a primary organic acid at room

temperature than at refrigeration temperatures (Ghate et al., 2016). Thus, pH

of the food matrix may be another critical factor affecting the efficacy of blue

LED illumination in preserving cut fruit.

In this study, L. monocytogenes grew on the surface of non-illuminated

and illuminated mangoes, while only Salmonella and E. coli O157:H7 cells

grew on non-illuminated mangoes during storage at 20 °C. This is because

Gram-negative bacteria (pH range, 4.5–9.0) are generally more sensitive to

low pH of food matrices than are Gram-positive bacteria (pH range, 4.0–8.5)

(Ray and Bhunia, 2013). Illuminated L. monocytogenes cells also could have

adapted to acidic conditions and grow on mangoes during LED illumination at

room temperature, although LED illumination caused longer lag time to L.

monocytogenes cells. Unlike bacterial behavior at 20 °C during LED

illumination, with the exception of Salmonella at 10 °C, which was more

resistant to LED illumination compared to E. coli O157:H7 and L.

monocytogenes, there was no significant difference in the bacterial sensitivity

to 405±5 nm LED illumination among the three species at two chilling

temperatures. The findings in Chapter 3 demonstrate that S. Typhimurium was

more susceptible to LED illumination than was E. coli O157:H7 in PBS at 4

°C. Ghate et al. (2013) reported a difference in the sensitivity of pathogens to

461 nm LED in TSB, revealing that L. monocytogenes was more sensitive than

E. coli O157:H7 to 461 nm LED at 10 °C, but there was no difference between

L. monocytogenes and S. Typhimurium. The other studies conducted by Ghate

104

et al. (2015a; 2015b) demonstrated that L. monocytogenes was more sensitive

than E. coli O157:H7 and S. Typhimurium to blue LED illumination at pH 4.5

(adjusted by HCl) at 15 °C, whereas the susceptibility to the same LED

illumination at pH 4.5 (adjusted by citric, lactic and malic acids) was affected

by the type of organic acid. These discrepant results could be due to a

difference in LED illumination conditions, such as temperature, light

wavelength, acidulant, and food matrix, indicating that cell susceptibility to

LED illumination might be influenced by these parameters.

Changes in physicochemical and nutritional qualities of fresh-cut

mangoes caused by LED illumination were also determined since some of

quality parameters, e.g., ascorbic acid and β-carotene contents are sensitive to

light. In this study, 405±5 nm LED illumination preserved firmness and colour

as well as antioxidant capacity and ascorbic acid, β-carotene, and flavonoid

contents of mangoes compared to non-illuminated control fruits, indicating

that the long-term illumination of LED did not influence these qualities.

Unlike the present results, improvement of firmness of whole and fresh-cut

mangoes treated with UV-C and pulsed light, respectively, compared to non-

irradiated control samples due to higher levels of polyamines contributing to

firmness retention after these treatments has been reported (Charles et al.,

2013; González-Aguilar et al., 2007a). Another study conducted by Hong et

al. (2015) showed that exposure of diverse fruits to light (440 nm) had a more

positive effect on flavonoid and β-carotene content compared to controls held

in the dark. Different results in the present study and previous studies could be

due to different storage periods. For example, fruit qualities of mangoes, such

as firmness, antioxidant capacity, and flavonoid, were not changed

105

immediately after the treatment of UV-C or pulsed light, but significant

changes were observed after storage at 3 days (Charles et al., 2013; González-

Aguilar et al., 2007a; 2007b). On the other hand, mature green tomatoes

treated with blue light illumination for 7 days had a lower amount of lycopene

than that in non-illuminated controls; however, the tomatoes after illumination

of tomatoes resulted in accumulation of lycopene and colour, and affected

ripening during storage (Dhakal and Baek, 2014). Thus, blue light illumination

may inhibit the ripening process of the tomatoes and consequently extend the

shelf life. Because of these advantages, use of light technology for RTE

applications is of special interest, but detailed mechanisms related to changes

in nutritional qualities of fruits is still unknown.

6.5 Conclusions

405±5 nm LED illumination effectively inactivated 97–99 % of E. coli

O157:H7, L. monocytogenes, and Salmonella spp. on the fresh-cut mango

surface at refrigeration temperatures, but was less effective to L.

monocytogenes and E. coli O157:H7 at room temperature. Furthermore,

quality parameters of cut mangoes were not influenced by long-term LED

illumination, regardless of storage temperature. Thus, this study demonstrates

the potential of 405±5 nm LEDs to be applied at low temperatures to control

foodborne pathogens on fresh-cut mangoes without deterioration in retail

stores and to the fresh produce industry in general as a novel food preservation

technology.

106

Chapter 7

Photodynamic inactivation of Salmonella enterica Serovar

Enteritidis by 405±5 nm LED and its application to control

salmonellosis on cooked chicken

7.1 Introduction

Salmonellosis results in 10 million cases of infection and 100,000

deaths every year worldwide according to the World Health Organization

(WH0, 2013). The MOH in Singapore reported 394 laboratory-confirmed

cases caused by Salmonella Enteritidis as the predominant serotype out of

1,883 cases of salmonellosis in 2014 (MOH, 2015). In the US, a total of 3,553

illnesses and 623 hospitalizations from 149 outbreaks of salmonellosis were

reported by the CDC in 2013, revealing that S. Enteritidis were also identified

as the major causative serotype (CDC, 2015). Chicken contaminated with

Salmonella is listed as number one in the top five pathogen-food category

associated with infections and hospitalizations in the US (CDC, 2015). Thus,

raw chicken is responsible for the transmission of salmonellosis in various

foodborne outbreaks, probably due to inadequate cooking of RTE chicken or

cross-contamination from preparation area to cooked meat, resulting in

increased risk of salmonellosis (Yang et al., 2016).

107

Although some previous studies have shown that the antibacterial effect

of LED might be species dependent, to the best of my knowledge, no study

has been performed to investigate the effectiveness of 405±5 nm LED

illumination on S. Enteritidis at the strain level. Furthermore, studies to

determine if ROS generated during 405±5 nm LED illumination causes

damage related to the metabolism of cellular components have not been

reported. Thus, the objective of this study was to evaluate the antibacterial

efficacy of 405±5 nm LED illumination against three different strains of S.

Enteritidis in PBS and on the surface of cooked chicken at different

temperatures as well as to elucidate its antibacterial mechanism by

determining damage to DNA, RNA, protein, and cell wall metabolism.



Salmonella enterica Enteritidis 124 (SE 124; phage type 8: Maryland

Department of Health and Mental Hygiene, MD, USA), S. Enteritidis 125 (SE

125; phage type 13A; U.S. Department of Agriculture, WA, USA), and S.

Enteritidis 130 (SE 130; phage type 2; CDC, NY, USA) obtained from Dr.

Kun-Ho Seo of Konkuk University in Republic of Korea were used in this

study. Strains were preserved on porous beads in cryoinstant vials (DeltaLab,

Barcelona, Spain) at –70 °C. A working culture was prepared as described in

Chapter 3.2.1.

108

7.2.2 LED system and illumination

Detailed information for LED characteristics and the illumination

system is described in Chapters 3.2.2. and 3.2.3., respectively. The irradiance

of 405±5 nm LED at the surface of cell suspensions and cooked chicken was

16.5±1.5 and 22.0±1.1 mW/cm2, respectively, which was measured with a

Compact Power and Energy Meter Console. To illuminate the entire bacterial

suspension (Figure 7–1a) and cooked chicken (Figure 7–1b), 10 mL of cell

suspension in a sterile Petri dish (60 mm diameter) and two cooked chicken

samples in a sterile Petri dish (90 mm diameter) were placed directly in the

LED illumination system at distances of 3.5 cm and 4 cm, respectively.

Figure 7-1 Schematic diagrams of a 405±5 nm LED illumination system.

7.2.3 LED illumination of cell suspension

Ten milliliters of cell suspension (approximately 106 CFU/mL of PBS),

as previously described, was placed in the LED illumination system at 4 and

20 °C for 7.5 h (a total dose of 0.45 kJ/cm2) in the incubator. Non-illuminated

control samples were placed in an incubator without LED illumination (dark

condition). A 0.1-mL aliquot was taken after every 1.5 h (0.09 kJ/cm2) and

analyzed as described in Chapter 3.2.4.

(a) (b)

109

7.2.4 Preparation of cooked chicken and inoculation

Raw chicken breast meat was purchased from a local supermarket in

Singapore. Chickens were cut into approximately 17-g slices (4 × 4 cm),

cooked at 121 °C for 20 min using a HG-50 autoclave (Hirayama

Manufacturing Co., Saitama, Japan), and processed within one day (Oscar,

2002). After cooking, the weight of chicken slices (3 x 3 cm) was

approximately 10 g. A 20-µL aliquot of cell suspension (ca. 105 CFU/mL), as

previously described, was spot-inoculated at five sites on the surface of

cooked chicken to reach a final concentration of ca. 104 CFU/cm

2, dried for 30

min in a biosafety cabinet, and individually wrapped in a thin cling wrap to

minimize a loss of moisture during storage.

7.2.5 LED illumination on cooked chicken

Two inoculated samples were placed in the LED illumination system at

the set temperatures of 4, 10, and 20 °C in an incubator for 20–48 h (a total

dose of 1.58–3.80 kJ/cm2). Non-illuminated control cooked chicken samples

were placed in the incubator without LED illumination (dark condition).

Inoculated non-illuminated and illuminated cooked chicken samples were

withdrawn at specific time intervals and analyzed as described in Chapter

5.2.5.

7.2.6 Cell injury

To determine possible sub-lethal injury of S. Enteritidis cells on the

surface of cooked chicken treated with LED illumination, non-illuminated and

110

illuminated cells were plated on TSA as a non-selective agar and xylose lysine

desoxycholate (XLD; Oxoid) as a selective agar where only healthy and intact

S. Enteritidis cells can grow. After incubation at 37 °C for 24–48 h, the

number of colonies was enumerated and the percentage of bacterial injury was

calculated with the following equation (Ghate et al., 2016).

Injury % 1 - Colonies on LD

Colonies on TSA × 100 (7.1)

7.2.7 Cellular damage in S. Enteritidis cells caused by LED illumination

To investigate sites of cellular damage in S. Enteritidis caused by 405±5

nm LED illumination, four antibiotics including ampicillin (Sigma-Aldrich)

for cell wall inhibition, chloramphenicol (Sigma-Aldrich) for inhibition of

protein synthesis (50S ribosome), nalidixic acid (Sigma-Aldrich) for inhibition

of DNA, and rifampicin (Sigma-Aldrich) for inhibition of RNA (RNA

polymerase) were used as metabolic inhibitors (Kohanski et al., 2010; Ha and

Kang, 2015). Non-illuminated and illuminated S. Enteritidis 130 cells on the

surface of cooked chicken at a set temperature of 4 °C for 22 h (a total dose of

1.74 kJ/cm2) were prepared. Sites of cellular damage were determined by

comparing the difference in the number of surviving cells grown on TSA as a

non-selective agar and TSA supplemented with various concentrations of each

antibiotic as a selective agar. The concentrations of ampicillin,

chloramphenicol, nalidixic acid, and rifampicin were 1.5, 3.0, 2.0, and 4.0

μg/mL, respectively. Preliminary experiments showed that the concentrations

were identified as the maximum non-inhibitory concentration for healthy and

intact cells in the stationary phase which do not inhibit cell growth on the

111

plates (data not shown). After incubation at 37 °C for 24–48 h the number of

colonies was counted and the percent of cells metabolically inhibited was

calculated using the following equation.

Metabolic inhibition % 1 - Colonies on TSA with an antibiotic

Colonies on TSA × 100 (7.2)


The procedures for statistical analysis are described in Chapter 3.2.10.

7.3 Results

7.3.1 Temperature change of PBS and cooked chicken surface during

illumination

Because of heat generated during 405±5 nm LED illumination, the

temperature for holding chicken in the non-illuminated control experiment

was determined. Temperatures of cell suspension in PBS and cooked chicken

surface were examined at 1-min intervals for 6–8 h. The temperatures of cell

suspensions and the cooked chicken surface increased by approximately 2.5

°C and 4.5 °C, respectively, within 1 h during LED illumination, regardless of

the set temperature (data not shown). The difference in temperature elevation

in PBS and on the cooked chicken surface might be due to different intensities

of LEDs that were generated by one or two resistors, revealing that higher

LED intensity (for chicken) resulted in a higher temperature. Thus, non-

illuminated control cells in suspensions and on cooked chicken surface were

held at 2.5 °C and 4.5 °C higher than set temperatures, respectively, to make

up for the efficacy of temperature elevation during LED illumination.

112

7.3.2 Antibacterial effect of 405±5 nm LED illumination against S.

Enteritidis in PBS

The antibacterial effect of 405±5 nm LED illumination against three

strains of S. Enteritidis in PBS up to a final dose of 0.45 kJ/cm2 at an intensity

of 16.5 mW/cm2 at set temperatures of 4 and 20 °C (actual temperatures of 6.5

and 22.5 °C) was evaluated. Results showed that populations in non-

illuminated S. Enteritidis were unchanged at set temperatures of 4 and 20 °C

for 7.5 h, while LED-illuminated cells were reduced by approximately 1.3,

1.4, and 2.1 log CFU/mL for S. Enteritidis 124, 125, and 130, respectively, at a

total dose of 0.45 kJ/cm2, regardless of set temperature (Figure 7–2).

To compare cell sensitivity to 405±5 nm LED illumination at set

temperatures of 4 and 20 °C, D-values were calculated using the linear portion

of inactivation curves. No significant (P > 0.05) difference in D-values at two

illumination temperatures was observed, while D-values were significantly (P

≤ 0.05) different in bacterial strains, achieving approximately 0.23, 0.31, and

0.34 kJ/cm2 as D-values for S. Enteritidis 130, 125, and 124, respectively,

revealing that S. Enteritidis 130 was the more sensitive strain to LED

illumination than the other strains (Table 7–1).

113

Figure 7-2 Inactivation curves for S. Enteritidis 124 (a), 125 (c), and 130 (e)

at 4 °C and S. Enteritidis 124 (b), 125 (d), and 130 (f) at 20 °C for 7.5 h (a

total dose of 0.45 kJ/cm2) in PBS. Asterisk (

*) indicates significant (P ≤ 0.05)

difference between non-illuminated control and illuminated cell counts.

* *

* *

3

4

5

6

7

0 0.1 0.2 0.3 0.4 0.5 Su

rviv

ors

(lo

g C

FU

/mL

)

Dose (kJ/cm2)

(a)

control 405 nm

* *

*

3

4

5

6

7

0 0.1 0.2 0.3 0.4 0.5 Su

rviv

ors

(lo

g C

FU

/mL

)

Dose (kJ/cm2)

(b)

control 405 nm

* *

* *

3

4

5

6

7

0 0.1 0.2 0.3 0.4 0.5 Su

rviv

ors

(lo

g C

FU

/mL

)

Dose (kJ/cm2)

(c)

control 405 nm

* *

* *

3

4

5

6

7

0 0.1 0.2 0.3 0.4 0.5 Su

rviv

ors

(lo

g C

FU

/mL

)

Dose (kJ/cm2)

(d)

control 405 nm

* *

* *

*

3

4

5

6

7

0 0.1 0.2 0.3 0.4 0.5 Su

rviv

ors

(lo

g C

FU

/mL

)

Dose (kJ/cm2)

(e)

control 405 nm

* *

* *

*

3

4

5

6

7

0 0.1 0.2 0.3 0.4 0.5 Su

rviv

ors

(lo

g C

FU

/mL

)

Dose (kJ/cm2)

(f)

control 405 nm

114

Table 7-1 Comparison of the decimal reduction dose (D-values)1 of three S.

Enteritidis strains treated with 405±5 nm LED illumination at 4 and 10 °C.

D-values (kJ/cm2)

Strains 4 °C ` 20 °C

SE124 0.34 ± 0.07aX

0.34 ± 0.05aX

SE125 0.30 ± 0.01abX

0.31 ± 0.06abX

SE130 0.23 ± 0.03bX

0.23 ± 0.01bX

1Different letters within a column

(a–b) and a row

(x) differ significantly (n=6; P

≤ 0.05).

7.3.3 Behavior of S. Enteritidis on cooked chicken surface during LED

illumination

The antibacterial efficacy of 405±5 nm LED illumination against three

S. Enteritidis strains on the surface of cooked chicken was investigated at 4,

10, and 20 °C (actual temperatures of 8.5, 14.5, and 24.5 °C), respectively, at

total doses of 1.58–3.80 kJ/cm2 (for 20–48 h) at an intensity of 22.0 mW/cm

2.

At a set temperature of 4 °C, the number of non-illuminated control cells

remained unchanged for 48 h, while populations of S. Enteritidis on cooked

chicken significantly (P ≤ 0.05) decreased by 0.5–0.6 CFU/cm2 during the first

12 h (a total dose of 0.95 kJ/cm2) during LED illumination (Figure 7–3). No

further inactivation was observed after 17 h (a total dose of 1.35 kJ/cm2).

Overall, LED illumination at 4 °C inactivated 0.8–0.9 log CFU/cm2 at a final

dose of 3.80 kJ/cm2 (for 48 h), regardless of bacterial strain.

115


Enteritidis 124 (a), 125 (b), and 130 (c) on the surface of cooked chicken at 4

°C.

Cells on the surface of non-illuminated cooked chicken at a set

temperature of 10 °C gradually grew to 7.0–7.3 log CFU/cm2 within 48 h,

whereas LED illumination inhibited the growth of S. Enteritidis cells until a

dose of 1.74 kJ/cm2 (for 22 h), and then slowly grew to 5.3–5.9 log CFU/cm

2

at the end of LED illumination of 3.80 kJ/cm2 (for 48 h) (Figure 7–4).

* * * * *

0.00 0.95 1.90 2.85 3.80

2

3

4

5

0 12 24 36 48

Dose (kJ/cm2)

Su

rviv

ors

(lo

g C

FU

/cm

2)

Time (h)

(a)

Control 405 nm

* * * * *

2

3

4

5

0 12 24 36 48

Su

rviv

ors

(lo

g C

FU

/cm

2)

Exposure time (h)

(b)

Control 405 nm

* * * *

*

2

3

4

5

0 12 24 36 48

Su

rviv

ors

(lo

g C

FU

/cm

2)

Exposure time (h)

(c)

Control 405 nm

116



°C.

Similarly, at room temperature, the number of cells on non-illuminated cooked

chicken rapidly increased to 10.2 10.4, and 9.5 log CFU/cm2 for S. Enteritidis

124, 125, and 130, respectively, for 20 h (a total dose of 1.58 kJ/cm2), while

populations of LED-illuminated cells reached to 8.7–9.0 log CFU/cm2 during

the same period of time, demonstrating that LED illumination retarded the

growth of S. Enteritidis cells on the surface of cooked chicken at set

temperatures of 10 and 20 °C, regardless of bacterial strain (Figure 7–5).

* * *

* *

0.00 0.95 1.90 2.85 3.80

2

3

4

5

6

7

8

0 12 24 36 48

Dose (kJ/cm2)

Su

rviv

ors

(lo

g C

FU

/cm

2)

Time (h)

(a)

Control 405 nm

* * *

*

*

2

3

4

5

6

7

8

0 12 24 36 48

Su

rviv

ors

(lo

g C

FU

/cm

2)

Exposure time (h)

(b)

Control 405 nm

* * *

* *

2

3

4

5

6

7

8

0 12 24 36 48

Su

rviv

ors

(lo

g C

FU

/cm

2)

Exposure time (h)

(c)

Control 405 nm

117



°C.

7.3.4 Injury of S. Enteritidis on cooked chicken treated with LED

illumination

To see if 405±5 nm LED illumination causes the sublethal injury of S.

Enteritidis, the percentage of injured cells was determined. Significant (P ≤

0.05) bacterial injury was observed in all S. Enteritidis strains on the surface of

cooked chicken during illumination at refrigeration temperatures (Figure 7–6

and 7–7). At 4 °C, the percentage of injured cells increased up to 65 and 68%

for S. Enteritidis 124 and 125, respectively, after LED illumination at a dose of

*

* *

* *

0.00 0.32 0.63 0.95 1.27 1.58

3

5

7

9

11

0 4 8 12 16 20

Dose (kJ/cm2)

Su

rviv

ors

(lo

g C

FU

/cm

2)

Time (h)

(a)

Control 405 nm

* *

* * *

3

5

7

9

11

0 4 8 12 16 20

Su

rviv

ors

(lo

g C

FU

/cm

2)

Exposure time (h)

(b)

Control 405 nm

* * *

* *

3

5

7

9

11

0 4 8 12 16 20

Su

rviv

ors

(lo

g C

FU

/cm

2)

Exposure time (h)

(c)

Control 405 nm

118


cells on the surface of cooked chicken at a set temperature of 4 °C.

2.85 kJ/cm2 (36 h) and 57% for S. Enteritidis 130 at the end of illumination

(48 h). At 10 °C, the maximum percentage of cell injury on illuminated

cooked chicken was 72% for S. Enteritidis 124 at the end of illumination (48

h), while similar percentages for S. Enteritidis 125 (70%) and 130 (77%) were

obtained at a dose of 2.85 kJ/cm2 (36 h). On the other hand, at room

temperature (20 °C), the number of illuminated cells that grew on both TSA

and XLD was similar for 20 h (a total dose of 1.58 kJ/cm2) (data not shown),

*

* *

* *

0

20

40

60

80

100

0 12 17 22 36 48

Inju

ry (

%)

(a)

Control 405 nm

Dose (kJ/cm2)

* *

* *

*

0

20

40

60

80

100

0 12 17 22 36 48

Inju

ry (

%)

Exposure time (h)

(b)

Control 405 nm

* * * * *

0

20

40

60

80

100

0 12 17 22 36 48

Inju

ry (

%)

Exposure time (h)

(c)

Control 405 nm

0.00 0.95 1.35 1.74 2.85 3.80

Time (h)

119

indicating that there was no significant (P > 0.05) injury, regardless of

bacterial strain.


cells on the surface of cooked chicken at a set temperature of 10 °C.

7.3.5 Sites of cellular damage caused by LED illumination

To elucidate the antibacterial mechanism of 405±5 nm LED

illumination, its influence on cellular components was determined using four

types of antibiotics, namely ampicillin, chloramphenicol, nalidixic acid, and

rifampicin as specific metabolic inhibitors for cell wall, protein, DNA, and

* *

* *

*

0

20

40

60

80

100

0 12 17 22 36 48

Inju

ry (

%)

(a)

Control 405 nm

Dose (kJ/cm2)

* * *

*

*

0

20

40

60

80

100

0 12 17 22 36 48

Inju

ry (

%)

Exposure time (h)

(b) Control 405 nm

* * *

*

*

0

20

40

60

80

100

0 12 17 22 36 48

Inju

ry (

%)

Exposure time (h)

(c) Control 405 nm

Time (h)

0.00 0.95 1.35 1.74 2.85 3.80

120

RNA synthesis, respectively (Ha and Kang, 2015). If any cellular component

is damaged by LED illumination, the illuminated cells would become more

sensitive to a specific antibiotic, resulting in its incapability to grow on TSA

containing the antibiotic. Since the behavior of three S. Enteritidis strains on

the surface of cooked chicken was not significantly (P > 0.05) different after

LED illumination, S. Enteritidis 130 was selected as a model strain in this

study. The percentages of non-illuminated and illuminated cells on cooked

chicken metabolically inhibited by each antibiotic are shown in Figure 7–8.

No significant (P > 0.05) difference in the percentage of metabolic inhibition

was observed in healthy (0 h) and non-illuminated control (22 h) cells for all

antibiotics, except for rifampicin in non-illuminated cells. In contrast, LED

illumination resulted in a significant (P ≤ 0.05) increase in the percentage of

injured cells (32.5, 24.2, 30.1, and 44.1 % for ampicillin, chloramphenicol,

nalidixic acid, and rifampicin, respectively) as compared with healthy and

Figure 7-8 Changes in metabolic inhibition of S. Enteritidis 130 caused by

ampicillin (Amp), chloramphenicol (Chl), nalidixic acid (Nal), and rifampicin

(Rif), respectively, after LED illumination on the chicken surface at 4 °C for

22 h. Different letters (A–C)

within the same antibiotic differ significantly (n=6;

P ≤ 0.05).

A

A

A

A

A

A

A

B B

B

B

C

0

10

20

30

40

50

Amp Chl Nal Rif

Me

tab

oli

c in

hib

itio

n (

%)

Control

Non-illuminated cell

Illuminated cells

121

non-illuminated cells. This indicates that the antibacterial effect of 405±5 nm

LED illumination at 4 °C on cooked chicken may be due in part to multi-

damage of metabolic activities associated with DNA, RNA, protein, and cell

walls in S. Enteritidis 130 cells.

7.4 Discussion

Photodynamic inactivation (PDI) by blue LEDs has attracted the

attention of researchers to its potential application for food preservation that

could minimize foodborne diseases. However, little work has been done to

determine the antibacterial effect of 405±5 nm LED illumination without the

addition of exogenous photosensitizers in food matrices as well as its

antibacterial mechanism. Thus, the present study evaluated the efficacy of

405±5 nm LED in inactivating three strains of S. Enteritidis in PBS and on the

surface of cooked chicken. The influence of LED illumination on synthesis of

DNA, RNA, protein, or cell wall was also determined to provide insights into

its antibacterial mechanism. The antibacterial effect of 405±5 nm LED

illumination was evaluated at temperatures simulating ideal refrigeration (4

°C), temperature abuse (10 °C), and room temperature (20 °C) conditions.

Although TSB mimics a food matrix because of its high nutrient content, PBS

was used in this study to eliminate the possibility of ROS formation from

nutrients such as glucose presented in TSB which are capable of autoxidation

using transition metal compounds as catalysts during LED illumination

(Grzelak et al., 2001).

122

Results show that temperature did not influence the antibacterial

efficacy of 405±5 nm LED illumination, inactivating 95–99% of cells of three

S. Enteritidis strains in PBS at the end of illumination (Figure 7–1 and Table

7–1). In contrast, a previous study using 460 nm LED against S. Typhimurium

in TSB demonstrated greater bactericidal effect at lower temperatures of 10

and 15 °C than a 20 °C (Ghate et al., 2013). This difference in illumination

temperature on the antibacterial efficacy of LED could be due to the nature of

a medium used for LED illumination. The presence of nutrients in suspending

medium such as TSB could enhance the ability of cells to repair injury caused

by LED illumination at room temperature. On the other hand, under similar

temperature conditions, damaged cells might not easily recover in PBS due to

the nutrient deficiency.

Unlike PBS, the efficacy of LED illumination on cooked chicken was

highly dependent on illumination temperature (Figure 7–2, 7–3, and 7–4). All

S. Enteritidis strains on the surface of cooked chicken were inactivated at 4 °C,

but they slowly and rapidly grew at 10 and 20 °C, respectively, during LED

illumination, indicating that the antibacterial effect of LED illumination is

enhanced at lower temperature. This might be because the ability to transport

solutes into Salmonella cells may be limited due to changes in membrane lipid

bilayer at lower temperatures, slowing down metabolic activities such as

protein and enzyme synthesis by inhibition of energy uptake and eventually

increasing sensitivity to LED illumination (Beales, 2004). Another possible

explanation could be the failure of illuminated cells to eliminate intracellular

ROS due to a lack of defense responses, such as activity of superoxide

dismutase (SOD) and catalase, at lower temperatures (Beales, 2004). In

123

contrast, as shown for illumination at 10 and 20 °C, growth on the surface of

cooked chicken may have due to the ability of cells to adapt to new

environments, such as light exposure under temperature abuse and room

temperature conditions, respectively (Dickson et al., 1992). Furthermore, near

neutral pH (pH 6.5–6.7) of cooked chicken might help the growth of

Salmonella during LED illumination. A previous study showed that S.

Typhimurium cells were significantly inactivated at acidic pH of 4.5 in TSB

for 7.5 h (a total dose of 0.60 kJ/cm2) at 15 °C by 460 nm LED illumination,

whereas only growth inhibition was observed at pH 6.0 and 7.3 (Ghate et al.,

2015). Another study demonstrated that 460 nm LED illumination inactivated

Salmonella cells in orange juice (pH 3.3–4.2) at room temperature than did

refrigeration temperature (Ghate et al., 2016). All of these results indicate that

illumination temperature and pH of the suspending medium may be primary

factors affecting the antibacterial effect of LED illumination.

A comparison of inactivation rates of three strains of S Enteritidis in

PBS during LED illumination showed that S. Enteritidis 130 was more

sensitive to illumination than the other two strains (Table 7–1) at temperatures

of 4 and 20 °C. Differences in sensitivity to LED illumination might be due to

the differences in types and levels of endogenous porphyrins as well as levels

of gene expressions associated with oxidation, starvation, and cold stresses

(Kumar et al., 2015). Unlike PBS, there was no significant (P > 0.05)

difference in sensitivity of Salmonella to LED illumination on the surface of

cooked chicken. Moreover, the antibacterial efficacy of 405±5 nm LED on

chicken was diminished (Figure 7–3, 7–4, and 7–5) compared to that in PBS.

This might be because the proteins in chicken meat exerted a neutralizing

124

effect on ROS, resulting in decreased antibacterial activity of LED

illumination (Juneja and Sofos, 2001). Results from the present study show

that antibacterial efficacy of LED illumination may be overestimated when

buffered solution is used as a suspending medium, thus it is necessary to

validate its efficacy with various food matrices.

To determine if 405±5 nm LED illumination causes sublethal damage to

Salmonella cells on the surface of cooked chicken, the percentage of injured

cells was calculated based on difference in colony numbers between TSA

(non-selective agar) and XLD (selective agar). Lipopolysaccharides (LPS) in

the outer membrane of Gram-negative bacteria repel hydrophobic molecules

such as bile salts outside the cells, thereby serving as a permeability barrier

(Ait-Ouazzou et al., 2012; Jasson et al., 2007). Membrane-damaged

Salmonella cells are theoretically unable to grow on XLD agar containing

sodium desoxycholate of bile salt (Stersky and Hedrick, 1972). Results in the

present study show that LED illumination significantly (P ≤ 0.05) increases

the percentage of cell injury at 4 and 10 °C (Figure 7–6 and 7–7) as compared

to that of non-illuminated cells, whereas no significant (P > 0.05) injury was

observed at 20 °C. This indicates that cell membranes may be substantially

injured by LED illumination at refrigeration temperatures, while damaged cell

membranes can repair at room temperature. Similarly, sensitivity to bile salts

and sodium chloride (NaCl) increases when S. Typhimurium cells are

illuminated by 405±5 nm LED at 4 °C, indicating damage to both outer and

cytoplasmic membranes due to a loss of outer membrane integrity and osmotic

functionality. Unlike the present results when cells were illuminated at 20 °C,

the previous study conducted by Ghate et al. (2013) showed that 461 nm LED

125

illumination for 7.5 h in TSB significantly (P ≤ 0.05) increased sensitivity of

cells to NaCl at 4 and 20 °C (84 and 33%, respectively), although the

percentage of injured cells at 20 °C was much lower. These different

observations may be due to differences in the selective agent and suspending

medium.

To obtain more concrete evidence on damage of cellular components by

ROS produced during LED illumination, specific metabolic inhibitions of S.

Enteritidis 130 cells on the surface of cooked chicken at 4 °C were evaluated

using four types of antibiotics. Nalidixic acid targets DNA replication by

binding to DNA gyrase (topoisomerase II) that introduces negative

supercoiling of DNA, forming topoisomerase–DNA complexes (Kohanski et

al., 2010). These complexes are trapped at the stage of DNA cleavage and

interrupt strand rejoining, resulting in inhibition of DNA synthesis. Rifampicin

inhibits the initiation of RNA synthesis by binding to DNA–dependent RNA

polymerase, especially to a β–subunit within the DNA/RNA channel

(Campbell et al., 2001). Chloramphenicol is an inhibitor of protein synthesis

by binding to 50S ribosome, which inhibits peptidyl transferase reactions by

disrupting either the translocation of peptidyl tRNAs or initiating protein

translation (Kohanski et al., 2010). Ampicillin, known as penicillin group of β-

lactam antibiotics, binds to penicillin-binding protein (PBP) enzymes, such as

transpeptidases which are responsible for catalysis of cross-linking reactions

located on the inner cell wall (Raynor, 1997). Inhibition of PBPs causes

irregularities in the structure of the cell wall by terminating the peptide chain

linkage and inhibiting synthesis of the peptidoglycan structure, resulting in

cell lysis and death (Raynor, 1997). However, some bacteria are resistant to

126

particular antibiotics and have an ability to acquire antibiotic resistance

through manipulating chromosomal genes and bacterial efflux pumps that

actively transport antibiotics out of the cells (Blair et al, 2015). There are also

several pathways to repair antibiotic–induced damage inside bacterial cells

(Blair et al, 2015). Thus, bacterial cells might be incapable of multiplying on

the selective medium containing one of antibiotics if LED illumination

influences the metabolism of DNA, RNA, protein, or cell wall.

Results of this study show that RNA synthesis inhibition by rifampicin

occurred in illuminated and non-illuminated cells, but not healthy control

cells. The primary reason for this may be due to the effect of refrigeration

temperature (4 °C), although a synergistic effect of LED illumination at low

temperature resulted in a higher level of RNA synthesis inhibition. It is known

that RNA polymerase is sensitive to temperature change (Sawai et al., 1995),

and thus refrigeration temperature might reduce RNA polymerase activity.

Similar to the present result, Ha and Kang (2015) also reported only RNA

synthesis inhibition by rifampin when S. Typhimurium cells on sliced cheese

were treated with near-infrared heating (NIR), while NIR and ultraviolet

irradiation (NIR-UV) treatment inhibited not only RNA metabolism but also

DNA, protein, and cell wall metabolism. RNA metabolic inhibition resulting

from both treatments could be caused by temperature elevation to 74 °C within

70 s during the treatments, which implies that RNA polymerase could be

sensitive to the fluctuation either at low or high temperature.

Compared to non-illuminated cells, LED illumination additionally

caused a higher level of metabolic inhibition in the presence of nalidixic acid,

chloramphenicol, or ampicillin. This might be because ROS generated during

127

LED illumination could nonspecifically attack bacterial membrane proteins

and enzymes related to the metabolism of cellular components and antibiotic

resistance and also oxidize guanine residues in genomic DNA, producing

oxidized derivatives such as 8–hydroxydeoxyguanosine (8-OHdG) (Joshi et

al., 2011; Sies and Menck, 1992). Consequently, LED-illuminated cells might

lose their resistance to these antibiotics. For instance, Salmonella are generally

resistant to ampicillin due to its ability to produce β-lactamase in order to

hydrolyze the β-lactam ring or due to impermeability of the cell membrane

(Raynor, 1997). However, ROS generated from LED illumination may

inactivate β-lactamase or increase the membrane permeability by oxidizing

fatty acids in cell membranes, making Salmonella sensitive to ampicillin. The

results obtained from LIVE/DEAD® BacLight™ assay in PBS in Chapter 3

also confirmed the loss of cell membrane integrity caused by 405±5 nm LED

illumination, partially supporting this assumption.

7.5 Conclusions

The present study demonstrates that LED illumination effectively

reduces S. Enteritidis on the surface of cooked chicken at refrigerated

temperatures, but has no antibacterial effect under temperature abuse (10 °C)

and room temperature (20 °C) conditions. However, the antibacterial efficacy

of LED illumination on cooked chicken is greatly diminished compared to that

in PBS. S. Enteritidis 130 in PBS was identified as the most sensitive strain to

LED illumination compared to the other two strains, but no difference was

observed when the three strains were illuminated on the surface of cooked

chicken. Furthermore, multi-damage to cellular components, including DNA,

128

RNA, protein, and cell wall, by LED illumination at refrigeration temperatures

were confirmed. Thus, the present study provides new insights to better

understand the value of using 405±5 nm LED in chillers and food

establishments to control Salmonella on cooked chicken, thereby reducing the

risk of salmonellosis.

129

Chapter 8

Elucidation of antibacterial mechanism of 405±5 nm LED

against Salmonella at refrigeration temperature

8.1 Introduction

Since Salmonella cells may encounter oxidative stress by ROS during

LED illumination, it is crucial to understand their response to LED

illumination in elucidating its antibacterial mechanism. Although the

molecular response of Salmonella cells to general oxidative stress has been

well documented (Farr and Kogoma, 1991), their response to LED

illumination at the molecular level is still unknown. Furthermore, no studies

have been conducted to find whether the difference in gene regulations

influences the bacterial susceptibility to LED illumination. Therefore, the

objective of this study was to elucidate the detailed antibacterial mechanism of

405±5 nm LED illumination on Salmonella spp. by determining endogenous

coproporphyrin content, DNA oxidation, damage to membrane function,

morphological change, and regulatory gene expression level during LED

illumination under chilling conditions.

130


8.2.1 Bacterial culture conditions

Eighteen Salmonella enterica strains used in this study were S. Agona

BAA-707; S. Enteritidis ATCC 13076, S. Gaminara BAA-711, S. Heidelberg

ATCC 8326, S. Montevideo BAA-710, S. Newport ATCC 6962, S. Poona

BAA-1673, S. Saintpaul ATCC 9712, S. Tennessee ATCC 10722, S.

Typhimurium ATCC 14028, S. Typhimurium ATCC 13311, S. Typhimurium

ATCC 25241, S. Typhimurium ATCC 29269, and S. Typhimurium ATCC

51812 purchased from the ATCC and S. Enteritidis 109 (phage type Group

D1; Peter Holt), S. Enteritidis 124, S. Enteritidis 125, and S. Enteritidis 130

obtained from Dr. Kun-Ho Seo of Konkuk University in Republic of Korea.

All Salmonella strains were stored at –70 °C into each cryoinstant vial. The

working culture was prepared as described in Chapter 3.2.1.


LED illumination system was described in Chapters 3.2.2 and 3.2.3. The

bacterial suspension (10 mL volume and 1 cm depth) into a sterile Petri dish

(60 mm diameter) or streak-plated agar plate (90 mm diameter) was directly

placed below the LED bulbs at a distance of 4.5 cm to illuminate the whole

Petri dish as previously described. The irradiance (W/cm2) of a 405±5 nm

LED unit was 20±2 mW/cm2 at the bacterial suspension.

8.2.3 Sensitivity of Salmonella strains to LED illumination

To select the susceptible and the resistant Salmonella strains to LED

illumination, a 10-µL bacterial suspension of 18 Salmonella strains (ca. 106

131

CFU/mL) was pipetted and streaked in an individual line of length ca. 3 cm

using an inoculating loop onto the surface of TSA plate. The inoculated plates

were placed in the LED system as previously described and exposed to 405±5

nm LED at a set temperature of 4 °C for 4 h (a total dose of 288 J/cm2) in an

incubator. Non-illuminated control plates were also placed in an incubator in

the dark. After illumination, plates were incubated at 37 °C for 24 h and then

were visualized using a G:Box EF2 Imaging System.

8.2.4 LED illumination on bacterial suspension and enumeration

Based on the results above, a 10-mL suspension of S. Enteritidis (ATCC

13076) and S. Saintpaul at an initial population of ca. 106 CFU/mL in a sterile

Petri dish was placed in the LED illumination system, followed by exposure to

LED illumination at a set temperature of 4 °C for 8 h (a total dose of 576

J/cm2). The same amount of bacterial suspension in a sterile Petri dish was

placed in an incubator without LED illumination (dark condition) and served

as non-illuminated control. A 0.5-mL aliquot was taken at selected time

intervals and then enumerated as described in Chapter 3.2.4.

8.2.5 Analysis of intracellular coproporphyrin content

A 100-mL culture of S. Enteritidis (ATCC 13076) and S. Saintpaul at

the stationary phase in TSB was centrifuged at 6,000 × g for 10 min at 4 °C,

washed thrice with 20 mL of PBS, and finally dried at 45 °C for 2 h.

Intracellular coproporphyrin was extracted from the dried pellets with a 0.1 M

NH4OH:acetone solution (1:9, v/v). The extracts were quantified using a C-18

reversed-phase silica column and a Waters 2695 HPLC system equipped with

132

a Multi λ fluorescent detector at 407 nm excitation and 612 nm emission.

Elution was carried out with a gradient separation consisting of water (Solvent

A) and acetonitrile (Solvent B). A standard curve was prepared in the

concentration range of 0–10 μg/mL of coproporphyrin I dihydrochloride

(Sigma-Aldrich). The amount of coproporphyrin was expressed in ng

coproporphyrin/mg dried cells.

8.2.6 Analysis of cellular DNA oxidation

A 10-mL bacterial suspension (ca. 108 CFU/mL) was illuminated at a set

temperature of 4 °C for 8 h (a total dose of 576 J/cm2). The degree of cellular

DNA oxidation was measured as described in Chapter 5.2.7.

8.2.7 Determination of damage to bacterial membrane function

To investigate damage to bacterial membrane function by LED

illumination, five different fluorescent probes including SYTO®9 and PI,

ethidium bromide (EtBr; Sigma-Aldrich), bis-(1,3-dibutylbarbituric acid)

trimethine oxonol [DiBAC4(3); Molecular Probes™

], and 2-[N-(7-nitrobenz-2-

oxa-1,3-diazol-4-yl) amino]-2-deoxy-D-glucose (2-NBDG; Molecular

Probes™

) were used in this study. The cellular target sites for the five probes

are depicted in Figure 8–1. A 10-mL bacterial suspension (ca. 106 CFU/mL) of

S. Enteritidis (ATCC 13076) or S. Saintpaul was illuminated at a set

temperature of 4 °C for 8 h (a total dose of 576 J/cm2). A 0.5-mL or 1-mL

aliquot was withdrawn at 4 and 8 h (at total doses of 288 and 573 J/cm2) of

illumination. Each 200-μL aliquot was immediately stained with two mixed

probes (SYTO®

9/PI or SYTO®

9/EtBr) and three single probes (SYTO®9,

133

DiBAC4(3), and 2-NBDG). Before staining cells, 2.0 mM of 2,4-dinitrophenol

(2,4-DNP; Sigma-Aldrich) was added in 2-NBDG. The working

concentrations of SYTO®9, PI, EtBr, DiBAC4(3), and 2-NBDG were 5, 30,

30, 10, and 5 μM, respectively. The mixtures were incubated at 37 °C for 10

min for 2-NBDG or at room temperature and for 15 min for SYTO®9, PI,

EtBr, and DiBAC4(3) in the dark. The mixtures were measured using a BD

Accuri™

C6 flow cytometer

Figure 8-1 Cellular target sites for fluorescent probes. A loss of specific

membrane functions is measured with fluorescent probes equipped with flow

cytometry; efflux pump activity with EtBr; glucose uptake activity [glucose-

specific phosphoenolpyruvate-phosphotransferase system (PEP-PTS)] with 2-

NBDG; depolarization with DiBAC4(3); permeability with PI; and total counts

with SYTO®9.

(Accuri Cytometers Inc., Ann Arbor, MI, USA) equipped with a blue laser

that excites at 488 nm and 5 detectors of forward scatter (FSC), side scatter

(SSC), green fluorescent filter (FL1; 533/30 nm), orange fluorescent filter

EtBr

Efflux pump

PI

Sy

to®9

DiB

AC

4(3

)

2-NBDG

134

(FL2; 585/40 nm), red fluorescent filter (FL3; 670 nm). The detectors were set

up FL1 for SYTO®9, FL3 for PI and EtBr, and FSC and SSC for DiBAC4(3)

and 2-NBDG.

8.2.8 Transmission electron microscopy (TEM)

Ten Petri dishes containing 10-mL suspension (ca. 109 CFU/mL) of S.

Enteritidis (ATCC 13076) were individually placed in the LED system for

illumination at a set temperature of 4 °C for 10 h (a total dose of 720 J/cm2).

Ten sets of non-illuminated control cells were also stored for 10 h in the dark

condition. Bacterial suspension pooled from ten Petri dishes was centrifuged

at 6,000 × g for 10 min at 4 °C to obtain the bacterial population of ca. 1011

CFU/sample. The resultant pellet was fixed with 2.5 % (v/v) glutaraldehyde

(Sigma-Aldrich) in PBS (pH 7.4) by incubating overnight at 4 °C, washed

twice using 25 mL of PBS, and stored at 4 °C prior to TEM analysis.

Bacterial sample was post fixed in 1% osmium tetroxide (pH 7.4) for 2

h at room temperature, washed twice with distilled H2O for 10 min, and

dehydrated through an ascending ethanol series (25% ethanol for 5 min, 50%

ethanol for 10 min, 75% ethanol for 10 min, 95% ethanol for 10 min, 100%

ethanol for 10 min, and 100% acetone for 10 min) at room temperature. The

fixed sample was infiltrated with a 1:1 mixture of 100% acetone and araldite

resin (Pelco International, Redding, CA, USA) for 30 min and then infiltrated

with a 1:6 mixture of 100% acetone and araldite resin for overnight at room

temperature. The filtrated sample was placed in fresh araldite resin for 1 h at

45 °C trice, embedded in fresh araldite resin, and cured in an oven at 60 °C for

24 h. After curing, the sample was sectioned and mounted on copper grids

135

(200 mesh, Pelco International), followed by staining with Reynols’ lead

citrate (Reynol, 1963). The stained sample was examined with a JEOL JEM

1010 transmission electron microscope (JEOL Asia Ltd. Tokyo, Japan).

8.2.9 Total RNA isolation and real-time qRT-PCR

After LED illumination on S. Enteritidis (ATCC 13076) and S.

Saintpaul at a set temperature of 4 °C for 1 h, the total RNAs of illuminated

cells were isolated with a RNeasy Mini Kit (Qiagen Inc., Hilden, Germany)

according to manufacturer’s instructions. The total RNAs of fresh cultured

cells and non-illuminated cells stored at 9.5 °C without LED illumination were

also extracted by the same method. The purified RNA was dissolved in 50 μL

of RNase-free water. The purity and the concentration of extracted RNA were

determined by the BioDrop Touch Duo Spectrophotometer. The integrity of

total RNA was evaluated by 1% (w/v) agarose gel electrophoresis.

One microgram of total RNA was converted to complementary DNA (cDNA)

using a QuantiTect Reverse Transcription Kit (Qiagen Inc.) according to

manufacturer’s instructions. Real-time quantitative reverse transcription-

polymerase chain reaction (real-time qRT-PCR) was carried out with a

StepOnePlus Real-Time PCR System (Applied Biosystems, Carlsbad, CA,

USA) to determine the relative expression level of oxyR, recA, rpoS, sodA, and

soxR genes in non-illuminated or illuminated cells. All primers used in this

study were designed using a Primer Expression Software 3.0 (Applied

Biosystems) on a basis of the nucleotide sequence derived from NCBI

database (accession number NC_011294.1). 16S rRNA was used as the

reference gene and the primer sequence was obtained from Yang et al. (2014).

136

The detailed information of these target genes and primer sequences is listed

in Table 8–1. A 20-μL reaction mixture contained the following components:

10 μL of Fast SYBR Green Master Mix (Applied Biosystems), 1 μL of 0.5 μM

forward primer, 1 μL of 0.5 μM reverse primer, 1 μL of template cDNA, and 7

μL of PCR water. Thermal cycling conditions consisted of 1 cycle at 95 °C for

20 s, followed by 40 cycles at 95 °C for 3 s and 60 °C for 30 s. The absence of

DNA contamination as a negative control was confirmed by reactions without

reverse transcriptase. The changes in relative gene expression were calculated

with the 2–ΔΔCt

method (Yang et al., 2014).

Table 8-1 Gene functions and primer sequences.

Gene Functiona Primer sequence (5’ to 3’)

Size

(bp)

oxyR A regulator of hydrogen

peroxide detoxification

F:ACCCTTAGCGGGCAAATACG

R:CGTACGCTCCAGCAGCATAA

62

sodA Encoding manganese

superoxide dismutase

F:CCCTGCCGTACGCTTATGA

R:TGACATAGGTTTGATGGTGTTTGG

89

soxR A regulator of resistance

to superoxide-generating

agents

F:GGCGACGCGTTTGGTATC

R:CACTGCGAGGAGAGCTGCTT

73

recA Induction of SOS

response and repair of

DNA damage

F:TCGCCGTTGTAGCTGTACCA

R:GGTTGACCTGGGCGTGAA

65

rpoS A regulator of general

stress responses (e.g.,

carbon starvation, acid

stress, oxidative stress)

F:CCACCAGGTTGCGTATGTTG

R:CCGTGCAGTCGAGAAGTTTG

63

F, forward; R, reverse; bp, base pairs

a Function referred to Farr and Kogoma (1991)


Statistical analysis was described in Chapter 3.2.10.

137

8.3 Results

8.3.1 Temperature changes by LED illumination

Temperature changes of TSA and PBS during 405±5 nm LED

illumination were monitored over a 5-hour period with a 1-min interval at a set

temperature of 4 °C to determine the temperature condition for non-

illuminated control cells. LED illumination increased by approximately 4.5 °C

on the surface of TSA and PBS within 1 h (data not shown). Thus, non-

illuminated control cells were held at 9.5 °C to eliminate the difference in

temperatures between LED illumination and non-illuminated conditions.

8.3.2 Antibacterial efficacy of LED illumination against different

Salmonella strains

Eighteen Salmonella enterica strains plated onto the surface of a TSA

plate were illuminated with 405±5 nm LED for 4 h (a total dose of 288 J/cm2)

at a set temperature of 4 °C to select the susceptible and resistant Salmonella

strains. This experiment was performed in independent triplicate with

duplicate plates (n=6) and the representative photographs are presented in

Figure 8–2. The results show that S. Enteritidis (ATCC 13076) and S.

Saintpaul (ATCC 9712) were the more susceptible and resistant strains to

LED illumination, respectively, than the other strains. Thus, these two strains

were selected for further experiments.

The bacterial suspensions of S. Enteritidis and S. Saintpaul were

illuminated with 405±5 nm LED at a set temperature of 4 °C for 8 h (a total

dose of 576 J/cm2) to quantitatively evaluate the bacterial inactivation.

138

Regardless of bacterial strain, non-illuminated control cell numbers remained

unchanged for 8 h, whereas the populations of LED-illuminated S. Enteritidis

and S. Saintpaul cells were significantly (P ≤ 0.05) decreased after 2 h (Figure

8–3). The difference in bacterial inactivation between the two strains was

Figure 8-2 Antibacterial effect of 405±5 nm LED illumination against 18

Salmonella spp. for 4 h at 4 °C (actual temperature at 9.5 °C) on TSA plates;

non-illuminated Salmonella spp. (a) and LED-illuminated Salmonella spp. (b).

Lane: 1, S. Agona; 2, S. Enteritidis ATCC 13076; 3, S. Enteritidis 109; 4, S.

Enteritidis 124; 5, S. Enteritidis 125; 6, S. Enteritidis 130; 7, S. Gaminara; 8, S.

Heidelberg; 9, S. Montevideo; 10, S. Newport; 11, S. Poona; 12, S. Saintpaul;

13, S. Tennessee; 14, S. Typhimurium ATCC 14028; 15, S. Typhimurium

ATCC 13311; 16, S. Typhimurium ATCC 25241; 17, S. Typhimurium ATCC

29269; 18, S. Typhimurium ATCC 51812.

(b)

(a)

139

obvious after 4 h of illumination. The populations of S. Enteritidis and S.

Saintpaul were reduced by 2.0 and 1.0 log CFU/mL at 4 h of illumination, and

by 5.6 and 1.7 log CFU/mL at the end of illumination, respectively. Thus,

these results indicate that S. Enteritidis was more susceptible to 405±5 nm

LED illumination than S. Saintpaul.

Figure 8-3 Survival curves of S. Enteritidis ATCC 13076 (a) and S. Saintpaul

ATCC 9712 (b) during 405±5 nm LED illumination at a set temperature of 4

°C for 8 h (a total dose of 576 J/cm2) in PBS. The detection limit was 1

CFU/mL. Asterisk (*) indicates significant (P ≤ 0.05) difference between

illuminated and non-illuminated control cells.

8.3.3 Intracellular coproporphyrin contents

The amounts of intracellular coproporphyrin compounds produced in

the stationary phase S. Enteritidis and S. Saintpaul cells were quantified to

understand the different inactivation patterns between the two strains. The

total amounts of the coproporphyrin in S. Enteritidis and S. Saintpaul were

61.1 and 46.5 ng/mg, exhibiting no significant (P > 0.05) difference between

the two strains (Figure 8–4).

*

*

* 0

1

2

3

4

5

6

7

0 2 4 6 8

Su

rviv

ors

(lo

g C

FU

/mL

)

Exposure time (h)

(a)

Control

405 nm

* *

*

0

1

2

3

4

5

6

7

0 2 4 6 8 Su

rviv

ors

(lo

g C

FU

/mL

)

Exposure time (h)

(b)

Control

405 nm

140

Figure 8-4 The amount of coproporphyrin extracted from stationary phase

bacterial cells. A letter (a)

between the two strains did not differ significantly

(n=6; P > 0.05).

8.3.4 DNA oxidation

After exposure to LED illumination for 8 h (5.1 and 1.9 log reductions

for S. Enteritidis and S. Saintpaul, respectively), genomic DNAs were

extracted from illuminated cells and the degree of DNA oxidation was

measured to determine whether ROS produced during LED illumination

oxidize Salmonella DNA, especially guanine. The levels of 8-OHdG in LED-

illuminated S. Enteritidis and S. Saintpaul were 2.8 and 2.6 times higher (P ≤

0.05) than those of non-illuminated cells, respectively, but there was no

significant (P > 0.05) difference in the level of 8-OHdG between the two

strains (Figure 8–5).

a

a

0

20

40

60

80

100

S. Enteritidis S. Saintpaul

Co

pro

po

orp

hyri

n

(ng

/mg

)

141

Figure 8-5 Change in the level of 8-hydroxydeoxyguanosine (8-OHdG) of S.

Enteritidis (a) and S. Saintpaul (b) by 405±5 nm LED illumination at a set

temperature of 4 °C. Different letters (a–b)

in the same bar are significantly (P ≤

0.05) different from each other.

8.3.5 Damage to bacterial membrane function

Damage to bacterial membrane function was observed using flow

cytometry with five probes (Figure 8–1) and SYTO®9, PI, and EtBr bind to

nucleic acids. Green fluorescing SYTO®

9 enters bacterial cells through both

intact and damaged bacterial membranes, while red fluorescing PI only

penetrates the damaged cytoplasmic membrane (see Chapters 3 and 4) . Red

fluorescing EtBr is only able to enter non-pumping cells since intact cells can

actively pump out EtBr through the efflux pump, a non-specific proton

transport system (Benrney, Weilenman, and Egli, 2006). When two probes of

SYTO®9 and either PI or EtBr coexist into the cells, the intensity of SYTO

®9

is reduced. Green fluorescing DiBAC4(3) binds to intracellular proteins by

entering in the cells through depolarization or damaged cytoplasmic

membrane (Benrney, Weilenman, and Egli, 2006). 2-NBDG, as a fluorescent

glucose analogue, is able to monitor the glucose uptake via the glucose-

a a

a

b

0

10

20

30

0 8

ng

8-O

Hd

G /

mg

DN

A

Exposure time (h)

(a)

Control 405 nm

a a

a

b

0

10

20

30

0 8

Exposure time (h)

(b)

Control 405 nm

142

specific PEP-PTS in intact cells as an indicator of cellular viability (Benrney,

Weilenman, and Egli, 2006).

The percentages of loss of membrane functions were calculated based

on flow cytometry plot (Figure 8–6) and presented in Figure 8–7. Results

showed that no significant (P ≤ 0.05) changes in their membrane functions

were observed in non-illuminated control cells stored at 9.5 °C for 8 h, except

for the glucose uptake activity in S. Enteritidis (Figure 8–7). On the other

hand, the percentages of the loss of efflux pump activity increased up to 98%

for S. Enteritidis and 99% for S. Saintpaul after 4 h of illumination (Figure 8–

7a). The flow cytometry plot (Figure 8–6) also clearly showed the increase in

the intensity of red fluorescing EtBr in illuminated S. Enteritidis cells

compared to fresh cultured cells. For glucose uptake activity, the loss

Figure 8-6 Flow cytometry plots of S. Enteritidis cells stained with

SYTO®9/EtBr, SYTO

®9/PI, DiBAC4(3), or 2-NBDG after 405±5 nm LED

illumination at a set temperature of 4 °C.

143

Figure 8-7 Changes in cellular functions of S. Enteritidis and S. Saintpaul

during 405±5 nm LED illumination at a set temperature of 4 °C. Loss of efflux

pump activity with SYTO®9/EtBr (a); loss of glucose uptake activity with 2-

NBDG (b); Loss of membrane potential with DiBAC4(3); loss of membrane

integrity stained with SYTO®9/PI (d). Uppercase letters

(A–C) in the same bar

and lowercase letters (a–c)

in the same exposure time are significantly (P ≤

0.05) different one another.

percentages were 76% for S. Enteritidis and 67% for S. Saintpaul after 4 h of

illumination and then increased up to 99% for both strains at the end of

illumination (Figure 8– 7b). In contrast, the percentages of membrane

depolarization and permeability were slightly increased by LED illumination

and the difference between non- illuminated and illuminated cells was only

less than 10%; however, the difference was still significant (P ≤ 0.05) (Figure

8–7c and d). There were no differences in the degree of damages to membrane

bA bA aA

aA aA

aA

bA

cB bB

aA

cB bB

0

20

40

60

80

100

0 4 8

Lo

ss

o

f e

fflu

x p

um

p

ac

tivit

y (

%)

Exposure time (h)

(a)

aA

bB

bB

aA aA

aA aA

cB

cC

aA

cB

cC

0

20

40

60

80

100

0 4 8

Lo

ss

of

glu

co

se

up

tak

e

ac

tivit

y (

%)

Exposure time (h)

(b)

aA aA aA aA aA aA aA

bB bB

aA bAB bB

0

20

40

60

80

100

0 4 8

Dep

ola

riza

tio

n (

%)

Exposure time (h)

(c)

bA bcA abA aA aA aA

bA

cAB cB

aA abAB

bB

0

20

40

60

80

100

0 288 576

Pe

rme

ab

ilit

y (

%)

Exposure time (h)

(d)

Control S. Enteritidis

Control S. Saintpaul

LED-illuminated S. Enteritidis

LED-illuminated S. Saintpaul

144

functions between S. Enteritidis and S. Saintpaul after LED illumination,

except for membrane permeability that showed 8.6% higher permeability in S.

Enteritidis than that of S. Saintpaul.

8.3.6 Transmission electron microscopy analysis

To obtain the concrete evidence on the antibacterial mechanism of

405±5 nm LED illumination, changes in the external and internal cell

structures were analyzed by TEM. S. Enteritidis was chosen as a model strain

for this analysis. TEM images revealed that the cytoplasm of non-illuminated

cells was evenly distributed without the aggregation of cellular components

(Figure 8–8a and b), while LED-illuminated cells had an altered appearance

Figure 8-8 Micrographs of non-illuminated and LED-illuminated S. Enteritidis

cells at a set temperature of 4 °C for 10 h (a total dose of 720 J/cm2): (a), non-

illuminated control cells at 10,000 ×; (b), non-illuminated control cells at

40,000 ×; (c), LED-illuminated cells at 10,000 ×; (d), LED-illuminated cells

at 40,000 ×. The morphological change in illuminated cells is highlighted by

an arrow.

145

with disorganization of the genomic area (Figure 8–8c and d). Thus, these

results indicate that LED illumination primarily induces intracellular damage

rather than outer membrane damage, although some of both non-illuminated

and illuminated cells showed an indistinctive outer membrane with a collapsed

shape.

8.3.7 Changes in gene expression levels by LED illumination

The levels of the relative gene expression in non-illuminated and

illuminated S. Enteritidis and S. Saintpaul cells are presented in Figure 8–9.

The results showed that only oxyR gene was upregulated in both non-

illuminated and illuminated S. Enteritidis cells (Figure 8–9a), whereas the

transcription levels of all genes (oxyR, recA, rpoS sodA, and soxR) were up-

regulated in non-illuminated and illuminated S. Saintpaul cells (Figure 8–9b).

Figure 8-9 Relative expression levels of oxyR, sodA, soxR, recA, and rpoS of

non-illuminated and LED-illuminated cells of S. Enteritidis (a) and S.

Saintpaul (b) at a set temperature of 4 °C for 1 h (a total dose of 72 J/cm2).

Asterisk (*) indicates significant (P ≤ 0.05) difference between illuminated

and non-illuminated control counts.

*

0

1

2

3

4

5

oxyR recA rpoS sodA soxR

Rela

tive

Ex

pre

ss

ion

L

eve

ls (

2-ΔΔ

Cт )

(a)

Control cells

Non-illuminated cells

Illuminated cells

*

0

1

2

3

4

5

oxyR recA rpoS sodA soxR

(b)

146

Among the five genes, the transcription level of oxyR in both strains was

significantly (P ≤ 0.05) different between non-illuminated and illuminated

cells; however, the transcription level of oxyR was 1.5 times higher in

illuminated S. Enteritidis, but 1.4 times lower in illuminated S. Saintpaul

compared to that of non-illuminated cells.

8.4 Discussion

The findings presented in Chapters 3 and 4 have demonstrated that the

antibacterial efficacy of 405±5 nm LED varied by bacterial species. In

addition, these studies also confirmed that LED illumination could damage

bacterial membrane using LIVE/DEAD® BacLight Kit. However, the

effectiveness of LED illumination at the same species level and its detailed

antibacterial mechanism has not been studied yet. Thus, the present study was

designed to assess the efficacy of LED against different Salmonella strains and

to elucidate its antibacterial mechanism at the membrane and gene levels as

well as to identify the factor influencing differences in the bacterial sensitivity

to LED illumination.

In this study, the antibacterial effect of 405±5 nm LED was evaluated at

a set temperature of 4 °C to simulate chilling conditions because effectiveness

of LED illumination was enhanced at chilling temperatures rather than room

temperature (Ghate et al., 2013, Chapter 5–7). The results showed that the

antibacterial efficacies of 405±5 nm LED illumination varied with Salmonella

strains on TSA plates (Figure 8–2), exhibiting that S. Enteritidis ATCC 13076

and S. Saintpaul ATCC 9712 were identified as the more susceptible and

resistant strains, respectively, than the other strains. Four S. Typhimurium and

147

five S. Enteritidis strains also exhibited the different sensitivities to LED

illumination, respectively. The difference in the sensitivity to LED

illumination between S. Enteritidis ATCC 13076 and S. Saintpaul ATCC 9712

was more obvious in PBS than on TSA (Figure 8–3). Thus, these results

indicate that the efficacy of LED illumination might be dependent on bacterial

strains rather than serotype.

In contrast to the present study, Endarko et al. (2012) reported that the

similar sensitivity to 405 nm LED among three different Listeria spp. (L.

ivanovii, L. monocytogenes, and L. seeligeri) in PBS, while other bacteria,

including S. Enteritidis, S, sonnei, L. monocytogenes, and E. coli, had the

different sensitivities to it. Another study conducted with 405 nm LED in PBS

showed that 5 log reductions of L. monocytogenes, S. sonnei, and E. coli

O157:H7 were achieved at different irradiation doses (Murdoch et al.,

2012).Similar to the results obtained in this study, variations in bacterial

sensitivities to other nonthermal technologies were also reported. For example,

the study conducted by Patteron et al. (1995) showed that the efficacy of high

hydrostatic pressure treatment varied by species and strains within the same

species. Gayán et al. (2012) also showed similar findings for different

sensitivities to UV light among five different Salmonella strains, revealing that

S. Enteritidis ATCC 13076 and S. Typhimurium STCC 878 were the most

sensitive and resistant, respectively.

Bacterial inactivation to LED illumination without the addition of

exogenous photosensitizers is theoretically due to the formation of

intracellular ROS by the excited endogenous porphyrins naturally presented in

the cells, which could nonspecifically damage cellular components such as

148

DNA, proteins, and lipids, eventually causing cell death (see Chapter 3;

Luksienė and Zukauskas, 2009). It is known that protoporphyrin IX, one of

endogenous photosensitizers, is localized in the cytoplasm and is catalyzed by

ferrochelatase that is one of cytoplasmic enzymes to incorporate iron in the

final step of heme synthesis (Thöny-Meyer, 2009). Thus, it is hypothesized

that the different photodynamic inactivation rate between S. Enteritidis and S.

Saintpaul might be attributed to the different levels of endogenous porphyrin

compounds. Since coproporphyrin is a precursor of protoporphyrin IX

(Hamblin and Hasan, 2004), the total amounts of coproporphyrin in two

Salmonella strains were quantified by HPLC in this study.

The present data showed that there was no significant (P > 0.05)

difference in the amounts between the two strains, indicating that

coproporphyrin content was not a contributing factor to the difference in the

bacterial sensitivity to LED illumination (Figure 8–4). Similar results were

also found in the study conducted by Kumar et al. (2015) who showed that S.

Typhimurium produced higher amounts of coproporphyrin than that of E. coli

O157:H7, but the inactivation rate was opposite. In addition, B. cereus with

higher amounts of coproporphyrin than S. aureus was less susceptible to LED

illumination than S. aureus. Thus, all these data indicate that there might be no

noticeable relationship between the levels of coproporphyrin and the

inactivation rate among the bacterial species, suggesting that other factors,

such as the extent of cellular damage and the bacterial response to LED

illumination, could influence the difference in the bacterial susceptibility to

LED illumination.

149

Since cellular DNA is supposed to be the major targets of ROS

generated by LED illumination, the oxidized derivative of 8-OHdG was firstly

analyzed to find out whether LED illumination causes DNA oxidation. The

present results showed that the levels of 8-OHdG in both S. Enteritidis and S.

Saintpaul cells were significantly increased after LED illumination,

confirming that 405±5 nm LED could oxidize genomic DNA by generating

intracellular ROS (Figure 8–5). However, there was no difference in the

degrees of DNA oxidation between the two strains. Similar to the present

results, some studies reported DNA oxidation in S. Typhimurium by 365 nm

LED illumination (Hamano et al., 2007) and in E. coli by illumination at 407

nm with the addition of terta-meso (N-methylpyridyl) porphine (TMPyP), one

of exogenous photosensitizers (Salmon-Divon, Nitzan, and Malik, 2004).

Loss of cellular membrane functions by LED illumination was

measured using flow cytometry. The results showed that LED illumination

completely inactivated efflux pumps (Figure 8–6 and 7a). Efflux pumps as

transport proteins are localized and embedded in bacterial cytoplasmic

membrane, which recognizes unwanted agents such as antibiotics and EtBr

from the environment or cytotoxic products produced during metabolism

(Amaral et al., 2014). To move noxious agents from the inside out, efflux

pump utilizes energy sources through the proton motive force (PMF) or ATP

synthesis (Amaral et al., 2014). Thus, one possibility for rationalizing loss of

efflux pump activity is that intracellular ATP is depleted due to the inhibition

of ATPase by ROS (Berney, Weilenmann, and Egli, 2006; Christena et al.,

2015). This is also associated with the abortion of DNA replication, resulting

in no bacterial growth (Christena et al., 2015). A previous study conducted by

150

Berney, Weilenmann, and Egli (2006) demonstrated that UV-A light rapidly

diminished a total of ATP and simultaneously inactivated efflux pump

activity.

Another possibility is due to ROS generated from cytochromes

containing a heme prosthetic group in the cytoplasmic membranes by LED

illumination (Thöny-Meyer, 2009), which could attack nearby efflux pumps.

Nitzan and Ashkenazi (2001) reported that 405 nm illumination with the

addition of TMPyP not only damaged the sodium-potassium pump but also

inactivated other enzymes such as NADH dehydrogenase and lactate

dehydrogenase. Based on these results, it is also speculated that intracellular

ROS produced from LED illumination could also attack the other proteins

associated with the function of efflux pump.

Similar to efflux pumps, the present results showed that the glucose

uptake system, the glucose-specific PEP-PTS, in Salmonella cells was also

totally damaged by LED illumination, regardless of bacterial strain. It is

known that this system catalyzes a group translocation process to

phosphorylate glucose through a phosphoryl transfer process as well as

monitors the metabolism in response to the availability of consumable glucose

(Deutscher, Francke, and Postma, 2006; Reizer et al., 1998). The damage to

PEP-PTS in Salmonella cells by LED illumination might be due to the

inactivation of enzymes associated with PEP-PTS and ATP synthesis to be

utilized for phosphorylation as described above. Surprisingly, non-illuminated

S. Enteritidis cells also slightly lost their glucose uptake activity

(approximately 34%) at chilling temperature but not for S Saintpaul. This is

151

probably because S. Enteritidis would be more sensitive to cold and starvation

conditions than S. Saintpaul.

A previous study tested with UV-A and sunlight on E. coli also reported

the damage to efflux pump and glucose uptake system over the exposure time,

demonstrating that efflux pump activity firstly ceased, then membrane

potential and the glucose uptake were gradually lost, and considerable

membrane permeability was finally observed (Berney, Weilenmann, and Egli,

2006). However, the present results showed that only 6–10% higher in cellular

depolarization and permeability after LED illumination compared to those of

fresh cultured and non-illuminated control cells. The results in Chapter 3 also

showed only some of illuminated S. Typhimurium cells underwent loss in the

membrane integrity under the same illumination condition.

Similar to the present results, Caminos et al. (2008) reported no change

of the membrane integrity of E. coli after PDI with the aid of an exogenous

photosensitizer, although the membrane functions could be lost. Alves et al.

(2014) demonstrated that the large amounts of exogenous photosensitizers

might be required to disrupt bacterial outer membrane by PDI. Thus, it is

speculated that the small amounts of endogenous porphyrins in Salmonella

cells could not generate sufficient ROS for the disruption of cell membrane

integrity during LED illumination; however, it might be enough to attack

DNA, efflux pump activity, and glucose uptake systems due to the proximity

of endogenous porphyrins. This possibility could be supported by the results

obtained by Kumar et al. (2015) who reported 9–25 times lower

concentrations of coproporphyrin compounds in S. Typhimurium cells than

other Gram-positive bacteria. Moreover, the slight increase in the membrane

152

depolarization and permeability by LED illumination might be due to the loss

in efflux pump activity and other membrane proteins (Berney, Weilenmann,

and Egli, 2006; Spesia et al., 2009).

For a better understanding of the antibacterial mechanism of LED

illumination, the morphological damage of illuminated cells was examined by

TEM. Visual changes in regions of nucleoid and ribosome were only observed

and no noticeable damage on cell envelops was found (Figure 8–8). The

results of TEM correspond with the present results of DNA oxidation and low

percentages of membrane depolarization and permeability. Thus, these results

clearly indicate that photodynamic inactivation of LED illumination without

the addition of photosensitizers might not be due to membrane disruption.

The bacterial response to LED illumination was investigated by

determining the transcription levels of oxyR, recA, rpoS, sodA, and soxR to

find out whether these genes could contribute to the different sensitivities of S.

Enteritidis (a sensitive strain) and S. Saintpaul (a resistant strain) to 405±5 nm

LED illumination. The results showed that both non-illuminated and LED-

illuminated S. Saintpaul cells in PBS upregulated all five genes tested in this

study, while both non-illuminated and illuminated S. Enteritidis cells

upregulated only oxyR gene (Figure 8–9). These findings suggest that the gene

expression level might be altered by the exposure to chilling temperature,

starvation condition, or both conditions rather than that of LED illumination.

However, such upregulation in the regulatory genes under the conditions could

make S. Saintpaul more resistant to LED illumination than S. Enteritidis.

Similar to the findings in this study, Smirnova, Zakirova, and

Oktyabrskii (2001) reported that the response of E. coli to temperature-shift

153

from 37 to 20 °C within 10 min resembled oxidative stress responses, resulting

in upregulation of sodA, but no change in katG that is controlled by oxyR.

Another previous study showed that the levels of oxyR expression in four

Vibrio vulnificus strains were elevated by cold shock at 4 °C, whereas the

transcription levels of katG were slightly changed in all strains but at different

exposure time (Limthammahisorn, Brady, and Arias, 2007).

In this study, both rpoS and oxyR genes were upregulated in S. Saintpaul

in response to chilling and starvation conditions. This is because rpoS could

reflect the positive transcription regulation of oxyR to adapt to environmental

change (Kong et al., 2004). Merrikh et al. (2009) reported that a number of

antioxidant enzymes such as catalase and SOD could be also regulated by

RpoS under the oxidative stress. A previous study demonstrated that rpoS

mutants of S. Typhimurium strain were even more susceptible to UV light

compared to wild-type strain (Child et al., 2002). The induction of the RpoS

regulator could make bacterial cells resistant to various stresses and starvation

condition (Battesti, Majdalani, and Gottesman, 2011). Thus, the results

obtained in this study indicate that the different sensitivities of S. Enteritidis

and S. Saintpaul to LED illumination might be due to the regulation of stress-

related genes at chilling and starvation conditions.

8.5 Conclusions

This is the first comprehensive study to elucidate the detailed

antibacterial mechanism of 405±5 nm LED illumination at refrigeration

temperatures against Salmonella cells as well as to identify the factors

influencing sensitivity to LED illumination. The present results showed that

154

the difference in sensitivity of Salmonella cells was strain dependent rather

than serotype dependent. These findings confirmed genomic DNA oxidation

and the loss of membrane functions, preferentially in efflux pump and glucose

uptake activity due to LED illumination but only slight damages to membrane

potential and integrity. Similar to DNA oxidation, TEM images clearly

showed that bacterial genomes were one of major targets of LED illumination.

Thus, these results propose that the antibacterial mechanism of 405±5 nm

LED illumination might be due to DNA oxidation and loss of membrane

functions. Furthermore, all five regulatory genes of resistant S. Saintpaul were

highly upregulated in response to low temperature and starvation rather than

LED illumination, suggesting that these changes make them more resistant to

LED illumination than S. Enteritidis. Therefore, the data obtained in this study

help us for a better understanding of antibacterial mechanism of 405±5 nm

LED illumination on Salmonella cells without the addition of exogenous

photosensitizers.

155

Chapter 9

Conclusions

The potential of 405±5 nm LED as a novel food preservation technology

was evaluated in this study by examining its antibacterial effect against major

foodborne pathogens in PBS, and on fresh-cut fruits and cooked chicken at

refrigeration temperatures that simulate storage conditions in food

establishments. Results show that LED illumination inactivates about more

than 90% of the populations of six pathogens (E. coli O157:H7, B. cereus, L.

monocytogenes, Salmonella, S. sonnei, and S. aureus) in PBS under

refrigeration conditions. In particular, S. Typhimurium and L. monocytogenes

were identified as being more sensitive among the Gram-negative and –

positive groups tested in this study, respectively (Chapters 3 and 4). S.

Enteritidis 130 was found to be more sensitive than S. Enteritidis 124 and 125

to LED illumination (Chapter 7). All 18 strains of Salmonella showed

different susceptibilities to LED illumination (Chapter 8), revealing that S.

Enteritidis (ATCC 13076) and S. Saintpaul strains were more sensitive and

resistant to LED illumination, respectively. Four different S. Typhimurium

strains also demonstrated differences in sensitivities to LED illumination.

Based on these findings, it is concluded that the antibacterial efficacy of 405±5

156

nm LED illumination is not only species and serotype dependent but also

strain dependent.

For food application, the efficacy of 405±5 nm LED in controlling E.

coli O157:H7, L. monocytogenes, or Salmonella spp. on cooked chicken, and

fresh-cut papaya and mango was evaluated. The effect of storage temperature

on effectiveness was also determined. Results show that LED illumination

effectively inactivates all test pathogens on fresh-cut fruits at refrigeration

temperatures (4 and 10 °C) for 2 days (Chapters 5 and 6), while S. Enteritidis

on illuminated cooked chicken was inactivated at only 4 °C (Chapter 7),

indicating refrigeration temperatures enhance the antibacterial effect of LED

illumination. Regardless of food matrix, except for Salmonella on the mango

surface, LED illumination at room temperature only delayed the bacterial

growth. These results indicate that storage temperature plays an important role

in the antibacterial effect of 405±5 nm LED. Furthermore, LED illumination

did not influence the physicochemical and nutritional qualities of fresh-cut

fruits at the storage temperatures tested, indicating that it would be a useful

tool to preserve RTE refrigerated foods without deterioration.

The antibacterial mechanism of 405±5 nm LED at refrigeration

temperatures was elucidated by determining damage to cellular components.

Results demonstrated that LED illumination increased cell sensitivity to NaCl

and bile salts by more than 90% compared to non-illuminated cells, exhibiting

damage to bacterial membranes by ROS generated from LED illumination

(Chapters 3 and 4). The loss of membrane functions especially in efflux pump

activity and glucose uptake systems was observed in Salmonella cells resulted

from LED illumination but analysis using flow cytometry showed that there

157

was only slight loss of membrane potential and integrity (Chapter 8). It was

also confirmed that membrane lipid peroxidation did not occur, while genomic

DNA was extensively oxidized due to LED illumination. Salmonella DNA

damage was confirmed by TEM images, which demonstrated visual changes

in nucleoid and ribosome, compared to non-illuminated cells (Chapter 8).

Furthermore, illuminated cells on chicken surface were incapable of repairing

damages to DNA, RNA, protein, and cell wall metabolism induced by

metabolic inhibitors (Chapter 7). LED illumination did lead to multi-damage

to cellular components. Findings suggest that DNA oxidation, the loss of

membrane functions in efflux pump activity and glucose uptake systems, and

failure of repair are main mechanisms of antibacterial action of 405±5 nm

LED illumination at refrigeration temperature (Figure 9–1). In addition, LED-

resistant S. Saintpaul cells and LED–sensitive S. Enteritidis cells upregulated

all five oxidative related genes and only oxyR gene, respectively, in response

to refrigeration temperature and starvation rather than LED illumination,

indicating that differences in regulation of genes may be contributing factors

influencing the cell sensitivity to LED illumination (Chapter 8). Results

obtained in all these studies not only indicate that 405±5 nm LED illumination

in combination with low temperature control is a promising technology for

RTE food preservation in food establishments but also sheds light on how

LED illumination without the addition of exogenous photosensitizers

inactivates Salmonella cells. However, further study is required to evaluate the

efficacy of 405±5 nm LED against other foodborne pathogens and natural

microbiota as well as on other food matrices, as the behavior of bacterial

pathogens may vary according to differences in types and contents of

158

bioactive compounds and nutrition in foods. In addition, the LED system

needs to be improved to effectively inactivate microorganism on both sides of

cut fruits.

159

Figure 9-1 Illustration of the proposed bacterial mechanism of 405±5 nm LED illumination at a refrigeration temperature. ROS generated during

LED illumination might attack DNA and bacterial membrane (A–E). PC, porphyrin compound; Cyt, cytochrome complexes; PEP-PTS,

phosphoenolpyruvate: sugar phosphotransferase system.

160

BIBLIOGRAPHY

Ait-Ouazzou, A., Mañas, P., Condón, S., Pagán, R., García-Gonzalo, D. 2012.

Role of general stress-response alternative sigma factors σS (RpoS) and

σB (SigB) in bacterial heat resistance as a function of illumination

medium pH. International Journal of Food Microbiology, 153, 358-364.

Amaral, L., Martins, A., Spengler, G., Molnar, J. 2014. Efflux pumps of

Gram-negative bacteria: what they do, how they do it, with what and

how to deal with them. Frontiers in Pharmacology, 4, 168.

Anyasi, T.A., Jideani, A.I., Mchau, G.R. 2015. Effect of organic acid

pretreatment on some physical, functional and antioxidant properties of

flour obtained from three unripe banana cultivars. Food Chemistry, 172,

515-522.

Alves, E., Santos, N., Melo, T., Maciel, E., Dória, M.L., Faustino, M.A.,

Helguero, L.A. 2013. Photodynamic oxidation of Escherichia coli

membrane phospholipids: new insights based on lipidomics. Rapid

Communications in Mass Spectrometry, 27, 2717-2728.

Alves, E., Faustino, M.A., Neves, M.G., Cunha, A., Tome, J., Almeida, A.

2014. An insight on bacterial cellular targets of photodynamic

inactivation. Future Medicinal Chemistry, 6, 141-164.

Aponiene, K., Luksienė, Ž. 2015. Effective combination of LED-based visible

light, photosensitizer and photocatalyst to combat Gram (−) bacteria.

Journal of Photochemistry and Photobiology B: Biology, 142, 257-263.

Aponiene, K., Paskeviciute, E., Reklaitis, I., Luksienė, Ž. 2015. Reduction of

microbial contamination of fruits and vegetables by hypericin-based

photosensitization: Comparison with other emerging antimicrobial

treatments. Journal of Food Engineering, 144, 29-35.

Barros, L., Calhelha, R.C., Vaz, J.A., Ferreira, I.C., Baptista, P., Estevinho,

L.M. 2007. Antimicrobial activity and bioactive compounds of

Portuguese wild edible mushrooms methanolic extracts. European Food

Research and Technology, 225, 151-156.

Battesti, A., Majdalani, N., Gottesman, S. 2011. The RpoS-mediated general

stress response in Escherichia coli. Annual Review of Microbiology, 65,

189-213.

Beales, N. 2004. Adaptation of microorganisms to cold temperatures, weak

acid preservatives, low pH, and osmotic stress: a review. Comprehensive

Reviews in Food Science and Food Safety, 3, 1-20.

Berney, M., Weilenmann, H.U., Egli, T. 2006. Flow-cytometric study of vital

cellular functions in Escherichia coli during solar disinfection (SODIS).

Microbiology, 152, 1719-1729.

Bialka, K.L., Demirci, A., Puri, V.M. 2008. Modeling the inactivation of

Escherichia coli O157:H7 and Salmonella enterica on raspberries and

http://www.sciencedirect.com/science/article/pii/S0168160511006891



161

strawberries resulting from exposure to ozone or pulsed UV-light.

Journal of Food Engineering, 85, 444-449.

Blair, J.M., Webber, M.A., Baylay, A.J., Ogbolu, D.O., Piddock, L.J. 2015.

Molecular mechanisms of antibiotic resistance. Nature Reveiw


Bleichert, P., Santo, C.E., Hanczaruk, M., Meyer, H., Grass, G. 2014.

Inactivation of bacterial and viral biothreat agents on metallic copper

surfaces. Biometals, 27, 1179-1189.

Bronze, M.S., Greenfield, R.A. 2005. Biodefense: Principles and Pathogens.

Horizon Bioscience, Norfolk.

Brooks, J.T., Sowers, E.G., Wells, J.G., Greene, K.D., Griffin, P.M., Hoekstra,

R.M., Strockbine, N.A. 2005. Non-O157 Shiga toxin-producing

Escherichia coli infections in the United States, 1983-2002. The Journal

of Infectious Diseases, 192, 1422-1429.

Bowen, A. 2015. Shigellosis. In: Brunette, G.W. (Ed.), CDC Health

Information for International Travel 2015 (Yellow book). Oxford

University Press, New York, Chapter 3.

Buchovec, I., Paskeviciute, E., Luksienė, Ž. 2010. Photosensitization-based

inactivation of food pathogen Listeria monocytogenes in vitro and on the

surface of packaging material. Journal of Photochemistry and

Photobiology B: Biology, 99, 9-14.

Buchovec, I., Lukseviciute, V., Marsalka, A., Reklaitis, I., Luksienė, Ž. 2016.

Effective photosensitization-based inactivation of Gram (−) food

pathogens and molds using the chlorophyllin–chitosan complex: towards

photoactive edible coatings to preserve strawberries. Photochemical and

Photobiological Sciences, 15, 506-516.

Byrne, L., Fisher, I., Peters, T., Mather, A., Thomson, N., Rosner, B.,

Aiyedun, V. 2014. A multi-country outbreak of Salmonella Newport

gastroenteritis in Europe associated with watermelon from Brazil,

confirmed by whole genome sequencing: October 2011 to January 2012.

Euro surveillance: bulletin Europeen sur les maladies transmissibles =

European Communicable Disease Bulletin, 19, 6-13.

Cabiscol, E., Tamarit, J., Ros, J. 2000. Oxidative stress in bacteria and protein

damage by reactive oxygen species. International Microbiology, 3, 3-8.

Caminos, D.A., Spesia, M.B., Pons, P., Durantini, E.N. 2008. Mechanisms of

Escherichia coli photodynamic inactivation by an amphiphilic tricationic

porphyrin and 5, 10, 15, 20-tetra (4-N, N, N-trimethylammoniumphenyl)

porphyrin. Photochemical and Photobiological Sciences, 7, 1071-1078.

Campbell, E.A., Korzheva, N., Mustaev, A., Murakami, K., Nair, S., Goldfarb,

A., Darst, S.A. 2001. Structural mechanism for rifampicin inhibition of

bacterial RNA polymerase. Cell, 104, 901-912.

Carré, G., Hamon, E., Ennahar, S., Estner, M., Lett, M.C., Horvatovich, P.,

Andre, P., 2014. TiO2 photocatalysis damages lipids and proteins in

Escherichia coli. Applied and Environmental Microbiology, 80, 2573-

2581.

162

Castro, A., Santos, C., Meireles, H., Silva, J., Teixeira, P. 2016. Food handlers

as potential sources of dissemination of virulent strains of

Staphylococcus aureus in the community. Journal of Infection and

Public Health, 9, 153-160.

Centers for Diseases Control and Prevention (CDC). 2010. Staphylococcal

food poisoning.

http://www.cdc.gov/foodsafety/diseases/staphylococcal.html (accessed

01.03.10).

CDC. 2011. Foodborne Outbreaks Online Database (FOOD).

http://wwwn.cdc.gov/foodborneoutbreaks/ (accessed 29.08.11).

CDC. 2012. FOOD. http://wwwn.cdc.gov/foodborneoutbreaks/ (accessed

11.10.12).

CDC. 2013. FOOD. http://wwwn.cdc.gov/foodborneoutbreaks/ (accessed

11.12.13).

CDC. 2015. Surveillance for foodborne disease outbreaks, United States, 2013,

Annual Report, Atlanta, Georgia: US Deparment of Health and Human

Service.

Charles, F., Vidal, V., Olive, F., Filgueiras, H., Sallanon, H. 2013. Pulsed light

treatment as new method to maintain physical and nutritional quality of

fresh-cut mangoes. Innovative Food Science and Emerging

Technologies, 18, 190-195.

Child, M., Strike, P., Pickup, R., Edwards, C. 2002. Salmonella Typhimurium

displays cyclical patterns of sensitivity to UV-C killing during prolonged

incubation in the stationary phase of growth. FEMS Microbiology

Letters, 213, 81–85

Christena, L,R,, Mangalagowri, V,, Pradheeba, P., Ahmed, K.B.A., Shalini,

B.I.S., Vidyalakshmi, M., Anbazhagan, V. 2015. Copper nanoparticles

as an efflux pump inhibitor to tackle drug resistant bacteria. RSC

Advances, 5, 12899-12909.

Couvert, O., Gaillard, S., Savy, N., Mafart, P., Leguérinel, I. 2005. Survival

curves of heated bacterial spores: effect of environmental factors on

Weibull parameters. International Journal of Food Microbiology, 101,

73-81.

Dai, T., Fuchs, B.B., Coleman, J.J., Prates, R.A., Astrakas, C., Denis, T.G.S.,

Tegos, G.P. 2012. Concepts and principles of photodynamic therapy as

an alternative antifungal discovery platform. Frontiers in Microbiology,

3, 1-16.

Darko, E., Heydarizadeh, P., Schoefs, B., Sabzalian, MR. 2014.

Photosynthesis under artificial light: the shift in primary and secondary

metabolism. Philosophical Transactions of the Royal Society of London.

Series B, Biological Sciences, 369, 20130243.

Dhakal, R., Baek, K.H. 2014. Short period irradiation of single blue

wavelength light extends the storage period of mature green tomatoes.

Postharvest Biology and Technology, 90, 73-77.

http://www.cdc.gov/foodsafety/diseases/staphylococcal.html

http://wwwn.cdc.gov/foodborneoutbreaks/



163

Demidova, T.N., Hamblin, M.R. 2004. Photodynamic therapy targeted to

pathogens. International Journal of Immunopathology and.

Pharmacology, 17, 245-254.

Deutscher, J., Francke, C., Postma, P.W. 2006. How phosphotransferase

system-related protein phosphorylation regulates carbohydrate

metabolism in bacteria. Microbiology and Molecular Biology Reviews,

70, 939-1031.

Dickson, J.S., Siragusa, G.R., Wray, J.E. 1992. Predicting the growth of

Salmonella typhimurium on beef by using the temperature function

integration technique. Applied and Environmental Microbiology, 58,

3482-3487.

D'Aoust, J.Y., Maurer, J., 2007. Salmonella species. In: Doyle, M.P., Beuchat,

L.R. (Eds.), Food Microbiology: Fundamentals and Frontiers. ASM

Press, Washington DC, pp. 187-236.

Dume, B. 2006. LEDs move into the ultraviolet. Physics World, Bristol.

http://physicsworld. com/cws/article/news/2006/may/17/leds-move-into-

the-ultraviolet (accessed 17.05.06).

European Food Safety Authority (EFSA). 2014. The European Union

summary report on trends and sources of zoonoses, zoonotic agents and

food-borne outbreaks in 2012, European Food Safety Authority Journal

12, 3547.

EFSA. 2015. The European Union summary report on trends and sources of

zoonoses, zoonotic agents and food-borne outbreaks in 2014, European

Food Safety Authority Journal 13, 4329.

Elman, M., Slatkine, M., Harth, Y. 2003. The effective treatment of acne

vulgaris by a high-intensity, narrow band 405-420 nm light source.

Journal of Cosmetic Laser Therapy, 5, 111-117.

Endarko, E., Maclean, M., Timoshkin, I.V., MacGregor, S.J., Anderson, J.G.

2012. High‐intensity 405 nm light inactivation of Listeria

monocytogenes. Photochemistry and Photobiology, 88, 1280-1286.

Farr, S.B., Kogoma, T. 1991. Oxidative stress responses in Escherichia coli

and Salmonella typhimurium. Microbiological Reviews, 55, 561-585.

Food and Drug Administration (FDA). 2011. Fish and fishery products

hazards and controls guidance. U.S. Department of Health and Human

Services, Public Health Service, Food and Drug Administration, USA.

http://www.fda.gov/downloads/food/guidanceregulation/ucm251970.pdf

(accessed 25.04.14).

Ferrario, M., Alzamora, S.M., Guerrero, S. 2013. Inactivation kinetics of some

microorganisms in apple, melon, orange and strawberry juices by high

intensity light pulses. Journal of Food Engineering, 118, 302-311.

Freed, M. 1966. Methods of Vitamin Assay. The Association of Vitamin

Chemists, Interscience publishers, New York, pp. 287-344.

Gayán, E., Serrano, M.J., Raso, J., Á lvarez, I., Condón, S. 2012. Inactivation

of Salmonella enterica by UV-C light alone and in combination with

http://www.efsa.europa.eu/en/search/doc/3590.pdf

http://www.efsa.europa.eu/en/search/doc/3590.pdf

http://www.fda.gov/downloads/food/guidanceregulation/ucm251970.pdf

164

mild temperatures. Applied and Environmental Microbiology, 78, 8353-

8361.

Ghate, V.S., Ng, K.S., Zhou, W., Yang, H., Khoo, G.H., Yoon, W.B., Yuk,

H.G. 2013. Antibacterial effect of light emitting diodes of visible

wavelengths on selected foodborne pathogens at different illumination

temperatures. International Journal of Food Microbiology, 166, 399-

406.

Ghate, V., Leong, A.L., Kumar, A., Bang, W.S., Zhou, W., Yuk, H.G. 2015a.

Enhancing the antibacterial effect of 461 and 521 nm light emitting

diodes on selected foodborne pathogens in trypticase soy broth by acidic

and alkaline pH conditions. Food Microbiology, 48, 49-57.

Ghate, V., Kumar, A., Zhou, W., Yuk, H. G. 2015b. Effect of organic acids on

the photodynamic inactivation of selected foodborne pathogens using

461 nm LEDs. Food Control, 57, 333-340.

Ghate, V.S., Kumar, A., Zhou, W., Yuk, H.G. 2016. Irradiance and

temperature influence the bactericidal effect of 460 nm LEDs on

Salmonella spp. in orange juice. Journal of Food Protection, 79, 553-

560.

Gibbs, R., Mazzucchelli, T., O'Reilly, L., MacKenzie, B., Green, J.,

Mogyorosy, R., Van Buynder, P., 2009. An outbreak of Salmonella

enterica serotype Litchfield infection in Australia linked to consumption

of contaminated papaya. Journal of Food Protection, 72, 1094-1098.

Gold, M.H. 2008. Lasers and light treatments for acne vulgaris promising

theraphies; in therapeutic and aesthetic uses of photodynamic therapy

part two of a five-part series. The Journal of Clinical and Aesthetic

Dermatology, 1, 28-34.

González-Aguilar, G. A., Wang, C. Y., Buta, J. G. 2000. Maintaining quality

of fresh-cut mangoes using antibrowning agents and modified

atmosphere packaging. Journal of Agricultural and Food Chemistry, 48,

4204-4208.

González‐Aguilar, G.A., Villegas‐Ochoa, M.A., Martínez‐Téllez, M.A.,

Gardea, A.A., Ayala‐Zavala, J.F. 2007a. Improving antioxidant capacity

of fresh‐cut mangoes treated with UV‐C. Journal of Food Science, 72,

S197-S202.

González-Aguilar, G. A., Zavaleta-Gatica, R., Tiznado-Hernández, M. E.

2007b. Improving postharvest quality of mango ‘Haden’ by UV-C

treatment. Postharvest Biology and Technology, 45, 108-116.

Granum, P.E. 2007. Listeria monocytogenes. In: Doyle, M.P., Beuchat, L.R.

(Eds.), Food Microbiology: Fundamentals and Frontiers. ASM Press,

Washington DC, pp. 457-491.

Grzelak, A., Rychlik, B., Bartosz, G. 2001. Light-dependent generation of

reactive oxygen species on cell culture media. Free Radical of Biology

and Medicine, 30, 1418–1425.

Guffey, J.S., Wilborn, J. 2006. In vitro bactericidal effects of 405-nm and 470-

nm blue light. Photomedicine and Laser Surgery, 24, 684-688.

165

Gupta, S. D., Jatothu, B. 2013. Fundamentals and applications of light-

emitting diodes (LEDs) in vitro plant growth and morphogenesis. Plant

Biotechnology Reports, 7, 211-220.

Ha, J.W., Kang, D.H. 2015. Enhanced inactivation of food-borne pathogens in

ready-to-eat sliced ham by near-infrared heating combined with UV-C

irradiation and mechanism of the synergistic bactericidal action. AppIed

and Environmental Microbiololgy, 81, 2-8.

Hamamoto, A., Mori, M., Takahashi, A., Nakano, M., Wakikawa, N.,

Akutagawa, M., Kinouchi, Y. 2007. New water disinfection system

using UVA light‐emitting diodes. Journal of Applied Microbiology, 103,

2291-2298.

Hamblin, M.R., Hasan, T. 2004. Photodynamic therapy: a new antimicrobial

approach to infectious disease?. Photochemical and Photobiological

Sciences, 3, 436-450.

Hamblin, M.R., Viveiros, J., Yang, C., Ahmadi, A., Ganz, R.A., Tolkoff, M.J.

2005. Helicobacter pylori accumulates photoactive porphyrins and is

killed by visible light. Antimicrobial Agents and Chemotherapy, 49,

2822-2827.

Hong, R., Kang, T.Y., Michels, C.A., Gadura, N. 2012. Membrane lipid

peroxidation in copper alloy-mediated contact killing of Escherichia

coli. Applied and Environmental Microbiology, 78, 1776-1784.

Hong, W.A.N.G., Ying, W.A.N.G., Shuang, X.U., Weimin, Z.H.U. 2015.

Light quality-controlled phytochemicals biosynthesis in vegetables and

fruits. Journal of Agricultural Science and Technology, 16, 2029-2035

Henle, E.S., Han, Z., Tang, N., Rai, P., Luo, Y., Linn, S. 1999. Sequence-

specific DNA cleavage by Fe2+

-mediated fenton reactions has possible

biological implications. Journal of Biological Chemistry, 274, 962-971.

Imlay, J.A. 2008. Cellular defenses against superoxide and hydrogen peroxide.

Annual Review of Biochemistry, 77, 755-776.

Issenhuth-Jeanjean, S., Roggentin, P., Mikoleit, M., Guibourdenche, M., De

Pinna, E., Nair, S., Weill, F.X. 2014. Supplement 2008–2010 (no. 48) to

the White–Kauffmann–Le Minor scheme. Research in Microbiology,

165, 526-530.

James, J.B., Nagramsak, T. 2011. Processing of fresh-cut tropical fruits and

vegetables: a Technical Guide. FAO Agricultural Service Bulletin, 1-86.

Jami, M., Ghanbari, M., Zunabovic, M., Domig, K.J., Kneifel, W. 2014.

Listeria monocytogenes in aquatic food products—a review.

Comprehensive Reviews in Food Science and Food Safety, 13, 798-813.

Janssen, R., van der Straaten, T., van Diepen, A., van Dissel, J.T. 2003.

Responses to reactive oxygen intermediates and virulence of Salmonella

typhimurium. Microbes and Infection, 5, 527-534.

Jasson, V., Uyttendaele, M., Rajkovic, A., Debevere, J. 2007. Establishment of

procedures provoking sub-lethal injury of Listeria monocytogenes,

Campylobacter jejuni and Escherichia coli O157 to serve method

166

performance testing. International Journal of Food Microbiology, 118,

241-249.

Jooste, P., Jordan, K., Leong, D., Alvarez-Ordoñez, A. 2016. Listeria

monocytogenes in food: Control by monitoring the food processing

environment. African Journal of Microbiology Research, 10, 1-14.

Joshi, S.G., Cooper, M., Yost, A., Paff, M., Ercan, U.K., Fridman, G., Brooks,

A.D. 2011. Nonthermal dielectric-barrier discharge plasma-induced

inactivation involves oxidative DNA damage and membrane lipid

peroxidation in Escherichia coli. Antimicrobial Agents and

Chemotherapy, 55, 1053-1062.

Joux, F., Lebaron, P. 2000. Use of fluorescent probes to assess physiological

functions of bacteria at single-cell level. Microbes and Infection, 2,

1523-1535.

Juneja, V.K., Sofos, J.N. 2001. Control of Foodborne Microorganisms. Marcel

Dekker, New York, Chapter 4.

Keyer, K., Imlay, J.A. 1996. Superoxide accelerates DNA damage by

elevating free-iron levels. Proceedings of the National Academy of

Sciences, 93, 13635-13640.

Kim, J., Park, W. 2014. Oxidative stress response in Pseudomonas putida.

Applied Microbiology and Biotechnology, 98, 6933-6946.

Kohanski, M.A., Dwyer, D.J., Collins, J.J. 2010. How antibiotics kill bacteria:

from targets to networks. Nature Review Microbiology, 8, 423-435.

Kondakci, T., Yuk, H.G. 2012. Overview of foodborne outbreaks in the last

decade in Singapore: Alarming increase in nontyphoidal salmonellosis.

Food Beverage Asia, 42-45.

http://www.foodbeverageasia.com/ebook/FBA_DecJan2013/files/assets/

seo/page44.html.

Kong, I.S, Bates, T.C, Hülsmann, A., Hassan, H., Smith, B.E., Oliver, J.D.

2004. Role of catalase and oxyR in the viable but nonculturable state of

Vibrio vulnificus. FEMS Microbiology Ecology, 50, 133-142.

Kumar, A., Ghate, V., Kim, M.J., Zhou, W., Khoo, G.H., Yuk, H.G. 2015.

Kinetics of bacterial inactivation by 405 nm and 520 nm light emitting

diodes and the role of endogenous coproporphyrin on bacterial

susceptibility. Journal of Photochemistry and Photobiology B. Biology,

149, 37-44.

Kumari, S., Rastogi, R.P., Singh, K. L., Singh, S.P., Sinha, R.P. 2008. DNA

damage: detection strategies. EXCLI Journal, 7, 44-62.

Lacombe, A., Tadepalli, S., Hwang, C.A., Wu, V.C. 2013. Phytochemicals in

lowbush wild blueberry inactivate Escherichia coli O157: H7 by

damaging its cell membrane. Foodborne Pathogens and Diseases, 10,

944-950.

Lampel, K.A., Maurelli, A.T. 2007. Shigella species. In: Doyle, M.P.,

Beuchat, L.R. (Eds.), Food Microbiology: Fundamentals and Frontiers.

ASM Press, Washington DC, pp. 323-341.

http://www.foodbeverageasia.com/ebook/FBA_DecJan2013/files/assets/seo/page44.html

http://www.foodbeverageasia.com/ebook/FBA_DecJan2013/files/assets/seo/page44.html

167

Liang, J.Y., Cheng, C.W., Yu, C.H., Chen, L.Y. 2015. Investigations of blue

light-induced reactive oxygen species from flavin mononucleotide on

inactivation of E. coli. Journal of Photochemistry and Photobiology B:

Biology, 143, 82-88.

Lianou, A., Sofos, J.N. 2007. A review of the incidence and transmission of

Listeria monocytogenes in ready-to-eat products in retail and food

service environments. Journal of Food Protection, 70, 2172-2198.

Liao, W., McNutt, M.A., Zhu, W.G. 2009. The comet assay: a sensitive

method for detecting DNA damage in individual cells. Methods, 48, 46-

53.

Lim, S.W., Kim, S.W., Lee, S.C., Yuk, H.G. 2013. Exposure of Salmonella

Typhimurium to guava extracts increases their sensitivity to acidic

environments. Food Control, 33, 393-398.

Limthammahisorn, S., Brady, Y.J., Arias, C.R. 2008. Gene expression of cold

shock and other stress-related genes in Vibrio vulnificus grown in pure

culture under shell stock temperature control conditions. Journal of

Food Protection, 71, 157-164.

Liu, D. 2006. Identification, subtyping and virulence determination of Listeria

monocytogenes, an important foodborne pathogen. Journal of Medical

Microbiology, 55, 645–59.

Luksienė, Ž. 2003. Photodynamic therapy: mechanism of action and ways to

improve the efficiency of illumination. Medicina, 39, 1137-1150.

Luksienė, Ž. 2005. New approach to inactivation of harmful and pathogenic

microorganisms by photosensitization. Food Technology and

Biotechnology, 43, 411-418.

Luksienė, Ž., Zukauskas, A. 2009. Prospects of photosensitization in control

of pathogenic and harmful micro-organisms. Journal of Applied


Luksienė, Ž., Buchovec, I., Paskeviciute, E. 2009. Inactivation of food

pathogen Bacillus cereus by photosensitization in vitro and on the

surface of packaging material, Journal of Applied Microbiology, 107,

2037-2046.

Luksienė, Ž., Paskeviciute, E. 2011. Novel approach to the microbial

decontamination of strawberries: chlorophyllin‐based photosensitization.

Journal of Applied Microbiology, 110, 1274-1283.

Luksienė, Ž., Kokstaite, R., Katauskis, P., Skakauskas, V. 2013. Novel

approach to effective and uniform inactivation of Gram-positive Listeria

monocytogenes and Gram-negative Salmonella enterica by

photosensitization. Food Technology and Biotechnology, 51, 338-344.

Luksienė, Ž. 2014. Novel approach to control pathogenic and harmful

microorganisms in nonthermal way: photosensitization. In: Boziaris, I.S.

(Ed.), Novel Food Preservation and Microbial Assessment Techniques.

CRC Press, New York, pp. 184-217.

168

Ma, G., Zhang, L., Kato, M., Yamawaki, K., Kiriiwa, Y., Yahata, M.,

Matsumoto, H. 2011. Effect of blue and red LED light irradiation on β-

cryptoxanthin accumulation in the flavedo of citrus fruits. Journal of

Agricultural and Food Chemistry, 60(, 197-201.

Ma, C., Li, J., Zhang, Q. 2016. Behavior of Salmonella spp. on fresh-cut

tropical fruits. Food Microbiology, 54, 133-141.

Maclean, M., MacGregor, S.J., Anderson, J.G., Woolsey, G. 2009.

Inactivation of bacterial pathogens following exposure to light from a

405-nanometer light-emitting diode array. Applied and Environmental


Maclean, M., MacGregor, S.J., Anderson, J.G., Woolsey, G.A., Coia, J.E.,

Hamilton, K., Gettinby, G. 2010. Environmental decontamination of a

hospital isolation room using high-intensity narrow-spectrum light.

Journal of Hospital Infection, 76, 247-251.

Marc, Y.L., Buchovec, I., George, S.M., Baranyi, J., Luksienė, Ž. 2009.

Modeling the photosensitization‐based inactivation of Bacillus cereus.

Journal of Applied Microbiology, 107, 1006-1011.

Massa, G.D., Kim, H.H., Wheeler, R.M., Mitchell, C.A. 2008. Plant

productivity in response to LED lighting. HortScience, 43, 1951-1956.

McKenzie, K., Maclean, M., Timoshkin, I.V., Endarko, E., MacGregor, S.J.,

Anderson, J.G. 2013. Photoinactivation of bacteria attached to glass and

acrylic surfaces by 405 nm light: potential application for biofilm

decontamination. Photochemistry and Photobiology, 89, 927-935.

Meng, J., Doyle, M.P., Zhao, T., Zhao, S. 2007. Enterohemorrhagic

Escherichia coli. In: Doyle, M.P., Beuchat, L.R. (Eds.), Food

Microbiology: Fundamentals and Frontiers. ASM Press, Washington DC,

pp. 249-269.

Merrikh, H., Ferrazzoli, A.E., Bougdour, A., Olivier-Mason, A., Lovett, S.T.

2009. A DNA damage response in Escherichia coli involving the

alternative sigma factor, RpoS. Proceedings of the National Academy of

Sciences, 106, 611-616.

Michán, C., Manchado, M., Dorado, G., Pueyo, C. 1999. In vivo transcription

of the Escherichia coli oxyR regulon as a function of growth phase and

in response to oxidative stress. Journal of Bacteriology, 181, 2759-2764.

Mikš-Krajnik, M.A.R.T.A., Yuk, H.G., Kumar, A., Yang, Y., Zheng, Q., Kim,

M.J., Yuan, W., Pang, X. 2015. Ensuring food security through

enhancing microbiological food safety. COSMOS, 11, 69-97.

Ministry of Health Singapore (MOH). 2010. Communicable diseases

surveillance in Singapore, Annual series 2009.

http://www.moh.gov.sg/content/moh_web/home/Publications/Reports.ht

ml.

MOH. 2015. Communicable disease surveillance in Singapore, Annual series

2014.

https://www.moh.gov.sg/content/moh_web/home/Publications/Reports.h

tml.

http://www.moh.gov.sg/content/moh_web/home/Publications/Reports.html

http://www.moh.gov.sg/content/moh_web/home/Publications/Reports.html

https://www.moh.gov.sg/content/moh_web/home/Publications/Reports.html

https://www.moh.gov.sg/content/moh_web/home/Publications/Reports.html

169

Mohammadi, A., Rafiee, S., Emam-Djomeh, Z., Keyhani, A. 2008. Kinetic

models for colour changes in kiwifruit slices during hot air drying.

World Journal of Agricultural Sciences, 4, 376-383.

Mori, M., Hamamoto, A., Takahashi, A., Nakano, M., Wakikawa, N.,

Tachibana, S., Kinouchi, Y. 2007. Development of a new water

sterilization device with a 365 nm UV-LED. Medical and Biological

Engineering and Computing, 45, 1237-1241.

Murdoch, L.E., Maclean, M., MacGregor, S.J., Anderson, J.G. 2010.

Inactivation of Campylobacter jejuni by exposure to high-intensity 405-

nm visible light. Foodborne Pathogens and Diseases, 7, 1211-1217.

Murdoch, L.E., Maclean, M., Endarko, E., MacGregor, S.J., Anderson, J.G.

2012. Bactericidal effects of 405 nm light exposure demonstrated by

inactivation of Escherichia, Salmonella, Shigella, Listeria, and

Mycobacterium species in liquid suspensions and on exposed surfaces.

The Scientific World Journal, 2012.

Nagata, M., Yamashita, I. 1992. Simple method for simultaneous

determination of chlorophyll and carotenoids in tomato fruit. Journal of

the Jananese Society of Food Science and Technology, 39, 925-928.

Nakamura, K., Ishiyama, K., Sheng, H., Ikai, H., Kanno, T., Niwano, Y. 2015.

Bactericidal activity and mechanism of photoirradiated polyphenols

against gram-positive and-negative bacteria. Journal of Agricultural and

Food Chemistry, 63, 7707-7713.

Nitzan, Y., Ashkenazi, H. 2001. Photoinactivation of Acinetobacter baumannii

and Escherichia coli B by a cationic hydrophilic porphyrin at various

light wavelengths. Current Microbiology, 42, 408-414.

Nitzan, Y., Salmon-Divon, M., Shporen, E., Malik, Z. 2004. ALA induced

photodynamic effects on Gram positive and negative bacteria.

Photochemical and Photobiological Sciences, 3, 430-435.

Nygren, B.L., Schilling, K.A., Blanton, E.M., Silk, B.J., Cole, D.J., Mintz,

E.D. 2013. Foodborne outbreaks of shigellosis in the USA, 1998–2008.

Epidemiology and Infection, 141, 233-241.

Oh, T.J., Kim, I.G. 1999. Identification of genetic factors altering the SOS

induction of DNA damage-inducible yebG gene in Escherichia coli.

FEMS Microbiology Letters, 177, 271-277.

Olle, M., Viršile, A. 2013. The effects of light-emitting diode lighting on

greenhouse plant growth and quality. Agricultural and Food Science, 22,

223-234.

Ooi, P.L., Goh, K.T., Neo, K.S., Ngan, C.C. 1997. A shipyard outbreak of

salmonellosis traced to contaminated fruits and vegetables. Annals of the

Academy of Medicine, Singapore, 26, 539-543.

Oscar, T.P. 2002. Development and validation of a tertiary simulation model

for predicting the potential growth of Salmonella Typhimurium on

cooked chicken. International Journal of Food Microbiology, 76, 177-

190.

170

Park, S., Imlay, J.A. 2003. High levels of intracellular cysteine promote

oxidative DNA damage by driving the fenton reaction. Journal of

Bacteriology, 185, 1942-1950.

Park, S.H., Kim, H.J., Cho, W.H., Kim, J.H., Oh, M.H., Kim, S.H., Kim, H.Y.

2009. Identification of Salmonella enterica subspecies I, Salmonella

enterica serovars Typhimurium, Enteritidis and Typhi using multiplex

PCR. FEMS Microbiology Letters, 301, 137-146.

Paskeviciute, E., Luksienė, Ž. 2009. Photosensitization as a novel approach to

decontaminate fruits and vegetables, PTEP (Serbia). 13, 50-53.

Patterson, M.F., Quinn, M., Simpson, R., Gilmour, A. 1995. Sensitivity of

vegetative pathogens to high hydrostatic pressure treatment in

phosphate-buffered saline and foods. Journal of Food Protection, 58,

524-529.

Prasad, K.S., Patel, H., Patel, T., Patel, K., Selvaraj, K. 2013. Biosynthesis of

Se nanoparticles and its effect on UV-induced DNA damage. Colloids

and Surfaces B: Biointerfaces. 103, 261-266.

Ramos, B., Miller, F.A., Brandão, T.R., Teixeira, P., Silva, C.L. 2013. Fresh

fruits and vegetables—an overview on applied methodologies to

improve its quality and safety. Innovative Food Science and Emerging

Technologies, 20, 1-15.

Ray, B., Bhunia, A. (Eds.). 2013. Fundamental Food Microbiology. CRC

press, Taylor and Francis Group, Boca Raton, Florida, USA, pp. 66–67.

Raybaudi-Massilia, R., Calderón-Gabaldón, M.I., Mosqueda-Melgar, J.,

Tapia, M.S. 2013. Inactivation of Salmonella enterica ser. Poona and

Listeria monocytogenes on fresh-cut “Maradol” red papaya (Carica

papaya L) treated with UV-C light and malic acid. Journal für

Verbraucherschutz und Lebensmittelsicherheit, 8, 37-44.

Raynor, B.D. 1997. Penicillin and ampicillin. Primary Care Update for Ob/

Gyns, 4, 147-152.

Reizer, J., Saier, M.H., Deutscher, J., Grenier, F., Thompson, J., Hengstenberg,

W., Dills, S.S. 1988. The phosphoenolpyruvate: sugar

phosphotransferase system in gram-positive bacteria: properties,

mechanism, and regulation. Critical Reviews in Microbiology, 15, 297-

338.

Reynolds, E.S. 1963. The use of lead citrate at high pH as an electron-opaque

stain in electron microscopy. The Journal of Cell Biology, 17, 208-212.

Rosenquist, H., Smidt, L., Andersen, S.R., Jensen, G.B., Wilcks, A. 2005

Occurrence and significance of Bacillus cereus and Bacillus

thuringiensis in ready-to-eat food. FEMS Microbiology Letters, 250,

129-136.

Salmon-Divon, M., Nitzan, Y., Malik, Z. 2004. Mechanistic aspects of

Escherichia coli photodynamic inactivation by cationic tetra-meso (N-

methylpyridyl) porphine. Photochemical and Photobiological Sciences,

3, 423-429.

171

Sawai, J., Sagara, K., Igarashi, H., Hashimoto, A., Kokugan, T., Shimizu, M.

1995. Injury of Escherichia coli in physiological phosphate-buffered

saline induced by far-infrared irradiation. Journal of Chemical

Engineering of Japan, 28, 294-299.

Scallan, E., Hoekstra, R.M., Angulo, F.J., Tauxe, R.V., Widdowson, M.A.,

Roy, S.L., Griffin, P.M. 2011a. Foodborne illness acquired in the United

States—major pathogens. Emerging Infectious Disease, 17.

Scallan, E., Griffin, P.M., Angulo, F.J., Tauxe, R.V., Hoekstra, R.M. 2011b.

Foodborne illness acquired in the United States—unspecified agents.

Emerging Infectious Diseases, 17, 16.

Scharff, R.L. 2012. Economic burden from health losses due to foodborne

illness in the United States. Journal of Food Protection, 75, 123-131.

Seo, K.S., Bohach, G.A. 2007. Staphylococcus aureus. In: Doyle, M.P.,

Beuchat, L.R. (Eds.), Food Microbiology: Fundamentals and Frontiers.

ASM Press, Washington DC, pp. 493-518.

Shi, L., Cao, S., Chen, W., Yang, Z. 2014. Blue light induced anthocyanin

accumulation and expression of associated genes in Chinese bayberry

fruit. Scientia Horticulturae, 179, 98-102.

Sies, H., Menck, C F. 1992. Singlet oxygen induced DNA damage. Mutation

Research/DNAging, 275, 367-375.

Sim, H.L., Hong, Y.K., Yoon, W.B., Yuk, H.G. 2013. Behavior of Salmonella

spp. and natural microbiota on fresh-cut dragon fruits at different storage

temperatures. Intentional Journal of Food Microbiology, 160, 239-244.

Smirnova, G.V., Zakirova, O.N., Oktyabrskii, O.N. 2001. The role of

antioxidant systems in the cold stress response of Escherichia coli.


Somolinos, M., García, D., Pagán, R., Mackey, B. 2008. Relationship between

sub-lethal injury and microbial inactivation by the combination of high

hydrostatic pressure and citral or tert-butyl hydroquinone. Applied and

Environmental Microbiology, 74, 7570-7577.

Spesia, M.B., Caminos, D.A., Pons, P., Durantini, E.N. 2009. Mechanistic

insight of the photodynamic inactivation of Escherichia coli by a

tetracationic zinc (II) phthalocyanine derivative. Photodiagnosis and

Photodynamic Therapy, 6, 52-61.

Spilimbergo, S., Komes, D., Vojvodic, A., Levaj, B., Ferrentino, G. 2013.

High pressure carbon dioxide pasteurization of fresh-cut carrot. The

Journal of Supercritical Fluids, 79, 92-100.

Stersky, A.K., Hedrick, T.I. 1972. Inhibition of growth of airborne coliforms

and other bacteria on selective media. Journal of Milk Food Technology,

35, 156-162.

Sultana, B., Hussain, Z., Asif, M., Munir, A. 2012. Investigation on the

antioxidant activity of leaves, peels, stems bark, and kernel of mango

(Mangifera indica L.). Journal of Food Science, 77, C849-C852.

172

Swanminathan, B., Cabanes, D., Zhang, W., Cossart, P. 2007. Listeria

monocytogenes. In: Doyle, M.P., Beuchat, L.R. (Eds.), Food

Microbiology: Fundamentals and Frontiers. ASM Press, Washington

DC, pp. 457-491.

Thöny-Meyer, L. 2009. Heme transport and incorporation into proteins. In:

Warren, M.J., Smith, A.G. (Eds), Tetrapyrroles: Birth, Life and Death.

Springer Science and Business Media, New York, pp. 149-159.

Unluturk, S., Atılgan, M.R., Baysal, A. H., Unluturk, M.S. 2010. Modeling

inactivation kinetics of liquid egg white exposed to UV-C irradiation.

International Journal of Food Microbiology, 142, 341-347.

Vaitonis, Z., Luksienė, Ž. 2010. LED-based light sources for decontamination

of food: Modelling photosensitization-based inactivation of pathogenic

bacteria. Lithuanian Journal Physics, 50, 141-145.

van Boekel, M.A. 2002. On the use of the Weibull model to describe thermal

inactivation of microbial vegetative cells. International Journal of Food


World Health Organisation (WHO). 2013. Salmonella (non-typoidal).

http://www.who.int/mediacentre/factsheets/fs139/en/ (updated 08.13).

Yuk, H.G., Geveke, D.J. 2011. Nonthermal inactivation and sub-lethal injury

of Lactobacillus plantarum in apple cider by a pilot plant scale

continuous supercritical carbon dioxide system. Food Microbiology, 28,

377-383.

Yang, Y., Khoo, W.J., Zheng, Q., Chung, H.J., Yuk, H.G. 2014. Growth

temperature alters Salmonella Enteritidis heat/acid resistance, membrane

lipid composition and stress/virulence related gene expression.

International Journal of Food Microbiology, 172, 102-109.

Yang, X., Huang, J., Wu, Q., Zhang, J., Liu, S., Guo, W., Yu, S. 2016.

Prevalence, antimicrobial resistance and genetic diversity of Salmonella

isolated from retail ready-to-eat foods in China. Food Control, 60, 50-

56.

http://www.who.int/mediacentre/factsheets/fs139/en/

photodynamic inactivation by 405±5 nm light emitting diode against foodborne pathogens on ready

Documents

Transcript of photodynamic inactivation by 405±5 nm light emitting diode against foodborne pathogens on ready