PCR Design Outline

• PCR Design- Importing and exporting oligos

- Parameters, saving data, settings- Types of PCR Design with examples

217 321230 240 250 260 270 280 290 300 310(217)

GACACACTGCAGTTCGTCTGTGGGGACAGGGGCTTCTACTTCAGT----A-----GACCAGTGGGACGAAATAACAGGAGGATCAACCGTGGCATTGTGGAGGAGigf2chicken_cds (112)

GACACGCTTCAGTTTGTCTGTTCGGACCGCGGCTTCTACTTCAGC----A-----GGCCTTCAAGCCGTGCCAACCGTCG---CAGCCGTGGCATCGTGGAAGAGigf2mouse_cds (201)

GACACGCTTCAGTTTGTCTGTTCGGACCGCGGCTTCTACTTCAG-----C----AGGCCTTCAAGCCGTGCCAACCGTCG---CAGCCGTGGCATCGTGGAAGAGigf2rat_cds (215)

GACACCCTCCAGTTCGTCTGTGGGGACCGCGGCTTCTACTTCAGTAAACCTGGCAGGCCCGCAAGCCGTGTGAGCCGTCG---CAGCCGTGGCATCGTTGAGGAGhumanigf2_cds_test (115) M is c . B in d in g S ite (2 3 8 . .2 6 0 ) humanigf2_cds_test

GACACGCTTCAGTTTGTCTGTTGGGACCGCGGCTTCTACTTCAGT C AGGCCTTCAAGCCGTGCCAACCGTCG CAGCCGTGGCATCGTGGAGGAGConsensus (217)

tarandal@email.unc.edu

PCR Design in VNTI

Proprietary algorithmDirect comparison to others has

not been done

OligoPerfect™ Designer

Primer3

Oligo 6.0

Primer Designer 5

PerlPrimer.lnk

Picky.lnk

Bioinformatics vol. 21: 3918

What Vector NTI Primer Design will not do…

• Will not suggest primer concentrations

• Will not suggest template concentrations• Will not suggest Mg++ concentrations

• Will not suggest annealing temp, extension times, temps

• Will not suggest no. of cycles in rxn

• Will not apologize (or give a refund) if your primers don’t work or do any troubleshooting

• Will not specifically design RT-PCR primers

Design options• Find PCR – find products within selected region• Amplify PCR – finds products encompassing selected

region• Amplify Feature – select feature(s) to be included in

product• PCR Using existing oligos* – Find PCR with predefined

oligo• Long PCR* (>20 kb) finds sets of overlapping primers

within given sequence• Multiplex* – design primers for several targets in one rxn• Alignment PCR* – design primers to an aligned DNA seq.• Sequencing primers – creates a set of primers to sequence

a region; for resequencing variants• Hybridization primers – designs single oligo primers

* Not available in Mac version 7.1

General parameters

• Primer – set basic primer parameters• Amplicon – set GC% in product, near annealing site• Structure – limit repeats, palindromes, hairpins• Pairs – control Tm, GC% difference between pairs• Similarity – control similarity between primer, template• 3’ end – control content at 3’ end of primer• Uniqueness – similarity cross check against template• Quantitative – allows user to prioritize some of the above

parameters• Filter – can exclude specific regions of template from

being used in design; repeats etc.

Saving settings

Every time you change settings, these are kept as default for next primer designSave VNTI defaults first or go to manual and re-enter defaults manually

Load and Apply

Adding individual primers to Oligo databaseNew Oligo

General tab: name oligoOligo tab: type or paste sequence

To add multiple primers, use the Oligo Import functi on. See the following websiteFor details on importing oligos: http://bioinformatics.unc.edu/software/nti/importOl igo.htm

To export primers saved to the Oligo Database to an Excel spreadsheet go to this website:http://bioinformatics.unc.edu/software/nti/exportOl igo.htm

Saving a PCR analysis

There are four elements of a PCR analysis that can be saved:

Right click on PCR Analysis folder in text pane to –Save Products to Database (to the DNA/RNA Database)Save Primers to Database (to the Oligo Database)Save as Analysis Result (to the Analysis Results Da tabase)

The PCR Analysis will not be saved by default unless the last option is chosen. If saved to the Analysis Results Database, the PCR Analysis result will only be opened if you open up that particular Analysis Result Database, not if yo u open up the molecule through the DNA/RNA Database

To save individual primers to the Oligo Database, ri ght click on the primer of interestAnd choose “Save to Database”

Finding the location of a primer or product on your molecule

To find the location of your PCR producton your molecule, click on the product inPCR Analysis folder, then choose the Find option (binoculars in the Active Pane window)

To find the location of a primer on your molecule,right click on the primer, choose “Copy Item Data”then click within the Graphics Pane and chose theFind tool. Paste in the primer and select Find Next .This tool only looks at one DNA strand at a time so to find an antisense primer you need to choose the“Complementary” Strand option.

Viewing options with OligoDatabase

Use View > Options to change the display of the database. Use Camerafunction to move contents of maindatabase window to a spreadsheet

Directly create primers for Gateway Cloning

Any selected sequence can be used to generate prime rs appropriate for Gateway cloning by following the above pathway. In the subsequent window for parameter selection appropriate attB extensions can be selected for the sense and antisense primers. Once the primer design is do ne, primers can then be saved to the Oligo List from which they can be saved to the Oligo Database by using the Save button in the Oligo List.

BLAT (Blast-like tool)use to check genome of interest for primer

specificity (need a minimum primer size of 20 nt)

http://genome.ucsc.edu/cgi-bin/hgBlat

Displaying a motif/feature in an alignment

• Select the sequence motif

• Save motif as a feature:

Edit > New >Add Feature to

Fmap• Save

Displaying a motif/feature in an alignment

• Create an alignment with newly modified sequence

• Expand sequence in text pane to display Feature Map folder

• Right click on folder or individual feature to display in alignment and select “Show”

• Can save alignment with feature displayed in metafile format using camera tool