PATHOLOGICAL EVALUATION OF FIBROPAPILLOMATOSIS IN …

PATHOLOGICAL EVALUATION OF FIBROPAPILLOMATOSIS IN GREEN SEA

TURTLES: EVALUATION OF BLOOD PARAMETERS AND LOCALIZATION OF VIRUS

IN TUMORS, AS DETERMINED BY IN SITU HYBRIDIZATION

by

KYUNG-IL KANG

(Under the Direction of Corrie C. Brown)

ABSTRACT

Fibropapillomatosis is a neoplastic disease of marine turtles characterized by cutaneous

fibropapillomas and occasionally internal fibromas. The prevalence of disease has been

increasing. Etiologically a herpesvirus has been incriminated but isolation efforts to date have

failed. To explore and update current diagnostic and pathological knowledge of this disease,

multiple laboratory and field analyses were used, including hematology, blood chemistry,

histopathology and in-situ hybridization on blood and tumors collected from affected and non-

affected animals. Green turtles (Chelonia mydas) were captured and subsequently released in a

location in the Caribbean on the ease side of Puerto Rico, islands of Culebra and Culebrita. This

study contributes to further understanding of the disease, through comparison of hematology and

biochemical parameters in affected and non-affected turtles and evaluation of tumor

characteristics and viral involvement using in situ hybridization.

INDEX WORDS: Fibropapillomatosis, Green turtle, Chelonia mydas, Herpesvirus, In situ

hybridization, Hematology, Blood biochemistry, Plasma protein

electrophoresis




by

KYUNG-IL KANG

DVM, Kangwon National University, Republic of Korea, 1996

MS, Kangwon National University, Republic of Korea, 1998

A Thesis Submitted to the Graduate Faculty of The University of Georgia in Partial Fulfillment

of the Requirements for the Degree

MASTER OF SCIENCE

ATHENS, GEORGIA

2007

© 2007

Kyung-il Kang

All Rights Reserved




by

KYUNG-IL KANG

Major Professor: Corrie C. Brown

Committee: Frederic S. Almy

Jaroslava Halper

Electronic Version Approved:

Maureen Grasso

Dean of the Graduate School

The University of Georgia

December 2007

iv

ACKNOWLEDGEMENTS

I want to thank everyone who has helped me in reaching here:

My committee:

• Dr. Corrie Brown

• Dr. Frederic Almy

• Dr. Jaroslava Halper

Everybody worked together:

• Dr. Anthony Moore

• Shannon Boveland

• Craig Dixon

• Jian Jang

• Fernando Torres-Velez

• Carlos E. Diez

• Debra Moore

• Samuel Rivera

• Sonja Mali

Special thanks to everybody in the department of pathology and

Many people worked hard in the sea over the sampling period.

v

TABLE OF CONTENTS

Page

ACKNOWLEDGEMENTS........................................................................................................... iv

CHAPTER

1 INTRODUCTION .........................................................................................................1

2 LITERATURE REVIEW ..............................................................................................7

3 COMPARISON OF HEMATOLOGICAL, PLASMA BIOCHEMICAL AND

PLASMA PROTEIN VALUES IN POPULATIONS OF PUERTO RICAN

GREEN SEA TURTLES (CHELONIA MYDAS) WITH AND WITHOUT

FIBROPAPILLOMATOSIS ...................................................................................25

4 LOCALIZATION OF FIBROPAPILLOMATOSIS-ASSOCIATED TURTLE

HERPESVIRUS IN GREEN TURTLES (CHELONIA MYDAS) BY IN-SITU

HYBRIDIZATION .................................................................................................47

5 CONCLUSIONS..........................................................................................................71

1

CHAPTER 1

INTRODUCTION

Fibropapillomatosis (FP) is a neoplastic disease of marine turtles characterized by single

to multiple neoplasms of epidermal and dermal structures and also occasionally involving

internal organs (Herbst, 1994; Jacobson, 1990). The prevalence of the disease has increased for

the last few decades and the high incidence of the disease is now threatening the survival of

some species of marine turtles.

Although the etiologic agent of FP has not been definitively proven, there is cumulative

evidence implicating a virus, specifically a herpesvirus. Cell-free extracts of the FP mass filtered

by 0.45um filters induced the same tumor when inoculated into turtles experimentally (Herbst et

al., 1995; Herbst et al., 1996). Extracts treated with chloroform failed to induce new tumors,

suggesting the virus is enveloped (Herbst et al., 1996). Eosinophilic to amphophilic intranuclear

inclusion bodies in epithelial cells are occasionally seen in histologic specimens, consistent with

herpesvirus induced lesions. Within the inclusion bodies, herpesvirus-like particles have been

detected on transmission electron microscopy (Herbst et al., 1995; Jacobson et al., 1991;

Jacobson et al., 1989). Highly conserved herpesviral genes and its mRNAs have been

consistently detected and these sequences are more abundant in FP than in non-tumor tissues,

indicating the sequences may be specific for the tumor tissue (Lu et al., 2000; Lu et al., 2003;

Quackenbush et al., 2001; Quackenbush et al., 1998). Sequencing and phylogenetic analysis of

these sequences have implicated a novel herpesvirus that is closely related to the

2

alphaherpesviruses (Lackovich et al., 1999; Nigro et al., 2004; Quackenbush et al., 2001;

Quackenbush et al., 1998; Yu et al., 2001). Unfortunately, despite numerous attempts by several

investigators to isolate a virus in vitro, no viruses have been isolated (Coberley, 2002; Lackovich

et al., 1999; Lu et al., 2003). In addition, it is not yet known what types of cells might be infected,

how extensive the cellular infection within an affected tissue is, or the degree of viral

transcription in the various stages of tumor development (Quackenbush et al., 2001).

Hematology and plasma biochemistry indices can change with animals’ health status and

have been used to monitor the health condition of wildlife (Aguirre and Balazs, 2000; Sposato et

al., 2001; Swimmer, 2000). Chronic stress response and immunosuppression due to FP

progression have been reported as turtles with extensive FP lesions have high corticosteroid

concentrations, resulting in heterophilia and lymphopenia (Aguirre et al., 1995; Cray et al., 2001;

Work et al., 2001). In addition, previous studies have shown that animals with severe FP tend to

be anemic, hypoproteinemic, and eosinopenic compared to FP-free turtles or turtles with low

grade FP (Work and Balazs, 1999). The decreased health status due to chronic stress and

decreased immunity, in turn, can provide more susceptibility to other diseases such as parasite

infection (Aguirre and Balazs, 2000; Aguirre et al., 1995; Work and Balazs, 1999).

We have identified 2 adjacent populations of green turtles in the coastal waters of the

island of Culebra, Puerto Rico. These 2 populations have been examined periodically over the

last 5 years. Although the populations co-mingle on a reef overnight, they spend their days at

separate locations. Many of these animals are tagged and can be readily identified and followed.

One population in Manglar Bay, close to human development, has numerous animals with FP.

The other population, at Culebrita, which is part of a nature preserve, has very few animals with

3

tumors. In this study, we examined animals from these 2 sites, 3 times per year for 1.5 years, and

briefly captured animals for physical measurement, tumor removal, and blood sampling.

We studied pathological aspects of FP through the viral localization in tumor tissues and

examination of blood parameters. For the health status of affected turtles, we hypothesized that

altered blood values are associated with the presence of FP. To test this hypothesis, hematology,

plasma biochemistry and plasma protein electrophoresis results were compared between groups

differing in tumor presence. For the localization of virus, we tested the hypothesis that viral

replication can be detected in the tumors with riboprobe in situ hybridization. To evaluate this

hypothesis, we used riboprobes to detect viral transcription for proliferation. We also applied the

probe to detect virus presence under conditions that allow hybridization with viral genomic DNA.

REFERENCES

Aguirre, A. A. and Balazs, G. H. (2000). Blood biochemistry values of green turtles, Chelonia

mydas, with and without fibropapillomatosis. Comparative Haematology International,

10, 132-137.

Aguirre, A. A., Balazs, G. H., Spraker, T. R. and Gross, T. S. (1995). Adrenal and hematological

responses to stress in juvenile green turtles (Chelonia mydas) with and without

fibropapillomas. Physiological zoology, 68, 831-854.

Coberley, S. S. (2002). The role of herpesviruses in marine turtle diseases, Vol. Doctoral

dissertation, University of florida.

Cray, C., Varella, R., Bossart, G. D. and Lutz, P. (2001). Altered in vitro immune responses in

green turtles (Chelonia mydas) with fibropapillomatosis. J Zoo Wildl Med, 32, 436-440.

4

Herbst, L. H. (1994). Fibropapillomatosis of marine turtles. Annual review of fish disease, 4,

389-425.

Herbst, L. H., Jacobson, E. R., Moretti, R., Brown, T., Sundberg, J. P. and Klein, P. A. (1995).

Experimental transmission of green turtle fibropapillomatosis using cell-free tumor

extracts. Dis Aquat Organ, 22, 1-12.

Herbst, L. H., Moretti, R. H., Brown, T. and Klein, P. A. (1996). Sensitivity of the transmissible

green turtle fibropapillomatosis agent to chloroform and ultracentrifugation conditions.

Dis Aquat Organ, 25, 225-228.

Jacobson, E. R. (1990). An udate on green turtle fibropapilloma. Marine Turtle Newsletter, 49,

7-8.

Jacobson, E. R., Buergelt, C., Williams, B. and Harris, R. K. (1991). Herpesvirus in cutaneous

fibropapillomas of the green turtle Chelonia mydas. Dis of Aquat Organ, 12, 1-6.

Jacobson, E. R., Mansell, J. L., Sundberg, J. P., Hajjar, L., Reichmann, M. E., Ehrhart, L. M.,

Walsh, M. and Murru, F. (1989). Cutaneous fibropapillomas of green turtles (Chelonia

mydas). J Comp Pathol, 101, 39-52.

Lackovich, J. K., Brown, D. R., Homer, B. L., Garber, R. L., Mader, D. R., Moretti, R. H.,

Patterson, A. D., Herbst, L. H., Oros, J., Jacobson, E. R., Curry, S. S. and Klein, P. A.

(1999). Association of herpesvirus with fibropapillomatosis of the green turtle Chelonia

mydas and the loggerhead turtle Caretta caretta in Florida. Dis Aquat Organ, 37, 89-97.

Lu, Y., Aguirre, A. A., Work, T. M., Balazs, G. H., Nerurkar, V. R. and Yanagihara, R. (2000).

Identification of a small, naked virus in tumor-like aggregates in cell lines derived from a

green turtle, Chelonia mydas, with fibropapillomas. J Virol Methods, 86, 25-33.

5

Lu, Y. A., Wang, Y., Aguirre, A. A., Zhao, Z. S., Liu, C. Y., Nerurkar, V. R. and Yanagihara, R.

(2003). RT-PCR detection of the expression of the polymerase gene of a novel reptilian

herpesvirus in tumor tissues of green turtles with fibropapilloma. Arch Virol, 148, 1155-

1163.

Nigro, O., Yu, G., Aguirre, A. A. and Lu, Y. (2004). Sequencing and characterization of the full-

length gene encoding the single-stranded DNA binding protein of a novel Chelonian

herpesvirus. Arch Virol, 149, 337-347.

Quackenbush, S. L., Casey, R. N., Murcek, R. J., Paul, T. A., Work, T. M., Limpus, C. J.,

Chaves, A., duToit, L., Perez, J. V., Aguirre, A. A., Spraker, T. R., Horrocks, J. A.,

Vermeer, L. A., Balazs, G. H. and Casey, J. W. (2001). Quantitative analysis of

herpesvirus sequences from normal tissue and fibropapillomas of marine turtles with real-

time PCR. Virology, 287, 105-111.

Quackenbush, S. L., Work, T. M., Balazs, G. H., Casey, R. N., Rovnak, J., Chaves, A., duToit,

L., Baines, J. D., Parrish, C. R., Bowser, P. R. and Casey, J. W. (1998). Three closely

related herpesviruses are associated with fibropapillomatosis in marine turtles. Virology,

246, 392-399.

Sposato, P., Lutz, P. L. and Cray, C. (2001). A comparative approach in determining health

status of chelonians with respect to avian and mammalian medicine. The 21st annual

symposium on sea turtle biology and conservation, Department of Commerce, NOAA

Technical Memorandum NMFS-SEFSC 528. Philadelphia, Pennsylvania, USA.

Swimmer, J. Y. (2000). Biochemical responses to fibropapilloma and captivity in the green turtle.

J Wildl Dis, 36, 102-110.

Work, T. M. and Balazs, G. H. (1999). Relating tumor score to hematology in green turtles with

fibropapillomatosis in Hawaii. J Wildl Dis, 35, 804-807.

6

Work, T. M., Rameyer, R. A., Balazs, G. H., Cray, C. and Chang, S. P. (2001). Immune status of

free-ranging green turtles with fibropapillomatosis from Hawaii. J Wildl Dis, 37, 574-581.

Yu, Q., Hu, N., Lu, Y., Nerurkar, V. R. and Yanagihara, R. (2001). Rapid acquisition of entire

DNA polymerase gene of a novel herpesvirus from green turtle fibropapilloma by a

genomic walking technique. J Virol Methods, 91, 183-195.

7

CHAPTER 2

LITERATURE REVIEW

Turtle Fibropapillomatosis

A. Definition

Fibropapillomatosis (FP) is a neoplastic disease of marine turtles characterized by single

to multiple fibroepithelial growths of skin, occasionally involving visceral fibromas (Herbst,

1994; Jacobson, 1990). The neoplastic masses are most frequently observed on the cutaneous and

outer soft tissues including eyelid, neck, flippers, jaw, tail, and sometimes mouth (Balazs, 1986).

The size can range from a few millimeters to more than 30 cm in diameter (D'Amato and

Moraes-Neto, 2000; Herbst, 1994). The tumors often cause affected animals to become

debilitated by hampering feeding and mobility, obscuring vision, and in the case of visceral

extension, can cause death due to organ failure (Balazs, 1986; Herbst, 1994; Jacobson, 1990;

Quackenbush et al., 1998; Smith and Coates, 1938). The etiology has still not been definitively

proven. While a herpesvirus has been implicated as a presumed causal agent, other factors such

as parasites and pollutants resulting in immune depression have been suggested (Aguirre and

Lutz, 2004; Herbst, 1994). Turtles are more likely to be affected after they arrive in their coastal

habitats rather than in the pelagic ocean environment (Aguirre and Balazs, 2000; Ene et al.,

2005). The highest prevalence is seen in juvenile or immature animals, which further endangers

the survival of these marine turtle species (Herbst et al., 2004; Seminoff, 2004; Work et al.,

8

2004). Although wide surgical excision and surgical strangulation of external lesions can be

curative, currently there are no other known treatments or therapy for this disease (Jacobson et

al., 1989).

B. History and prevalence

The disease was first described in 1938 by Smith and Coates in a green turtle (Chelonia

mydas) which had been captured 2 years prior to the report. Also, in the same year they found 3

cases among 200 wild animals examined near Key West, Florida (Smith and Coates, 1938).

Dramatic increases in the prevalence of the disease have been noted in many parts of the world

over the last three decades (Williams and Bunkley-Williams, 1994). In 1982, the percentage of

affected animals was as high as 50% in the waters on the east coast of Florida (Herbst, 1994). It

was believed that the disease was not present in Hawaii until the 1950s. However, in 1985, the

prevalence was found to be 35% (Balazs, 1986); and between 1991 to 1995, 51% of observed

green turtles had FP (Aguirre and Balazs, 2000). Among sea turtles, green turtles are the most

commonly affected species, but there have been scattered reports in loggerhead (Caretta caretta),

olive ridley (Lepidochelys olivacea), Kemp’s ridley (Lepidochelys kempii), hawksbill

(Eretmochelys imbracata), flatback (Natator depressus) and leatherback (Dermochelys coriacea)

turtles (Aguirre and Lutz, 2004; Balazs, 1991; D'Amato and Moraes-Neto, 2000; Greenblatt et

al., 2005a; Herbst et al., 2004; Huerta et al., 2002; Lackovich et al., 1999; Quackenbush et al.,

2001; Quackenbush et al., 1998).

The prevalent geographic areas are suggestive that development of FP is highly

associated with agricultural and urban development (Greenblatt et al., 2005b; Herbst, 1994).

There are habitats in which FP occurrence is contrastingly different from that in nearby areas,

9

where one place is close to human activity and the other remains pristine or face to clean open

sea. In Hawaii, the high prevalence of FP is present in Kaneohe bay, Island of Oahu while it is

absent along the Kona Coast, the island of Hawaii (Aguirre and Balazs, 2000; Work et al., 2001).

On the west side of the island of Hawaii there are only rare cases of FP, while the disease is

common in all other habitats in the island (Work, 2005). In Puerto Rico, it is prominent in

Manglar bay on the island of Culebra but it was free in the island of Culebrita until 2005

(Greenblatt et al., 2005b). There is marked variation among habitats in Florida, ranging from 0 to

50-70% (Ene et al., 2005; Foley et al., 2005). The Indian River Lagoon, Florida where water

exchange from the nearby ocean is geographically limited had high frequency of FP, whereas the

Wabasso Beach, 1 km east of the Indian River Lagoon site, has been FP free (Herbst et al., 1998).

C. Etiology

The primary etiologic agent of FP has still not been conclusively demonstrated. Several

causal factors that compromise immune function such as environmental pollutants, chronic stress,

genetic factors, and parasites have been suggested as playing a role in promotion or even

causation of FP (Aguirre and Lutz, 2004; Herbst, 1994). However, the most putative single agent

is a herpesvirus, fibropapillomatosis-associated turtle herpesvirus (FPTHV).

There are several lines of consistent evidence to implicate a herpesvirus in a causal

association with FP. When filtered cell-free extract (0.45µm filters) derived from a FP mass are

inoculated into other turtles, new FP develops (Herbst et al., 1995; Herbst et al., 1996). The

extract treated with chloroform failed to induce new tumors (Herbst et al., 1996). These findings

suggest the agent is subcellular (less than 0.45 µm) and most likely enveloped (sensitive to

chloroform) (Herbst et al., 1995; Herbst et al., 1996). Histologically, perivascular lymphocytic

10

infiltration in neoplastic fibrovascular dermis is present, suggestive of, but not specific for, viral

infection (Herbst, 1994). Eosinophilic intranuclear inclusion bodies (INIB) are observed, and

using electron microscopy herpesvirus-like particles are visualized in the INIBs. Various stages

of development of viral particles, including viral budding and mature enveloped particles (110-

125nm), have been detected, which is indicative of viral replication (Herbst et al., 1995;

Jacobson et al., 1991).

Unfortunately, efforts to isolate a virus in vitro have not been successful in spite of

numerous attempts by several investigators (Coberley, 2002; Lackovich et al., 1999; Lu et al.,

2003). Thus, it has not been possible to fulfill Koch’s postulates. In addition, it is not yet known

what types of cells are infected and how extensive the cellular infection is or the degree of viral

transcription in the various stages of tumor development (Quackenbush et al., 2001).

Molecular detection of the viral genes through PCR of FP tissue extracts strongly

supports evidence of the involvement of a marine turtle herpesvirus, and based on the sequencing

analysis, specifically a member of alphaherpesvirinae subfamily has been suggested (Coberley,

2002; Herbst, 1994; Herbst and Klein, 1995; Lackovich et al., 1999; Landsberg et al., 1999; Lu

et al., 2000; Quackenbush et al., 2001; Quackenbush et al., 1998). With PCR for a highly

conserved herpesviral DNA polymerase gene (UL30, pol), almost all FP tissues have this nucleic

acid segment while a limited percentage of non-tumor normal skin from tumor bearing turtles

also contain this viral DNA (Greenblatt et al., 2005b; Lu et al., 2000; Quackenbush et al., 2001).

However, using quantitative molecular methods, FP tissues have 102.5

-104.5

more viral DNA than

non-affected normal tissues (Quackenbush et al., 2001). In addition, the quantity of herpesvirus-

related mRNA levels in the tumors is over 200-fold higher than the non-tumor tissues, indicating

that the viral transcription is occurring in the tumors (Lu et al., 2003). The more viral mRNA

11

production in the upper layer of tumors is indicative of active replication at the surface,

suggesting a source of contact transmission between turtles (Greenblatt et al., 2004). Comparison

of the herpesviral sequences from various geographic areas and among various species of the

tumored turtles is indicative that the viruses have high degree of relatedness (more than 96%

homology), but the viruses have mutations among them that have been established long before

recent high FP occurrence (Greenblatt et al., 2005a; Herbst et al., 2004).

Herpesvirus is an enveloped, double stranded DNA virus, divided into alpha, beta and

gamma groups. The virus is characterized by latent infection and reactivation, which mechanism

is not well understood yet. Replication of virus occurs in the nucleus of the host cell, through

complex gene expression such as immediated-early genes which encode regulatory proteins,

early genes which are for viral polymerases and late genes which are for structural proteins

(Baron, 1996). Some of herpesviruses can transform host cells such as Epstein-Barr virus in

Burkitt’s lymphoma of human, Kaposi’s sarcoma-associated herpesvirus in Kaposi’s sarcoma of

human, and Marek’s disease virus in Marek’s disease of chicken. Epstein-Barr virus also causes

an epithelial carcinoma (nasal carcinoma) in human which may have etiologic involvements of

genetic susceptibility, chemical carcinogens and the virus infection (Chan et al., 2004). The types

of nasopharyngeal carcinoma can be classified into squamous cell carcinoma, non-keratinizing

carcinoma and undifferentiated carcinoma by histologic features and prognosis (Chan et al.,

2002).

Two other herpesviral infections are documented in green turtles, and they are also

associated with skin disease. Gray patch disease (GPD) is a herpesvirus associated disease

occurring as early as a few weeks after hatching. The disease is characterized by gray patches of

hyperkeratotic and necrotic papules that occur on the head, neck, and flipper. Characteristic

12

intranuclear inclusions in acanthotic epithelial cells are formed. The viral particles, 160-200 nm,

are ubiquitous in the lesion by electron microscopy (Rebell et al., 1975), but the virus has not

been isolated. Lung, eye, and trachea disease (LETD) is associated with a herpesvirus, LETDV.

The virus causes inflammatory lesions in respiratory tract and eye. Viral particles are present in

the nucleus with intranuclear inclusions and in the cytoplasm (132-147 nm). The causative virus,

LETDV, has been isolated from green turtles (Jacobson et al., 1986), and share 26-57%

homology, by genes, with FPTHV (Greenblatt et al., 2005a). However, both of these viruses

have been only reported in turtles raised in aquaculture (Jacobson et al., 1986; Rebell et al.,

1975).

Spirorchid flukes in the cardiovascular system are the most common parasites in sea

turtle. Three species (Hapalotrema mehrai, H. postorchis and Neospirorchis schistosomatoides)

have been reported in turtles. Spirorchid infection (spirorchidiasis) rate was as high as 98% in a

diseased population in Australia (Gordon et al., 1998). The association of spirorchid infection

with FP is uncertain, although spirorchid egg granulomas are frequently found lesions in tumors.

Parasite egg injection failed to develop tumors while tumor occurred when injected with cell-free

filtrate from tumor tissue (Herbst et al., 1995). An enzyme-linked immunosorbent assay (ELISA)

developed for specific spirorchid antigen showed no significant relationship between antibody

reactivity to spirorchids and FP status (Herbst et al., 1998).

D. Pathology

D1. Clinicopathological findings

Blood values change according to an animal’s health status and have been used to

monitor the health condition of wildlife (Aguirre and Balazs, 2000; Sposato et al., 2001;

13

Swimmer, 2000). Reference values of blood parameters, however, can be different among

different animal groups, often according to the geographic area and age (Aguirre and Balazs,

2000). In addition, the reference values of sea turtle blood parameters may have broader range

than those seen in mammals, influenced by a greater tolerance of turtle’s internal changes and

other environmental factors such as food (Sposato et al., 2001).

Investigations that have included blood analyses demonstrate that there is a relationship

between hematologic status and severity of FP disease. As tumors become more extensive, the

clinicopathologic data reflect progressive overall health deterioration (Aguirre and Balazs, 2000;

D'Amato and Moraes-Neto, 2000; Work and Balazs, 1999). Turtles with FP may develop non-

regenerative anemia and leukopenia with lymphopenia and monocytosis. For biochemical

analytes, hypoproteinemia with hypoglobulinemia and hypoalbuminemia, hypoferremia,

azotemia, hypolipidemia and increased corticosterone concentration are observed (Aguirre and

Balazs, 2000; Aguirre et al., 1995; Aguirre et al., 1998; Work and Balazs, 1999). High

corticosteroid concentration in tumored turtles may cause resultant heterophilia and lymphopenia,

which suggests that the health status is under chronic stress and the animals are

immunosuppressed (Aguirre et al., 1995; Cray et al., 2001).

The relationship between immune status and FP also has been examined. In vitro

immune response of the lymphocytes from affected turtles demonstrates decreased proliferation

indices and depressed reactivity to immune stimulation (Cray et al., 2001). Chronic stress and

immune compromise in affected animals may result in more susceptibility to other

environmental infectious agents (Aguirre and Balazs, 2000; Aguirre et al., 1995; Work and

Balazs, 1999). Work et al.(2001) reported similar immune status between tumor-free animals and

14

tumor bearing animals, suggesting immunosuppression is an eventual result from the disease

progress rather than a causal factor for development of FP.

In green turtles, five types of leukocytes (lymphocytes, monocytes, heterophils,

eosinophis and basophils) are present (Work et al., 1998). While lymphocytes and heterophils are

the most common cells, basophils are extremely rare, with only 0 to 8 cells/µl is present on

average (Samour et al., 1998; Work et al., 1998). Severity of parasite infection such as spirorchid

spp. may increase circulating eosinophil counts in marine turtles (Gordon et al., 1998). In turtles

with FP, however, there have been reports indicating decreased eosinophil counts (Cray et al.,

2001; Work and Balazs, 1999; Work et al., 2001). Eosinopenia in turtles affected with severe FP

and spirorchids was reported, and the authors attribute the low eosinophil count to sequestration

of eosinophils in tissue lesions surrounding the parasites (Work and Balazs, 1999).

The decreased protein level in turtles with tumors is mainly attributed to malnutrition of

affected animals while decreased B-cell function and humoral immune depression are suggested

based on decreased gamma globulins (Aguirre and Balazs, 2000; Work et al., 2001). Cary (2001),

however, reported hyperproteinemia with hypergammaglobulinemia in tumor bearing turtles,

suggesting antibody production. Gammaglobulin fractions in turtles may consist mainly of

immunoglobulins, possibly against herpesvirus in FP and spirorchids.

D2. Gross and microscopic lesions

The gross and histologic appearances of FP have been well described (Herbst, 1994;

Herbst et al., 1999). FP in green turtles usually occurs as soft integumentary tumors with a

verrucous or a smooth surface. FP usually appears slowly, and tumors progressively increase in

number and size (Balazs, 1991; Jacobson et al., 1989), although there are rare reports of

15

spontaneous regression (Bennett et al., 1999; Jacobson et al., 1989; Wood and Wood, 1993).

Diverse pathological changes of FP may be present among different geographic populations due

to the virus strains, viral activity and other environmental cofactors (Greenblatt et al., 2005b;

Work, 2005).

Grossly, FP in green turtles usually presents with cutaneous and ocular neoplastic masses

with verrucous or smooth surfaces. Visceral tumors are white, firm nodular masses within or

adjacent to parenchymatous organs. Most nodules are well-demarcated while some may appear

to be irregular indicating infiltration to nearby tissue (Herbst, 1994).

Histologically, FP has been described and classified into three stages: papillomas,

fibropapillomas, and fibromas. Papillomas may represent the earliest stage in tumor development

and consist predominantly of proliferating epidermis. Fibromas are characterized by dermal

proliferation with relatively normal epidermis suggesting a chronic process. Fibropapillomas

exhibit proliferation of both components, suggesting an intermediate form (Herbst, 1994; Herbst

et al., 1999; Jacobson et al., 1989). Epithelial cells in the proliferating lesion may show

ballooning degeneration with eosinophilic intranuclear inclusion bodies (Greenblatt et al., 2005b;

Herbst et al., 1999; Jacobson et al., 1991) while fibrovascular stroma in the dermis of FP has

well-differentiated fibroblasts often with haphazard arrangement and perivascular mononuclear

infiltrates (Greenblatt et al., 2005b; Herbst et al., 2004). Viral particles (77-90nm) in the

inclusion, their envelopment at the nuclear membrane, and enveloped particles (110-120nm) in

the cytoplasm are observed and the appearance is consistent with herpesvirus morphology by

electron microscopy (Herbst et al., 1995; Jacobson et al., 1991).

Occurrence of visceral tumors in FP is believed to be at the later stage of the disease and

is usually found at necropsy of moribund animals (Herbst et al., 1999). Work et al. (2004)

16

reported 255 FP cases from stranded turtles in the Hawaiian islands for 10 years and they found

39% occurrence of visceral tumors, while visceral tumors were present in 8 of 10 (80%) turtles

with FP in Florida (Herbst et al., 1999). Spirorchid granulomas are frequently observed in the

fibrous tissue of the neoplasms (Herbst, 1994; Jacobson et al., 1991). Most of the internal

fibromas consist of well-differentiated fibroblasts with normally layered epithelial layer, similar

to the cutaneous fibroma. The dermal cells of FP show normal cell cycles, indicating most of

them staying in the G1 phase (Papadi et al., 1995). Lung, heart, kidney, and intestines are most

commonly involved with types of fibromas, myxofibromas or both (Herbst, 1994). A few cases

of malignant types have been present in the heart (Work et al., 2004) and lung (Garner et al.,

2004) with low grade of anaplasia and irregular invasive features to the adjacent tissue. While

through PCR the specific viral sequence is persistently found in visceral tumors, immunological

antigenic detection has not been successful (Herbst et al., 1998; Herbst et al., 1999;

Quackenbush et al., 2001). It is unknown whether cutaneous fibroblasts metastasize to visceral

organs or whether tumors arise de novo from altered cells at the visceral site (Herbst et al., 1999).

Antibodies to herpes group-specific antigens (HSV1/HSV2) did not cross-react to

herpesviral antigens in intranuclear inclusions with an immunohistochemistry method

(Matushima et al., 2001). However, immunohistochemistry using serum from FP-affected turtles

as a primary antibody has been successful. In these experiments, the serum binds to the

inclusions, but it cannot be ruled out that the reaction may be associated with other herpesviruses

which also infect turtles such as gray-patch disease virus (GPDV) or lung-eye-trachea disease

virus (LETDV) (Herbst et al., 1998; Herbst et al., 1999). However, the cross-reactivity between

LETDV and FPTHV can be differentiated using LETDV, which is the only isolated turtle

herpesvirus, specific ELISA (Coberley et al., 2001).

17

With the immunohistochemistry, however, no viral antigenic reactions have been

detected in dermal fibroblasts (Herbst et al., 1999). Molecular techniques demonstrate that

specific herpesvirus gene sequences, both DNA and RNA, are present in the deep dermis in spite

of far fewer numbers than in the superficial layer (Greenblatt et al., 2004).

REFERENCES



10, 132-137.




Aguirre, A. A. and Lutz, P. L. (2004). Marine turtles as sentinels of ecosystem health: Is

fibropapillomatosis an indicator? EcoHealth, 1, 275-283.

Aguirre, A. A., Spraker, T. R., Balazs, G. H. and Zimmerman, B. (1998). Spirorchidiasis and

fibropapillomatosis in green turtles from the Hawaiian Islands. J Wildl Dis, 34, 91-98.

Balazs, G. (1991). Current status of fibropapillomas in the Hawaiian green turtle, Chelonia

mydas. In: Research plan for marine turtle fibropapilloma., G. Balazs and S. Pooley, Eds,

U.S. Department of Commerce, National Oceanographic and Atmospheric

Administration, National Marine Fisheries Service, pp. 47-57.

Balazs, G. H. (1986). Fibropapillomas in Hawaiian green turtles. Marine Turtle Newsletter, 39, 1-

3.

18

Baron, S. (1996). Medical microbiology. University of Texas Medical Branch at Galveston,

Galveston, Tex., pp. xvii, 1273.

Bennett, P., Keuper-Bennett, U. and Balazs, G. H. (1999). Photographic evidence for the

regression of fibropapillomas afflicting green turtles at Honokowai, Maui, in the

Hawaiian islands. 19th annual sea turtle symposium, South Padre island, Texas, USA.

Chan, A. T., Teo, P. M. and Huang, D. P. (2004). Pathogenesis and treatment of nasopharyngeal

carcinoma. Semin Oncol, 31, 794-801.

Chan, A. T., Teo, P. M. and Johnson, P. J. (2002). Nasopharyngeal carcinoma. Ann Oncol, 13,

1007-1015.



Coberley, S. S., Herbst, L. H., Brown, D. R., Ehrhart, L. M., Bagley, D. A., Schaf, S. A., Moretti,

R. H., Jacobson, E. R. and Klein, P. A. (2001). Detection of antibodies to a disease-

associated herpesvirus of the green turtle, Chelonia mydas. J Clin Microbiol, 39, 3572-

3577.



D'Amato, A. F. and Moraes-Neto, M. (2000). First documentation of fibropapillomas verified by

histopathology in Eretmochelys imbricata. Marine Turtle Newsletter, 89, 12-13.

Ene, A., Su, M., Lemaire, S., Rose, C., Schaff, S., Moretti, R., Lenz, J. and Herbst, L. H. (2005).

Distribution of chelonid fibropapillomatosis-associated herpesvirus variants in Florida:

19

molecular genetic evidence for infection of turtles following recruitment to neritic

developmental habitats. J Wildl Dis, 41, 489-497.

Foley, A. M., Schroeder, B. A., Redlow, A. E., Fick-Child, K. J. and Teas, W. G. (2005).

Fibropapillomatosis in stranded green turtles (Chelonia mydas) from the eastern United

States (1980-98): trends and associations with environmental factors. J Wildl Dis, 41, 29-

41.

Garner, M. M., Hernandez-Divers, S. M. and Raymond, J. T. (2004). Reptile neoplasia: a

retrospective study of case submissions to a specialty diagnostic service. Vet Clin North

Am Exot Anim Pract, 7, 653-671, vi.

Gordon, A. N., Kelly, W. R. and Cribb, T. H. (1998). Lesions caused by cardiovascular flukes

(Digenea: Spirorchidae) in stranded green turtles (Chelonia mydas). Vet Pathol, 35, 21-30.

Greenblatt, R. J., Quackenbush, S. L., Casey, R. N., Rovnak, J., Balazs, G. H., Work, T. M.,

Casey, J. W. and Sutton, C. A. (2005a). Genomic variation of the fibropapilloma-

associated marine turtle herpesvirus across seven geographic areas and three host species.

J Virol, 79, 1125-1132.

Greenblatt, R. J., Work, T. M., Balazs, G. H., Sutton, C. A., Casey, R. N. and Casey, J. W. (2004).

The Ozobranchus leech is a candidate mechanical vector for the fibropapilloma-

associated turtle herpesvirus found latently infecting skin tumors on Hawaiian green

turtles (Chelonia mydas). Virology, 321, 101-110.

Greenblatt, R. J., Work, T. M., Dutton, P., Sutton, C. A., Spraker, T. R., Casey, R. N., Diez, C. E.,

Parker, D., St Leger, J., Balazs, G. H. and Casey, J. W. (2005b). Geographic variation in

marine turtle fibropapillomatosis. J Zoo Wildl Med, 36, 527-530.

20

Herbst, L., Ene, A., Su, M., Desalle, R. and Lenz, J. (2004). Tumor outbreaks in marine turtles

are not due to recent herpesvirus mutations. Curr Biol, 14, R697-699.


389-425.

Herbst, L. H., Greiner, E. C., Ehrhart, L. M., Bass, A. L. and Klein, P. A. (1998). Serological

association between spirorchidiasis, herpesvirus infection, and fibropapillomatosis in

green turtles from Florida. J Wildl Dis, 34, 496-507.

Herbst, L. H., Jacobson, E. R., Klein, P. A., Balazs, G. H., Moretti, R., Brown, T. and Sundberg, J.

P. (1999). Comparative pathology and pathogenesis of spontaneous and experimentally

induced fibropapillomas of green turtles (Chelonia mydas). Vet Pathol, 36, 551-564.




Herbst, L. H. and Klein, P. A. (1995). Green turtle fibropapillomatosis: challenges to assessing

the role of environmental cofactors. Environ Health Perspect, 103 Suppl 4, 27-30.




Huerta, P., Pineda, H., Aguirre, A., Spraker, T., Sarti, L. and Barragan, A. (2002). First confirmed

case of fibropapilloma in a leatherback turtle (Dermochelys coriacea). Proceedings of the

20th annual symposium on sea turtle biology and conservation., pp. P. 193.

21

Jacobson, E. R. (1990). An udate on green turtle fibropapilloma. Marine Turtle Newsletter, 49, 7-

8.



Jacobson, E. R., Gaskin, J. M., Roelke, M., Greiner, E. C. and Allen, J. (1986). Conjunctivitis,

tracheitis, and pneumonia associated with herpesvirus infection in green sea turtles. J Am

Vet Med Assoc, 189, 1020-1023.








Landsberg, J. H., Balazs, G. H., Steidinger, K. A., Baden, D. G., Work, T. M. and Russell, D. J.

(1999). The Potential Role of Natural Tumor Promoters in Marine Turtle

Fibropapillomatosis. J Aqua Anim Health, 11, 199-210.

Lu, Y., Wang, Y., Yu, Q., Aguirre, A. A., Balazs, G. H., Nerurkar, V. R. and Yanagihara, R. (2000).

Detection of herpesviral sequences in tissues of green turtles with fibropapilloma by

polymerase chain reaction. Arch Virol, 145, 1885-1893.



22


1163.

Matushima, E. R., Filho, A. L., Loretto, C. D., Kanamura, C. T., Sinhorini, I. L., Gallo, B. and

Baptistolle, C. (2001). Cutaneous papillomas of green turtles: a morphological, ultra-

structural and immunohistochemical study in Brazilian specimens. Bra J Vet Res Anim

Sci, 38, 51-54.

Papadi, G. P., Balazs, G. H. and Jacobson, E. R. (1995). Flow cytometric DNA content analysis

of fibropapillomas in green turtles Chelonia mydas. Dis Aquat Organ, 22, 13-18.

Quackenbush, S. L., Casey, R. N., Murcek, R. J., Paul, T. A., Work, T. M., Limpus, C. J., Chaves,

A., duToit, L., Perez, J. V., Aguirre, A. A., Spraker, T. R., Horrocks, J. A., Vermeer, L. A.,

Balazs, G. H. and Casey, J. W. (2001). Quantitative analysis of herpesvirus sequences

from normal tissue and fibropapillomas of marine turtles with real-time PCR. Virology,

287, 105-111.

Quackenbush, S. L., Work, T. M., Balazs, G. H., Casey, R. N., Rovnak, J., Chaves, A., duToit, L.,

Baines, J. D., Parrish, C. R., Bowser, P. R. and Casey, J. W. (1998). Three closely related

herpesviruses are associated with fibropapillomatosis in marine turtles. Virology, 246,

392-399.

Rebell, G., Rywlin, A. and Haines, H. (1975). A herpesvirus-type agent associated with skin

lesions of green sea turtles in aquaculture. Am J Vet Res, 36, 1221-1224.

Samour, J. H., Howlett, J. C., Silvanose, C., Hasbun, C. R. and Al-Ghais, S. M. (1998). Normal

haematology of free-living green sea turtles (Chelonia mydas) from the United Arab

Emirates. Comparative Haematology International, 8, 102-107.

23

Seminoff, J. A. (2004). Chelonia mydas. In: IUCN 2007, 2007 IUCN Red List of Threatened

Species. www.iucnredlist.org. Downloaded on 08 November 2007, pp. Web.

Smith, G. M. and Coates, C. W. (1938). Fibro-epithelial growths of the skin in large marine

turtles, Chelonia mydas (Linnaeus). Zoologica, 23, 93-98.

Sposato, P., Lutz, P. L. and Cray, C. (2001). A comparative approach in determining health status

of chelonians with respect to avian and mammalian medicine. The 21st annual




J Wildl Dis, 36, 102-110.

Williams, E. H., Jr. and Bunkley-Williams, L. (1994). An epizootic of cutaneous fibropapillomas

in green turtles Chelonia mydas of the Caribbean: Part of a panzootic? Journal of Aquatic

Animal Health, 6, 70-78.

Wood, F. and Wood, J. (1993). Release and recapture of captive reared green sea turtle (Chelonia

mydas) in the waters surrounding Grand Cayman. Herpetological journal, 3, 84-89.

Work, T. M. (2005). Cancer in sea turtles. Hawaii Medical Journal, 64, 23-24.



Work, T. M., Balazs, G. H., Rameyer, R. A. and Morris, R. A. (2004). Retrospective pathology

survey of green turtles Chelonia mydas with fibropapillomatosis in the Hawaiian Islands,

1993--2003. Dis Aquat Organ, 62, 163-176.

24



Work, T. M., Raskin, R. E., Balazs, G. H. and Whittaker, S. D. (1998). Morphologic and

cytochemical characteristics of blood cells from Hawaiian green turtles. Am J Vet Res, 59,

1252-1257.

25

CHAPTER 3

COMPARISON OF HEMATOLOGICAL, PLASMA BIOCHEMICAL AND PLASMA

PROTEIN VALUES IN POPULATIONS OF PUERTO RICAN GREEN SEA TURTLES

(CHELONIA MYDAS) WITH AND WITHOUT FIBROPAPILLOMATOSIS1

1 K. I. Kang, C.C. Brown,, Carlos E. Diez, Samuel Rivera, Fernando Torres and F.S. Almy. To

be submitted to Journal of Wildlife Diseases.

26

ABSTRACT

Green sea turtles (Chelonia mydas) are an endangered species. Increased prevalence of

fibropapillomatosis (FP) has contributed to their population reduction in recent decades. The

cause and pathogenesis of FP are still uncertain. Physical examination, hematology, plasma

biochemistry and plasma protein electrophoresis were performed in free ranging juvenile green

turtle populations in Culebra, Puerto Rico. Reference values for hematologic, biochemical and

plasma proteins were established from healthy, tumor-free (FP-) turtles. Comparison of blood

values from turtles with fibropapillomatosis (FP+) versus FP- turtles revealed only a significant

difference in total protein and gamma globulin concentrations characterized by hyperproteinemia

and hypergammaglobulinemia in the FP+ turtles. Hematologic, biochemical and plasma protein

data from each tumor bearing turtle were analyzed. Two of 13 turtles with tumors had increased

AST, CK and/or LDH values, suggesting muscle injury while 2 other turtles had

hyperglobulinemia with hypergammaglobulinemia. Significant changes in tumors with high

tumor score were not found.

INTRODUCTION

The green sea turtle (Chelonia mydas) is an endangered species with a measurable risk

of extinction (Seminoff, 2004). A neoplastic disease affecting green sea turtles,

fibropapillomatosis, has been proposed as one of the causal factors of the population decline. For

the last few decades, the prevalence of fibropapillomatosis has increased among turtle

populations (Foley et al., 2005; Herbst, 1994; Williams and Bunkley-Williams, 1994). The

neoplastic masses are most frequently observed cutaneously and include the soft tissues of the

conjunctiva, neck, flippers, jaw, tail, and sometimes the mouth. Fibropapillomas occasionally

27

involve the visceral organs (Balazs, 1986; Herbst, 1994). The size of the tumors can range from a

few millimeters to more than 30 cm in diameter (D'Amato and Moraes-Neto, 2000; Herbst,

1994). The tumors often cause affected animals to become debilitated by hampering feeding and

moving actions, obscuring vision, and in the case of visceral extension, can cause death due to

organ failure (Balazs, 1986; Herbst, 1994; Jacobson, 1990; Quackenbush et al., 1998; Smith and

Coates, 1938). Turtles are more likely to be affected after they arrive in their coastal habitats

rather than in the pelagic ocean environment (Aguirre and Balazs, 2000; Ene et al., 2005). While

a herpesvirus has been implicated as a presumed causal agent, other factors such as parasites and

pollutants resulting in immune depression have been suggested (Aguirre and Lutz, 2004; Herbst,

1994). However, the etiology has not been definitively proven.

Based upon earlier studies, turtles with severe FP tend to be anemic, hypoproteinemic,

and eosinopenic compared to FP-free turtles or turtles with low grade FP (Work and Balazs,

1999). Previous reports have indicated FP+ turtles have high corticosterone concentrations, with

resultant heterophilia and lymphopenia. High corticosterone concentrations can contribute to

immunosuppression and a reduced overall health status (Aguirre et al., 1995; Cray et al., 2001).

As a result, decreased health status and immunocompromise render the turtles more susceptible

to disease and possibly the development of fibropapillomatosis. However, based upon the

findings of similar immune status (WBC count, mononuclear cell proliferation test and plasma

protein electrophoresis) between FP- and FP+ turtles, Work et al. (2001), suggested

immunosuppression in severely affected FP+ turtles resulted from disease progression itself

rather than as a causal factor for FP,.

Hematologic and biochemical values can change with an animals health status and are

valuable in monitoring the health condition of wildlife (Aguirre and Balazs, 2000; Sposato et al.,

28

2001; Swimmer, 2000). Reference values have been shown to differ not only among species, but

within specific groups based upon variables such as geographic location (environment), sex and

age (Aguirre and Balazs, 2000). The reference values of sea turtle blood parameters may have a

broader range than those seen in mammals due to many factors including their habitat

environment (Sposato et al., 2001). Therefore, when comparing diseased wild animal to healthy

wild animal populations it is important to consider any potential differences in reference values

due to geographic and environmental differences. The objective of this study was to investigate

blood values associated with fibropapillomatosis in green turtles in Culebra, Puerto Rico

compared to tumor-free turtles. The parameters evaluated included routine hematological and

plasma biochemical data together with plasma protein electrophoresis and physical examination.

Reference values were established for both the geographically unique turtle populations and the

FP- turtles in order to more accurately compare data among FP+ and FP- turtles.

MATERIALS AND METHODS

From March 2006 to March 2007, two different populations of juvenile green sea turtles

from the island of Culebra (Manglar bay; Manglar population) and island of Culebrita (Culebrita

population), Puerto Rico were wild caught. These two populations were chosen because,

historically, fibropapillomatosis has been highly prevalent in Manglar turtles while Culebrita

turtles are typically free of the tumors (Greenblatt et al., 2005). Both sites are foraging grounds

for juvenile turtles and are considered developmental habitats. In order to minimize stress and

the effects of corticosteroid release associated with handling, immediately after turtle capture, all

animals were phlebotomized from the dorsal cervical sinus (external jugular vein) using a

Vacutainer® system in lithium heparin collection tubes. Three whole-blood filled microcapillary

29

tubes were prepared, two of which were later used for measurement of packed cell volume

(PCV). Two blood smears were made with the other microcapillary tubes and were air-dried.

Plasma was separated on site by centrifuge. The samples were stored in a cooler with ice and

stored at 4°C for 1 to 5 days until shipped to a contracting laboratory (IDEXX, Atlanta GA) for

determination of hematology, biochemistry and plasma protein electrophoresis results.

Packed cell volumes (PCV) were determined using a microhematocrit centrifuge. Blood

smears were fixed in methanol and then stained with Wright-Giemsa. Total WBC count was

estimated from blood films by multiplying the average number of leukocytes observed per 50X

field x2500 (objective power squared). WBC differentials (heterophils, lymphocytes, eosinohils

and monocytes) were performed manually. Absolute counts were calculated from the differential

percentages. Blood smears were also thoroughly evaluated for cell morphology and the presence

of hemoparasites. Samples for plasma biochemistry (ALP, ALT, AST, CK, LDH, albumin, TP,

cholesterol, glucose, calcium, phosphorus, potassium, sodium, and uric acid) were processed on

an automated chemistry analyzer.2 Values for total globulins and the A/G ratio were calculated.

Plasma electrophoresis was performed by standard procedures. Not all biochemical tests were

performed on all individuals because the amount of plasma was limited for some of the animals.

In addition to blood sample collections, each turtle then had a complete physical

examination, was assessed for tumor presence, was weighed and its length was measured. Turtle

size was determined by measuring the length in cms, with calipers, from the anterior edge of the

carapace to the posterior tip of the supracaudals on the same side and reported as maximum

straight carapace length (SCL). The weight, in kilograms (kg), was recorded for all animals.

General body condition and assessment for the presence of tumors were performed by a

2 Roche Hitachi 914

30

complete visual examination. If tumors were found, surgical removal or 6mm diameter punch-

biopsies were taken of both the tumors and of normal skin after administration of local

anesthesia. The biopsies were used for a separate study. Following the procedures, the turtles

were released in the water as close to possible as to where caught.

For each tumor bearing (FP+) turtle, a tumor score was assigned based upon a scoring

system developed by Work and Balazs (1999). Briefly, a score of 0 indicates a tumor-free animal,

1 indicates a lightly-affected turtle, 2 indicates a moderately affected turtle, and 3 indicates

severely affected animals.

Reference values for each parameter were established from values derived from all

healthy, tumor-free turtles from both Culebrita and Manglar. Data from turtles with FP (FP+)

were compared with these reference values (FP-). Further, blood values of individual tumor

bearing turtles were compared to the reference values.

Descriptive statistics (mean, standard deviation, minimum, and maximum) were recorded

and reference values (RV) were generated. A test for normality for every parameter assayed was

determined by the Kolmogorov-Smirnov test using statistical software.3 The reference intervals

for normally distributed values were determined as the mean ± 2 SD. If the values were not

normal, nonparametric methods were used to determine reference intervals (Lassen, 2004). For

comparison of data between groups, each mean value was analyzed by comparison of the

Student’s t-test for normal data while the Mann-Whitney Rank Sum test was used for

nonparametrically distributed data. A value of p<0.5 was considered significant.

RESULTS

3 Sigma Stat for Windows Version 3.0 (Systat Software Inc., San Jose, CA, USA)

31

Turtles used in this study are summarized in table 3-1. A total of 77 green turtles were

caught, 26 from Culebrita and 51 from Manglar. Mean straight carapace length (SCL) for all

turtles was 53.5 cm (range, 26.0-80.9) while the mean body weight was 22.9 kg (range, 2.0-68.0).

The smallest turtle affected with FP had an SCL of 40cm and weighed 8 kg. The largest tumor

bearing turtle had and SCL of 73cm and weighed 55 kg. Fibropapillomas were present in 3

(12%) and 10 (20%) turtles from the Culebrita and Manglar populations, respectively. The mean

tumor scores for the Culebrita and Manglar turtles were 1 and 1.4, respectively. No overtly

emaciated turtles were observed.

There were no statistical differences in any of the blood values between the two distinct

geographic populations of healthy, tumor-free Culebrita and Manglar (data not shown) turtles.

Thus, hematology, plasma biochemistry and plasma protein electrophoresis data were combined

from all healthy animals without cutaneous and fibropapillomas. Mean and reference intervals

were determined. (See Table 3-2.) The mean body weight and length (SCL) of the healthy, tumor

free turtles was 20.9 kg (range, 2.0-68.0) and 52.1cm (range, 26.0-80.9) respectively. For WBC

differentials, heterophils, lymphocytes, eosinophils and monocytes were counted as previously

mentioned. No basophils or hemoparasites were detected in any of the turtles examined. For

plasma protein electrophoresis, albumin, alpha, beta and gamma regions were detected for all

turtles. Prealbumin fractions and beta-gamma bridging were not observed in any of the FP-

animals.

A total of 13 turtles were found to have fibropapillomas. As for the FP- turtles,

hematologic, biochemical and plasma protein data for each of the 13 FP+ turtles were compared

to the reference values established for FP- turtles. Three FP+ turtles (No. 2, 6, and 8) had AST,

CK and/or LDH activity above the reference intervals. Two FP+ turtles (No. 10 and 13) exhibited

32

increased globulin concentrations with an increased gammaglobulin fraction as detected by

protein electrophoresis. The beta-globulin fraction was also slightly increased in turtle No.13.

Slightly increased values were present in Turtle No. 2 (glucose), No. 5 (uric acid), No. 7

(potassium), No. 10 (lymphocytes and calcium), and No. 12 (LDH) but not significantly

considered.

Turtles with fibropapillomas were, on average, larger (mean, 32kg and 60cm SCL) than

FP- turtles (mean, 21kg and 52cm SCL). Hyperproteinemia characterized by normoalbuminemia,

hyperglobulinemia and decreased A/G ratio was present in the group of the FP+ turtles compared

to FP- turtles. Hyperglobulinemia primarily resulted from hypergammaglobulinemia. Review of

the electrophoretograms from FP+ turtles with hypergammaglobulinemia indicated broad based

peaks consistent with a polyclonal gammopathy. No other significant difference was found

between FP+ and FP- turtles.

In a separate study using same turtles, we found total 21 turtles (12 of 64 in FP- and 9 of

13 in FP+) infected with spirorchids by H&E stained histology sections (Table 3-4). These data

were included to interpret the blood vale changes.

DISCUSSION

Because the physical stress associated with wild animal capture may affect both

hematological and plasma biochemical data, all captured turtles were immediately transferred to

a boat and blood was drawn within 5-30 minutes. Following blood collection, physical

examinations were performed. In this manner, we tried to minimize the effects of capture stress

on blood value results. It has been previously reported that blood values can fluctuate in marine

turtles due to age, sex, diet, seasonal changes and geographical areas. For these reasons, we

33

chose to examine only juvenile turtles from a specific geographic region. Within this small

geographic region are two separate populations of juvenile sea turtles that afford the opportunity

to further investigate the effects of environment and habitat on hematological and biochemical

blood values.

The turtle populations evaluated in this study were all juvenile turtles at the post oceanic

phase. Previous studies classified green sea turtles as juvenile based upon SCL ranges of 32.6-

76.9cm (Work and Balazs, 1999) and 35-65cm for Hawaiian turtles and (Aguirre and Balazs,

2000), and 25-68cm for Bahamian turtles (Bolten and Bjorndal, 1992). Both Culebrita and

Manglar Bay are considered developmental habitats for the turtles since they move from the

oceanic stage to these areas, develop for a few years and then leave before maturation into

sexually mature adults (Collazo et al., 1992). The gender of the animals was not determined in

this study, however, since the all of the turtles evaluated were considered juveniles, the influence

of gender for comparison between each group was thought to be minimal. The onset of sexual

maturity is not thought to occur until a green sea turtles reaches a minimum SCL of 80 cm

(Balazs and Chaloupka, 2004; Chaloupka and Balazs, 2005). Only one turtle (FP-) in this study

was larger than 80cm, but was only minimally so (80.9cm).

There was a statistically significant difference between FP+ and FP- turtles in regard to

size with tumor bearing being significantly larger than FP- negative turtles. Previous studies

comparing tumor free juvenile turtles to affected turtles have reported similar findings (Aguirre

and Balazs, 2000; Work et al., 2004). Since there is a direct relationship between age and size of

turtles, it is assumed larger turtles are older. This may be important in the development of FP

especially when considering the slowly progressive nature of FP. Although the specific causal

factors of FP development are unclear, prolonged exposure to certain factors may facilitate FP

34

development and thus explain the reason why FP+ turtles are typically larger than unaffected

turtles (Chaloupka and Balazs, 2005).

Heterophils, lymphocytes, monocytes, and eosinophils were present the blood from all

of the turtles examined in this study. Work et al. (1998), however, described 5 different types of

leukocytes in Hawaiian green turtles including basophils in addition to the leukocytes mentioned

above, (Samour et al., 1998; Work et al., 1998). We did not detect basophils in any of the turtles

examined. The lack of basophils in the turtles of this study may reflect different parasite burdens

or other environmental conditions.

Since no significant differences were detected between the two different geographic

populations (Culebrita and Manglar) for any of the blood parameters analyzed, we combined

data from the two populations to generate reference intervals. Reference intervals have been

generated by other investigators using similar methods for geographically distinct populations in

Hawaii (Aguirre and Balazs, 2000; Work et al., 2001). When comparing the reference intervals

for the majority of the plasma biochemical analytes in this study to those of other reports, similar

values were obtained. However, mean creatine kinase (CK) values in FP- turtles of this study

tended to be higher than values reported in green turtles in Florida (Jacobson et al.) and in

nesting leatherback turtles (Deem et al., 2006). Interestingly, CK activity of the turtles of this

study were quite similar to that reported in green turtles living in the Indian Ocean (Whiting et

al., 2007). While we tried to minimize muscle injury associated with capture and blood

collection, the possibility of capture myopathy as a cause of the increased CK activity cannot be

excluded. Previously existing or underlying, but clinically unapparent muscle injury should also

be considered. While the gender of the turtles seems unlikely as a cause of the increased CK

35

activity compared to other juvenile turtle populations, the possibility the sex of the turtles may be

contributing to the higher CK activity cannot be eliminated.

Comparisons between non-tumored healthy turtles and tumor bearing turtles revealed a

significant difference in protein concentrations. Previous studies have shown that protein

concentrations were decreased in turtles with FP, potentially as a result of malnutrition and

humoral immune suppression (Aguirre and Balazs, 2000; Work et al., 2001). In contrast, Cary

(2001) reported hyperproteinemia due to hypergammaglobulinemia in FP+ turtles. The authors

surmised the hypergammaglobulinemia was the result of antigenic stimulation by the

fibropapillomas with resulting antibody production. Similar to Cary’s findings, our results

indicated hyperproteinemia in FP+ turtles compared to FP- turtles. The hyperproteinemia was

caused by either increased beta- or gamma globulins. It is possibly the hypergammaglobulinemia

observed in the turtles of this report reflect production of immunoglobulins against the

alphaherpesvirus associated with FP. However, response to spirorchid infection cannot be

excluded since nearly 70% of the FP+ turtles were found to have intralesional spirorchids.

Furthermore, when considering the examined tissue size was small and the low sensitivity of

spirorchid detection by histopatholgy, it is likely more turtles were infected with the parasites

than observed and as postulated by other investigators (Gordon et al., 1998).

As mentioned previously, gammaglobulins are primarily composed of

immunoglobulins. In sea turtles, 3 major classes (17S IgM, 7S IgY and 5.7S IgY) of

immunoglobulins with molecular weights similar to mammalian types have been identified

(Benedict and Pollard, 1972). Among the three classes, 5.7S IgY has been shown to develop later

in the immune response and persist at higher concentrations than 7S IgY. Thus, 5.7S IgY is

suspected as the primary immunoglobulin associated with a chronic or sustained immune

36

response (Herbst and Klein, 1995). Thus, the hypergammaglobulinemia observed in these turtles

may be associated with a sustained 5.7S IgY response to either or both FP and parasitic infection.

In addition to the immunoglobulins, the gamma globulin fraction in turtles may include

transferrin (Musquera et al., 1976). In turtles, serum iron concentration decreases as a defense

mechanism to infection (Aguirre and Balazs, 2000) with a resultant increase in transferrin

concentration. Since transferrin was not specifically measured in this study, the possibility of

decreased iron concentration cannot be excluded as a cause of hypertransferrinemia and

hypergammaglobulinemia.

With the exception of significant differences of total protein concentration, total

globulin concentration and hypergammaglobulinemia in FP+ turtles compared to FP- turtles, no

other routine blood parameter was found to be of value in differentiating tumor-bearing from

tumor-free turtles. It is unclear if the increased muscle enzyme activity in the FP+ turtles was

directly associated with tumor burden or a result of unrelated muscle injury. The lack of

significant differences in other parameters may be attributable to the small sample size, or

possibly, a lower tumor burden in the turtles of this report compared to other studies. Geographic

differences did not seem to affect blood parameters in the FP- turtles even though water quality

and environment was subjectively poorer for Manglar Bay versus Culebrita. Additional studies

with larger sample sizes are warranted to further elucidate changes in blood parameters in FP+

green sea turtles. Serial evaluations of blood parameters over longer periods may also prove to be

of benefit.

REFERENCES



37

10, 132-137.






Balazs, G. and Chaloupka, M. (2004). Spatial and temporal variability in somatic growth of

green sea turtles (Chelonia mydas) resident in the Hawaiian Archipelago. Marine Biology,

145, 1043-1059.

Balazs, G. H. (1986). Fibropapillomas in Hawaiian green turtles. Marine Turtle Newsletter, 39, 1-

3.

Benedict, A. A. and Pollard, L. W. (1972). Three classes of immunoglobulins found in the sea

turtle, Chelonia mydas. Folia Microbiol (Praha), 17, 75-78.

Bolten, A. B. and Bjorndal, K. A. (1992). Blood profiles for a wild population of green turtles

(Chelonia mydas) in the southern Bahamas: size-specific and sex-specific relationships. J

Wildl Dis, 28, 407-413.

Chaloupka, M. and Balazs, G. (2005). Modelling the effect of fibropapilloma disease on the

somatic growth dynamics of Hawaiian green sea turtles. Marine Biology, 147, 1251-1260.

Collazo, J. A., Ralf Boulon, J. and Tallevast, T. L. (1992). Abundance and growth patterns of

Chelonia mydas in Culebra, Puerto Rico. Journal of Herpetology, 26, 293-300.


38


D'Amato, A. F. and Moraes-Neto, M. (2000). First documentation of fibropapillomas verified by

histopathology in Eretmochelys imbricata. Marine Turtle Newsletter, 89, 12-13.

Deem, S. L., Dierenfeld, E. S., Sounguet, G. P., Alleman, A. R., Cray, C., Poppenga, R. H.,

Norton, T. M. and Karesh, W. B. (2006). Blood values in free-ranging nesting leatherback

sea turtles (Dermochelys coriacea) on the coast of the Republic of Gabon. J Zoo Wildl

Med, 37, 464-471.

Ene, A., Su, M., Lemaire, S., Rose, C., Schaff, S., Moretti, R., Lenz, J. and Herbst, L. H. (2005).

Distribution of chelonid fibropapillomatosis-associated herpesvirus variants in Florida:

molecular genetic evidence for infection of turtles following recruitment to neritic

developmental habitats. J Wildl Dis, 41, 489-497.

Foley, A. M., Schroeder, B. A., Redlow, A. E., Fick-Child, K. J. and Teas, W. G. (2005).

Fibropapillomatosis in stranded green turtles (Chelonia mydas) from the eastern United

States (1980-98): trends and associations with environmental factors. J Wildl Dis, 41, 29-

41.

Gordon, A. N., Kelly, W. R. and Cribb, T. H. (1998). Lesions caused by cardiovascular flukes

(Digenea: Spirorchidae) in stranded green turtles (Chelonia mydas). Vet Pathol, 35, 21-30.

Greenblatt, R. J., Work, T. M., Dutton, P., Sutton, C. A., Spraker, T. R., Casey, R. N., Diez, C. E.,

Parker, D., St Leger, J., Balazs, G. H. and Casey, J. W. (2005). Geographic variation in

marine turtle fibropapillomatosis. J Zoo Wildl Med, 36, 527-530.


389-425.

39

Herbst, L. H. and Klein, P. A. (1995). Monoclonal antibodies for the measurement of class-

specific antibody responses in the green turtle, Chelonia mydas. Vet Immunol

Immunopathol, 46, 317-335.

Jacobson, E., Bjorndal, K., Bolten, A., Herren, R., Harman, G. and Wood, L. Establishing plasma

biochemical and hematocrit reference intervals for sea turtles in Florida, Vol. 2007,

http://accstr.ufl.edu/blood_chem.htm. Downloaded on 08 November 2007, pp. 1-4.

Jacobson, E. R. (1990). An udate on green turtle fibropapilloma. Marine Turtle Newsletter, 49, 7-

8.

Lassen, E. D. (2004). Perspectives in data interpretation. In: Veterinary hematology and clinical

chemistry, M. A. Thrall, Ed, Lippincott Williams & Wilkins, Philadelphia, pp. x, 518 p.

Musquera, S., Massegu, J. and Planas, J. (1976). Blood proteins in turtles (Testudo hermanni,

Emys orbicularis and Caretta caretta). Comparative Biochemistry and Physiology Part

A: Physiology, 55, 225-230.

Quackenbush, S. L., Work, T. M., Balazs, G. H., Casey, R. N., Rovnak, J., Chaves, A., duToit, L.,

Baines, J. D., Parrish, C. R., Bowser, P. R. and Casey, J. W. (1998). Three closely related

herpesviruses are associated with fibropapillomatosis in marine turtles. Virology, 246,

392-399.

Samour, J. H., Howlett, J. C., Silvanose, C., Hasbun, C. R. and Al-Ghais, S. M. (1998). Normal

haematology of free-living green sea turtles (Chelonia mydas) from the United Arab

Emirates. Comparative Haematology International, 8, 102-107.

Seminoff, J. A. (2004). Chelonia mydas. In: IUCN 2007, 2007 IUCN Red List of Threatened

Species. www.iucnredlist.org. Downloaded on 08 November 2007, pp. Web.

http://accstr.ufl.edu/blood_chem.htm

40



Sposato, P., Lutz, P. L. and Cray, C. (2001). A comparative approach in determining health status

of chelonians with respect to avian and mammalian medicine. The 21st annual




J Wildl Dis, 36, 102-110.

Whiting, S. D., Guinea, M. L. and Limpus, C. J. (2007). Blood chemistry reference values for

two ecologically distinct populations of foraging green turtles, eastern Indian Ocean.

Comp Clin Pahol, 16, 109-118.

Williams, E. H., Jr. and Bunkley-Williams, L. (1994). An epizootic of cutaneous fibropapillomas

in green turtles Chelonia mydas of the Caribbean: Part of a panzootic? Journal of Aquatic

Animal Health, 6, 70-78.



Work, T. M., Balazs, G. H., Rameyer, R. A. and Morris, R. A. (2004). Retrospective pathology

survey of green turtles Chelonia mydas with fibropapillomatosis in the Hawaiian Islands,

1993--2003. Dis Aquat Organ, 62, 163-176.



Work, T. M., Raskin, R. E., Balazs, G. H. and Whittaker, S. D. (1998). Morphologic and

41

cytochemical characteristics of blood cells from Hawaiian green turtles. Am J Vet Res, 59,

1252-1257.

42

Table 3-1. No. of turtles used for blood value evaluation.

Location FP (-) FP (+) Tumor rate (%)

Culebrita 23 3 3/26 (12%)

Manglar 41 10 10/51 (20%)

Subtotal 64 13 13/77 (17%)

43

Table 3-2. Blood parameters of tumor bearing turtles compared to juvenile health FP-free turtles in Culebra, Puerto Rico.

Turtles with tumors Parameters

a

1 2 3† 4

† 5 6

† 7 8 9 10 11 12 13

Mean

(Reference Range) ¶

SCL (cm) 67 65 40 44 43 71 74 58 60 65 65 60 74 52.1 (26.0-80.9) *

Weight (kg) 45 37 8 11 8 48 55 25 28 37 40 26 52 20.9 (2.0-68.0) *

Spirorchid infection b + + - + + + - + - - + + + 12 of 64 (19%)

**

Tumor score 3 1 1 1 1 1 1 1 1 1 1 3 1 0**

Packed cell volume (%) 32 42 33 38 32 37 41 39 34 38 37.2 (25.0-49.4)

Estimated WBC (103/µl)

c 12.0 15.0 12.0 13.0 17.0 17.0 26.0 18.0 13.0 17.0 16.3 (8.0-33.0)

Heterophils (103/µl) 3.0 2.9 2.3 2.3 1.4 1.2 3.6 1.8 2.5 1.2 2.4 (0.5-4.9)

Lymphocytes (103/µl) 5.6 11.1 8.4 8.7 13.6 13.6 19.2 15.5 8.2 12.2 11.2 (4.7-18.6)

Monocytes (103/µl) 0.7 0.5 0.0 0.1 0.2 0.0 2.1 0.2 1.6 1.0 0.4 (0-3.0)

Eosinophils (103/µl) 2.6 0.6 1.3 1.8 1.9 2.2 1.0 0.5 0.8 2.6 2.2 (0-8.3)

ALP (IU/L) 33 35 35 65 32 62 23 43 51.7 (20.0-83.7)

ALT (IU/L) 3 14 5 4 2 3 3 3.8 (1.0-10.0)

AST (IU/L) 122 136 87 263 164 150 219 147 155.0 (97.0-219.2)

CK (IU/L) 471 4921 202 6140 1009 336 2519 575 1039 (249-3093)

LDH (IU/L) 125 569 148 870 170 222 365 150 188.9 (81.0-350.9)

Albumin (g/dL) 1.3 1.3 1.6 1.4 1.5 1.7 1.5 1.5 1.8 1.6 1.6 1.8 1.4 (0.9-2.1)

TP (g/dL) 5.4 4.5 5.2 4.5 5.2 6.4 5.1 4.4 6.9 5.5 6.1 7.2 4.6 (2.8-6.4)

Globulin (g/dL) 4.1 3.2 3.7 4.7 3.6 5.1 3.6 4.5 5.4 3.2 (1.5-5.4)

A/G ratio (%) 30.0 40.0 40.0 40.0 40.0 40.0 40.0 30.0 43.1 (30.0-70.0)

Cholesterol (mg/dL) 134 143 139 99 140 132 157 109 148.5 (63.9-233.1)

Glucose (mg/dL) 107 153 82 85 99 93 114 87 89.4 (59.0-132.0)

Calcium (mg/dL) 9.3 9.1 9.7 9.5 8.8 8.8 9.3 9.5 11.2 9.9 8.6 10.6 9.6 (7.4-10.7)

Phosphorus (mg/dL) 7.3 8.0 7.9 8.3 7.9 8.5 8.5 8.4 8.7 7.3 7.0 8.5 7.7 (5.7-9.7)

Potassium (mEq/L) 4.1 4.6 5.2 6.5 4.6 5.3 4.9 5.4 5.0 (4.0-6.2)

Sodium (mEq/L) 152 154 152 155 158 160 159 163 157.1 (149.0-165.0)

Uric acid (mg/dL) 0.6 1.6 0.5 2.8 0.5 1 1.6 1 1.1 1.1 0.7 1.0 (0.4-2.3)

44

Albumin (g/dL) 1.8 1.7 1.9 1.6 1.9 1.9 1.7 2.2 1.9 2.1 2.2 1.8 (1.2-2.4)

Globulin (g/dL) 3.5 3.0 3.3 2.9 2.2 3.2 2.7 4.7 3.6 4.0 5.0 2.8 (1.4-4.2)

A/G ratio (%) 50.6 54.6 59.0 56.3 85.1 57.6 63.8 47.2 51.9 52.1 44.3 64.7 (41.3-88.1)

Alpha (g/dL) 0.6 0.6 0.5 0.5 0.7 0.6 0.5 0.8 0.6 0.7 0.7 0.6 (0.4-0.8)

Beta (g/dL) 0.7 0.8 0.6 0.4 0.7 0.6 0.6 0.7 0.6 0.7 0.9 0.6 (0.4-0.8)

Gamma (g/dL) 2.2 1.7 2.1 2.0 0.8 2.1 1.6 3.2 2.4 2.6 3.4 1.7 (0.5-2.9) ¶ Thirty three to 57 turtles were used for reference values.

a SCL, straight carapace length; ALP, alkaline phosphatase; ALT, alanine aminotransferase; AST, aspartate aminotransferase; CK, creatine kinase; LDH, lactate

dehydrogenase; TP, total protein. b Determined by histopathologic evaluation.

c Total white blood cell count performed by blood smear evaluation.

† Turtles were from Culebrita. The other 10 turtles were from Manglar

* Mean (full range) of healthy turtles used for the reference range.

** Results of healthy turtles used for the reference range.

Blank: not tested due to shortage of sample.

45

Table 3-3. Physical examination, plasma biochemistry, and plasma protein electrophoresis values of turtles with FP.

Valuesa N Mean ± SD Range (Mim. - Max.)

Weight * (kg) 13 32.3 ± 16.2 8.0-55.0

Max-SCL * (cm) 13 60.3 ± 11.3 40.0-73.7

PCV (%) 10 36.6 ± 3.7 32-42

WBC (103/µl) 10 16.0 ± 4.2 12-26

Heterophil (103/µl) 10 2.2 ± 0.8 1.2-3.6

Lymphocyte (103/µl) 10 11.6 ± 4.1 5.6-19.2

Monocyte (103/µl) 10 0.6 ± 0.7 0-2.1

Eosinophil (103/µl) 10 1.5 ± 0.8 0.5-2.6

ALP (IU/L) 8 41.0 ± 14.9 23.0-65.0

ALT (IU/L) 7 4.9 ± 4.1 2.0-14.0

AST (IU/L) 8 161.0 ± 55.7 87.0-263.0

CK (IU/L) 8 2021.6 ± 2308.1 202.0-6140.0

LDH (IU/L) 8 327.4 ± 265.8 125.0-870.0

Albumin (g/dL) 12 1.6 ± 0.2 1.3-1.8

TP (g/dL) * 12 5.5 ± 0.9 4.4-7.2

Globulin (g/dL) * 9 4.2 ± 0.8 3.2-5.4

A/G ratio (%) 8 37.5 ± 4.6 30.0-40.0

Cholesterol (mg/dL) 8 131.6 ± 18.8 99.0-157.0

Glucose (mg/dL) 8 102.5 ± 23.2 82.0-153.0

Calcium (mg/dL) 12 9.5 ± 0.8 8.6-11.2

Phosphorus (mg/dL) 12 8.0 ± 0.6 7.0-8.7

Potassium (mEq/L) 8 5.1 ± 0.7 4.1-6.5

Sodium (mEq/L) 8 156.6 ± 4.0 152.0-163.0

Uric acid (mg/dL) 11 1.1 ± 0.7 0.5-2.8

Albumin (g/dL) 11 1.9 ± 0.2 1.6-2.2

Globulin (g/dL)* 11 3.5 ± 0.8 2.2-5.0

A/G ratio(%)* 11 56.6 ± 10.9 44.3-85.1

Alpha (g/dL) 11 0.6 ± 0.1 0.5-0.8

Beta (g/dL) 11 0.6 ± 0.1 0.4-0.9

Gamma (g/dL)* 11 2.2 ± 0.7 0.8-3.4

a ALP, alkaline phosphatase; ALT, alanine aminotransferase; AST, aspartate aminotransferase; CK, creatine kinase;

LDH, lactate dehydrogenase; TP, total protein. b Total white blood cell count performed by blood smear evaluation.

* Significantly different between FP free and FP turtles (P<0.05).

46

Table 3-4. Spirorchid infection detected by histopathology

Location FP (-) FP (+) All

Culebrita 1/23 (4%) 2/3 (67%) 3/26 (12%)

Manglar 11/41 (27%) 7/10 (70%) 18/51 (35%)

Subtotal 12/64 (19%) 9/13 (69%) 21/77 (27%)

47

CHAPTER 4

LOCALIZATION OF FIBROPAPILLOMATOSIS-ASSOCIATED TURTLE HERPESVIRUS

IN GREEN TURTLES (CHELONIA MYDAS) BY IN-SITU HYBRIDIZATION1

1 K. I. Kang, Fernando Torres-Velez, Jian Zhang, Anthony Moore, Carlos Diez, and C.C. Brown.

To be submitted to Journal of Comparative Pathology.

48

ABSTRACT

Fibropapilloma-associated turtle herpesvirus (FPTHV) is the presumed agent of sea

turtle fibropapillomatosis (FP). The viral DNA and RNA have been detected by PCR, but the

location and distribution of the virus within the tumors have not been addressed. We used in situ

hybridization (ISH) to investigate viral transcriptional activity and localization of HPTHV. From

105 green turtles (Chelonia mydas) from islands of Culebra and Culebrita, Puerto Rico, twenty-

five tumors were obtained from the skin or conjunctiva of fifteen green turtles. The tumors were

assigned to either fibropapilloma or fibroma types on the basis of the tumor morphology. With

ISH, we detected FPTHV viral mRNA transcripts in 3 of 25 tumors, with positive reactions

present in the epithelial cells with intranuclear inclusion bodies in fibropapilloma types. Viral

presence (DNA) was detected in 14 of 25 tumors, including both fibropapilloma and fibroma

types. The signals were confined to the nuclei of acanthotic epithelial cells and were never seen

in the fibrotic areas. From this limited study, these results suggest that FPTHV is present in

epithelial cells and transcriptionally active in some tumors, specifically in fibropapillomas as

opposed to fibromas. By ISH, viral presence, either DNA or RNA, was never detected in the

subepithelial connective tissue of the tumors.

INTRODUCTION

Fibropapillomatosis (FP) is a neoplastic disease of marine turtles characterized by

single to multiple cutaneous fibroepithelial growths with a verrucous or a smooth surface,

occasionally involving fibromas in visceral organs. The tumors often cause affected animals to

become debilitated by hampering feeding and moving actions, obscuring vision, and in the case

49

of visceral extension, can cause death due to organ failure (Balazs, 1986; Herbst, 1994; Jacobson,

1990; Quackenbush et al., 1998; Smith and Coates, 1938).

Histologically, FP has been described and classified into three stages: papillomas,

fibropapillomas, and fibromas. Papillomas may represent the earliest stage in tumor development

and consist predominantly of proliferating epidermis. Fibromas are characterized by dermal

proliferation with relatively normal epidermis suggesting a chronic process. Fibropapillomas

exhibit proliferation of both components, suggesting an intermediate form (Herbst, 1994; Herbst

et al., 1999; Jacobson et al., 1989). Epithelial cells in the proliferating lesion may show

ballooning degeneration with eosinophilic intranuclear inclusion bodies, while fibrovascular

stroma in the dermis has well-differentiated fibroblasts often with haphazard arrangement and

perivascular mononuclear infiltrates (Greenblatt et al., 2005; Herbst, 1994).

Visceral tumors in FP appears to occur at the later stage of the disease and is usually

found at necropsy of moribund animals (Herbst et al., 1999). Most of the internal fibromas

consist of well-differentiated fibroblasts with normally layered epithelial layer, similar to the

cutaneous fibroma. Lung, heart, kidney, and intestines are most commonly involved organs

(Herbst, 1994). It is unknown whether cutaneous fibroblasts metastasize to visceral organs or

whether tumors arise de novo from altered cells at the visceral site.

The primary etiologic agent of FP has not been conclusively demonstrated. Several

causal factors that may compromise immune function such as environmental pollutants, chronic

stress, genetic factors, and parasites have been suggested as playing a role in causation of FP

(Aguirre and Lutz, 2004; Herbst, 1994). However, the most putative single agent is a herpesvirus,

fibropapillomatosis-associated turtle herpesvirus (FPTHV). There is cumulative evidence

implicating a herpesvirus. Subcellular (less than 0.45 µm) and chloroform sensitive (suggestive

50

of enveloped virus) agents have been implicated through experimental tumor transmission

(Herbst et al., 1995; Herbst et al., 1996). Histologically, perivascular lymphocytic infiltration in

neoplastic fibrovascular dermis is present, suggestive of, but not specific for, viral infection

(Herbst, 1994). Eosinophilic intranuclear inclusion bodies (INIB) are observed, and using

electron microscopy herpesvirus-like particles are visualized in the inclusions. Various stages of

viral particles, including viral budding and mature enveloped particles (110-125 nm), have been

detected, which is indicative of viral replication (Herbst et al., 1995; Jacobson et al., 1991). A

highly conserved herpesviral polymerase gene (UL30, pol) and its mRNA have been consistently

detected and these sequences are more abundant in FP than in non-neoplastic tissues, indicating

the sequences are specific for the tumor tissue (Lu et al., 2000; Lu et al., 2003; Quackenbush et

al., 2001; Quackenbush et al., 1998). Sequencing and phylogenetic analysis of these sequences

have implicated a novel herpesvirus that is closely related to the alphaherpesviruses (Lackovich

et al., 1999; Nigro et al., 2004; Quackenbush et al., 2001; Quackenbush et al., 1998; Yu et al.,

2000). Comparison of the herpesviral sequences from other various geographic areas and among

other species of the tumor bearing turtles is indicative that the viruses have high degree of

relatedness among them, implying the viruses are commonly associated with FP (Quackenbush

et al., 2001; Quackenbush et al., 1998).

To date, despite numerous attempts, virus isolation has not been accomplished (Coberley,

2002; Lackovich et al., 1999; Lu et al., 2003). Therefore, it has not been possible to fulfill

Koch’s postulates. Currently, despite confirmed viral presence in the tumor tissue using PCR, the

cellular location of virus is not defined (Quackenbush et al., 2001).

Immunological methods have been used to attempt to detect viral antigen in the tumor

tissue, although currently no specific antibodies to FPTHV are available. Antibodies to herpes

51

group-specific antigens (HSV1/HSV2) did not cross-react to herpesviral antigens in intranuclear

inclusions with an immunohistochemistry method (Matushima et al., 2001). An

immunohistochemistry protocol that used serum from FP-affected turtles as a primary antibody

has been successful in the detection of antigen in the inclusions in FP tissues. However, there is

no guarantee that the serum of the FP-affected turtle did not have antibodies to another

herpesvirus that might have been present in the FP tissue. There are 2 other chelonian

herpesvirus - Lung-eye--trachea disease virus (LETDV), which is isolated and serologically

distinct from FPTHV, and also gray-patch disease virus (GPDV), with unknown serologic

relatedness to FPTHV (Coberley et al., 2001; Herbst et al., 1998). However, those viruses have

been only reported in turtles raised in aquaculture (Jacobson et al., 1986; Rebell et al., 1975).

We studied pathological aspects of FP through the localization of FPTHV nucleic acids

in tumor tissues. In situ hybridization is a technique that can be used to document the tissue and

cellular location of specific nucleic acid and therefore using a FPTHV specific riboprobe,

localization of viral replication within tumor tissue could be confirmed. We hypothesized that

viral replication can be detected in the tumors using in situ hybridization with a digoxigenin-

labeled riboprobe. To evaluate this hypothesis, we used negative-stranded riboprobes to detect

for production of mRNA from viruses. We also applied the probe to detect viral DNA under

conditions that allow hybridization with viral genomic DNA, i.e., after denaturation. This study

provides evidence that is consistent with the hypothesis that the FPTHV nucleic acids can be

detected by ISH.

MATERIALS AND METHODS

Sample collection

52

One-hundred five juvenile, 26-81 cm in straight carapace length, green turtles (Chelonia

mydas) were captured by netting and subsequently released (Collazo et al., 1992) from Mar 2006

to Jun 2007 at the Culebra archipelago, Puerto Rico. All procedures were handled under federal

and state permits (US NMFS: Permit No. 1253 and PRDRNA 12-EPE-04) and Animal Care and

Use Protocol at the University of Georgia.

Following disinfection (Betadine) of the sampling area, 25 tumors from 15 affected

animals were either surgically removed or punch (6mm in diameter) biopsied. A punch biopsy of

normal skin on the shoulder area was also taken from all animals, whether or not they were

affected by FP. After removal, tissues were immediately fixed in 10 % neutral buffered formalin

for 12 – 24 hours and placed in diethyl pyrocarbonate (DEPC) treated phosphate-buffered saline

(PBS) until transported to the laboratory. Each tissue was processed and embedded into paraffin

using routine tissue processing methods, and 3 µm cut sections were used for H&E staining and

in-situ hybridization. The number of turtles and tissues examined are described in Table 4-1.

During this study, a set of formalin fixed tissues were submitted from a necropsy case, which

contained internal and external tumors. The turtle was 15 kg, appeared to be severely emaciated,

and died at a rehabilitation center in Puerto Rico. Tissues submitted consisted of the skin, eyelid,

intestine, lung, kidney, heart, spleen, spinal cord, and brain. The formalin fixed tissues were

included for the detection of ISH reaction.

Histopathologic evaluation and lesion scoring

All skin and conjunctival tumor tissues were thoroughly examined histologically, and

scored, according to degree of acanthosis, fibroblast proliferation and collagen fiber deposition.

The lesion scores were set as follows: acanthosis - normal 4 to 7 layers of epithelial cells (0),

within 2 fold of normal thickness (1), more than 2 fold but focal (2), and severe and diffuse with

53

papillary pattern (3); proliferation of fibroblasts - normal (0), scattered (1), local or superficial

(2), and diffuse (3); collagen deposition - normal (0), mild between fibroblasts (1), dense but in

the superficial subepithelial connective tissue (2), and diffuse into deep subepithelial connective

tissue (3). Mitotic index of epithelial cells was counted as average of the total number of mitoses

per 10 high power fields (40X).

Subsequent to observation and lesion scoring, the tumors were classified into papilloma,

fibropapilloma or fibroma types on the basis of tumor progression and histopatholgical changes

previously described (Herbst, 1994; Herbst et al., 1999; Jacobson et al., 1989). The papilloma

type represents papillary epithelial growth without involvement of subepithelial component. The

fibropapilloma type is an intermediate form between the papilloma and fibroma types, involving

pathological changes both in epithelial and subepithelial components. The fibroma type is

characterized by smooth epithelial surface covering fibrotic tissues.

Preparation of probe for in-situ hybridization

Riboprobes were generated based on the PCR amplicons of FPTHV herpesviral DNA

polymerase (UL30, pol) (Gene bank accession No. AF035003). The 364 bp final amplicons,

were produced by primary PCR primers (forward: 5-AGCATCATCCAGGCCCACAATCTG-3;

reverse: 5-CGGCCAGTTCCGGCGCGTCGACCA-3) and then nested PCR primers (forward 5-

CGGCGAGCCGAAACGCTCAAGG -3 and reverse: 5-TCCGTTCCCCAGCGGGTGTGAA-3).

After purification from an agarose gel, the PCR products were ligated into the TA- vector

(pGEM-T Easy, Promega, Madison, WI) and ligation products were introduced into E.coli by

heat-shock. Positive colonies were confirmed by DNA sequencing performed by the sequencing

and synthesis facility at the University of Georgia. A confirmed positive colony was cultured and

plasmid DNA was prepared using a commercially available kit (Promega mini-prep, Promega,

54

Madison, WI). The resulting constructs were cleaved with restriction enzyme SacII. This was

followed by in vitro transcription with RNA polymerase SP6 to generate an anti-sense RNA of

approximately 364 nucleotides in length in the presence of labeled digoxigenin nucleotides. For

the sense RNA probe, restriction enzyme Sac I and RNA polymerase T7 were used.

Incorporation of digoxigenin was verified by dot blot.

The anti-sense riboprobes were used for in situ hybridization of formalin-fixed,

paraffin-embedded tissue samples to detect the mRNA of FPTHV in turtle tissues. The sense

probe, a non-sense probe (a riboprobe of a turkey newcastle disease virus matrix gene) and

hybridization solution without probe were used as controls.

In-situ hybridization methods

[RNA ISH standard method]

RNA ISH was performed to hybridize the probes to viral transcripts as described

previously (Brown, 1998). (1) Slides were first heated at 70 oC for 10 min and deparaffinized in

Hemo-De (Fisher Scientific, Pittsburgh, PA). After slides were air-dried thoroughly, tissue

sections were rehydrated in 5 mM MgCl2 in PBS and digested with Proteinase K (50 µg/ml) in

proteinase K buffer (10 mM Tris pH 7.5 + 2 mM CaCl2) for 15 min at 37 o

C. The enzymatic

reaction was stopped with 0.1 M glycine in 0.2 M Tris, pH 7.5. (2) Prehybridization solution (5X

standard sodium citrate containing 50 % formamide, 5 % blocking reagent (Boehringer

Mannheim, Indianapolis, IN), 1 % N-lauroylsarcosine, and 0.02 % sodium dodecyl sulphate) was

added to sections for 1 hr at 42 oC. (3) A total of 70 µl hybridization solution (2 µl probe in 70 µl

prehybridization solution) per slide was applied directly onto the section, which was covered

with a siliconized coverslip, and the edges sealed with nail hardener. Hybridization occurred

overnight at 42 oC in a humid chamber. (4) The next day, after stringent washes at 50

oC, the

55

slides were blocked with 10 % normal sheep serum and 10 % nonfat dried milk for 10 min at RT

(5) 1:300 Sheep anti-dig AP, F(ab’)2 (Roche 11-093-274-910) was applied for 2 hr at 37 o

C. (6)

After washing, signal was developed with substrate and chromogen (nitroblue tetrazolium + 5-

bromo-4-chloro-3-in indolylphosphate). (7) Development was allowed to progress up to several

hours. Slides were counterstained lightly with hematoxylin. All were coverslipped with

permount for a permanent record.

[Standard method with denaturation]

To detect genomic viral DNA, the slides were heated at 95 oC for 7 min to denature

DNA and then chilled on ice, between (2) prehybridization and (3) hybridization solution steps.

Other steps were performed identically as in the standard method.

[Signal amplification method with or without denaturation]

For signal amplification, to detect mRNA following the initial steps in the standard

method, (3) hybridization was done at 50 oC and (4) slides were subjected to stringent washes at

55 o

C. At step (4), the slides were blocked with 20% normal rabbit serum. After step (5) and

before (6), 1:1000 rabbit F(ab’)2 anti-sheep IgG, AP conjugate (Southern Biotech 6010-04) was

applied for 30 min at RT. (7) Substrate development progressed for 30-80 min. To detect viral

DNA, all steps were the same, except for denaturation just prior to the hybridization step.

RESULTS

Histopathological evaluation and classification

Of 105 turtles which we captured, 90 turtles were tumor-free and 15 had tumors.

Twenty-five tumors from 15 tumor bearing turtles and 104 normal skin biopsies obtained from

the field sampling were evaluated for histopathologic changes (Table 4-1). The tumors were

composed of 18 conjunctival and 7 skin masses, ranging few millimeters up to 12 cm. We

56

classified tumors into papilloma, fibropapilloma or fibroma types. None of tumors were seen as

the papilloma type which was expected to have papillary epithelial growth without involvement

of fibroblast proliferation. All tumors in this study were in either the fibropapilloma or fibroma

type. Nineteen of the 25 tumors were classified as the fibropapilloma type (Fig. 4-1). In this type,

the papillary projections of the epithelial layer with acanthosis were supported by various

degrees of fibrovascular connective tissues which were primarily composed of well-

differentiated fibroblasts and various amounts of inflammatory cells. The other 6 tumors had an

appearance of the fibroma type, which was characterized by smooth epithelial surface with none

to mild acanthosis of epithelial layer (Fig. 4-2). The dermis of the fibromatous type was

composed of dense collagen deposition with scattered fibroblasts. The dense collagen deposition

area can be differentiated from the adjacent dermal connective tissues.

Acanthosis was common in fibropapilloma types in which eosinophilic intranuclear

inclusion bodies (INIB) in ballooning epithelial cells were seen in 4 tumors. In the epithelium,

fibropapilloma types had 5.5 mitotic cells (average of the total number of mitoses per 10 high

power fields) and fibroma types and normal skin tissues had less than 2 mitotic cells per high

power field. The cellularity of fibroblasts in the subepithelial connective tissue was higher in the

fibropapilloma type than in the fibroma type in which more dense collagen deposition was

prevalent (Fig. 4-3).

All of conjunctival tumors in this study were the fibropapilloma type characterized by

hyperplasia of noncornified stratified squamous and columnar cells of conjunctival epithelium,

while 6 of 7 skin tumors were of the fibromatous type.

Perivascular mononuclear inflammation was common in the subepithelial connective

tissue, cells of which were composed mainly of histiocytes and lymphocytes with few plasma

57

cells. Granulomas associated with spirorchid eggs and sectioned parasite bodies were commonly

observed. Table 4-2 shows the number of turtles with spirorchid infection found by microscopic

examination. Intravascular spirorchids and their eggs with granulomas were present in 10 of 15

tumor bearing turtle (67 %). Spirorchid eggs and granulomas were observed in normal skin

tissues from 17 % of healthy turtles. Total 24 % (25 of 105 turtles) had spirorchid organisms in

this study.

Tissues from a necropsied turtle contained tumors in the skin, conjunctiva, intestine,

lung, kidney, heart, and spleen. The skin tumor was the fibromatous type, while the conjunctival

tumor was the fibropapilloma type. The internal tumors had the appearance of fibromas. The

tumors were uncapsulated but well demarcated with around tissues, locating in both parenchyma

and interstitium. They consisted of well-differentiated fibroblasts with dense collagen deposition.

Epithelial layers in the organs were attenuated. Spirorchid organisms with granulomas were

commonly observed in the tissues.

In-situ hybridization

The standard method was less sensitive than the signal amplification method. However,

background staining was occasionally a problem using the signal amplification method. With

both techniques, all negative controls (sense probe, nonsense probe, no probe) were consistently

without staining. Results for in situ hybridization are summarized in table 4-3. Using the

standard method and probing without denaturation, we detected viral pol transcripts in two tumor

tissues only (No. 22 and No. 23). The positive signals were focally present in epithelial cells,

which were in the same regions where were observed in H&E stain (Fig. 4-4). With the signal

amplification method, we found the positive signal in one additional tumor (No. 15). Control

with the sense probe and negative control without probe did not show the reaction.

58

The standard method with denaturation of DNA revealed positive reaction in 3 tumors

(No. 22 - 24), and signal was consistently intranuclear. Signal amplification with denaturation of

DNA revealed 14 positives, and signal was consistently intranuclear (14/25, 56 %). These

included 10 of 19 fibropapilloma types (53 %) and 4 of 6 fibroma types (67 %). However, the

intensity of staining and number of positive cells were much more frequent in fibropapilloma

types than in fibroma types. The positive reactions were always confined to the nuclei of

acanthotic epithelial cells. The signal also existed in the nuclei of proliferative noncornified

conjunctival stratified squamous and columnar epithelial cells in conjunctival tumors.

There were no reactions in dermal cells such as fibroblasts and inflammatory cells by

all ISH methods used. Also, reactions were never seen in non-neoplastic skin tissues. Tissues

from a necropsy case were tested by ISH methods. The conjunctival tumor had positive signals

in the nuclei of neoplastic epithelial cells (Fig. 4-5). None of visceral and skin tumors as well as

serial sections of the brain and spinal cord exhibited positive signals.

DISCUSSION

In this study, 25 tumor masses collected from 15 affected green turtles in eastern Puerto

Rico and multiple tissues from a necropsied turtle affected with FP were examined

histopathologically and by in situ hybridization. The pathologic features of FP have been

described previously (Herbst, 1994; Herbst et al., 1999; Jacobson et al., 1989; Smith and Coates,

1938). When we classified tumors into the established categories of papilloma, fibropapilloma or

fibroma, we only saw the fibropapilloma or fibroma types.

With H&E stain, we found INIB in 4 tumors (16 %), all of which were fibropapilloma

types, while none of fibroma types had INIB, suggesting more viral activity in fibropapilloma

59

types. On the other hand, the primary cells in the fibroma type were scattered well-differentiated

fibroblasts, which is consistent with previous reports (Herbst, 1994). In addition, Papadi et al.

(1995) reported that dermal cells of FP show normal cell cycles and most of them stay in the G1

phase. All of conjunctival tumors and one skin tumor (No. 25) were fibropapilloma types, while

6 of 7 skin tumors were fibroma types. Although the mass (No. 25) had papillary epithelial

hyperplasia with minimal acanthosis, the dermal fibrosis was consistent with that in other

fibroma types, representing part of chronic features. Thus, it seemed that skin tumors, which

were fibroma types, tend to be more chronic, while conjunctival tumors, which were

fibropapilloma types, were more recently developed and/or active. The frequent contacts due to

their close location to nearby tissues might be prone to the propagation with high frequency in

this warm, moist, well-vascularized region.

Even though the histologic findings are not sensitive to detect parasites, we found

spirorchid infection in 24% turtles we sampled and in the necropsied turtle. The parasitic lesion

was more common in tumor bearing turtles (67%) than healthy turtles (17%). Spirorchid flukes

in the cardiovascular system are the most common parasites in sea turtle. Three species

(Hapalotrema mehrai, H. postorchis and Neospirorchis schistosomatoides) have been reported in

turtles. The association of spirorchid infection with FP is uncertain, although spirorchid egg

granulomas are frequently found lesions in tumors. Parasite egg injection failed to develop

tumors while tumor occurred when injected with cell-free filtrate from tumor tissue (Herbst et al.,

1995). An enzyme-linked immunosorbent assay (ELISA) developed for specific spirorchid

antigen showed no significant relationship between antibody reactivity to spirorchids and FP

status (Herbst et al., 1998). In addition, enough amounts of viral copies are not detected within

the parasite to be a possible vector for FPTHV (Greenblatt et al., 2004).

60

Herpesviral polymerase gene (pol, UL30) belongs to early expression genes (beta

genes), so that the expression is indicative of the beginning and presence of the viral productive

replication. Using riboprobe ISH to detect viral replication, positive reactions were seen in 2 of

25 tumors, each of which had INIB by H&E. The positive transcripts were confined to the

inclusions in the ballooning degenerative epithelial cells. Using an ISH signal amplification

technique, there were an additional positive tumor demonstrating viral replication. Thus, we had

3 tumors in which transcripts were detected. We localized the viral pol transcripts in the tissues.

Herpesvirus is a double stranded DNA virus. Using riboprobe ISH, we should only be

detecting mRNA produced by the virus. But with the added step of denaturing DNA within the

tissue, the double-stranded genomic DNA is separated and our riboprobe ISH will also highlight

areas of mature virions. Similar application of riboprobe to detect DNA has been successfully

used in other herpesvirus study (Simmons et al., 1997). With DNA denaturation, we localized

the presence of virus in 3 tumors with the standard ISH. Using signal amplification, 14 tumors

were positive for virus presence. By the signal amplification, however, more epithelial cells, both

in fibropapilloma and fibroma types were shown to contain viral genomic gene, indicating viral

presence in both types of tumors.

All ISH reactions were confined to the nucleus of epithelial cells. It was common and

prominent in cells with INIB as seen by H&E, as well as other cells in stratum spinosum and

granulosum in which ballooning degeneration was shown. However, we failed to detect ISH

signals in the subepithelial connective tissue both in external and internal tumors. It was most

likely attributed to an undetectable level of genes rather than the total absence of virus, since

both DNA and RNA by PCR have been detected in the deep dermis in spite of far fewer numbers

than in the superficial layer (Greenblatt et al., 2004).

61

We detected viral mRNA transcripts in 3 tumors, whereas viral DNA was detected in

14 of 25 tumors with the same probe. The reason is unknown but it is possible there are limited

viral production in its pathogenesis. In the previous experimental tumor transmission study by

Herbst el al. (1995), one tumor extract, even though the source tumor looked similar as others,

failed to transmit tumors. They attributed it to low concentration of viral particles or wrong stage

of tumors for infectious particle production. Greenblatt et al. (2004) reported viral mRNA in

most of FP tumors were only 1 % level comparing the DNA copies present, indicating only

limited viral productivity and possibility of viral latency in most of tumors.

Morphologic changes of FP resemble that of papilloma virus induced tumors of other

species where the viral particles are only present in a few nuclei of the highly proliferative

epithelial cells (Jones et al., 1997; Sundberg et al., 1984). Here our results share the similarity

with those of papilloma viruses. The virus detected by ISH was only located in the epithelial

cells. This characteristic can be associated with the epithelial tropism of the alphaherpesvirus. In

a quantitative PCR, the viral loads were much more abundant in the superficial part (epidermis

and dermis) than the inside part of tumor tissues (Greenblatt et al., 2004).

REFERENCES



Balazs, G. H. (1986). Fibropapillomas in Hawaiian green turtles. Marine Turtle Newsletter, 39,

1-3.

Brown, C. (1998). In situ hybridization with riboprobes: an overview for veterinary pathologists.

Vet Pathol, 35, 159-167.

62



Collazo, J. A., Ralf Boulon, J. and Tallevast, T. L. (1992). Abundance and growth patterns of

Chelonia mydas in Culebra, Puerto Rico. Journal of Herpetology, 26, 293-300.

Greenblatt, R. J., Work, T. M., Balazs, G. H., Sutton, C. A., Casey, R. N. and Casey, J. W.

(2004). The Ozobranchus leech is a candidate mechanical vector for the fibropapilloma-

associated turtle herpesvirus found latently infecting skin tumors on Hawaiian green

turtles (Chelonia mydas). Virology, 321, 101-110.

Greenblatt, R. J., Work, T. M., Dutton, P., Sutton, C. A., Spraker, T. R., Casey, R. N., Diez, C.

E., Parker, D., St Leger, J., Balazs, G. H. and Casey, J. W. (2005). Geographic variation

in marine turtle fibropapillomatosis. J Zoo Wildl Med, 36, 527-530.


389-425.

Herbst, L. H., Greiner, E. C., Ehrhart, L. M., Bass, A. L. and Klein, P. A. (1998). Serological

association between spirorchidiasis, herpesvirus infection, and fibropapillomatosis in

green turtles from Florida. J Wildl Dis, 34, 496-507.

Herbst, L. H., Jacobson, E. R., Klein, P. A., Balazs, G. H., Moretti, R., Brown, T. and Sundberg,

J. P. (1999). Comparative pathology and pathogenesis of spontaneous and experimentally

induced fibropapillomas of green turtles (Chelonia mydas). Vet Pathol, 36, 551-564.




63




Jacobson, E. R. (1990). An udate on green turtle fibropapilloma. Marine Turtle Newsletter, 49,

7-8.



Jacobson, E. R., Gaskin, J. M., Roelke, M., Greiner, E. C. and Allen, J. (1986). Conjunctivitis,

tracheitis, and pneumonia associated with herpesvirus infection in green sea turtles. J Am

Vet Med Assoc, 189, 1020-1023.




Jones, T. C., Hunt, R. D. and King, N. W. (1997). Veterinary pathology. Williams & Wilkins,

Baltimore, Md., pp. viii, 1392 p.





Lu, Y., Wang, Y., Yu, Q., Aguirre, A. A., Balazs, G. H., Nerurkar, V. R. and Yanagihara, R.

(2000). Detection of herpesviral sequences in tissues of green turtles with fibropapilloma

by polymerase chain reaction. Arch Virol, 145, 1885-1893.

64




1163.

Matushima, E. R., Filho, A. L., Loretto, C. D., Kanamura, C. T., Sinhorini, I. L., Gallo, B. and

Baptistolle, C. (2001). Cutaneous papillomas of green turtles: a morphological, ultra-

structural and immunohistochemical study in Brazilian specimens. Bra J Vet Res Anim

Sci, 38, 51-54.

Nigro, O., Yu, G., Aguirre, A. A. and Lu, Y. (2004). Sequencing and characterization of the full-

length gene encoding the single-stranded DNA binding protein of a novel Chelonian

herpesvirus. Arch Virol, 149, 337-347.

Papadi, G. P., Balazs, G. H. and Jacobson, E. R. (1995). Flow cytometric DNA content analysis

of fibropapillomas in green turtles Chelonia mydas. Dis Aquat Organ, 22, 13-18.

Quackenbush, S. L., Casey, R. N., Murcek, R. J., Paul, T. A., Work, T. M., Limpus, C. J.,

Chaves, A., duToit, L., Perez, J. V., Aguirre, A. A., Spraker, T. R., Horrocks, J. A.,

Vermeer, L. A., Balazs, G. H. and Casey, J. W. (2001). Quantitative analysis of

herpesvirus sequences from normal tissue and fibropapillomas of marine turtles with real-

time PCR. Virology, 287, 105-111.

Quackenbush, S. L., Work, T. M., Balazs, G. H., Casey, R. N., Rovnak, J., Chaves, A., duToit,

L., Baines, J. D., Parrish, C. R., Bowser, P. R. and Casey, J. W. (1998). Three closely

related herpesviruses are associated with fibropapillomatosis in marine turtles. Virology,

246, 392-399.

Rebell, G., Rywlin, A. and Haines, H. (1975). A herpesvirus-type agent associated with skin

lesions of green sea turtles in aquaculture. Am J Vet Res, 36, 1221-1224.

65

Simmons, A., Bowden, R. and Slobedman, B. (1997). Retention of herpes simplex virus DNA

sequences in the nuclei of mouse footpad keratinocytes after recovery from primary

infection. J Gen Virol, 78 ( Pt 4), 867-871.



Sundberg, J. P., Junge, R. E. and Lancaster, W. D. (1984). Immunoperoxidase localization of

papillomaviruses in hyperplastic and neoplastic epithelial lesions of animals. Am J Vet

Res, 45, 1441-1446.

Yu, Q., Lu, Y., Nerurkar, V. R. and Yanagihara, R. (2000). Amplification and analysis of DNA

flanking known sequences of a novel herpesvirus from green turtles with fibropapilloma

Brief report. Arch Virol, 145, 2669-2676.

66

Table 4-1. Number of turtles and their tissues examined in this study.

Healthy turtle Turtle with FP Total

No. of turtle 90 15 105

No. of normal skin 90 14 104

No. of tumor 0 25 25

Table 4-2. Spirorchid infection found by histopathological evaluation (No. of positive/No.

of animals examined)

Healthy turtle Turtle with FP Total

15/90 10/15 25/105

(17 %) (67 %) (24 %)

67

Table 4-3. Comparison of external FP tumors and ISH results.

ISH reaction†

RNA target DNA target No Tumor

location Tumor type INIB*

Standard Amplification Standard Amplification

1 Skin Fibroma - - - - +

2 Conjunctiva Fibropapilloma - - - - +

3 Conjunctiva Fibropapilloma - - - - -












15 Conjunctiva Fibropapilloma + - + - +




19 Skin Fibroma - - - - -

20 Skin Fibroma - - - - -


22 Conjunctiva Fibropapilloma + + + + +

23 Conjunctiva Fibropapilloma + - - + +

24 Conjunctiva Fibropapilloma + + NT + +

25 Skin Fibropapilloma - - - - -

Sub total 4 2 2 3 14

* Intranuclear inclusion bodies in epithelial cells observed by H&E. † In situ hybridization using a riboprobe, antisense FPTHV pol.

NT, not tested.

68

0

1

2

3

Acanthosis Fibroblasts Collagen fibers Mitotic Index*

0

1

2

3

4

5

6

Fibropapilloma

Fibroma

Fig 4-3. Comparison of average lesion scores between fibropapilloma and fibroma types of FP.

Left Y-axis is for acanthosis, fibroblasts, and collagen fiber. Right Y-axis is for mitotic index.

The lesion scores were set as follows: acanthosis - normal 4 to 7 layers of epithelial cells (0),

within 2 fold of normal thickness (1), more than 2 fold but focal (2), and severe and diffuse with

papillary pattern (3); proliferation of fibroblasts - normal (0), scattered (1), local or superficial

(2), and diffuse (3); collagen deposition - normal (0), mild between fibroblasts (1), dense but in

the superficial subepithelial connective tissue (2), and diffuse into deep subepithelial connective

tissue (3).

* Average of the total number of mitoses per 10 high power fields (40X).

69

Fig. 4-1. Fibropapilloma type seen in tumor No.14. Papillary growth of acanthotic epithelial

layer is seen with fibroblast proliferation and collagen deposition in the lamina propria. H&E.

Bar = 100 um

Fig. 4-2. Fibroma type seen in tumor No.11. Smooth thin epithelial layer rests on the

fibrovascular connective tissue composed mainly of diffuse dense collagen fibers with scattered

fibroblasts and few mononuclear inflammatory cells. H&E. Bar = 200 um.

Fig. 4-4. FP (No.22) with INIB was hybridized with antisense riboprobe in standard RNA ISH.

Note focally clustered intranuclear signals in ballooned hyperplastic cells with INIB. ISH.

Hematoxylin counterstain. Bar = 100 µm.

Fig. 4-5. Conjunctival tumor from necropsy turtle. Note intranuclear reactions (arrows) in the

noncornified squamous epithelial cells of a conjunctival mass. ISH with DNA denaturation and

signal amplification. Hematoxylin counterstain. Bar = 100 um.

70

1 2

4 5

71

CHAPTER 5

CONCLUSIONS

This study investigated the clinicopathological effect of fibropapillomatosis (FP) in

turtles and localized the putative causal agent, fibropapillomatosis-associated turtle herpesvirus

(FPTHV), in tumor tissues by in situ hybridization (ISH). To conduct this study, samples were

obtained from juvenile green turtles (Chelonia mydas) in islands of Culebra and Culebrita,

Puerto Rico, where one place (Manglar bay, Culebra) is disease prevalent while the other place

(Culebrita) is less affected.

To examine health status of the disease affected turtles, reference values of hematology,

plasma biochemistry and plasma protein electrophoresis were established within the studied

animal groups. Turtles affected with FP exhibited hyperproteinemia characterized by

hypergammaglobulinemia, suggesting active immunity due to chronic inflammation such as

parasitism and tumors. Between two geographically different groups composed of healthy turtles,

the values were not significantly different, suggesting absence of major health difference

between them.

In this study, the tumors were assigned to either fibropapilloma or fibroma types on the

basis of the tumor morphology. Fibropapilloma types were regarded as earlier form than fibroma

types. Fibropapilloma types had more proliferative epithelium with high cellularity in the

underlying tissue, while fibroma types exhibited smooth and attenuated epithelium and marked

fibrosis composed of fine dense collagen deposition.

72

In situ hybridization technique was used to demonstrate viral proliferation and localize

FPTHV within tumor tissues using a specific riboprobe of viral polymerase gene (pol). We

detected FPTHV viral transcripts (RNA) in 3 of 25 tumors and viral presence (DNA) in 14 of 25

tumors. The signals were confined to the nuclei of acanthotic epithelial cells, while none of them

were present in the attenuated epithelia or subepithelial connective tissue, suggesting far more

virus reside in the epithelial cells than other types of cells. A set of necropsy tissues from a turtle

that died of FP with visceral fibromas were included in this study. Attempts to detect ISH

reactions failed in all internal fibromas from the turtle. Taken all together, these results suggest

that FPTHV DNA is present in epithelial cells and transcriptionally active in some tumors,

specifically in more early and active types, whereas it is in quantities too low in the subepithelial

connective tissue for detection by ISH.

PATHOLOGICAL EVALUATION OF FIBROPAPILLOMATOSIS IN …

Documents

Transcript of PATHOLOGICAL EVALUATION OF FIBROPAPILLOMATOSIS IN …