PBS EOC Study Guide

PBS EOC Study Guide

Unit 1 – The Mystery

1.1 - Investigating the Scene

Understandings

1. Principles of biomedical science can be used to investigate the circumstances surrounding a mysterious death.

2. Experiments are designed to find answers to testable questions.

Knowledge and Skills

It is expected that students will:

Recognize that processing a crime scene involves purposeful documentation of the conditions at the scene and the

collection of any physical evidence. (Should include a Legend and a Key. Key is #s with what each item is

numbered. Legend is a description underneath the sketch of time, date, location etc.)

Describe how evidence at a crime scene, such as blood, hair, fingerprints, and shoeprints can help forensic

investigators determine what might have occurred and help identify or exonerate potential suspects.

Recognize that bloodstain patterns left at a crime scene can help investigators establish the events that took place

during the crime.

Recognize that all external variables in an experiment need to be controlled.

Analyze key information gathered at a simulated crime scene.

Design a controlled experiment.

Graph and analyze experimental data to determine the height associated with bloodstain patterns

Essential Questions

What can be done at a scene of a mysterious death to help reconstruct what happened?

Collect evidence, interview, examine, sketch, photograph (others: find samples of DNA, see if

there were any witnesses, cause of death, weapons, blood spatters, wounds on victim, violence

of death, finger prints, shoe prints, hair, clothing

How do the clues found at a scene of a mysterious death help investigators determine what might

have occurred and help identify or exonerate potential suspects?

Run DNA on fingerprints, cause of death, wound on victim

How do scientists design experiments to find the most accurate answer to the question they are

asking?

Scientific method: hypothesis, Independent Variable (manipulated), Dependent Variable

(effected), controls, conclusion

How are bloodstain patterns left at a crime scene used to help investigators establish the events that

took place during a crime?

The bloodstains help determine what happened in the scene. Violence of death. The patterns

could help at which angle and height the victim was bleeding from. The height is known by size

and shape of blood drops.

Key Terms

Biomedical Science The application of the principles of the natural sciences, especially biology and

physiology, to clinical medicine.

Control Group The group in an experiment where the independent variable being tested is not

applied so that it may serve as a standard for comparison against the experimental

group where the independent variable is applied.

Dependent Variable The measurable effect, outcome, or response in which the research is interested.

Experiment A research study conducted to determine the effect that one variable has upon

another variable.

Forensic Science The application of scientific knowledge to questions of civil and criminal law.

Hypothesis Clear prediction of the anticipated results of an experiment.

Independent

Variable

The variable that is varied or manipulated by the researcher.

Negative Control Control group where conditions produce a negative outcome. Negative control

groups help identify outside influences which may be present that were not

accounted for when the procedure was created.

Personal Protective

Equipment

Specialized clothing or equipment, worn by an employee for protection against

infectious materials (as defined by OSHA).

Positive Control Group expected to have a positive result, allowing the researcher to show that the

experimental set up was capable of producing results.

1.2 - DNA Analysis

Understandings

1. Human DNA is a unique code of over three billion base pairs that provides a genetic blueprint of an individual.

2. DNA is packaged as chromosomes, which each contain numerous genes or segments of DNA sequence that code

for traits.

3. DNA from all living organisms has the same basic structure – the differences are in the sequences of the

nucleotides.

4. Restriction enzymes recognize and cut specific sequences in DNA.

5. Gel electrophoresis separates DNA fragments based on size and is used in Restriction Fragment Length

Polymorphism (RFLP) analysis.



Describe the relationship between DNA, genes, and

chromosomes.

Describe the structure of DNA.

Describe the structure of a nucleotide.

Explain how restriction enzymes cut DNA.

Describe how gel electrophoresis separates DNA

fragments.

Recognize that gel electrophoresis can be used to

examine DNA differences between individuals.

Demonstrate how restriction enzymes work.

Demonstrate the steps of gel electrophoresis and analyze the resulting restriction fragment length polymorphisms

(RFLPs).

Essential Questions

1. What is DNA?

Blueprint for our physical traits. Also a double stranded, helical nucleic acid molecule capable

of replicating and determining the inherited structure of a cell's proteins.

2. How do scientists isolate DNA in order to study it?

DNA extraction. You extract DNA from the other parts of the cell, the buffer/detergent (soap)

breaks down the cell membrane, alcohol precipitates the DNA (separates the DNA and allows

it to float to the surface)

3. How does DNA differ from person to person?

The only difference between two people’s DNA is the sequence of the base pairs

4. How can tools of molecular biology be used to compare the DNA of two individuals?

The restriction enzymes and gel electrophoresis can be used to match or compare DNA. PCR

can be used to make more copies of DNA if there isn't enough to examine

5. What are restriction enzymes?

Enzymes that cut DNA into fragments at specific patterns (ex GC | CG)

Read from left to right, top strand ONLY

Ex: ATGGTCTAACTGCCGTACAGGTAGCCGTAAGACCCCCTAATTTGCCGATA

TACCAGATTGACGGCATGTCCATCGGCATTCTGGGGGATTAAACGGCTAT

In the above example, 3 restriction enzyme cuts were made, which results in 4 RFLPs

6. What are restriction fragment length polymorphisms (RFLPs)?

Different sized fragments of DNA produced from treatment with restriction Enzymes. Size is

determined by how many base pairs the fragment is made up of. Since every one’s DNA is

different, no two people will produce the same RFLPs

7. What is gel electrophoresis and how can the results of this technique be interpreted?

Gel electrophoresis is a molecular analysis technique used to identify the presence of genes

and to identify unknown DNA samples. Results are interpreted by comparing the known and

unknown lanes.

Who does the blood at this crime scene belong to? ______________________________________

Key Terms

Adenine A component of nucleic acids, energy-carrying molecules such as ATP, and certain

coenzymes. Chemically, it is a purine base.

Chromosome Any of the usually linear bodies in the cell nucleus that contain the genetic material.

Cytosine A component of nucleic acids that carries hereditary information in DNA and RNA in

cells. Chemically, it is a pyrimidine base.

Deoxyribonucleic

Acid (DNA)

A double-stranded, helical nucleic acid molecule capable of replicating and

determining the inherited structure of a cell’s proteins.

Gel Electrophoresis The separation of nucleic acids or proteins, on the basis of their size and electrical

charge, by measuring their rate of movement through an electrical field in a gel.

Gene A discrete unit of hereditary information consisting of a specific nucleotide

sequence in DNA (or RNA, in some viruses).

Guanine A component of nucleic acids that carries hereditary information in DNA and RNA in

cells. Chemically, it is a purine base.

Helix Something spiral in form.

Model A simplified version of something complex used, for example, to analyze and solve

problems or make predictions.

Nucleotide A building block of DNA, consisting of a five-carbon sugar covalently bonded to a

nitrogenous base and a phosphate group.

Restriction Enzyme A degradative enzyme that recognizes specific nucleotide sequences and cuts up

DNA.

Restriction Fragment

Length Polymorphisms

(RFLPs)

Differences in DNA sequence on homologous chromosomes that can result in

different patterns of restriction fragment lengths (DNA segments resulting from

treatment with restriction enzymes).

Thymine A component of nucleic acid that carries hereditary information in DNA in cells.

Chemically, it is a pyrimidine base.

1.3 - The Findings

Understandings

1. The purpose of an autopsy is to answer any questions about the illness, cause of death, and/or any co-existing

conditions.

2. Determining the manner of death involves the investigation of many aspects, including the medical condition of the

victim, the internal and external examination of the body, the chemical and microscopic analysis of tissues and

body fluids, and the analysis of all evidence found at the scene.

3. A comprehensive set of standards and practices is necessary in order to give patients specific rights regarding their

personal health information.



Describe how an autopsy is performed and the types of information it provides to officials regarding the manner

and cause of death.

Recognize that a variety of biomedical science professionals are involved in crime scene analysis and

determination of manner of death in mysterious death cases.

Interpret information from an autopsy report to predict the manner of death.

o Natural, Accident, Suicide, Homicide, Undetermined

Explain the importance of confidentiality when dealing with patients, and describe the major patient protections

written into the Health Insurance Portability and Accountability Act (HIPAA).

Analyze patient confidentiality scenarios.

Essential Questions

1. What is an autopsy and how can it be used to determine the cause of death?

It is an examination of the body after death usually with such dissection as will expose the

vital organs for determining the cause of death. It can be used to see how the organs or if any

of the organs failed or were damaged.

2. How can the manner of death be determined?

Through examining the medical condition of victim (3 steps)

1. External examination: results recorded, physical characteristics are listed, body

measured and weighed

2. Internal examination: organs examined and weighed

3. Chemical and microscopic analysis: Tissues and bodily fluids are analyzed more

closely for cause and manner of death

3. Why is confidentiality of patient information important?

Patients share personal information with health care providers. If the confidentiality of this

information were not protected, trust in the provider-patient relationship would be diminished.

Patients would be less likely to share sensitive information, which could negatively impact

their care

4. Who should keep patient information confidential?

All health professionals!

5. Is there ever a time when patient confidentiality should be broken?

When the patient is deceased

when there is a court ordered warrant

the parent of a minor has the right to their child’s medical information

if the patient threatens to harm themselves or others

6. What biomedical science professionals are involved in crime scene analysis and determination of

manner of death?

Blood spatter analyst, forensic DNA analyst, medical examiner/coroner, coroner’s assistant, morgue

technician, Crime Scene Analyst, Forensic Pathologist

Key Terms

Autopsy An examination of the body after death usually with such dissection as will expose

the vital organs for determining the cause of death.

Bibliography A document showing all the sources used to research information.

Citation A written reference to a specific work (book, article, dissertation, report, musical

composition, etc.) by a particular author or creator which identifies the document in

which the work may be found.

Documentation The act of creating citations to identify resources used in writing a work.

Health Insurance

Portability and

Accountability Act

(HIPAA)

A comprehensive set of standards and practices designed to give patients specific

rights regarding their personal health information.

Medical Examiner A physician who performs an autopsy when death may be accidental or violent. He

or she may also serve in some jurisdictions as the coroner.

Unit 2 – Diabetes

2.1 - What is Diabetes?

Understandings

1. Diabetes is a disorder characterized by high blood glucose levels and caused by insufficient insulin or the inability

of the insulin to function properly.

2. Diabetes can be diagnosed and further characterized as Type 1 or Type 2 by measuring glucose and insulin levels

in the blood or urine.

3. The human body uses feedback mechanisms to maintain homeostasis.

4. It is important to evaluate a source of information to ensure the information is accurate and unbiased.



Recognize that insulin is the protein that regulates the transfer of glucose into body cells.

Recognize that blood glucose levels are regulated by the feedback action of the hormones insulin and glucagon.

Graph laboratory blood glucose and insulin level data and interpret results. (see graphs below)

Compare Type 1 and Type 2 diabetes.

Demonstrate the role of insulin in transferring glucose from blood into cells.

Diagram the feedback relationship of blood glucose and the hormones insulin and glucagon. (see picture below)

Evaluate web resources to determine their level of credibility.

Essential Questions

1. What is diabetes?

A disorder characterized by high blood glucose levels and caused by insufficient insulin or the

inability of insulin to function properly

2. How is glucose tolerance test (GTT) and Insulin testing used to diagnose diabetes?

GTT – Determine whether or not someone is diabetic. Test of the body's ability to metabolize

glucose that involves the administration of a measure dose of glucose to a fasting stomach and

determination of blood glucose levels. If they stay high, the majority of the time the person

most likely has diabetes

Insulin Test – Determines which type of diabetes someone has. Measure the body’s insulin

levels during GTT.

Normal Resting #: 60-99 mg/dL.

Diabetic Resting #: 100+ mg/dL.

3. How does the development of Type 1 and Type 2 diabetes relate to how the body produces and uses insulin?

Type 1 diabetes: A genetic disorder in which the pancreas does not produce insulin

Type 2 diabetes: A lifestyle disorder in which insulin is defective and cannot let glucose into the cell

4. What is the relationship between insulin and glucose? (see picture below)

When blood glucose levels increase, insulin levels also increase.

Eventually the insulin causes the glucose to leave the blood and move into the cell, causing a decrease

in blood glucose, which is followed by a decrease in insulin until the blood returns to normal fasting

glucose levels.

5. How does insulin assist with the movement of glucose into body cells? (see picture below)

1) Insulin Binds receptor

2) Signal sent to DNA to transcribe/translate GLUT 4 transporter

3) GLUT 4 transporter is added to the cell membrane by exocytosis

4) GLUT 4 transporter allows Glucose into the cell

0

20

40

60

80

100

120

140

160

0 30 60 90 120 150

mg/

dL

Minutes after Glucose Administration

Normal

Glucose Insulin

0

20

40

60

80

100

120

140

160

0 30 60 90 120 150

mg/

dL


Type 1 Diabetes

Glucose Insulin

0

20

40

60

80

100

120

140

160

0 30 60 90 120 150

mg/

dL


Type 2 Diabetes

Glucose Insulin

6. What is homeostasis?

the maintenance or relatively stable internal conditions (ie body temperature or glucose levels

in blood) in higher animals under fluctuating environmental conditions (NORMAL/OPTIMAL

CONDITION FOR THE BODY)

7. What does feedback refer to in the human body?

The body uses feedback mechanisms to maintain homeostasis within the body.

Negative: reverse change; shiver when body temperature is low. (return to homeostasis)

Positive: magnify process; fever (moves farther and farther from homeostasis)

8. How does the body regulate the level of blood glucose?

See picture above

Blood sugar high > release insulin > blood sugar decreases back to normal

Blood sugar low > release glucagon > glycogen broken down into glucose and released to

return blood glucose back to normal

Key Terms

Glucagon A protein hormone secreted by pancreatic endocrine cells that raises blood glucose

levels; an antagonistic hormone to insulin.

Glucose Tolerance

Test

A test of the body’s ability to metabolize glucose that involves the administration of

a measured dose of glucose to the fasting stomach and the determination of blood

glucose levels in the blood or urine at intervals thereafter and that is used especially

to detect diabetes.

Homeostasis The maintenance of relatively stable internal physiological conditions (as body

temperature or the pH of blood) in higher animals under fluctuating environmental

conditions.

Hormone A product of living cells that circulates in blood and produces a specific, often

stimulatory, effect on the activity of cells that are often far from the source of the

hormone.

Insulin A protein hormone secreted by the pancreas that is essential for the metabolism of

carbohydrates and the regulation of glucose levels in the blood.

Negative Feedback A primary mechanism of homeostasis, whereby a change in a physiological variable

that is being monitored triggers a response that counteracts the initial fluctuation.

Positive Feedback Feedback that tends to magnify a process or increase its output.

Type 1 Diabetes Diabetes of a form that usually develops during childhood or adolescence and is

characterized by a severe deficiency of insulin, leading to high blood glucose levels.

Type 2 Diabetes Diabetes of a form that develops especially in adults and most often obese

individuals and that is characterized by high blood glucose resulting from impaired

insulin utilization coupled with the body’s inability to compensate with increased

insulin production.

2.2 – The Science of Food

Understandings

1. Foods contain macromolecules, particularly carbohydrates, lipids, and proteins, which are broken down and

reassembled for use in the human body.

2. The human body utilizes nutrients, vitamins, and minerals consumed in food to maintain overall health and

homeostasis.

3. Energy is stored in the chemical bonds of the macromolecules found in food.



Describe which foods are high in carbohydrates, lipids, and proteins.

Recognize that the nutritional content of food helps individuals make decisions about diet and maintain good

health.

Describe basic nutritional terms as well as identify the role of each nutrient in the body.

Recognize that the structure of macromolecules is related to their function in the human body.

Carbohydrates: Short term energy

Proteins: Enzymes, Do work in the cell, Muscle

Lipids: Cell membranes, Cushion Organs, Long term

energy

Explain the process of calorimetry and how it is used to measure the amount of energy in a food.

Analyze food labels and food choices for nutritional content.

Demonstrate the processes of dehydration synthesis and hydrolysis.

Perform calorimetric measurements on food items and interpret the results.

Essential Questions

1. How can carbohydrates, lipids, and proteins be detected in foods?

Biuret’s Solution: Glucose/Sugars

Iodine: Starch

Benedict’s Solution: Protein

Paper Bag: Lipids

2. What types of foods supply sugar, starch, proteins and lipids?

Sugar– candy, marshmallows, soda

Starch- bread, pasta, crackers

Protein- meat, beans

Lipids- avocado, oils, meats

3. How can food labels be used to evaluate dietary choices?

How many calories are in the food, what nutrients are in the food, etc.

4. What role do basic nutrients play in the function of the human body?

carbohydrates: energy storage.

Proteins: to build, maintain, and repair the tissues in the body.

Lipids: fats in the food store large amounts of energy, structure of membranes, cell

communication, and bone structure

5. What are basic recommendations for a diabetic diet?

Make healthy food choices, eat regularly w/out skipping meals.

Limit intake of alcohol, fat, and protein.

Eat a wide variety of foods such as vegetables, fruits, lean meats, and other forms of proteins

such as nuts, low/fat dairy products, and whole grains, cereals.

Eat every 3-5 hours.

When eating sugary food, substitute that for a carb or starch.

It is vital to limit the intake of sugary food which are high in sugar, calories, and fat.

6. What are the main structural components of carbohydrates, proteins and lipids?

carbohydrates: CHO Building block: monosaccharide.

Lipids: CHO Building block: glycerol, fatty acids.

Proteins: CHON (amino acids: R variable group, carboxyl group, amino group)

Nucleic Acids: CHONP (Nucleotides: phosphate group, deoxyribose sugar, nitrogen base)

7. What is dehydration synthesis and hydrolysis?

See diagram above

Dehydration synthesis: formation of polymers: loss of water (water forms as byproduct;

breaks H2O).

Hydrolysis: breakdown of polymers: gain of water (water splits and is attached to each of the

newly created molecule).

8. How do dehydration synthesis and hydrolysis relate to harnessing energy from food?

Bond breaking releases energy & bond forming stores energy.

9. How is the amount of energy in a food determined?

Burn food then measure the difference in temperature and mass of food before/after to find

energy in food.

Key Terms

Adenosine tri-

phosphate (ATP)

A compound composed of adenosine and three phosphate groups that supplies

energy for many biochemical cellular processes by undergoing enzymatic hydrolysis.

Amino Acid An organic monomer which serves as a building block of proteins.

Calorie The amount of heat energy required to raise the temperature of 1 g of water by 1°C;

also the amount of heat energy that 1 g of water releases when it cools by 1°C. The

Calorie (with a capital C), usually used to indicate the energy content of food, is a

kilocalorie.

Carbohydrate A sugar in the form of a monosaccharide, disaccharide or polysaccharide.

Chemical Bond An attractive force that holds together the atoms, ions, or groups of atoms in a

molecule or compound.

Chemical Indicator A substance (as a dye) used to show visually usually by its capacity for color change,

the condition of a solution with respect to the presence of free acid or alkali or

some other substance.

Chemical Reaction Chemical transformation or change; the interaction of chemical entities.

Compound A substance consisting of two or more elements in a fixed ratio.

Covalent bond A type of strong chemical bond in which two atoms share one or more pairs of

valence electrons.

Dehydration

Synthesis

A chemical reaction in which two molecules are bonded together with the removal

of a water molecule.

Disaccharide A double sugar molecule made of two monosaccharides bonded together through

dehydration synthesis.

Element The smallest particle of a substance that retains all the properties of the substance

and is composed of one or more atoms.

Glucose A monomer of carbohydrate, simple sugar.

Homeostasis The maintenance of relatively stable internal physiological conditions (as body

temperature or the pH of blood) in higher animals under fluctuating environmental

conditions.

Hydrolysis A chemical process that splits a molecule by adding water.

Ionic bond A chemical bond resulting from the attraction between oppositely charged ions.

Lipid One of a family of compounds including fats, phospholipids, and steroids that is

insoluble in water.

Macromolecule A type of giant molecule formed by joining smaller molecules which includes

proteins, polysaccharides, lipids, and nucleic acids.

Molecule Two or more atoms held together by covalent bonds.

Monomer The subunit that serves as the building block of a polymer.

Monosaccharide A single sugar molecule such as glucose or fructose, the simplest type of sugar.

Nutrient A substance that is needed by the body to maintain life and health.

Polymer A large molecule consisting of many repeating chemical units or molecules linked

together.

Polysaccharide A polymer of thousands of simple sugars formed by dehydration synthesis.

Protein A three dimensional polymer made of monomers of amino acids.

2.3 – Life with Diabetes

Understandings

1. Diabetes affects the overall health of the individual as well as aspects of daily life.

2. Blood glucose concentration affects osmosis, the movement of water in and out of body cells.

3. Type 1 and Type 2 diabetes can cause significant complications in many human body systems.

4. Scientists need to make sure that what they present is accurate and is communicated in a way that keeps interest

and focus.



Recognize that a wide variety of treatment and management medical interventions are available to diabetics.

Recognize that regulation of blood sugar is necessary to avoid severe and life-threatening diabetic emergencies.

Be able to advise a patient newly diagnosed with diabetes on treating and living with the disease.

Compare Type 1 and Type 2 diabetes.

Demonstrate how water moves across a cell membrane to balance the level of dissolved solutes on either side.

Diagram complications of diabetes on a human body graphic organizer.

Essential Questions

1. What are several ways the life of someone with diabetes is impacted by the disorder?

Watch carb intake, keep snack with them at all times in case of low blood sugar, stay hydrated,

exercise regularly, manage stress levels, careful when sick.

2. How do the terms hyperglycemia and hypoglycemia relate to diabetes? (See picture above)

Hypoglycemia is when there is not enough sugar in blood. Cells will expand because the water

will come in the cell to maintain homeostasis.

Hyperglycemia is when there is excess sugar in the blood. Cells get dehydrated because the

water moves out to balance blood sugar.

3. What might happen to cells that are exposed to high concentrations of sugar?

The cells would dehydrate because of homeostasis; the water would move out of the cell to

dilute the sugar in the blood resulting in increased urination and dehydration

4. How do Type I and Type II diabetes differ? (See chart above)

Type I: insulin injections, ketoacidosis

Type II: no insulin injection, insulin receptors do not react.

5. What are the current treatments for Type I and Type II diabetes?

Type I: insulin pump and injections.

Type II: diet, exercise, medication, nutrition.

6. What is the importance of checking blood sugar levels for a diabetic?

Need to know if blood sugar is too high (insulin).

If blood sugar is too low, then they need a snack with quick sugar(sugar/carbs)

7. How can an insulin pump help a diabetic?

It can help someone gain better control of their blood sugar. Insulin pumps are small

computerized devices that deliver insulin to the body. The insulin doses are delivered through

a flexible plastic tube called a catheter which is inserted through the skin into the fatty tissue

with the help of a needle.

8. What are potential short and long term complications of diabetes?

short term: low blood sugar leads to passing out, ketoacidosis(high ketones become toxic),

hypertension.

Long term: stress, stroke, kidney disease(from high blood sugar, kidney is worn out),

pancreas shuts down(Type I), heart disease, hypertension, neuropathy, peripheral artery

disease, glaucoma, hearing loss, neuropathy

9. What innovations are available to help diabetics manage and treat their disease?

Exercise, hydration, check blood glucose, diet, artificial pancreas, glucose meter, implantable

devices

Key Terms

Hemoglobin A1c A test that measures the level of hemoglobin A1c in the blood as a means of

determining the average blood sugar concentrations for the preceding two to three

months.

Hyperglycemia An excess of sugar in the blood.

Hypertonic In comparing two solutions, referring to the one with a greater solute

concentration.

Hypoglycemia Abnormal decrease of sugar in the blood.

Hypotonic In comparing two solutions, referring to the one with a lower solute concentration.

Isotonic Having the same solute concentration as another solution.

Osmosis The movement of water across a selectively permeable membrane from an area of

higher concentration to an area of lower concentration.

Solute A substance that is dissolved in a solution.

Solution A liquid that is a homogeneous mixture of two or more substances.

Solvent The dissolving agent of a solution. Water is the most versatile solvent known.

Unit 3 – Sickle Cell

3.1 The Disease

Understandings

1. Sickle cell disease is caused by an abnormal type of hemoglobin which causes red blood cells to become shaped

like crescents or sickles.

2. Sickle cell disease and anemia cause many health problems and affect daily life for someone with the disease.



Explain the function of each of the major components of blood.

Erythrocytes: red blood cells

Leukocytes: White blood cells

Thrombocytes: Platelets

Recognize that anemia is a deficiency in red blood cells or hemoglobin.

Recognize that a hematocrit, a test performed to determine if someone is anemic, is the percent of the volume of

whole blood that is composed of red blood cells.

Compare normal vs. sickle-shaped red blood cells.

Demonstrate how sickle-shaped red blood cells lead to

decreased oxygen flow to body tissues.

Essential Questions

1. What is sickle cell disease?

Genetic mutation resulting in abnormal hemoglobin: red blood cells are crescent shaped.

2. Why does the sickling of red blood cells cause health problems?

crescent shaped cells can block blood flow (see diagram above)

3. What is sickle cell anemia?

Genetic mutation resulting in abnormal hemoglobin: red blood cells are crescent shaped.

Because sickled cells are removed from circulation by the spleen faster than new red blood

cells can be made, there is an overall deficiency of red blood cells

4. How is anemia diagnosed?

Hematocrit (amount of red blood cells) test: complete blood cell count: 30% or lower is

anemic.

5. How does sickle cell disease affect daily life?

Shortness of breath (can't go to high altitudes), headaches, liver complications, dizziness,

coldness in extremities, and paler skin. Live 40-50. Cope w/ pain called crisis.

Key Terms

Anemia A condition in which the blood is deficient in red blood cells, in hemoglobin, or in

total volume.

Blood Plasma The pale yellow fluid portion of whole blood that consists of water and its dissolved

constituents including, sugars, lipids, metabolic waste products, amino acids,

hormones, and vitamins.

Erythrocytes (Red

Blood Cells)

Any of the hemoglobin-containing cells that carry oxygen to the tissues and are

responsible for the red color of vertebrate blood.

Hematocrit The percent of the volume of whole blood that is composed of red blood cells as

determined by separation of red blood cells from the plasma usually by

centrifugation.

Leukocytes (White

Blood Cells)

Any of the blood cells that are colorless, lack hemoglobin, contain a nucleus, and

include the lymphocytes, monocytes, neutrophils, eosinophils, and basophils.

Sickle Cell Disease Individuals who are homozygous for the gene controlling hemoglobin S. The disease

is characterized by the destruction of red blood cells and by episodic blocking of

blood vessels by the adherence of sickle cells to the vascular endothelium.

Thrombocytes

(Platelets)

A minute colorless anucleate (does not have a nucleus) disk like body of mammalian

blood that assists in blood clotting by adhering to other platelets and to damaged

epithelium.

3.2 It’s in the Genes

Understandings

1. Proteins are produced through the processes of transcription and translation.

2. Changes in the genetic material may cause changes in the structure and function of a protein and consequently the

traits of an organism.



Recognize that the sequence of nucleotides in DNA determines the sequence of amino acids in a protein.

Explain the process of protein synthesis.

Explain how changes in the b-globin protein are due to the mutation associated with sickle cell disease.

Demonstrate transcription and translation to create a simulated protein.

Analyze the effect that base pair mutations have on a simulated protein.

Essential Questions

1. What is the DNA code?

Series of nucleotides in a polymer that code for proteins in the cell

2. What is the connection between genes and proteins?

A gene is a section of DNA that is transcribed and translated into one protein

3. How are proteins produced in a cell?

DNA > Transcription (mRNA) > Translation (rRNA, mRNA, and tRNA to build protein)

4. How does the sequence of nucleotides in DNA determine the sequence of amino acids in a protein?

Genes are made up of nucleotides

Three nucleotides together are called a codon

One codon codes for one amino acid

5. What is a mutation?

A mutation is ANY change to the nucleotide sequence in DNA

6. What determines the shape of a protein?

It is determined by the amino acids present and by the properties of those amino acids

(hydrophilic, hydrophobic, neutral, positively charged, negatively charged, disulfide bridges,

size of R group)

7. Is the shape of a protein affected by its surrounding environment?

The cell is mostly water, so protein shape is determined by whether or not its amino acids are

hydrophobic or hydrophilic

Hydrophilic amino acids will fold toward outside (touching water)

Hydrophobic amino acids will fold toward inside (away from water)

8. How does a change in the DNA code affect the shape of a protein?

Shape will stay the same if replaced with amino acid of similar properties

Shape will change either minimally or drastically if replaced with amino acid with much

different properties

9. Can changing just one nucleotide in a gene change the shape of a protein?

Yes, sickle cell disease is caused by a change in just one nucleotides which changes the amino

acids that make up that protein. (Glutamic acid to Valine at the 6th Amino acid in the Beta-

Globin chain)

Key Terms

Amino Acid An organic monomer which serves as a building block of proteins.

Anticodon A triplet of nucleotide bases in transfer RNA that identifies the amino acid carried

and binds to a complementary codon in messenger RNA during protein synthesis at

a ribosome.

Codon A three-nucleotide sequence of DNA or mRNA that specifies a particular amino acid

or termination signal; the basic unit of the genetic code.

Hydrophilic Having an affinity for water.

Hydrophobic Having an aversion to water; tending to coalesce and form droplets in water.

Messenger RNA

(mRNA)

A type of RNA, synthesized from DNA and attached to ribosomes in the cytoplasm; it

specifies the primary structure of a protein.

Mutation A rare change in the DNA of a gene, ultimately creating genetic diversity.

Nucleotide The building block of a nucleic acid, consisting of a five-carbon sugar covalently

bonded to a nitrogenous base and a phosphate group.

Protein A three dimensional polymer made of monomers of amino acids.

Protein Synthesis The creation of a protein from a DNA template.

Ribonucleic Acid

(RNA)

A type of nucleic acid consisting of nucleotide monomers with a ribose sugar and

the nitrogenous bases adenine (A), cytosine (C), guanine (G), and uracil (U); usually

single-stranded; functions in protein synthesis and as the genome of some viruses.

Ribosome A cell organelle that functions as the site of protein synthesis in the cytoplasm;

consists of ribosomal RNA and protein molecules and is formed by combining two

subunits.

Transcription The synthesis of RNA on a DNA template.

Transfer RNA

(tRNA)

An RNA molecule that functions as an interpreter between nucleic acid and protein

language by picking up specific amino acids and recognizing the appropriate codons

in the mRNA.

Translation The synthesis of a polypeptide using the genetic information encoded in an mRNA

molecule. There is a change of language from nucleotides to amino acids.

3.3 Chromosomes

Understandings

1. Chromosomes transfer genetic material from cell to cell as well as from generation to generation, in processes

called mitosis and meiosis.

2. There are often several forms of each gene, some being dominant over the others.



Recognize that in order for cellular division to occur, exact copies of the DNA must be transferred to the resulting

daughter cells.

Recognize that chromosomes in reproductive cells contain numerous genes that carry traits through the

generations.

Demonstrate the processes of mitosis and meiosis.

Model the inheritance of genetic diseases.

Analyze genotype to determine phenotype.

Use proper techniques to examine, count, and measure chromosomes. (Karyotype shown below)

Essential Questions

1. How is DNA passed to new cells during cell division?

Mitosis: 2 daughter cells that are exactly like the parent cell (diploid). Growth/Repair/Asexual

Meiosis: 4 different daughter cells with half of the genetic information (haploid). Sexual

Reproduction

2. What is a chromosome?

Complex of DNA wrapped around proteins to fit inside of the nucleus. 46 chromosomes in

human somatic cells. 23 in human gametes.

3. How are traits passed through the generations?

Through gametes (sex cells 23 chromosomes) such as egg and sperm. Half of the genetic

information comes from the father, and half of the information comes from the mother.

When the egg and sperm fuse, the diploid (46 chromosomes) number is restored to make a

new organism

Key Terms

Allele Any of the alternative forms of a gene that may occur at a given locus.

Autosome A chromosome that is not directly involved in determining sex, as opposed to a sex

chromosome.

Chromosome

Any of the usually linear bodies in the cell nucleus that contain the genetic material.

Dominant trait A genetic trait is considered dominant if it is expressed in a person who has only one

copy of the gene associated with the trait.

Gene A discrete unit of hereditary information.

Genetic Material Molecules responsible for heredity and variation of organisms.

Genotype All or part of the genetic constitution of an individual or group.

Heredity The transmission of traits from ancestor to descendant.

Homologous

Chromosomes

Chromosomes having the same or allelic genes with genetic loci usually arranged in

the same order.

Karyotype A display of the chromosome pairs of a cell arranged by size and shape.

Meiosis The cellular process that results in the number of chromosomes in gamete-

producing cells being reduced to one half and that involves a reduction division in

which one of each pair of homologous chromosomes passes to each daughter cell.

Mitosis A process that takes place in the nucleus of a dividing cell, involves a series of steps,

and results in the formation of two new nuclei each having the same number of

chromosomes as the parent nucleus.

Mutation A rare change in the genetic material, ultimately creating genetic diversity.

Pedigree A diagram of a family tree showing the occurrence of heritable characteristics in

parents and offspring over multiple generations.

Phenotype The observable properties of an organism that are produced by the interaction of

the genotype and the environment.

Recessive Trait A condition that appears only in individuals who have received two copies of a

mutant gene, one copy from each parent.

Sex Chromosome One of the pair of chromosomes responsible for determining the sex of an

individual.

3.4 Inheritance

Understandings

1. The expression of a trait through the generations of a family can be visualized using a pedigree.

2. A Punnett square is a simple graphical way of discovering all of the potential combinations of genotypes of an

offspring and can be used to determine the percent chance of each genotype occurring.



Explain how pedigrees can be used to determine the mode of inheritance of genetic diseases.

Draw and analyze pedigree charts to illustrate passage of a trait through generations.

Determine and compare the experimental probability and the theoretical probability of inheriting a trait.

Analyze pedigrees to calculate the probability of inheriting a trait or disease.

Essential Questions

1. How are pedigrees used to track diseases?

Pedigrees are organized by family generation, giving a clear overlook on who had children w/

who, also the genotypes are shown depending on what diseases are being shown.

2. Why does sickle cell disease run in families, yet is not present in every generation?

It is a recessive trait (skips generations), therefore the individual must have two copies of the

recessive gene.

Heterozygous individuals have some symptoms, but not nearly as bad as homozygous

recessive individuals.

Carries may not be affected and can pass on the recessive trait to their offspring.

3. How can doctors and genetic counselors calculate the probability of a child inheriting a disease?

Building pedigrees with family history knowledge, genetic testing

Key Terms

Dominant Trait A genetic trait is considered dominant if it is expressed in a person who has only one

copy of the gene associated with the trait.

Gene A discrete unit of hereditary information.


Heredity The transmission of traits from ancestor to descendant.

Pedigree A diagram of a family tree showing the occurrence of heritable characters in parents

and offspring over multiple generations.

Phenotype The observable properties of an organism that are produced by the interaction of

the genotype and the environment.

Punnett Square A simple graphical way of discovering all of the potential combinations of genotypes

of an offspring, given the parents’ genotypes.

Recessive Trait A condition that appears only in individuals who have received two copies of a

mutant gene, one copy from each parent.

Unit 4 – Heart Disease

4.1 Heart Structure

Understandings

1. The human heart is a four-chambered muscular pump designed to provide the force needed to transport blood

through all the tissues of the body.

2. The heart’s pulmonary circuit pumps blood to the lungs to pick up oxygen, while the systemic circuit pumps

oxygenated blood out to the tissues of the body.

3. The structure of blood vessels relates to their overall function.



Identify the main structures of the heart and describe their functions. (see below)

Outline the path of the major blood vessels to and from the heart. (see below)

Recognize that heart valves function to keep blood moving in the proper direction.

Recognize that arteries move blood away from the heart and veins carry blood back to the heart.

Compare the structure and function of arteries and veins (see below)

Essential Questions

1. What are the structures that make up the human heart and how are they organized?

2. How do the heart and lungs work together to pick up and deliver oxygen to the cells?

Pulmonary circulation: Right side of the heart, Pulmonary Arteries and Veins, Lungs. Brings

deoxygenated blood to the lungs for oxygenation, and then back to the heart

Systemic circulation: Left side of the heart, Aorta, all other arteries and veins. Carries oxygenated

blood around the body to the tissues, and back to the heart.

3. What is the pathway that blood takes as it passes through the heart?

Right Atrium > Tricuspid Valve > Right Ventricle > Pulmonary valve > Pulmonary artery > Lungs

(oxygenation) > Pulmonary Vein > Left Atrium > Mitral/Bicuspid valve > Left Ventricle > Aortic Valve>

Aorta > Body (deoxygenated) > Superior/Inferior Vena Cava

4. What is the function of valves in the heart?

To prevent the backflow of blood into the atria when the ventricles contract

5. How does the structure of arteries and veins relate to their functions?

Artery: Thick muscle layer to retain blood

pressure

Veins: Thin muscle layer. Valves to prevent

backflow with gravity

Key Terms

Aorta The large arterial trunk that carries blood from the heart to be distributed by branch

arteries through the body.

Aortic Valve The semilunar valve separating the aorta from the left ventricle that prevents blood

from flowing back into the left ventricle.

Artery Any of the tubular branching muscular and elastic-walled vessels that carry blood

from the heart through the body.

Atrium An anatomical cavity or passage; especially a chamber of the heart that receives

blood from the veins and forces it into a ventricle or ventricles.

Cardiovascular

System

The transport system of the body responsible for carrying oxygen and nutrients to

the body and carrying away carbon dioxide and other wastes; composed of the

heart, blood vessels, and blood.

Cell The smallest structural unit of living matter capable of functioning independently.

Inferior Vena Cava A vein that is the largest vein in the human body and returns blood to the right

atrium of the heart from bodily parts below the diaphragm.

Mitral Valve A valve in the heart that guards the opening between the left atrium and the left

ventricle; prevents the blood in the ventricle from returning to the atrium.

Alternative name is bicuspid valve.

Pulmonary

Circulation

The passage of venous blood from the right atrium of the heart through the right

ventricle and pulmonary arteries to the lungs where it is oxygenated and its return

via the pulmonary veins to enter the left atrium and participate in systemic

circulation.

Superior Vena Cava A vein that is the second largest vein in the human body and returns blood to the

right atrium of the heart from the upper half of the body.

Systemic

Circulation

The branch of the circulatory system that supplies all body organs and then returns

oxygen-poor blood to the right atrium via the veins.

Tissue An integrated group of cells with a common function, structure, or both.

Tricuspid Valve A valve that is situated at the opening of the right atrium of the heart into the right

ventricle and that resembles the mitral valve in structure but consists of three

triangular membranous flaps.

Valve A body structure that temporarily closes a passage or orifice, or permits movement

of fluid in only one direction.

Vein A vessel that returns blood to the heart.

4.2 The Heart at Work

Understandings

1. Heart rate, EKG, and blood pressure measurements are indicators of a person’s overall cardiac health.

2. Experiments are designed to find answers to testable questions.



Recognize that the heartbeat is caused by the contraction of muscle cells and results in the movement of blood

from the heart to the arteries and the rest of the body. (systole: LUB (contraction) diastole: DUB (relaxing))

Recognize that heart rate is the number of heart contractions per unit of time, usually per minute.

Recognize that blood pressure is a measure of the force put on the vascular walls by the blood as it is pushed by

the cardiac muscles through the blood vessels.

Recognize that the electrical activity of the heart can be measured and recorded by an electrocardiogram (EKG or

ECG).

Describe how internal and external factors can affect heart function and can contribute to the development of heart

disease.

Analyze EKG readings and relate resultant data to heart function.

Essential Questions

1. In what ways can technology be used to collect and analyze cardiovascular data?

EKG/ECG Electrocardiogram

Echocardiogram (ultrasound of the heart)

2. Why is it important to monitor the rate at which the heart beats?

Abnormal heart rate can be a sign of cardiovascular disease or malfunction

3. What factors can influence heart rate?

age, gender, physical activity, body temp, diet, caffeine

4. What is blood pressure?

pressure exerted by the blood upon the walls of the blood vessels, especially arteries

5. How do systolic and diastolic blood pressure values relate to the movement of blood in arteries?

systolic: pressure generated by left ventricle during systole. Normal: 120 mm mercury

diastolic: blood pressure that remains between heart contractions Normal: 80mm mercury

6. What factors can influence blood pressure?

raise: stress, cardiovascular activity, blocked blood vessels, poor diet

lower: healthy lifestyle, relaxation

7. What is an EKG/ECG?

Electrocardiogram. A measurement of heart electrical activity to diagnose heart problems.

8. How can an EKG be used in the diagnosis and treatment of heart disease?

Show electrical depolarization and polarization of the heart

Shows how well the conductive system of the heart is working.

Key Terms

Atrioventricular Node A specialized mass of conducting cells located at the atrioventricular

junction in the heart.

Blood Pressure Pressure exerted by the blood upon the walls of the blood vessels,

especially arteries, usually measured by means of a sphygmomanometer

and expressed in millimeters of mercury.

Cardiology The study of the heart and its action and diseases.

Diastole The stage of the heart cycle in which the heart muscle is relaxed, allowing

the chambers to fill with blood.

Diastolic Pressure Blood pressure that remains between heart contractions.

Electrocardiogram

(EKG) A measurement of heart electrical activity.

Heart Rate A measure of cardiac activity usually expressed as the number of beats

per minute.

Hypertension An abnormally high blood pressure.

Pacemaker An electrical device for stimulating or steadying the heartbeat or

reestablishing the rhythm of an arrested heart.

Pulse The rhythmic expansion and recoil of arteries resulting from heart

contraction; can be felt from the outside of the body.

Sinoatrial Node A small mass of tissue that is made up of Purkinje fibers, ganglion cells,

and nerve fibers, that is embedded in the musculature of the right

atrium, and that originates the impulses stimulating the heartbeat --

called also S-A node, sinus node.

Sphygmomanometer An instrument for measuring blood pressure and especially arterial blood

pressure.

Systole The stage of the heart cycle in which the heart muscle contracts and the

chambers pump blood.

Systolic Pressure The pressure generated by the left ventricle during systole.

4.3 Heart Dysfunction

Understandings

1. Cholesterol is a lipid that is necessary for the proper functioning of cells and for maintaining a healthy body.

2. The measurement of the HDL and LDL complexes may indicate a person’s risk for heart disease.

3. Restriction Fragment Length Polymorphism (RFLP) analysis can be used to diagnose genetic disease and

disorders.

4. The human heart pumps blood around the body, and the efficiency of this pump is affected by the rate at which

blood can move through the vessels.



Recognize that cholesterol is transported in the blood by protein complexes called high density lipoprotein (HDL)

and low density lipoprotein (LDL).

Describe how restriction enzymes and gel electrophoresis can be used to analyze genetic information. (see unit 1)

Describe how cholesterol buildup can impact blood flow through arteries.

Compare and contrast the role of HDL and LDL in the body and how each relates to health.

Analyze the results of the gel electrophoresis to correctly diagnose the presence of the familial

hypercholesterolemia mutation

Essential Questions

1. What is cholesterol?

Lipid that forms an essential component of animal cell membranes and acts as a precursor

molecule for the synthesis of other biologically important steroids.

2. What roles does cholesterol play in our cells and in the body?

Part of the lipid bilayer in the cell membrane

Precursor to bile (needed for digesting fats)

Necessary for learning and memory (brain function)

Precursor for Vitamin D

Precursor for Steroid Hormones (testosterone, estrogen, progesterone etc.)

3. What are LDL and HDL?

Both lipoproteins (part lipid, part protein)

LDL (low density lipoprotein): “bad” carry cholesterol from liver to body to cells. Mostly

made of lipids.

HDL: (high density lipoprotein) “good” carry cholesterol away from cells to liver for disposal.

Mostly made of proteins.

4. How are LDL, HDL, and cholesterol related to heart disease?

Too much LDL/not enough HDL causes plaque build-up in the arteries which results in

reduced blood flow to tissues, so the heart pumps harder resulting in disease

5. How do doctors interpret the results of a cholesterol test?

Total Cholesterol: Should be less than 200 mg/dL

LDL: Should be less than 100 mg/dL

HDL: Should be 60+ mg/dL

6. What is familial hypercholesterolemia and how is it inherited?

genetic defect or absent in LDL receptor on cell surfaces due to a mutation.

Body cannot remove LDL, thus causing high levels of cholesterol in the blood and

atherosclerosis.

AUTOSOMAL DOMINANT trait.

7. How can techniques of molecular biology be used to analyze DNA for the presence of the FH

mutation?

See electrophoresis diagram above.

Compare known genotypes Unaffected (ff) /Affected (Ff, or FF) to DNA of patient to

compare.

8. What lifestyle changes may help a patient obtain healthy cholesterol levels?

diet, exercise, weight loss, stress management, stop tobacco use

9. What are the pros and cons of using cholesterol lowering medications?

pros: lower cholesterol, health.

cons: If removes too much cholesterol, pain in muscles, vomiting, memory loss, hormone

deficiency, vitamin D deficiency

10. How does the heart work as a pump?

contracts and relaxes to pump blood throughout the body

11. What is atherosclerosis?

Thickening of artery walls due to plaque (cholesterol) build-up. Can lead to clots, resulting in

a heart attack or stroke

12. How can cholesterol plaques affect the overall function of the heart?

Blocks arteries and makes heart pump harder to move blood around

Heart can get left ventricular hypertrophy (thickening of muscle) due to having to pump so

hard, resulting in heart failure

Can cause clots resulting in a heart attack or stroke

Key Terms

Atherosclerosis Changes in the walls of large arteries consisting of lipid deposits on the artery

walls.

Cholesterol A lipid that forms an essential component of animal cell membranes and acts

as a precursor molecule for the synthesis of other biologically important

steroids.

Electrophoresis The movement of suspended particles through a fluid or gel under the action

of an electromotive force applied to electrodes in contact with the suspension.

Familial

Hypercholesterolemia

A metabolic disorder that is caused by defective or absent receptors for LDLs

on cell surfaces, that is marked by an increase in blood plasma LDLs and by an

accumulation of LDLs in the body resulting in an increased risk of heart attack

and coronary heart disease, and that is inherited as an autosomal dominant

trait.


HDL (High Density

Lipoprotein)

A cholesterol-carrying particle in the blood, made up of cholesterol and other

lipids surrounded by a single layer of phospholipids in which proteins are

embedded. An HDL particle carries less cholesterol than a related lipoprotein,

LDL, and may be correlated with a decreased risk of blood vessel blockage.

Heterozygous Having two different alleles for a given gene.

Homozygous Having two identical alleles for a given gene.

LDL (Low Density

Lipoprotein)

A cholesterol-carrying particle in the blood, made up of cholesterol and other

lipids surrounded by a single layer of phospholipids in which proteins are

embedded. An LDL particle carries more cholesterol than a related lipoprotein,

HDL, and high LDL levels in the blood correlate with a tendency to develop

blocked blood vessels and heart disease.

Mutation A rare change in the DNA of a gene, ultimately creating genetic diversity.

PCR

(Polymerase Chain

Reaction)

A laboratory technique for amplifying DNA in vitro by incubating with special

primers, DNA polymerase molecules, and nucleotides.

Phenotype The physical and physiological traits of an organism that are determined by its

genetic makeup.

Restriction Enzyme A degradative enzyme that recognizes specific nucleotide sequences and cuts

up DNA.

4.4 Heart Intervention

Understandings

1. A blocked coronary artery can lead to tissue death causing a myocardial infarction, or heart attack.

2. Risk factors such as genetics, poor diet, high cholesterol, high blood pressure, diabetes, and smoking increase a

person’s risk of developing heart disease.



Describe the function of an angiogram in diagnosing blocked vessels.

Recognize that blocked blood vessels can be treated surgically using procedures that tunnel through or around the

areas that disrupt normal blood flow.

Explain how lifestyle changes as well as medication or medical treatment may help decrease heart disease risk.

Demonstrate a technique used to open a blocked vessel.

Essential Questions

1. What is heart disease?

An abnormal condition of the heart or blood circulation

2. What happens inside the heart to cause a heart attack?

A clot forms in the arteries supplying the heart muscle with oxygenated blood. All cells

behind the blockage cannot get oxygen and then die, resulting in death of that part of the

muscle.

Depending on where the blockage occurs, can result in the heart quitting and death

3. How do doctors treat a blocked blood vessel?

Angioplasty

Stent

Bypass Surgery (CABG)

4. What are risk factors for the development of heart disease?

smoking, obesity, high LDL, low HDL, hypertension, diabetes, stress, abdominal/visceral fat

5. How can a person decrease his or her risk of heart disease?

avoid smoking and stress, exercise, healthy diet, good cholesterol levels

6. What is metabolic syndrome?

A group of risk factors such as hypertension, high blood sugar, bad cholesterol levels,

abdominal fat resulting in a higher risk of heart disease and diabetes

Key Terms

Angiogram The radiographic visualization of blood vessels after the injection of radiopaque

substance.

Angioplasty Surgical repair or recanalization of a blood vessel.

Coronary Bypass A surgical bypass operation performed to shunt blood around an obstruction in a

coronary artery that involves grafting one end of a segment of vein removed from

another part of the body into the aorta and the other end into the coronary artery

beyond the obstructed area to allow for increased blood flow.

Heart Attack An acute episode of heart disease marked by death or damage of heart muscle due

to insufficient blood supply to the heart muscle usually as a result of coronary

thrombosis or a coronary occlusion and that is characterized especially by chest

pain.

Heart Disease An abnormal organic condition of the heart or of circulation.

Metabolic Syndrome A syndrome marked by the presence of usually three or more of a group of factors

(as high blood pressure, abdominal obesity, high triglyceride levels, low HDL levels,

and high fasting levels of blood sugar) that are linked to increased risk of

cardiovascular disease and Type 2 diabetes.

Risk Factor Something which increases risk or susceptibility.

Stenting A surgical procedure or operation for inserting a stent, a mold designed to keep a

passageway open, into an anatomical vessel.

Stroke Sudden loss of consciousness, sensation, and voluntary motion caused by rupture or

obstruction (as by a clot) of a blood vessel of the brain.

Unit 5 – Infectious Disease

5.1 – Infection

Understandings

1. Infectious diseases are caused by infectious agents and are transmitted in a variety of manners.

2. Aseptic technique assures that contaminants are not introduced into a specimen and that infectious agents are not

spread to people or laboratory surfaces.

3. Bacteria are characterized by their shape, colony morphology, metabolism, and reaction to the Gram stain.

4. The specific structures of the immune system function to protect the human body against foreign invaders.



Describe the mode of transmission and mode of reproduction of various infectious agents.

Describe the prevention of and treatment for various infectious agents.

Pathogen Transmission/Reproduction Prevention/Treatment

Bacteria

Lives everywhere

Transmitted through contact and

food

Does not need host for

reproduction

Good hygiene

Properly cooked food

Washing Hands

Antibiotics

Virus

Requires host for reproduction

Transmitted through contact with

blood/saliva/mucous

Stay away from sick people

Wash hands

Can only treat symptoms

Fungi

Live in moist wet environments

Does not need host for

reproduction

Proper hygiene

Wearing clean socks and

footwear

Antifungal treatments

Protozoa

Live in contaminated water

Can be transmitted by vectors

(malaria)

Only drink from clean sources

of water

Wear bug repellent

Specific medications

Helminthes

Parasitic worms

Live in fecal matter

Transmitted through

drinking/eating contaminated

substance

Only eat/drink from non-

contaminated sources

Fully cook foods

Specific medications

Prions Misfolded proteins

Transmitted from cow brains

Don’t eat contaminated animal

No cure

Identify the basic structures of a bacterial cell.

Describe how the immune system responds when an antigen enters the body.

Use proper Gram staining and microscope techniques to stain, observe, and classify bacteria

No color No color

Purple Purple

Purple Purple

Purple No color

Purple Pink

Essential Questions

1. How are infectious diseases spread through a population?

airborne, direct contact, indirect contact, contaminated food/water, vectors (mosquitos)

2. What is aseptic technique?

A procedure used by medical staff to prevent the spread of infection or in the lab to prevent

contamination of samples

3. How can an unknown sample of bacteria be identified?

Gross colony morphology analysis, Gram Staining, Biochemical Tests

4. How does the immune system function to protect the human body from foreign invaders?

Non-specific defenses such as nose hair, mucous, skin, inflammation

Specific defenses such as antibodies, B cells, T cells, Macrophages (phagocytes)

First exposure = body has to recognize and respond (takes a while)

Second exposure = body remembers and responds very quickly (no symptoms)

Key Terms

Antibody An antigen-binding immunoglobulin, produced by B cells, that functions as the

effector in an immune response.

Aseptic Technique A procedure performed under sterile conditions.

Bacillus A cylindrical or rod-shaped bacterium.

Bacteria Single-celled microorganisms that are often aggregated into colonies or motile by

means of flagella, live everywhere, and are noted for their biochemical effects and

pathogenicity.

B Lymphocyte (B

Cell)

A type of lymphocyte that develops in the bone marrow and later produces

antibodies.

Coccus A spherical bacterium.

Contagious Communicable by contact.

Fungus Saprophytic and parasitic spore-producing eukaryotic organisms that lack

chlorophyll and include molds, rusts, mildews, smuts, mushrooms, and yeasts.

Gram Stain A method for the differential staining of bacteria. Results in gram-positive bacteria

retaining the purple dye and gram-negative organisms having it decolorized so that

the red counterstain shows up.

Helminth A parasitic worm (as a tapeworm, liver fluke, ascarid, or leech).

Immunity A condition of being able to resist a particular disease, especially through preventing

development of a pathogenic microorganism

Infection The state produced by the establishment of an infective agent in or on a suitable

host.

Microbiology A branch of biology dealing especially with microscopic forms of life (as bacteria,

protozoans, viruses, and fungi).

Phagocyte A cell (as a white blood cell) that engulfs and consumes foreign material (as

microorganisms) and debris.

Prion Any of various infectious proteins that are abnormal forms of normal cellular

proteins

Protozoan Any protist of the phylum or subkingdom Protozoa.

Spirillum A spiral-shaped bacterium.

T Lymphocyte (T

Cells)

A type of lymphocyte responsible for cell-mediated immunity that differentiates

under the influence of the thymus.

Transmission The way a microbial organism moves from one host to another.

Virus Any of a large group of submicroscopic infective agents that typically contain a

protein coat surrounding an RNA or DNA core of genetic material but no

semipermeable membrane.

Unit 6 – Post Mortem

Understandings

1. The human body is composed of multiple body systems working together to maintain good health.

2. Scientists need to make sure that what they present is accurate and is communicated in a way that keeps interest

and focus.

3. Determining the cause of death involves the investigation of many aspects of the medical condition of a victim, the

internal and external examination of the body, and the chemical and microscopic analysis of tissues and body

fluids.



Explain the functions of different human body systems and list the major organs within each system. (see below)

Describe how multiple body systems are interconnected and how those interconnections and interactions are

necessary for life.

Demonstrate the ways an illness affects the various body systems.

Analyze autopsy reports and medical history documents to determine cause of death.

Essential Questions

1. What are examples of human body systems?

Nervous, Digestive, Urinary, Immune, Respiratory, Cardiovascular

2. What organs make up the different body systems?

Organ System Organs

Cardiovascular Heart, aorta, valves, arteries, arterioles,

capillaries, veinules, veins, vena cava

Immune Thymus, spleen, bone marrow, lymph nodes

Digestive Mouth, esophagus, stomach, liver, gall bladder,

pancreas, small intestine, large intestine

Nervous Brain, spinal cord, neurons, various sensory

organs

Urinary Kidneys, ureters, bladder, urethra

Respiratory Trachea, larynx, nasal cavity, bronchi, lungs

3. How do the different body systems interact to maintain good health?

They all work together to maintain homeostasis

4. What might be the consequence of malfunctions in any of the body systems?

If one system malfunctions it will affect other body systems eventually causing them to

malfunction as well

5. How can prevention measures and medical interventions prolong life?

Prevention results in maintenance of homeostasis

Medical Interventions (medications, surgery etc.) can act to reverse or maintain current state of

the body and prevent it from getting worse

Key Terms

Cardiovascular System The transport system of the body responsible for carrying oxygen and nutrients to

the body and carrying away carbon dioxide and other wastes; composed of the

heart, blood vessels, and blood.

Digestive System The group of organs that break down foods into chemical components that the

body can absorb and use for energy and for building and repairing cells and tissues.

Nervous System The bodily system that in vertebrates is made up of the brain and spinal cord,

nerves, ganglia, and parts of the receptor organs and that receives and interprets

stimuli and transmits impulses to the effector organs.

Organ Collection of tissues which performs a particular function or set of functions in an

animal's body. The heart, brain, and skin are three organs found in most animals.

Organs are composed of tissues and may be organized into larger organ systems.

Respiratory System A system of organs, functioning in the process of gas exchange between the body

and the environment, consisting especially of the nose, nasal passages,

nasopharynx, larynx, trachea, bronchi, and lungs.

System A collection of components organized to accomplish a specific function or set of

functions.

Urinary System Also known as the renal system, the urinary system produces, stores, and eliminates

urine, the fluid waste excreted by the kidneys.

PBS EOC Study Guide

Documents

Transcript of PBS EOC Study Guide