Pesticide Biochemistry and Physiology xxx (2013) xxx–xxx

Contents lists available at ScienceDirect

Pesticide Biochemistry and Physiology

journal homepage: www.elsevier .com/locate /pest

The pyrethroid resistance status and mechanisms in Aedes aegyptifrom the Guerrero state, Mexico

0048-3575/$ - see front matter � 2013 Elsevier Inc. All rights reserved.http://dx.doi.org/10.1016/j.pestbp.2013.07.005

⇑ Corresponding author. Fax: +52 962 6 265782.E-mail address: penilla@insp.mx (R.P. Penilla).

Please cite this article in press as: H.A. Aponte et al., The pyrethroid resistance status and mechanisms in Aedes aegypti from the Guerrero state, MPestic. Biochem. Physiol. (2013), http://dx.doi.org/10.1016/j.pestbp.2013.07.005

H. Angélica Aponte a, R. Patricia Penilla a,⇑, Felipe Dzul-Manzanilla b, Azael Che-Mendoza b, Alma D. López a,Francisco Solis a, Pablo Manrique-Saide c, Hilary Ranson d, Audrey Lenhart d, Philip J. McCall d,Américo D. Rodríguez a

a Centro Regional de Investigación en Salud Pública, Instituto Nacional de Salud Pública, cuarta avenida norte y 19 calle poniente, C.P. 30700 Tapachula, Chiapas, Mexicob Secretaría de Salud del Estado de Guerrero, C.P. 39090 Chilpancingo, Guerrero, Mexicoc Facultad de Medicina Veterinaria y Zootecnia, Campus de Ciencias Biológicas y Agropecuarias (FCBA), Universidad Autónoma de Yucatán (UADY), Carretera a Xmatkuil Km 15.5,Mérida, Yucatán, Mexicod Liverpool School of Tropical Medicine, Pembroke Place, Liverpool L3 5QA, UK

a r t i c l e i n f o

Article history:Received 4 June 2012Accepted 19 July 2013Available online xxxx

Keywords:Aedes aegyptiPyrethroidDDTKnockdown resistanceEsterasesGlutathione S-transferases

a b s t r a c t

Dengue is one of the most important vector-borne diseases worldwide and is a public health problem inMexico. Most programs in dengue endemic countries rely on insecticides for Aedes control. In Mexico,pyrethroid insecticides (mainly permethrin and deltamethrin) have been extensively used over a decadeas adulticides and represented a strong selection for insecticide resistance for dengue vectors in severalparts of the country. We studied the type, frequency and distribution of insecticide resistance mecha-nisms in Aedes aegypti from six municipalities in the state of Guerrero selected on the basis of historicallyintense chemical control and a high risk for dengue transmission. Ae. aegypti eggs were collected fromOctober 2009 to January 2010 using ovitraps. F1 adults, emerged from these collections, were exposedto permethrin, deltamethrin and DDT in WHO diagnostic tests and showed high resistance levels to bothpyrethroids and DDT. This was consistent with the presence of increased metabolic enzyme activities andtarget site insensitivity due to kdr mutations. Biochemical assays showed elevated esterase and glutathi-one S-transferase activities in the six municipalities. The V1016I kdr mutation on the IIS6 domain of thesodium channel gene was present in an overall frequency of 0.80. A second mutation, F1534C on the IIIS6domain of the same gene was also detected, being the first report of this mutation in Guerrero. The multi-ple resistance mechanisms present in Ae. aegypti from Guerrero state represent a warning for the efficacyof the pyrethroid usage and consequently for the success of the dengue control program.

� 2013 Elsevier Inc. All rights reserved.

1. Introduction

Dengue fever (DF) and dengue haemorrhagic fever (DHF) arediseases of great importance globally on public health in terms ofmorbidity and mortality. Dengue is caused by a flavivirus with fourserotypes and is transmitted primarily by the Aedes aegypti mos-quito. Dengue affects tropical and subtropical areas and is endemicin most countries in Latin America. Data from the Pan AmericanHealth Organization indicate that the dengue incidence rate inMexico ranged from 20 to 51 cases/100,000 inhabitants in 2009–2010 (http://new.paho.org/mex) [1]. Guerrero state regularly re-ports approximately 10% of all dengue cases in Mexico, and in2009, the dengue incidence reached 139 cases/100,000 inhabit-ants. Acapulco was the municipality most affected in Guerrero

state with 2742 cases in 747,925 inhabitants (CENAVECE http://www.cenave.gob.mx/dengue/) [2].

The prevention and control of dengue transmission in Mexico,as in many dengue endemic countries, focus on Ae. aegypti controland insecticides play a major role. Between 1950 and 1960, DDTwas widely used in Mexico for indoor residual spraying and in1998 still was used for malaria control in some regions of the coun-try. Subsequently, the organophosphate (OP) malathion was exten-sively used as an adulticide for ultra-low volume (ULV) spacespraying from 1981 to 1999. The OP temephos is still widely usedas a larvicide. From 2000 to 2011, the major adulticide insecticideclass used for Aedes control have been pyrethroids (PYR), usedeither through residual spraying, impregnated mosquito nets, orspace spraying [3]. During 2007, 60,944 kg of PYR active ingredientwas used for vector borne disease control [4], demonstrating thewidespread use of this class of insecticide throughout the country.Resistance to organophosphate and pyrethroid insecticides is nowwidespread throughout the global geographic range of Ae. aegypti

exico,

2 H.A. Aponte et al. / Pesticide Biochemistry and Physiology xxx (2013) xxx–xxx

[5], and in several states from Mexico a rapid rise of a permethrinknock down resistance allele has already been reported [6].

Metabolic resistance and alterations in the target site of theinsecticides are two of the most important insecticide resistancemechanisms. Metabolic resistance is conferred by alterations inthe levels or activities of detoxification enzymes, predominatelyesterases, glutathione S-transferases and/or cytochrome P450s [7].Structural changes in an insecticide’s target site, such as the volt-age-gated sodium channel, can lower the affinity for the insecticide[7]. Cross-resistance between pyrethroids and DDT is frequentlydue to mutations on the voltage-gated sodium channel gene, andthis mechanism is known as ‘‘knockdown resistance’’ or ‘‘kdr’’[6,8,9,10]. Most resistance-associated mutations are found in seg-ment 6 of domain II (IIS6) and domain III (IIIS6) of the sodiumchan-nel gene. In Ae. aegypti populations from Latin America, severalmutations that correlate with resistance to DDT and PYR have beenidentified i.e. V1016I, I1011M, I1011V and F1534C [8,9,6,11,12].The V1016I mutation is widely distributed in populations of Ae.aegypti in Mexico, and rapidly increased in frequency from 1997to 2009 [6].

Here we report an analysis of pyrethroid resistance and itsunderlying mechanisms in Ae. aegypti from Guerrero state, Mexico.

2. Material and methods

2.1. Mosquito collection

Ae. aegypti eggs were collected transversally between October2009 and January 2010, from 1092 ovitraps placed in six munici-palities in Guerrero state (Fig. 1). These municipalities have beenconsidered by the health authorities as high risk for the denguevirus transmission, due to their history of persistent transmission

Fig. 1. Municipalities in Guerrero state selected for this study. Selection crite

Please cite this article in press as: H.A. Aponte et al., The pyrethroid resistancePestic. Biochem. Physiol. (2013), http://dx.doi.org/10.1016/j.pestbp.2013.07.00

and high numbers of cases of dengue fever [2]. The sites collectedwere: Eight neighborhoods from Iguala (Chapultepec, Luis Quinte-ro, San José, Santa Cruz, Acatempan, Mirador, Vicente Guerrero andTierra y Libertad) with a total of 188 ovitraps; four neighborhoodsfrom Acapulco (Progreso, Renacimiento, Hogar Moderno and Beni-to Juárez) with a total of 560 ovitraps; two neighborhoods fromChilpancingo (Tatagildo and San Mateo) with a total of 80 ovitraps;four neighborhoods from Zihuatanejo (Primer Paso, Morelos, Hujaland Emiliano Zapata) with a total of 160 ovitraps; two neighbor-hoods from Tlapa (Caltitlán and Jardín Niños) with a total of 64 ovi-taps and; one neighborhood from Técpan de Galeana (Colonia Pri)with 40 ovitraps.

Eggs were hatched at the insectary of the Centro Regional deInvestigación en Salud Pública (CRISP) and larvae were reared toadults at 25–27 �C, relative humidity 60–70% and fed on a diet of10% sucrose solution. One to three days old adults were used forthe insecticide susceptibility tests [13], biochemical assays andmolecular analysis. Three reference mosquito strains were usedin this study: the New Orleans susceptible strain, originally colon-ised by the U.S. Centers for Disease Control and Prevention (CDC),the laboratory strain 90, which is 10% permethrin resistant, and astrain collected by ourselves in Isla Mujeres, Quintana Roo, Mexicoin January 2009, which was previously reported as resistant andcalled IMUS by Saavedra-Rodriguez et al. [9]. This strain (IMUS2009) was colonised without insecticide pressure at CRISP, ofwhich F11 generation was used for this study.

2.2. Determination of diagnostic doses of insecticides

As the WHO recommended discriminative dosage for permeth-rin susceptibility testing bioassays of 0.25% did not kill a singlefield individual mosquito in our first bioassays, we decided to

ria were based on the accumulated cases of dengue fever in 2009–2010.

status and mechanisms in Aedes aegypti from the Guerrero state, Mexico,5

Table 1Primer sequences used in kdr genotyping.

Primer name Position Oligonucleotide sequence (50-30)

Ae2021aF ATTGTATGCTTGTGGGTGAe2021aR GCGTTGGCGATGTTCAaEx31P TCGCGGGAGGTAAGTTATTGAaEx31Q GTTGATGTGCGATGGAAATGAaEx31wt CCTCTACTTTGTGTTCTTCATCATCTTAaEx31mut GCGTGAAGAACGACCCGCVal1016dtc 1016-1st GCAAGGCTAAGAAAAGGTTAAGTACIle1016dtc 1016-1st GCAAGGCTAAGAAAAGGTTAAGTATIle1016rpt 1016-1st CTGTGCGAGTGGGAAACAAT

rpt = reporter, dtc = detector. Ninety-six-well streptavidin plates (Sigma�ScreenTM)were used for SNP detection.Colour change was scored visually after incubating with 100 ll TMB solution(Roche� BM Blue Pod Substrate) for 5 min.

H.A. Aponte et al. / Pesticide Biochemistry and Physiology xxx (2013) xxx–xxx 3

increase the dosage based on one of our laboratory strain base-line(undertaken following the WHO recommendations [13]), whichpermethrin mortalities were not less than 90% using the WHO rec-ommended discriminative dosage (thus called laboratory strain90). Using a higher discriminative dosage would allow us to obtainresistance percentage figures and so to be able to compare resultsof the localities collected. For the two pyrethroids, base lines wereestablished using six dosages of deltamethrin and seven of per-methrin which gave a range of mortalities between 10% and 99%and 2% and 99% respectively, with four replicates each. Data wereanalysed with the software EPA (Probit Analysis Program version1.5) and Chi square analysis showed no significance between theobserved and expected lines. The resulting diagnostic doses were:permethrin (0.816% concentration) and deltamethrin (0.034% con-centration). Filter papers (Whatman # 1 CH of 12 cm� 15 cm) werethen impregnated with these insecticide percentages as describedby WHO [13,14]. Four percent DDT was used to impregnate filterpapers. All insecticides were technical grade; the pyrethroids wereprovided by Bayer de Mexico and DDT was obtained by Sigma.

2.3. Insecticide bioassays

Mortality with diagnostic concentration treated filter papers ofthe three insecticides was determined using WHO test kits against1–3 day old mosquitoes [13,14]. At least 100 mosquitoes wereused in each bioassay and if the mosquitoes were available, threereplicates were done for each insecticide and locality. After an hourof exposure, mosquitoes were transferred to the holding tube andprovided with a 10% sugar solution soaked cotton pads. Mortalitywas recorded after 24-h, and dead and surviving mosquitoes werefrozen separately for molecular assays. Tests with papers impreg-nated as described by WHO [13] but without insecticide, were con-ducted in parallel and served as control.

2.4. Biochemical assays

To determine whether a resistance mechanism based on themetabolism of the pyrethroid and DDT insecticides could be in-volved in these mosquito populations, enzymatic levels were mea-sured by biochemical assays compared with those of thesusceptible strain. Protein concentrations were calculated accord-ing to Bradford [15] and esterase concentration, glutathioneS-transferase (GST) activity and cytochrome P450 content weremeasured as described by Penilla et al. [16]. As the distributionof a normal population with a determined enzyme activity canbe observed in a histogram of 47 mosquitos data, batches of at least24 females and 23 males of one-day-old mosquitoes were used byassay and were individually homogenized on ice in 200 ll ofdistilled water in a v-bottomed micro titer tube [16]. Esterase con-centrations were quantified using three distinct substrates:a and b- naphthyl acetate and para-nitrophenyl acetate (qNPA).Glutathion S-transferase (GST) activity was measured using thechlorodinitrobenzene (CDNB) substrate (Sigma) and, cytochromeP450 content was determined using heme–peroxidase reactions.Absorbances at end points for the colorimetric assays and kineticsof 2 and 5 min for the qNPA and GST assays, respectively, wereread in a Multiskan� spectrophotometer (Thermo Labsystems).Enzyme activities or content/mg protein were calculated for all ref-erence and field samples.

2.5. Detection of mutations in Ae. aegypti voltage- gated sodiumchannel

Genomic DNA was extracted from 100 survivor and dead mos-quitoes (sample size was determined from the total of 10,179 pyre-throid exposed mosquitoes, at a 95% of confidence, 10% of sampling

Please cite this article in press as: H.A. Aponte et al., The pyrethroid resistancePestic. Biochem. Physiol. (2013), http://dx.doi.org/10.1016/j.pestbp.2013.07.00

error and a resistance allele frequency of 0.49 previously reported[26]) of different pyrethroid bioassays using the Livak method [17].The PCR primers Ae2021aF and Ae2021aR were used to amplify a457 bp fragment of exons 20 and 21, encoding the subunit 6 of do-main II of the sodium channel gene [12], 77 out of 100 mosquitoesDNA amplified. Cycling conditions were 95 �C for 5 min followedby 35 cycles at 94 �C for 30 s, 58 �C for 30 s, and 72 �C for 30 s fol-lowed by a final elongation stage at 72 �C for 10 min. To amplifyexon 31 encoding the subunit 6 of the domain III, we used thePCR primers AaEx31P and AaEx31Q, which amplified a 350 bp frag-ment [12,18]. The conditions were 95 �C for 5 min followed by 35cycles at 94 �C for 30 s, 60 �C for 30 s, and 72 �C for 30 s followed bya final elongation stage at 72 �C for 10 min. PCR reactions were car-ried out according to the methods described by Harris et al. [12].For the primer set AaEx31, 18 out of 100 genomic DNA tested,amplified.

To confirm the presence of mutations in its nucleotide se-quence, purified PCR products (Qiagen� PCR purification kit forsequencing) of exons 20-21 and exon 31 from eight mosquitoes(seven permethrin survivors and one deltamethrin survivor), weresequenced by Macrogen (Seoul, Korea). The sequences were thenassembled and aligned using Lasergene (DNAstar, Madison, WI).

2.6. Kdr genotyping

2.6.1. Hot oligonucleotide ligation assay (HOLA) for the detection ofV1016I

For the 77 amplified PCR products, a HOLA assay was used tocalculate the frequency of the V1016I mutation in the exon 20-21 as described by Rajatileka et al. [18]. For each allele, a 20 ll liga-tion reaction containing 3 ll of PCR product, 1X Ampligase� buffer,50 nM of each detector/reporter mix, and 0.05 U/ll Ampligase�

was set up. The reaction conditions for the hot ligation were95 �C for 5 min followed by 25 cycles at 94 �C for 1 min, 62 �C for2 min and 4 �C-hold. The sequence of the oligonucleotide reporterIle1016rpt and detector Val1016dtc and Ile1016dtc are shown inTable 1.

2.6.2. Tetraplex assay for the detection of F1534CTo test this assay as a diagnostic technique for detection of the

F1534C mutation for these samples, a tetra primer PCR assay wasused as designed by Harris et al. [12], using the primers AaEx31P,AaEx31Q, AaEx31wt and AaEx31mut. In this PCR, the flankingprimers amplify a control band of 350 bp. Two internal allele spe-cific primers give products of either 231 bp (wild type, phenylala-nine allele) or 163 bp (mutant, cysteine allele) by forming PCRprimer pairs with the flanking regions. Each PCR reaction con-tained 2.5 mM MgCl2, 0.4 mM each dNTPs, 0.5 lM each primer,2.5 U taq polymerase, and 1% of the total genomic DNA (extracted

status and mechanisms in Aedes aegypti from the Guerrero state, Mexico,5

Table 2Insecticide (permethrin, deltamethrin and DDT) susceptibility status of Ae. aegypti indifferent localities from Guerrero state compared with a pyrethroid resistant strain(IMUS 2009) and a susceptible reference strain (New Orleans).

Municipalities 0.816% permethrin 0.034%deltamethrin

4% DDT

n Mean ± SDmortality%

n Mean ± SDmortality%

n Mean ± SDmortality%

Iguala 1847 12.3 ± 15.5* 1853 20.2 ± 22.4* 900 9.5 ± 11.9*

Acapulco 1135 9.8 ± 15.6* 823 8.7 ± 8.7* 300 2.0 ± 2.7*

Chilpancingo 517 14.2 ± 13.4* 309 13.0 ± 13.4* 200 15.0 ± 5.1*

Zihuatanejo 1225 11.4 ± 14.7* 1025 22.2 ± 17.3* 400 0.0 ± 0.0*

Tlapa 412 15.7 ± 7.7* 402 45.2 ± 15.3* – –Técpan de

Galeana318 14.5 ± 23.9* 312 28.3 ± 16.2* 200 0.0 ± 0.0*

IMUS 2009 307 28.9 ± 15.3* 321 11.9 ± 11.7* 300 0.0 ± 0.0*

New Orleans 300 100.0 ± 0.0 307 100.0 ± 0.0 300 100.0 ± 0.0

n: total number of tested mosquitoes, SD: standard deviation.* Mean of mortality percentage significantly different to the New Orleans strain,P < 0.0001.

4 H.A. Aponte et al. / Pesticide Biochemistry and Physiology xxx (2013) xxx–xxx

from each of the eighteen mosquitoes that amplified) giving atotal final volume of 25 ll. The cycling conditions were 95 �C for5 min followed by 35 cycles at 94 �C for 30 s, 60 �C for 30 s, and72 �C for 30 s, and a final elongation at 72 �C for 10 min. PCR prod-ucts were visualized on a 2% agarose gel.

2.7. Statistical analysis

Statistical analyses were performed using SPSS 19.0 software[19]. Descriptive analyses of mortality were obtained from differ-ent exposures to insecticides. An analysis of variance (ANOVA)was conducted to compare the average mortality of all strainsand the New Orleans reference strain. The statistical analyses in-cluded Levenes test for homogeneity of variance and descriptiveanalysis (mean, standard deviation, a 0.05). The enzymatic activitydata of the field mosquitoes were compared using ANOVA, andLevene’s and Dunnet’s tests were used to compare means againstthose activities of the reference strain (a 0.05). The allele frequencyfor the V1016 mutation was calculated using the Hardy–WeinbergEquilibrium Calculator (http://www.changbioscien.com).

3. Results

3.1. Insecticide bioassays

Bioassays for insecticides were carried out using a range of mos-quitoes from 102 to 1853 per locality. Results from the bioassaysindicated that the mosquito populations tested from Guerrerostate are highly resistant to both of the PYRs (permethrin anddeltamethrin) tested. Mortalities varied between 9.8–15.7% and8.7–45.2% for those exposed to permethrin and deltamethrin,respectively (Table 2) compared to 100% mortality in the suscepti-ble reference strain. Permethrin resistance in the field mosquitoeswas higher than that of the IMUS 2009 resistant strain (28.9% mor-tality), but that was not the case for deltamethrin resistance, wherethe IMUS 2009 strain was more resistant (11.9% mortality), exceptfor mosquitoes from Acapulco (8.7% mortality). All field mosquitopopulations showed high resistance to DDT, with mortality rangesfrom 0% to 15.0%. Mosquitoes from Zihuatanejo and Técpan deGaleana had resistance compared to those of the IMUS 2009 strain,with 0% mortality.

3.2. Enzymatic assays

A total of 1551 mosquitoes from the different localities and thereference strains were assayed for the three enzymes. The mediansof enzymatic activity for each mosquito population compared withthose of the susceptible strain are shown in Figs. 2–5. Esterase con-centrations with the substrates a naphthyl acetate and qNPA(Figs. 2A and 3) and GST activities (Fig. 4) were significantly ele-vated (P < 0.001) in all field mosquito populations when comparedwith those of the susceptible New Orleans strain (mean ± deviationstandard for New Orleans (n = 149) = 0.00041 ± 0.0001 nmola-naphthol/mg prot; 0.496 ± 0.160 lmol qNPA/min/mg prot;1.60 ± 0.76 mmol CDNB conjugated/min/mg prot). Mosquitoesfrom Acapulco had the highest mean esterase concentration withboth substrates: 0.0011 ± 0.0011 nmol a-Naphhtol/mg prot,2.12 ± 2.09 lmol pNPA/min/mg prot, n = 282). While mosquitoesfrom Tlapa had the highest mean GST activity (8.08 ± 2.11 mmolCDNB conjugated/min/mg prot, n = 188). Mean cytochrome P450

contents reported in pmol P450/mg prot (Fig. 5) were significantlyhigher in mosquitoes from Acapulco (0.0029 ± 0.0061, n = 282),Iguala (0.0016 ± 0.0012, n = 320) (P < 0.001) and Zihuatanejo(0.0012 ± 0.0007, n = 376) (P < 0.05) compared with that of theNew Orleans strain (0.00045 ± 0.00028, n = 149).

Please cite this article in press as: H.A. Aponte et al., The pyrethroid resistancePestic. Biochem. Physiol. (2013), http://dx.doi.org/10.1016/j.pestbp.2013.07.00

3.3. Kdr genotyping

Six out of eight PCR products were successfully sequencedshowing two mutations, V1016I and F1534C, three samples weresequenced for both mutations from which two (from Acapulcoand Iguala) were homozygous resistant for both mutations andone (from Chilpancingo) was heterozygous resistant for F1534Cmutation and homozygous resistant for V1016V mutation. Theother three samples were homozygous resistant for F1534C.

The first mutation is the result of a valine to isoleucine substi-tution in the IIS6 domain, exons 20-21. The HOLA assay to detectthe V1016I mutation (Fig. 6) was conducted on the 77 genomicDNAs (from both pyrethroid survivors and dead mosquitoes thatamplified the exon 21-22), of which 58 were positive in the color-imetric reaction. We calculated the frequencies for the pyrethroidresistance allele in these 58 individuals, using the formula ofHardy–Weinberg Equilibrium (Table 3). The V1016I mutationwas found in the 58 positive mosquitos, with an overall allele fre-quency of 0.8 for the sample studied. Acapulco had 1.0 resistanceallele frequency in survivors to pyrethroid.

The second mutation in the IIIS6 domain (exon 31) is non-syn-onymous, in which a single base pair substitution changes phenyl-alanine to cysteine on the 1534 codon. From the six mosquitoessequenced, all had the mutation, but five were homozygotes(two from Acapulco, one from Iguala, one from Zihuatanejo andone from Tecpan) and one was a heterozygote (from Chilpancingo).

The PCR tetraplex technique was successfully applied in thesamples from Guerrero. Three genomic DNAs extracted from survi-vors to pyrethroids from Acapulco, Iguala and Zihuatanejo, andthat amplified the exon 31, were tested to determine the presenceof the F1534C mutation. Results showed a band of 163 bp for thethree samples (Fig. 7). The three samples were homozygous resis-tant (RR). This is the first time that the F1534C mutation has beenfound in Ae. aegypti from Guerrero, Mexico.

4. Discussion

Pyrethroid and DDT resistance was detected at high levels in Ae.aegypti collected from the six municipalities in the Guerrero stateof Mexico. Resistance to pyrethroid insecticides for this specieshad been already reported during the last decade in several statesin Mexico [6,9,20,21,24,26,27]. The mechanisms in Ae. aegypti cor-relating with the pyrethroid resistance also have been determinedin those studies. They were based mainly on kdr and there are re-ports inclusive of its rapid allele rising [6,9,26,27]. We found that

status and mechanisms in Aedes aegypti from the Guerrero state, Mexico,5

Fig. 2. Box plots representing the esterase median activity (horizontal bar) and upper and lower quartiles for different Aedes aegypti populations from Guerrero using thesubstrates: (A) a naphthyl acetate and (B) b naphthyl acetate. The vertical lines show the full range of the data set. Black stars could mean outliers. Red stars show statisticaldifferences among the field mosquitoes and resistant strain (IMUS = IMUS 2009) against the susceptible strain (P < 0.001) and for resistant strain and the susceptibility strainin (B) (P < 0.05). (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

H.A. Aponte et al. / Pesticide Biochemistry and Physiology xxx (2013) xxx–xxx 5

resistance to pyrethroids in the field mosquito populations fromfive municipalities of Guerrero was also mainly due to a kdr-basedresistance mechanism.

Two non-synonymous mutations in the sodium channel,V1016I and F1534C, previously reported to be involved in resis-tance to pyrethroids, were detected in this study. The I1011M/V,which also was previously identified in the Mexican populationof Ae. aegypti, was not investigated in this study because of its

Please cite this article in press as: H.A. Aponte et al., The pyrethroid resistancePestic. Biochem. Physiol. (2013), http://dx.doi.org/10.1016/j.pestbp.2013.07.00

negative correlation to pyrethroid resistance [9]. The V1016I muta-tion has been already reported in Mexico in the states of Chiapas,Quintana Roo, Yucatan, Veracruz, Nuevo Leon [6] and in somelocalities of Guerrero [26,27]. We have found for the V1016I muta-tion a resistance allele general frequency of 0.8 for the state ofGuerrero (based in the collection in different localities from fivemunicipalities). We did not determined the resistance allele fre-quency for all the samples undertaken in bioassays, but correlation

status and mechanisms in Aedes aegypti from the Guerrero state, Mexico,5

Fig. 3. Box plots representing the esterase median activity (horizontal bar) and upper and lower quartiles for different Aedes aegypti populations from Guerrero using thesubstrate para-nitrophenyl acetate (pNPA). The vertical lines show the full range of the data set. Black stars could mean outliers. Red stars show statistical differences amongthe field mosquitoes and the resistant strain (IMUS = IMUS 2009) against the susceptible strain (P < 0.001). (For interpretation of the references to colour in this figure legend,the reader is referred to the web version of this article.)

Fig. 4. Box plots representing GST median activity (horizontal bar) and upper and lower quartiles for different Aedes aegypti populations from Guerrero using the CDNBsubstrate. The vertical lines show the full range of the data set. Black stars could mean outliers. Red stars show statistical differences among the field mosquitoes and thesusceptible strain (P < 0.0001), and for resistant strain (IMUS = IMUS 2009) and the susceptible strain (P < 0.05). (For interpretation of the references to colour in this figurelegend, the reader is referred to the web version of this article.)

6 H.A. Aponte et al. / Pesticide Biochemistry and Physiology xxx (2013) xxx–xxx

of this mutation and bioassay results supporting the role of thismutation in conferring pyrethroid resistance has been previouslyreported [9]. The high number of dengue cases reported in some

Please cite this article in press as: H.A. Aponte et al., The pyrethroid resistancePestic. Biochem. Physiol. (2013), http://dx.doi.org/10.1016/j.pestbp.2013.07.00

municipalities like Acapulco and Iguala in 2009–2010 could be ex-plained in certain way by the high resistance allele frequencyfound for this mutation in the dengue vector.

status and mechanisms in Aedes aegypti from the Guerrero state, Mexico,5

Fig. 5. Box plots representing cytochrome P450 median content (horizontal bar) and upper and lower quartiles for different Aedes aegypti populations from Guerrero. Thevertical lines show the full range of the data set. Black stars could mean outliers. Red stars show statistical differences among the field mosquitoes and the susceptible strain(P < 0.001 and P < 0.05 for Zihuatanejo). IMUS = IMUS 2009. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of thisarticle.)

Fig. 6. Acapulco mosquito samples from the HOLA assay: 1–6, survived mosquitoesto pyrethroid exposure; 18, heterozygous mosquito from the reference strain 90.V = valine, L = isoleucine, RR = homozygous resistant and RS = heterozygoussusceptible.

H.A. Aponte et al. / Pesticide Biochemistry and Physiology xxx (2013) xxx–xxx 7

The mutation F1534C was found in all six mosquitoes that weresequenced, with five homozygotes and one heterozygote. Thismutation is very prevalent in the Cayman Islands, and is also foundin Southeast Asia and in populations of Aedes albopictus from Sin-gapore [12,28,29]. Recently this mutation was reported in Ae.aegypti in a DDT/permethrin-resistant strain (PMD-R) fromThailand [30], it has been also associated with pyrethroid resis-tance in Ae. aegypti from Vietnam and Cayman Islands [12,32],and it was shown to confer resistance to type I but not type II pyre-throids in cockroach sodium channel [31]. The phenotypic effect ofhaving both F1534C and V1016I alleles is not yet known but thehigh frequencies of both of these alleles in the Caribbean suggestsa selective advantage [12]. This study represents the first report ofthis mutation in Mexico. Analysis of the resistance allele frequencyin these mosquito populations still has to be carried out in our lab-oratory in order to calculate the percentage of individuals withboth mutations (V1016I and F1534C) and the resistance levels topyrethroids that together and each mutation separately confers.

The same studies reporting pyrethroid resistance in Mexico alsoconcluded that metabolic resistance mechanisms are involved,

Please cite this article in press as: H.A. Aponte et al., The pyrethroid resistancePestic. Biochem. Physiol. (2013), http://dx.doi.org/10.1016/j.pestbp.2013.07.00

where esterase or cytochrome P450 activities have been found ele-vated [20,21,24]. Our results also suggest that pyrethroidresistance could be mediated by esterases-, GSTs-, and for mosqui-toes from three municipalities by cytochrome P450s-based resis-tance mechanisms. Metabolism assays are necessary to be donefor these field mosquito populations in order to confirm their con-tribution extent to pyrethroid resistance. In Brazil however, it washypothesized that the high esterase activity detected with theqNPA substrate in some populations could be construed as indirectevidence of the role of esterases in pyrethroid resistance, becauseesterase activity increased with the introduction of PYR in adultmosquito control [23]. Studies in Cuba in a deltamethrin selectedlaboratory strain showed that esterase and GST enzymes wereresponsible for resistance to pyrethroids [22]. Elevated expressionof GSTe-2 has been associated with DDT and, permethrin resistantAe. aegypti strain, together with recently RNAi experiments, havedemonstrated a role for Epsilon class GSTs in conferring resistanceto pyrethroids [25]. In another study, it has been demonstratedthat elevated activities of GSTs determined by biochemical assayswith the CDNB substrate from Ae. aegypti populations of othermunicipalities from Guerrero, were not correlated with DDTmetabolism [33], which suggests that those elevated GST activitiesmay be more associated in pyrethroid than in DDT resistance.

Our results demonstrated the existence of PYR and DDT crossresistance with two target site point mutations, and multipleunderlying enzyme activity-based resistance mechanisms. Theuse of PYR in Guerrero for dengue vector control dates back morethan 10 years and they were widely used as adulticides for both in-door and outdoor ULV/residual spraying. As a result of recognizingthe high levels of PYR resistance the Vector Control Program inGuerrero has switched to an organophosphate (chlorpyrifos) forULV as adulticide for dengue vector control. Further studies shouldto be carried out to establish frequency and changes of these kdrmutations, changes in the metabolic mechanisms and the role of

status and mechanisms in Aedes aegypti from the Guerrero state, Mexico,5

Table 3Phenotype and kdr allele frequencies for the amino acid 1016 of the voltage-gated sodium channel of different Aedes aegypti populations from Guerrero and the IMUS 2009resistant strain (survivors and dead) exposed to pyrethroids (permethrin and deltamethrin) in WHO tests.

Municipality Phenotype/bioassay n sample Genotype Kdr/HOLA assay F1 alleles

RR RS SS R SIle/Ile Val/Ile Val/Val Ile Val

Iguala Survivors 18 13 5 0 0.85 0.15Dead 2 0 2 0 0.5 0.5Total 20 13 7 0 0.806 0.194

Acapulco Survivors 12 12 0 0 1.0 0.0Dead 2 0 2 0 0.5 0.5Total 14 12 2 0 0.926 0.074

Chilpancingo Survivors 4 2 2 0 0.75 0.25Dead 2 0 2 0 0.5 0.5Total 6 2 4 0 0.577 0.423

Zihuatanejo Survivors 4 2 2 0 0.75 0.25Dead 7 2 5 0 0.64 0.36Total 11 4 7 0 0.603 0.397

Técpan de Galeana Survivors 1 0 1 0 0.5 0.5

Guerrero Survivors 39 29 10 0 0.862 0.138Dead 13 2 11 0 0.392 0.608Total 52 31 21 0 0.8 0.2

IMUS 2009 Survivors 3 0 3 0 0.5 0.5Dead 1 0 1 0 0.5 0.5

Fig. 7. Agarose gel (2%) electrophoresis of tetraplex PCR products for F1534Cmutation. Permethrin resistant mosquito samples: 1 Acapulco, 12 Iguala, 14Zihuatanejo, M, molecular marker; FF, control homozygous susceptible mosquito;CC, control homozygous resistant mosquito; FC, heterozygote.

8 H.A. Aponte et al. / Pesticide Biochemistry and Physiology xxx (2013) xxx–xxx

each one of these mechanisms in the resistance to pyrethroids, asthe general status of susceptibility to the different insecticides inthese Ae. aegypti populations from Guerrero, should becontinuously monitored to ensure the optimal selection of insecti-cides for control actions taken by the Vector Control Program.

Acknowledgments

This study was supported by the project ‘‘Impacto del controlquímico sobre las poblaciones del vector Aedes aegypti en funciónde la eficacia biológica, susceptibilidad y mecanismos de resisten-cia a insecticidas en Guerrero México’’ (FOMIX CONACYT GuerreroID:GUE-2008-C01-91 330).

Special thanks to the technicians of the Vector Control Programand the Ministry of Health of Guerrero and people of the localitiesstudied for their allowance on the execution of this project. Thanksto Gabriel Fuentes and Octavia Perez for their technical collabora-tion in this study and to Lilia González for her critical revision ofthe manuscript.

Please cite this article in press as: H.A. Aponte et al., The pyrethroid resistancePestic. Biochem. Physiol. (2013), http://dx.doi.org/10.1016/j.pestbp.2013.07.00

References

[1] Organización Panamericana de las Salud (http://paho.org/mex).[2] Centro Nacional de Vigilancia Epidemiológica y Control de Enfermedades

(CENAVECE) http://www.cenavece.gob.mx/denge/.[3] NORMA OFICIAL MEXICANA, 2003 NOM-032-SSA2-2002 para la vigilancia

epidemiológica, prevención y control de enfermedades transmitidas por vectorD.O.F. 21 julio 2003. Norma Oficial Mexicana, Mexico City.

[4] WHO 2009. Global insecticide use for vector-borne disease control. 4th ed.‘‘WHO/HTM/NTD/WHOPES/GCDPP/2009.6’’.

[5] H. Ranson, J. Burhani, L. Lumjuan, W.C. Black IV, Insecticide resistance indengue vectors, Tropika Net J. 1 (1) (2010).

[6] G.P. Garcia, A.E. Flores, I. Fernandez, K. Saavedra, G. Reyes, S. Lozano, J.G. Bond,M. Casas, J.M. Ramsey, J. Garcia, M. Dominguez, H. Ranson, J. Hemingway, L.Eisen, W.C. Black IV, Recent rapid rise of a permethrin knock down resistanceallele in Aedes aegypti in Mexico, PLoS. Negl. Trop. Dis. 10 (3) (2009) e531,http://dx.doi.org/10.1371/journal.pntd.0000531.

[7] J. Hemingway, N.J. Hawkes, L. McCarroll, H. Ranson, The molecular basis ofinsecticide resistance in mosquitoes, Insect Biochem. Mol. Biol. 34 (2004) 653–665.

[8] C. Brengues, N.J. Hawkes, F. Chandre, L. McCarroll, S. Duchon, P. Guillet, S.Manguin, J.C. Morgan, J. Hemingway, Pyrethroid and DDT cross- resistance inAedes aegypti is correlated with novel mutations in the voltage-gated sodiumchannel gene, Med. Vet. Entomol. 17 (2003) 87–94.

[9] K. Saavedra-Rodriguez, L. Urdaneta-Marquez, S. Rajatileka, M. Moulton, A.E.Flores, I. Fernandez-Salas, J. Bisset, M. Rodriguez, P.J. Mccall, M.J. Donelly, H.Ranson, J. Hemingway, W.C. Black IV, A mutation in the voltage-gated sodiumchannel gene associated with pyrethroid resistance in Latin American Aedesaegypti, Insect. Mol. Biol. 16 (6) (2007) 785–798.

[10] C. Chang, W.K. Shen, T.T. Wang, Y.H. Lin, E.L. Hsu, S.M. Dai, A novel amino acidsubstitution in a voltage-gated sodium channel is associated with knockdownresistance to permethrin in Aedes aegypti, Insect. Biochem. Mol. Biol. 39 (2009)272–278.

[11] E. Lima, M.H. Santos, A. Araújo, E.V. Gomes, U.M. Da Silva, L.N. Oliveira, A.E.Santana, C. Barbosa, C. Paiva, C.M. Goulart, C.S. Wilding, C.F. Junqueira, M.A.Melo, Insecticide resistance in Aedes aegypti populations from Ceará, Brazil,Parasites & Vectors (2011) 4–5.

[12] A.F. Harris, R. Shavanthi, H. Ranson, Pyrethroid resistance in Aedes aegypti fromGrand Cayman, Am. J. Trop. Med. Hyg. 83 (2) (2010) 277–284.

[13] World Health Organization, Test procedures for insecticide resistancemonitoring in malaria vectors, bioefficacy and persistence of insecticides ontreated surfaces, 1998, WHO/CDS/CPC/MAL/98.12, Geneva, p. 43.

[14] World Health Organization, Preparation, production and supply or test kits,impregnated papers and standard solutions for the evaluation of vectorsusceptibility to insecticides, 1980, WHO/VBC/EC 80.25, Geneva.

[15] M.M. Bradford, A rapid and sensitive method for the quantitation ofmicrogram quantities of protein utilizing the principle of protein-dyebinding, Anal. Biochem. 72 (1976) 248–254.

[16] R.P. Penilla, A.D. Rodriguez, J. Hemingway, J.L. Torres, J.I. Arredondo- Jimenez,M.H. Rodriguez, Resistance management strategies in malaria vector mosquito

status and mechanisms in Aedes aegypti from the Guerrero state, Mexico,5

H.A. Aponte et al. / Pesticide Biochemistry and Physiology xxx (2013) xxx–xxx 9

control. Baseline data for a large-scale field trial against Anopheles albimanus inMexico, Med. Vet. Entomol. 12 (1998) 217–233.

[17] K.J. Livak, Organization and mapping of a sequence on the Drosophilamelanogaster X-chromosome and Y-chromosome that is transcribed duringspermatogenesis, Genetics 107 (1984) 611–634.

[18] R. Rajatileka, W.C. Black IV, K. Saavedra, Y. Trongtokit, C. Apiwathnasorn, P.J.McCall, H. Ranson, Development and application of a simple colorimetricasssay reveals widespread distribution of sodium channel mutations in Thaipopulations of Aedes aegypti, Acta tropica 108 (2008) 54–57.

[19] SPSS 19 for windows (2010), SPSS Incorporation. Headquarters, 233 S. WackerDrive, 11th floor. Chicago, Illinois 60606.

[20] A.E. Flores, W. Albeldano-Vazquez, I.F. Salas, M.H. Badii, H.L. Becerra, Elevatedalpha-esterase levels associated with permethrin tolerance in Aedes aegypti(L.) from Baja California, Mexico, Pest. Biochem. Physiol. 82 (2005) 66–78.

[21] A.E. Flores, G. Reyes, I. Fernandez-Salas, F.J. Sanchez, G.P. Garcia, Resistance topermethrin in Aedes aegypti (L.) in Northern Mexico, SouthwesternEntomologist 34 (2) (2009) 167–177, http://dx.doi.org/10.3958/059.034.020.

[22] M.M. Rodriguez, J.A. Bisset, Y. Armas, F. Ramos, Pyrethroid insecticide-resistantstrain of Aedes aegypti from Cuba induced by deltamethrin selection, J. Am.Mosq. Control Assoc. 21 (4) (2005) 437–445.

[23] A.J. Martins, R.M. Lins, J.B. Linss, A.A. Peixoto, D. Valle, Voltage-gated sodiumchannel polymorphism and metabolic resistance in pyrethroid-resistant Aedesaegypti from Brazil, Am. J. Trop. Med. Hygi. 81 (1) (2009) 108–115.

[24] A.E. Flores, J.S. Grajales, I.F. Salas, G.P. Garcia, M.H.L. Becerra, S. Lozano, W.G.Brogdon, W.C. Black IV, B. Beaty, Mechanisms of insecticide resistance in fieldpopulations of Aedes aegypti (L) from Quintana Roo, Southern Mexico, J. Am.Mosq. Control Assoc. 22 (4) (2006) 672–677.

[25] N. Lumjuan, L. McCarroll, L.A. Prapanthadara, J. Hemingway, H. Ranson,Elevated activity of an Epsilon class glutathione transferase confers DDTresistance in the dengue vector, Aedes aegypti, Insect Biochem. Mol. Biol. 35(2005) 861–871.

Please cite this article in press as: H.A. Aponte et al., The pyrethroid resistancePestic. Biochem. Physiol. (2013), http://dx.doi.org/10.1016/j.pestbp.2013.07.00

[26] G.G. Clark, Y. Rubio, Mosquito vector biology and control in Latin America 19thsymposium, J. Am. Mosq. Control Assoc. 25 (4) (2009) 486–499.

[27] Q. Siller, G. Ponce, S. Lozano, A.E. Flores, Update on the frequency of Ile 1016mutation in voltage-gated sodium channel gene of Aedes aegypti in Mexico, J.Am. Mosq. Control Assoc. 27 (4) (2011) 357–362.

[28] J. Yanola, P. Somboon, C. Walton, W. Nachaiwieng, L. Prapanthadara, A novelF1552/C1552 point mutation in the Aedes aegypti voltage-gated sodiumchannel gene associated with permethrin resistance, Pestic. Biochem.Physiol. 96 (2010) 127–131.

[29] S. Kasai, L. Ching, S.G. Lam- Phua, C.S. Tang, K. Itokawa, O. Komagata, M.Kobayashi, T. Tomita, First detection of a putative knockdown resistance genein major mosquito vector, Aedes albopictus, Jpn. J. Infect. Dis. 64 (2011) 217–221.

[30] J. Yanola, P. Somboon, C. Walton, W. Nachaiwieng, W. Somwang, L.Prapanthadara, High-throughput assays for detection of the F1534Cmutation in the voltage-gated sodium channel gene in permethrin-resistantAedes aegypti and the distribution of this mutation throughout Thailand. Trop.Med. and, Int. Health 16 (4) (2011) 501–509.

[31] Z. Hu, Y. Du, Y. Nomura, K. Dong, A sodium channel mutation identified inAedes aegypti selectively reduces cockroach sodium channel sensitivity to typeI, but not type II pyrethroids, Insect Biochem. Mol. Biol. 41 (1) (2011) 9–13.

[32] H. Kawada, Y. Higa, O. Komagata, S. Kasai, T. Tomita, N.T. Yen, L.L. Loan, R.A.Sanchez, M. Takagi, Widespread distribution of a newly found point mutationin voltage-gated sodium channel in pyrethroid-resistant Aedes aegyptipopulations in Vietnam, PLoS. Negl. Trop. Dis. 10 (3) (2009) e0000527,http://dx.doi.org/10.1371/journal.pntd.0000527.

[33] N.I. Vázquez-Martínez, F. Dzul-Manzanilla, A.D. López-Solis, F. Solis-Santoyo,A.D. Rodríguez-Ramírez y R.P. Penilla-Navarro. Las glutatión s-transferasas enAedes aegypti resistente a piretroides y DDT de Guerrero y Chiapas,Entomología Mexicana 11(2) (2012): 874–879.

status and mechanisms in Aedes aegypti from the Guerrero state, Mexico,5