(CANCER RESEARCH 56. 1418-1425. March 15. 19%|

Partial Tandem Duplication of ALLÕas a Recurrent Molecular Defect in AcuteMyeloid Leukemia with Trisomy II1

Michael A. Caligiuri,2 Matthew P. Strout, Steven A. Schichman, Krzysztof Mrózek, Diane C. Arthur,

Geoffrey P. Herzig, Maria R. Baer, Charles A. Schiffer, Kristiina Heinonen, Sakari Knuutila, Tapio Nousiainen,Tapani Ruutu, AnneMarie W. Block, Philip Schulman, Jens Pedersen-Bjergaard, Carlo M. Croce, and

Clara D. Bloomfield

Division of Medicine [M. A. C., M. P. S.. K. M., G. P. H.. M. R. B.. C. D. fi./ and Departments of Molecular Immunology ¡M.A. C., M. P. S.I and Pathology ¡A.W. B.I RoswellPurk Cancer Institute. Buffalo, New York; Jefferson Cancer Institute and Department of Microbiology and Immunology. Jefferson Medical College of Thomas JeffersonUniversitv. Philadelphia. Pennsylvania IS. A. S., C. M. C.J: Cancer and Leukemia Group B. Chicago. Illinois ¡M.A. C., D. C. A., C. A. S„C. D. B.J; Depanment.s of ClinicalChemistry IK. H.I tinti Internal Medicine ¡T.N.J. Kuopio University Hospital. Kuopio. and Departments o/Medical Genetics ¡S.K.I and Medicine ¡T.K.¡,University of Helsinki.Helsinki. Finland: Department of Medicine. North Shore University Hospital. Manhasset. New York ¡P.S.I; and Department of Hematology. Finsen Center, Copenhagen,Denmark ¡J.P-BJ

ABSTRACT

Gains of a single chromosome are frequent cytogenetic Findings inhuman cancer, but no molecular rearrangement has been consistentlyassociated with any trisomy. In acute myeloid leukemia (AMD, trisomy11 (+ 11) occurring as a sole abnormality is the third most commontrisomy. We have shown that the ALLÕ gene, located at Hq23, can berearranged as a result of a partial tandem duplication in two such cases ofVM1 . To test the hypothesis that the partial tandem duplication of ALL!

is the recurrent molecular defect in cases of AML presenting with +11 asa sole cytogenetic abnormality, we performed Southern analysis and PCRfor defects of ALU in 17 cases of AML and one case of myclodysplasticsyndrome with +11 or +llq but without cytogenetic evidence of a structural abnormality involving Ilq23. Twelve cases (67%) had rearrangement of ALLÕ, including 10 of 11 patients (91%) with +11 as a soleabnormality and 2 of 7 cases (29%) with +11 and other aberrations; allwere classified as FAB Ml or M2. In 10 of the 12 cases, material wasavailable for additional characterization; a partial tandem duplication ofALLJ was detected in each of these 10 cases (100%). Four cases demonstrated previously unreported duplications, two of which were detectableonly by reverse transcription-PCR. Four patients with tin1 I/././ duplica

tion also displayed a loss of material from 7q, suggesting an associationbetween these two Findings. We conclude that the partial tandem duplication of ALLÕis present in most, if not all, cases of AML with +11 as asole abnormality, and can be found in cases of AML with +11 or +llqaccompanied by other cytogenetic abnormalities. The duplication is moreprevalent in AML than was recognized previously in part because its sizeand location vary considerably, requiring a variety of molecular probesfor detection. Our finding of the ALLÕduplication as a consistent defect inpatients with +11 represents the first identification of a speciFic generearrangement associated with recurrent trisomy in human cancer.

INTRODUCTION

Recurrent chromosome translocations found in human acute leuke-

mias usually produce rearranged genes encoding chimeric proteinsthat induce neoplastic transformation (1-4). Five to 10% of adult andpediatrie cases of acute leukemia show translocations between chro-

Received 12/21/95; accepted 1/17/96.The costs of publication of this anide were defrayed in pan by the payment of page

charges. This article must therefore be hereby marked advertisement in accordance with18 U.S.C. Section 1734 solely to indicate this fact.

1Supported by Grants CA-37027. CA-65670. and CA-57974. a Translational ResearchGrant from the Leukemia Society of America. Outstanding Investigator Grant CA-39860from the National Cancer Institute, the Lady Tata Memorial Trust Fund, and the ColemanLeukemia Research Fund. Cancer and Leukemia Group B patients studied in this reportcame from the University of Maryland Cancer Center (Baltimore. MD: Grant CA31983).Duke University (Durham, NC; Grant CA47577). Bowman Gray School of Medicine(Winston-Salem. NC; Grant CA03927). State University of New York Health SciencesCenter at Syracuse (Syracuse. NY; Grant CA2I060), and the University of North Carolina(Chapel Hill, NC; Grant CA47559).

2 To whom requests for reprints should be addressed, at Division of Medicine.

Department of HématologieOncology, Roswell Park Cancer Institute, Elm and CarltonStreets, Buffalo, NY 14263.

mosome 1Iq23 and at least 26 different chromosome partners (4-7),

each of which results in the disruption of a gene at 1Iq23 called ALL!(8, 9), MLL (10), HRX (11), or Htrx (12). The diversity of thetranslocation partners that fuse with ALLÕhas made it difficult tounderstand how each contributes to leukemogenesis as part of theALLÕfusion protein.

Little is known about the pathogenesis of leukemia in patients withAML1 and trisomy. Trisomy 11 occurring as a sole abnormality,

although relatively rare, is the third most common trisomy found inAML (13). Recently, we detected ALLÕgene rearrangements bySouthern analysis in 3 of 4 adults with AML and +11 as a solecytogenetic abnormality (14). Additional material was available inonly two of these patients, and genomic cloning of the ALL! rearrangements revealed a direct tandem duplication of a portion of theALLÕgene spanning exons 2-6 in both cases (15). RT-PCR and DNAsequence analysis showed an in-frame fusion of exon 6 with exon 2,

demonstrating that the partially duplicated ALLÕgene is transcribedinto mRNA capable of encoding a partially duplicated protein.

On the basis of our preliminary work, we hypothesized that thepartial tandem duplication of ALLÕis the recurrent molecular defect incases of AML presenting with +11 as a sole cytogenetic abnormality.In the present report, we have tested this hypothesis by studying ALLÕin AML and MDS with kuryotypes including more than two copies ofllq but without cytogenetic evidence of a structural abnormalityinvolving I Iq23. We show that ALLÕis rearranged in 10 of 11 cases(91%) of AML with +11 as a sole abnormality and in two cases with+ 11 and other aberrations. Of the 10 rearranged cases that hadmaterial available for further analysis, all 10 ( 100%) had evidence forthe partial tandem duplication of ALLÕ,suggesting that this is thecritical molecular event for leukemogenesis.

MATERIALS AND METHODS

Patients. BM or PB containing > 10% blasts was obtained from 18 patients

with AML or MDS who had at least three copies of 1Iq. For 4 patients (UPNs22. 134.1. 137.1. and 138.1) only DNA was available for study; viable cellswere available from the remaining 14 patients. The diagnosis of AML or MDSwas based on standard FAB morphological and cytochemical criteria (Table I ;Refs. 17 and 18). Response criteria were as recommended previously (19).Duration of CR was defined as the interval between the attainment of firstremission and relapse or date of last follow-up if still in CR.

Cytogenetic Analyses. Cytogenetic analyses were performed using standard techniques on the same BM or PB specimens studied molecularly ( 14). Thecriteria used to define a cytogenetic clone and descriptions of karyotypes

'The abbreviations used are: AML, acute myeloid leukemia; +11, trisomy 11;

RT-PCR, reverse transcription-PCR; MDS. myelodysplastic syndrome; BM, bone marrow; PB, peripheral blood; UPN. unique patient number; FAB, French-American-British;

CR. complete remission.

1418

Research. on November 12, 2020. © 1996 American Association for Cancercancerres.aacrjournals.org Downloaded from

PARTIAL DUPLICATION OF ALLÕIN ACUTE MYELOID LEUKEMIA

Table 1 Characteristics of specimens studied

UPNCases

with23C24C134.1969510856137.122C23829CCases

with77138.1110*1

30. 1Diagnosis+

11 as a sole abnormality inatAML-M2AML-M2AML-M2AML-M2AML-M2AML-MIAML-M2AML-M2'AML-M2"AML-MIAML-M2+

11 accompanied byadditionalAML-MIAML-M2'RAEB-TAML-MISpecimen

source"%blastsleast

onecloneBM/DxBM/DxPB/DxBM/DxBM/DxBM/DxBM/DxBM/DxBM/RelBM/DxBM/DxcytogeneticBM/DxPB/DxBM/DxPB/Rel7356807754917544118382abnormalities80141591Karyotype47,XX.+11[16]/46,XX[4]''47,XY,+11[221/46,XY[8]47,XY,+

11[5]/46,XY[8]47,XY,+ll[18]/51,idem,+6.+ 8.+ 10,+13[6]47,XX,-H1[21]47,XY,+ll(20]/46,XY.del(7)(q3?2q3?6)(71/46,XY[3]47.XY.-Hl|ll]/46,XY.del(7)(q32q36)[2]/46,XY[25]''47,XY,+

11[5]/46,XY[20]47,XY,+11[2]/46.XY[17]''47,XY,+11[16]/46,XY[4]47,XX,+11[25]/46,XX[2]47,XY,del(7)(qll.23),

+ll[54]/46,XY[2]49,XX,+8.+ll,-H4[10]/46,XX[13]45.XY,der(5;17)(pl();qlO).

+ll.-19.add(20)(ql3.3)[24]45,XX,del(5)(ql3q33).t(5;8)(q31;ql!),-13,r(?15).

add(17)(pl3),add(l7)(qll).del(20)(qllql3.l)[2]/46.idem.+ marl[3]/46.idem, + mar2[2]/45^t6,idem,-t(5;8),t(12;22)(pl3;ql2-13)[cpl3]/45-48,Õdem,der(2)?ins(2;4)(p25;q25q3l),der(4)?ins(2;4)(p25:q25q31),-t(5;8),add(12)(pl?2), + mar2[cp9]/62,idem, + X,+ l,t(3;6)(pl3;p23),-t(5;8),+del(5)(ql3q33),+6,+8,+9, + 10,+ 11,+ 13,+ 14.-r(?15),+ 15,+ 15, + 16,-add( 17)(pl3),~add(17)(qll), + 17,+ 17,+ add(I9)(pl3),+20, + 21

+ mar4[cp5]/6l.idem, + X.+ 1,l3.1), + del(5)(ql3q33),

).+ 19,-del(20),-add(l7|(pl3),-add(17)(qll),

+20,+21,+22,+mar3|cp3]

Cases with three or more copies of 11q resulting from structural rearrangements107 AML-M2 BM/Dx 44 45.XY,del(3)(p2l),-5,-7.der(8)t(8;?12)(q22;ql?3),

113

30'

AML-M2

AML-M2

BM/Dx

BM/Dx

41

76

add(17)(pll-13),-20,dic(22)(pll), + mar|cpl2]/46.XY[8|46,X,-X.del(5)(qI5q33).del(12)(pll.2pl2-13),der(17)t(X;17)(pll;pll).+ mar[2]/47, idem, der(8)t(8;ll)(p21 :ql3.5-14).+der(8)t(8;ll)(p21 ;ql3.5-14).-del(12),+ l2[32]/44,idem.i(8)(ql0),der(ll)t(ll;13)(pll.2;qll),-del(12),+ 12,- 13,-mar(4]/46,XX[7]46,XY,-7,+der(7;ll)(plO;qlO)[l7]/46,XY[3]

" Dx, diagnosis; Rei, relapse.* Boldface denotes extra chromosome 11 or llq.' Reported in Ref. 14.

Number of cells in each clone reported incorrectly in Ref. 14.'The karyotype at first relapse was 46,XY,del(7)(q21q36)[16]/47.XY, + ll(2]/46,XY(2].^ Three-month history of MDS.* Morphology at diagnosis, at which time karyotype was 47,XY.+11|13]/46.XY|7|.'' One cell with the karyotype 47,XY,-t-ll,i(17)(qlO) present.' Twenty-month history of MDS.'Reported in Ref. 16.

followed the recommendations of the International System for Human Cytogenetic Nomenclature (20).

DNA and RNA Preparation. Genomic DNA was extracted using a standard isolation procedure (21 ), and total cellular RNA was extracted by thawingthe viably frozen cells and placing them into RNAzol (Biotecx Laboratories,Houston, TX) following the manufacturer's directions.

Southern Analysis. Approximately 6 /xg of genomic DNA were digestedto completion with BamHl. Hindlll, or EcoRl. Probes for Southern hybridization, designated B859 and SAS1, have been described (9, 14, 15). The BamHland EcoRl digests were hybridized to the B859 and SAS 1 probes, respectively,whereas the Hindlil digests were hybridized to the B859 probe, stripped, andthen hybridized to the SAS1 probe. Southern blotting, stripping, probe radio-

labeling, and autoradiography were performed by standard techniques (22).RT-PCR and Standard PCR Analysis. PCR primer names, exon location,

and primer sequences are listed in Table 2. The RT-PCR with Primer Set 1 was

performed as described previously (15). For Primer Set 2, designed for thisstudy, RT was performed with primer 4.1R, PCR with 4. l R and 5.3, and nestedPCR with 4.2R and 6.1 under the conditions described previously for PrimerSet 1. RT-PCR was performed with both Primer Sets 1 and 2 in all 14 cases

for which RNA was obtained. Standard PCR with Primer Set 3, also constructed for this study, was performed on genomic DNA using Taq ExtenderPCR additive (Stratagene, La Jolla, CA) according to the manufacturer'sinstructions. The reactions were for 35 cycles (95°Cfor 1 min, 60°Cfor 1 min,

and 72°Cfor 3.5 min), followed by a 10-mtn extension at 72°C.All PCR

products were subsequently analyzed by electrophoresis on 2.0% agarose gels.DNA Sequencing and Sequence Analysis. DNA sequencing was per

formed with an Applied Biosystems Model 373 Stretch DNA sequencingsystem (Perkin-Elmer, Forest City, CA). Programs from the Genetics Com

puter Group system (23) and Dear and Staden (24) were used for DNAsequence analysis. Single-band PCR products were sequenced directly by

Table 2 Oligonucleotidi' primers used for PCR

PrimernameSet

1654c5.3400c6.1Set

24.1R5.34.2R6.1Set

32.0R6.1LocationExon

3Exon5Exon3Exon6Exon

4bExon5Exon4bExon6Exon

2Exon6Primer

sequence(5'-3')AGGAGAGAGTTTACCTGCTCGGAAGTCAAGCAAGCAGGTCACACAGATGGATCTGAGAGGGTCCAGAGCAGAGCAAACAGGCCTTGTTTCTAGTGACAGGGGAAGTCAAGCAAGCAGGTCGGAGCAAGAGGTTCAGCATCGTCCAGAGCAGAGCAAACAGCGCACTCTGACTTCTTCATCGTCCAGAGCAGAGCAAACAG

1419

Research. on November 12, 2020. © 1996 American Association for Cancercancerres.aacrjournals.org Downloaded from

PARTIAL DUPLICATION OF ALL] IN ACUTE MYELOID LEUKEMIA

Table 3 Results of molecular analysis according to cytogenetic group

UPNCases

with2324134.1969510856137.12223829Cases

with77138.1110130.1Cases

with10711330Southern

analysisB859SAS1RT-PCRSite

of fusionPCRprimerset"+

11 as a sole abnormality in at least oneclonePositivePositivePositivePosi

ivePosiivePosiivePosiivePosi

ivePositiveNegativeNegative+

11 accompanied by additionalcytogeneticPositiveNegativeNegativeNegativePositivePositivePositivePositivePositivePositiveNegativeNegativeND*NegativeNegativeabnormalitiesPositiveNegativeND''ND''PositivePositiveND*PositivePositivePositivePositiveND"ND"PositiveNegativePositive''ND*NegativeNegativeExon

6/exon2Exon6/exon2Exon6/exon2'Exon

7/exon2Exon8/exon2*Exon8/exon2''Exon

6/exon4aExon

9/exon2Exon

6/exon2212three

or more copies of 1Iq resulting from structuralrearrangementsNegativeNegativeNegativeNegativeND*ND*PositiveNegativeNegativeExon9/exon 21

" See Table 2. Only the primer set that amplified the fusion transcript is indicated.' No material available. ND. not done.' Determined by standard DNA PCR.' Alternatively spliced exon 7/exon 2 fusion transcript also detected.'' Determined from BM obtained at relapse.

PCR. whereas double-band PCR products were subcloned into the pBluescript

II plasmid vector and then sequenced directly.

RESULTS

Specimens from 18 patients were analyzed (Table 1). Seventeenpatients had AML. All were classified as FAB Ml or M2; two hadAML evolving from an antecedent MDS (UPNs 137.1 and 138.1).One patient (UPN 110) had treatment-related refractory anemia with

excess blasts in transformation. Eleven patients had a clone with +11as the sole cytogenetic abnormality; 4 patients had +11 only inassociation with other abnormalities; and 3 patients had karyotypeswith at least three copies of 1Iq resulting from unbalanced structuralabnormalities involving chromosome 11.

Molecular Analysis of ALLÕGene Rearrangements. All 18 caseswere first studied for evidence of ALLÕgene rearrangement by Southernanalysis (Table 3). Of the 18 cases probed with B859, 10 showedevidence of a rearranged ALL! gene with a single band in addition to agermline band (Figs. 1/4 and Iß).Seven of 9 cases rearranged with theB859 probe also demonstrated ALLÕgene rearrangements using theSASI probe (Figs. 1C and ID). One case rearranged with the B859 probehad insufficient material to study with the SAS 1 probe.

In 14 of the 18 cases, there was material for study by RT-PCR. In nine

cases, a PCR product was amplified; in each instance it was also sequenced. In all nine cases, a partial tandem duplication of ALLÕwasidentified. In each case in which the duplication was identified byRT-PCR, the sequence of the resultant fusion transcript was in frame. In

one additional case (UPN 134.1), the duplication was identified bystandard PCR. Fig. 2A illustrates the transcripts resulting from fourdifferent partial tandem duplications of ALL!. Each transcript contains aunique fusion between two exons. which is indicated in Fig. 2. One set ofoutside and nested primer pairs (Primer Set I, Table 2), was used forRT-PCR amplification of each unique transcript and is also shown in Fig.2A, along with the calculated size of the RT-PCR product. Fig. 2Billustrates the actual nested RT-PCR products amplified from each patient

sample shown in Fig. 24. Fig. 2C details the unique point of exon fusionfor all of the partially duplicated ALLÕfusion transcripts reported in thisseries. In every instance, the fusion between exons was in frame.

There was significant variation in the size of the duplicated region andin the point of fusion. In three patients (UPNs 23, 24, and 134.1),including the two reported previously (15), the duplication of ALL!spanned exons 2-6 without interruption. In two cases (UPNs 95 and108), the duplication of ALL! spanned exons 2-8. Both of these casesalso expressed an alternatively spliced RT-PCR product spanning exons2-7. The alternatively spliced transcript for UPN 108 can be seen as thelower band in the next to last lane of Fig. 2B. In all of the above-described

patients, ALLÕrearrangement could be detected by Southern analysiswith both B859 and SAS1. In the four cases for which RNA wasavailable, both types of duplications could be amplified with Primer Set1 but not Primer Set 2. For UPN 134.1. for which only DNA wasavailable, the duplication could be amplified by standard PCR withPrimer Set 3 (Table 2), which we constructed for this purpose.

UPN 77 expressed a partial duplication of ALLÕspanning exons2-6 with a 2517-bp deletion from the 5' portion of exon 3. This

previously unreported 505-bp RT-PCR product had the same point offusion as in the other patients with duplication of exons 2-6 (Fig. 2C).

The novel duplication was also detected by Southern analysis usingboth B859 and SAS1. However, in contrast to the uninterruptedduplications spanning exons 2-6 described above, the duplication

found in UPN 77, with the deletion in exon 3 from the fusiontranscript, could only be amplified with Primer Set 2 (Table 2), whichwe constructed to detect duplications that do not include exon 3.

UPN 56 had a partial tandem duplication spanning exons 4a-6, the

shortest duplication described to date. Partial DNA sequencing of thegenomic region including exon 4 showed this exon to be composed ofthree smaller exons designated 4a. 4b, and 4c (Fig. 3/4), rather than asingle exon as reported previously (9). A schematic illustration of thisnovel duplication is shown both in Fig. 2C and in Fig. 3/4. The ALLÕduplication was detected by Southern analysis with the B859 probebut not with SAS1 (Fig. 1 and Table 3) because SAS1 recognizes aregion outside of this duplication. Likewise, because exon 3 is notinvolved, the duplication was amplified by RT-PCR with Primer Set

2 but not with Primer Set 1. The location of Primer Set 2 is shownschematically in Fig. 3/4.

UPN 96 expressed a partial tandem duplication spanning exons 2-7

1420

Research. on November 12, 2020. © 1996 American Association for Cancercancerres.aacrjournals.org Downloaded from

PARTIAL DUPLICATION OF ALLÕIN ACUTE MYELOID LEUKEMIA

B H H H B BH

14 kt>

SAS1

I II III II III I I III III

E E E E

Mill I II2 3 4a-c56 7-1112-14 15-17 18 19 20 21

B

8.3 kbgermline

UPNs

NB [22 23 24 77 95 96 108 561 NH

UPNs

N I 23 24 56 77 95 96 108 134.1 I

14 kb 14kb"germline germline -12kb~

4kb _

rearrangedbands

BamHt H/ndlllEcoRI

Fig. i.A. genomic structure of the ALLI gene showing location of BamHl (ß)and//mdlll (//) restriction sites within the involved regions of the gene. Arrow, location of the B859cDNA probe that corresponds to exons 5-11. These exons span the entire breakpoint cluster region of the ALLÕgene. The size of the 8.3-kb germline ALLÕband for the BcimHl digestand the 14-kb germline ALLÕband for the rY/ndlll digest are indicated by the brackets. B. composite Southern analysis of representative ALLÕgene rearrangements detected by B859in adult AML patients with +11. The label above each lane corresponds to the UPN. Blots were examined with the B859 probe after digestion with BamHl (UPNs 22. 23, 24. 77, 95,96, and 108) or Hindlll (UPN 56). NB. normal control for BamHl digest; NH, normal control for Hindlll digest. Germline 8.3-kb (BamHI) and 14-kb (Hindlll) bands are indicated.

Arrows, rearranged bands. C. genomic structure of the ALLÕ gene showing location of the EcoRI (£) restriction site within the involved regions of the gene. Arrow, location of theSAS1 genomic probe located near the 3' end of intron I. The size of the 14-kb germline ALLÕband for the EcoRI digest is indicated. D. blots were examined with the SASI probe

after digestion with EcoRI. N, normal control for EcoRI digest. The 14-kb germline band is indicated. Arrows, rearranged bands.

(Fig. 2C), which has not previously been reported as a single tran

script. Analysis at the genomic level revealed a duplication thatextended from the 3' portion of intron 1 into the 5' portion of intron

8 (Fig. 30), but a duplicated transcript spanning exons 2-8 was not

detected by RT-PCR for unknown reasons. ALL! rearrangement in

this case was detected by both the B859 and the SASI probes onSouthern analysis (Fig. 1), and a 360-bp product was amplified by

RT-PCR using Primer Set 1 (Fig. 2B). The ALLÕ duplication and the

location of Primer Set 1 are shown schematically in Fig. 3ß.

UPN 107 and UPN 238 expressed two different partial duplicationsof ALLÕ spanning exons 2-9, neither of which have been reported

previously. Sequence analysis of the 621-bp amplified RT-PCR prod

uct of UPN 107 showed the duplication to include all of exon 9, whichfused at its 3' end to the 5' end of exon 2 (Fig. 2, B and C). In contrast,

sequence analysis of the 525-bp amplified RT-PCR product of UPN238 showed a deletion of the last 96 bp of the 3' end of exon 9,

creating a point of fusion with exon 2 that was distinct from that of

UPN 107 (Fig. 1C). ALLÕ rearrangement was not detected with the

B859 or SASI probes on Southern analysis in either patient, despite

high percentages of leukemic blasts in their diagnostic specimens. The

reason for this is unknown, but because each patient has a novel

partial tandem duplication of ALLÕ, contamination from another case

is impossible. Both of the novel duplications were amplified byRT-PCR with Primer Set 1.

Correlation of Molecular Findings with Cytogenetic Features.Of 11 patients with a clone with +11 as the sole cytogenetic abnor

mality, 10 (91%) showed rearrangement of ALL!. All eight rearrangedcases studied by standard PCR or RT-PCR showed a fusion indicating

partial tandem duplication of ALLÕ (Table 3). One of four patientswith + 11 accompanied by additional cytogenetic abnormalities in the

same clone (UPN 77) also showed a duplication of ALL!. In thispatient, all 101 cells studied by G-banding or metaphase fluorescence

in situ hybridization showed a del(7)(ql 1.23) in addition to +11.

Interestingly, two of the cases (UPNs 56 and 108) with +11 as a sole

abnormality and the ALLÕ duplication had a second clone comprising

a del(7q) as the sole abnormality (Table 1). In UPN 56, a minor clone

(2 of 38 cells studied) with del(7)(q32q36) found at diagnosis was

replaced at relapse by a predominant clone (16 of 20 cells) with a

deletion of a larger region of 7q, del(7)(q21q36).

One of three patients with structurally rearranged chromosome 11 s

and at least three copies of 1Iq (UPN 107) also had a partial tandem

duplication of ALLÕ. Cytogenetically, this patient showed one normal

chromosome 11 and two chromosome 11s with insertion of uniden

tified material into band p 13. It is of interest that this case also showedmonosomy 7 ( —¿�7). The association between the partial tandem du

plication of ALLÕ and loss of chromosome 7q did not reach statisticalsignificance by a two-sided Fisher's exact test. Notably, molecular

rearrangement of ALLÕ was not observed in either case (UPNs 130.1and 113) in which +11 or extra llq was present only in sidelines.

There was no correlation between the specific ALLÕ duplication or

point of fusion and cytogenetic findings.

Correlation of Molecular Findings with Clinical Features. Clin

ical characteristics of the 12 patients with ALLÕ rearrangements are

shown in Table 4. The patients tended to be older (median age, 64years; range, 22-69) and predominantly male (83%). All except one

(UPN 137.1) presented with de novo AML. Most cases were mor

phologically FAB M2 (75%). Almost all patients presented withanemia (median hemoglobin. 9.6 g/dl; range, 4.5-13.5). Overall, the

patients presented with relatively high platelet counts; 42% had countsgreater than 100 X 109/liter (median, 90 X 109/liter; range, 17-157).

1421

Research. on November 12, 2020. © 1996 American Association for Cancercancerres.aacrjournals.org Downloaded from

PARTIAL DUPLICATION OF ALLÕIN ACUTE MYELOID LEUKHMIA

228 bp

UPN23

UPNs96 & 108

UPN 108

2 3 4562 3 456| | |

tandem duplication of exons 2-6

360 bp

2 3 45672 3 4567I i |tandem duplication of exons 2-7

467 bp

2 3 456782 3 45678

tandem duplication of exons 2-8

5' CC

PrExon

6A

AAA GAA AAGD Lys Glu LysExon

2UPN23UPN

24UPN77GAT

GAG CAÕ TTC 3'

Asp Glu Gin Phe

Exon 8

5' GGG CAT GTA GAG

Gly His Val Glu

Exon 2 UPN 95UPN 108

GAT GAG CAA TTC 3'

Asp Glu Gin Phe

Exon 7

5' GTG GAG TTT AAG

Val Asp Phe Lys

Exon 2

GAT GAG CAA TTC 31

Asp Glu Gin Phe

UPN 96UPN 95 (Alt Splice)UPN 108 (Alt Splice)

UPN 107

621 bp

2 3 4567892 3 456789

Exon 6

5' CCA AAA GAA AAG

Pro Lys Glu Lys

Exon 4

GGT CAA GAA AGT 31

Gly Gin Glu Ser

UPN 56

B

tandem duplication of exons 2-9

UPN

Exon 9

N l 23 96 108 107 I

5' CAG GCT ACA AAG

Gin Ala Thr Lys

Exon 2

GAT GAG CAA TTC 3'

Asp Glu Gin Phe

Exon 9

5' TTT TGT TTA GAG

Phe Val Leu Glu

Exon 2

UPN 107

UPN 238

GAT GAG CAA TTC 31

Asp Glu Gin Phe

228

Fig. 2. Analysis of the fusion transcript generated in AML patients with 4-11 and the partial tandem duplication at ALLÕ.A, schematic illustration of the unique transcripts resulting from

four different partial tandem duplications of ALLÕ.Euch transcript contains a unique fusion between two exons, which is in the middle of the duplication and is indicated by the change fromgray to white. One set of outside and nested primer pairs (Primer Set 1) was used for RT-PCR amplification of each unique transcript and is shown with the calculated size of each RT-PCRproduct. B. actual nested RT-PCR products amplified from each patient sample shown in A using Primer Set 1 (UPNs 23. 96, 108, and 107). N, normal control. Bands ranging from 22S to621 hp were detected on an ethidium-stained agarose gel. The label above each lane corresponds to the UPN. The lower band seen in the lane of UPN 108 identifies an alternatively splicedproduct (see "Results"). C DNA sequence analysis of PCR products from six of the seven different ALLÕin frame exon fusions. Right. UPNs identify cases that have each of the fusions shown.

UPN 77 is distinct in its deletion of a 2,517-bp portion of exon 3. not in its point of fusion between exons 6 and 2 (not shown). Alt. alternative. Amino acid translation is shown beneath theDNA sequence. Different exon fusions result from the variability in the portion oíALLÕthat is duplicated within the gene and from alternative splicing of fusion transcripts (see "Results").

Presenting leukocyte count varied greatly, ranging from 0.7 to All patients received intensive induction therapy. Only six (50%)112.5 x 10'Vliter (median, 18.4). The majority (58%) presented with achieved a CR, although three others achieved CR from second-line

70% or more circulating blasts, but one patient had no circulating induction therapy. The median CR duration was only 276 days, butblasts detected (median, 83%; range, 0-95%). one patient continued in initial CR at 2813 days. Median survival was

1422

Research. on November 12, 2020. © 1996 American Association for Cancercancerres.aacrjournals.org Downloaded from

PARTIAL DUPLICATION OF ALLÕIN ACUTE MYELOID LEl'KEMIA

10kb

B H H H B H B

5'

I III I •¿�II2 3 4a-c56 4a-c 56 78 9-13 14 15-17 18 19

I I I

tandem duplication

20 21

KHI-4a 4b 4c 5 6

B

BHH HBH HB BH

5' •¿�

10kb

I III M II2 3 4a-c5678 2 3 4a-c5678 9-13 14 15-17 18 19 20 21

tandem duplication

5.3 6.1

4a 4b 4c 5 6 78 2

400c 654c

HHHOHH"3 4a 4b 4c 5 6 78

1 kb

Fig. 3. Proposed structure of the ALLÕgene rearrangement. A. the partial tandem duplication oíALLÕin UPN 56 involves a portion of the gene spanning exons 4a-6 indicated by the white

region. The region of the partial tandem duplication oíALLÕis enlarged to indicate the location of the outside PCR Primer Set 2 (5.3 and 4.1R) and the nested PCR Primer Set 2 (6.1 and 4.2R).The precise fusion point within the intronic region between exons 6 and 4a has not been determined. B. the duplication of ALLÕin UPN % involves a portion of the gene that extends fromthe 3' portion of intron I into the 5' portion of intron 8. The region of the duplication is enlarged to indicate the location of the outside PCR Primer Set I (5.3 and 654c) and the nested PCR

Primer Set 1 (6.1 and 4<X)c).The precise fusion point between intron 8 and intron I has not been determined. Vertical lines and boxes numbered 1-21 indicate exons. H. Hindi 11:B. BamHl.

339 days. There were no obvious correlations between specific mo- cases. This extends our original observation of ALLÕrearrangement in

lecular findings and clinical features.

DISCUSSION

Trisomy 11 occurring as a sole abnormality is the third mostcommon trisomy in AML (13). In the current report, we have detectedALLÕ rearrangement by molecular analysis in 91% of such AML

3 of 4 cases (14) to 10 of 11 cases and of the partial tandemduplication from 2 ( 15) to 8 cases with +11 as a sole abnormality. Theduplication has been found in 100% of/4LZ./-rearranged cases with

material available for study. Thus, we have now established a strongcorrelation between the presence of +11 as a sole abnormality inAML and the ALLÕduplication. This suggests that a novel molecular

1423

Research. on November 12, 2020. © 1996 American Association for Cancercancerres.aacrjournals.org Downloaded from

PARTIAL DUPLICATION OF ALL! IN ACUTE MYELOID LEUKEMIA

Table 4 Clinical characteristics of patients with molecular rearrangements of ALLÕ"

UPN2324134.1969510856137.12223877107Age646747516963694267226443SexFMMMFMMMMMMMFABM2M2M2M2M2MlM2M2M2MlMlM2Hgb(g/dl)4.59.412.713.57.58.09.88.68.09.89.710.9WBC(X109/l)35.226.41.620.53.0112.529.616.20.77.433.91.0%PB

blasts9468807399583301288910Pits(X109/l)437014117157491

12121102918877Induction

regimen'HiDAC/Ida'7

+3"DAT'7

+3rf7+3*HiDAC/Ida'HiDAC/Ida'DAT7

+3"7+3dAC/lda/6TC/HiDAC/Ida'CRachieved

'NoNoYesNoNoYesNoNoYesYesYesYesDurationof

CR(days)'"2813

+149266928286141Survival

(days)1215142840

+434201782632027192693

+414231

" Clinical and laboratory characteristics at diagnosis.'' Indicated are initial induction regimen, whether it resulted in a CR. and. if so. duration of that CR.' High-dose cytarabine (HiDAC) and idarubicin (Ida) as described in reference 25.' Cytarabine and daunorubicin as described in reference 26.'' Daunorubicin (50 mg/m2/day) on days 1, 3, and 5; 100 mg/m2/day cytarabine for 7-9 days; and 75 mg/m2 6-thioguanine twice a day for 7-9 days.'Cytarabine (100 mg/irT/day) for 7 days; 12 mg/in~/day idarubicin on days I, 3. and 5; and 75 mg/irr 6-thioguanine twice a day for 7 days.

mechanism for leukemogenesis is operative in patients with thiscytogenetic abnormality. Recently, Bernard et al. (27) have confirmedour results in two cases. To our knowledge, the partial tandemduplication of ALL! represents the first consistent rearrangement of aspecific gene associated with recurrent trisomy in acute leukemia, andindeed in any human cancer. The fact that the ALLÕduplication wasalso found in cases with + 11 and other chromosome changes supportsthe notion that this molecular defect is more prevalent in AML thanwas recognized previously.

The ALL! duplication we reported previously in two patients with+11 represented a fusion between exons 6 and 2 (15). Bernard et al.(27) identified a fusion between exons 8 and 2 in one case of AMLwith +11, a duplication we reported previously in an AML patientwith normal cytogenetics (28). In this study, we identified an additional four novel partial tandem duplications of ALLÕ.Thus, in AMLwith +11, at least 7 types of duplications have been identified in 12cases studied, suggesting that additional variations in the duplicationare likely to be found in this cytogenetic group of patients.

The majority of the ALL! duplications characterized to date involveexon 2, and the transcript can be amplified with Primer Set 1. Ininstances in which RNA is not available, we have now developed astandard PCR primer set (Set 3) that allows detection of some duplications spanning exons 2-6. This report also identifies a novel transcript that duplicates exons 2-6 but omits a portion of exon 3 and. in

another case, a novel transcript that establishes that the duplication ofALL! does not have to involve exon 2. We report here a new primerset (Set 2) that allows detection of fusion transcripts such as these, inwhich both exons 2 and 3 or only exon 3 are not duplicated. Finally,we describe the first two cases of AML with the partial tandemduplication of ALL! that are detectable by RT-PCR but not by

Southern analysis. These data further emphasize that the partial duplication within the ALL! gene is likely to be present in all patientswith AML and +11 as a sole abnormality, but because of variation, itsdetection in AML may increase only as more molecular tools becomeavailable.

In all seven cases of AML with +11 and ALLÕrearranged onSouthern analysis with both the B859 and SAS1 probes, the partialduplication of ALLÕwas identified by sequencing RT-PCR or PCR

products. Thus, although the duplication can be seen in the absence ofALL! gene rearrangement by Southern analysis, to date, rearrangement of ALL I detected by both of these two probes on Southern hasbeen diagnostic of the duplication. Additional cases must be studied tofurther evaluate the specificity of this observation.

Sequence analysis of RT-PCR products from two patients identified

alternatively spliced transcripts generated from a partial duplication

spanning exons 2-8. In both instances, the alternatively spliced transcript spanned exons 2-7. This confirms our earlier observation made

in an AML patient with the partial duplication and a normal karyotype(28), and that reported in an AML patient with +11 as a soleabnormality by Bernard et al. (27). Alternative splicing of bothnormal ALLÕtranscripts and rearranged ALL! transcripts resultingfrom reciprocal translocations has been reported previously (29, 30).

Two patients with +11 also had an unrelated clone with a del(7q).The finding of cytogenetically unrelated clones in AML is rare,constituting 1.1% of karyotypically abnormal cases (31). However,this phenomenon appears unusually common in patients with anisolated +11: 8 of 57 (14.0%) cases (including those reported hereand in Ref. 13) had an independent clone or clones, 50% of whichcontained a del(7q) or -7. The high incidence of karyotypically

unrelated clones among patients with solitary +11 could be explainedby the existence of parallel routes of clonal evolution of cells with thepartial tandem duplication of ALLÕ.If true, this would mean thatclones cytogenetically perceived as independent are in fact derivedfrom the same ancestor cell in which the tumor-initiating event was

the duplication oíALLÕ.Although variable, each of the seven distinct fusion transcripts

resulting from an ALLÕduplication has thus far been in frame andencoded the amino-terminal region of the ALLÕprotein that containsthe AT-hook and DNA methyltransferase motifs (11, 32). The com

mon feature of the partial tandem duplication oíALLÕand the ALLÕrearrangements generated by reciprocal translocations appears to bethe uncoupling of the amino-terminal domains of ALLÕ from the

remainder of the ALLÕprotein. This suggests that: (a) the ALLÕgenecan, in some instances, play a critical role in leukemogenesis on itsown, without any contribution from other translocated genes as previously thought; and (b) abnormal ALLÕ proteins may exert theirmalignant action through a dominant negative mechanism involvingthe formation of inactive ALLÕprotein complexes. The identificationof the amino-terminal region of ALLÕas critical for leukemogenesis

may provide a common site for novel therapeutic approaches that willtarget the ALLÕgene.

It is significant that the number of variable partial tandem duplications of ALL! suggests that routine diagnosis of the molecular defectwill not be possible by Southern analysis with the currently availableprobes. To date, all such fusion transcripts have been detected bynested RT-PCR using one of two primer sets listed in Table 2. but asadditional duplications are detected, it is likely that additional primersets will be required. The primer sets constructed thus far should beuseful not only in the identification of the partial tandem duplicationof ALLÕbut also in the detection of minimal residual disease after

1424

Research. on November 12, 2020. © 1996 American Association for Cancercancerres.aacrjournals.org Downloaded from

PARTIAL DUPLICATION OF ALLÕIN ACUTE MYELOID LEUKEMIA

induction chemotherapy in these patients. The prognosis of AMLpatients with the ALLÕduplication appears to be similar to that ofpatients with reciprocal chromosome translocations involving ALLÕinterms of the overall poor disease-free survival after conventional

chemotherapy (7, 33, 34). Detection of the fusion transcript resultingfrom the partial tandem duplication of ALL! during CR may thereforeassist in applying additional treatment options.

ACKNOWLEDGMENTS

We are indebted to Christine Wick for preparation of the manuscript. LaurieAnn Ford and Linda Regal for assistance with data collection, and PamelaEvans and Eileen Healey for tissue procurement. We thank our colleagues atRoswell Park Cancer Institute. Kuopio University Hospital, the University ofHelsinki, and the Cancer and Leukemia Group B for assisting in the study andmanagement of the patients in this report. We also thank Professor Albert dela Chapelle and Dr. Lynne Maquat for helpful discussions.

REFERENCES

1. Croce. C. M. Origins of Human Cancer: A Comprehensive Review, pp. 527-542.

Cold Spring Harbor, NY: Cold Spring Harbor Laboratory. 1991.2. Heim, S., and Mitelman. F. Cancer Cytogenetics. Ed. 2. New York: Wiley-Liss, Inc.,

1995.3. Rabbits. T. H. Chromosomal translocations in human cancer. Nature (Lond.). 372:

143-149, 1994.

4. Sandberg, A. A. The Chromosomes in Human Cancer and Leukemia. Ed. 2. NewYork: Elsevier Science Publishing, Inc., 1990.

5. Mitelman, F.. Kaneko. Y.. and Berger. R. Report of the Committee on ChromosomeChanges in Neoplasia. In: A. J. Cuticchia and P. L. Pearson (eds.). Human GeneMapping, 1993: A Compendium, pp. 773-812. Baltimore: The Johns HopkinsUniversity Press, 1994.

6. Raimondi. S. C. Current status of cytogenetic research in childhood acute lympho-blastic leukemia. Blood, 81: 2237-2251, 1993.

7. Thirman. M. J., Gill. H. J.. Burnett, R. C., Mbangkollo, D., McCabe, N. R., Koba-yashi, H. Ziemin-van der Poel. S., Kaneko. Y., Morgan. R.. Sandberg. A. A.,

Chaganti. R. S. K.. Larson, R. A.. LeBeau, M. M., Diaz, M. O., and Rowley, J. D.Rearrangement of the MLL gene in acute lymphoblastic and acute myeloid leukemiaswith Ilq23 chromosomal translocations. N. Engl. J. Med., 329: 909-914, 1993.

8. Cimino, G., Moir, D. T., Canaani, O., Williams, K., Crist, W. M.. Katzav, S.,Cannizzaro. L.. Lange B., Nowell., P. C.. Croce. C. M., and Canaani, E. Cloning ofALL-I, the locus involved in leukemias with the 1(4:11)(q2l;q23). t(9:ll)(p22:q23),and t(I I;l9)(q23;pl3) chromosome translocations. Cancer Res., 57: 6712-6714,1991.

9. Gu, Y.. Nakamura. T.. Alder. H.. Prasad. R., Canaani. O., Cimino. G.. Croce. C. M.,and Canaani. E. The t(4;ll) chromosome translocation of human acute leukemiasfuses the ALL-1 gene, related to Drosophila Iriîhorax.to the AF-4 gene. Cell. 71:701-708, 1992.

10. Ziemin-van der Poel, S., McCabe. N. R., Gill, H. J.. Espinosa, R.. Patel. Y.. Harden.

A.. Rubineli, P., Smith, S. D.. Le Beau. M. M., Rowley, J. D.. and Diaz, M. O.Identification of a gene. MLL. that spans the breakpoint in Ilq23 translocationsassociated with human leukemias. Proc. Nati. Acad. Sci. USA, 88: 10735-10739.1991.

11. Tkachuk, D. C., Kohler. S., and Cleary. M. L. Involvement of a homolog ofDrosophila trithorax by 1Iq23 chromosomal translocations in acute leukemias. Cell,71: 691-700, 1992.

12. Djabali, M., Selleri, L., Parry, P., Bower, M., Young, B. D., and Evans, G. A. AIrithorax-like gene is interrupted by chromosome I Iq23 translocations in acuteleukaemias. Nat. Genet., 2: 113-118, 1992.

13. Mitelman, F. Catalog of Chromosome Aberrations in Cancer, Ed. 5. New York:Wiley-Liss, Inc., 1994.

14. Caligiuri, M. A.. Schichman, S. A., Strout, M. P.. Mrozek, K.. Baer. M. R., Frankel.S. R., Barcos, M., Herzig, G. P., Croce. C. M., and Bloomfield, C. D. Molecularrearrangement of the ALL-1 gene in acute myeloid leukemia without cytogeneticevidence of 1Iq23 chromosomal translocations. Cancer Res.. 54: 370-373, 1994.

15. Schichman, S. A., Caligiuri. M. A., Gu. Y., Strout. M. P.. Canaani. E.. Bloomfield.C. D., and Croce, C. M. ALL-1 partial duplication in acute leukemia. Proc. Nati. Acad.Sci. USA, 91: 6236-6239. 1994.

16. Pedersen-Bjergaard, J.. Janssen. J. W. G.. Lyons. J., Philip. P.. and Bartram, C. R.

Point mutation of the ran protooncogenes and chromosome aberrations in acutenonlymphocytic leukemia and preleukemia related to therapy with alkylating agents.Cancer Res., 48: 1812-1817, 1988.

17. Bennett, J. M., Catovsky. D., Daniel, M. T., Danier. M. T.. Flandrin, G.. Gallon.D. A. G.. Gralnick. H. R.. and Sultan. C. Proposed revised criteria for the classification of acute myeloid leukemia. A report of the French-American-British Cooperative Group. Ann. Intern. Med., 103: 620-625. 1985.

18. Bennett. J. M.. Catovsky, D., Daniel. M. T.. Flandrin. G.. Galton. D. A.. Gralnick.H. R.. and Sultan. C. Proposals for the classification of the myelodysplastic syndromes. Br. J. Haematol.. 51: 189-199. 1982.

19. Cheson, B. D.. Cassilelh. P. A.. Head. D. R.. Schiffer. C. A.. Bennett. J. M..Bloomfield. C. D.. Brunning. R.. Gale. R. P.. Grever. M. R.. Keating, M. J.. Sawitsky.A.. Stass, S.. Weinstein. H., and Woods. W. G. Report of the National CancerInstitute-sponsored workshop on definitions of diagnosis and response in acutemyeloid leukemia. J. Clin. Oncol., 8: 813-819. 1990.

20. Mitelman. F. (ed). Guidelines for Cancer Cytogenetics: Supplement to an International System for Human Cytogenetic Nomenclature. Basel: S. Karger AG. 1991.

21. Gustincich. S.. Manfioletti. G.. Del Sal, G., and Schneider. C. A fast method forhigh-quality genomic DNA extraction from whole blood. Biotechniques //.- 298-

301. 1991.22. Sambrook. J.. Fritsch. E.. and Maniatis, T. Molecular Cloning: A Laboratory Manual.

Ed. 2. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory. 1989.23. Devereux, J.. Haeberli. P.. and Smithies. O. A comprehensive set of sequence analysis

programs for the VAX. Nucleic Acids Res., 12: 387-395, 1984.24. Dear. S.. and Staden. R. A. Sequence assembly and editing program for efficient

management of large projects. Nucleic Acids Res.. 19: 3907-3911. 1991.25. Baer. M. R.. Christiansen, N. P.. Frankel, S. R.. Brunetto. V. L.. Mrózek. K..

Bloomfield. C. D.. and Herzig. G. P. High dose cytarabine. idarubicin. and granulo-cyte colony-stimulating factor remission induction therapy for previously untreated denovo and secondary adult acute myeloid leukemia. Semin. Oncol.. 20 (Suppl. 8):6-12, 1993.

26. Mayer. R. J., Davis, R. B.. Schiffer. C. A.. Berg. D. T.. Powell. B. L.. Schulman, P.,Omura. G. A.. Moore, J. O.. Mclntyre. O. R., and Frei. E.. III. Intensive postremissionchemotherapy in adults with acute myeloid leukemia. N. Engl. J. Med.. 331: 896-903, 1994.

27. Bernard. O. A.. Romana. S. P.. Schichman. S. A.. Mauchauffé.M.. Jonveaux. P., andBerger. R. Partial duplication of HRX in acute leukemia with trisomy 11. Leukemia(Baltimore). 9: 1487-1490, 1995.

28. Schichman, S. A., Caligiuri, M. A., Strout, M. P.. Carter. S. L.. Gu, Y.. Canaani. E.,Bloomfield, C. D.. and Croce. C. M. ALL-1 tandem duplication in acute myeloidleukemia with a normal karyotype involves homologous recombination between Ahielements. Cancer Res.. 54: 4277-4280. 1994.

29. Domer. P. H., Fakharzadeh. S. S., Chen, C-S.. Jockei, J.. Johansen, L.. Silverman,G. A., Kersey, J. H.. and Korsmeyer. S. J. Acute mixed-lineage leukemia t(4:11 )(q21 ;q23) generates an MLL-AF4 fusion product. Proc. Nati. Acad. Sci. USA. 90: 7884-

7888, 1993.30. Mbangkollo. D.. Burnett. R.. McCabe. N.. Thirman. M., Gill. H.. Yu. H.. Rowley. J,

D., and Diaz. M. O. The human MLL gene: nucleotide sequence, homology to theDrasophila trx zinc-finger domain, and alternative splicing. DNA Cell Biol., 14:475-483. 1995.

31. Heim. S., and Mitelman. F. Cytogenetically unrelated clones in hematological neoplasms. Leukemia (Baltimore). 3: 6-8. 1989.

32. Ma. Q., Alder, H.. Nelson, K. K., Chatterjee. D., Gu. Y.. Nakamura, T., Canaani, E.,Croce. C. M.. Siracusa, L. D.. and Buchberg. A. M. Analysis of the murine All-1 genereveals conserved domains with human ALL-1 and identifies a motif shared withDNA methyltransferases. Proc. Nati. Acad. Sci. USA. 90: 6350-6354, 1993.

33. Chen, C-S.. Sorensen. P. H. B.. Domer. P. H., Reaman. G. H., Korsmeyer, S. J..Heerema, N. A-, Hammond. G. D.. and Kersey. J. H. Molecular rearrangements onchromosome 1Iq23 predominate in infant acute lymphoblastic leukemia and areassociated with specific biologic variables and poor outcome. Blood. XI: 2386-2393.1993.

34. Heerema. N. A.. Arthur. D. C.. Sather. H.. Albo. V.. Feusner. J.. Lange. B. J..Steinherz, P. G.. Zeltzer. P.. Hammond. D., and Reaman G. H. Cytogenetic featuresof infants less than 12 months of age at diagnosis of acute lymphoblastic leukemia:impact of the 1Iq23 breakpoint on outcome. A report of the Children's Cancer Group.

Blood. 83: 2274-2278. 1994.

1425

Research. on November 12, 2020. © 1996 American Association for Cancercancerres.aacrjournals.org Downloaded from

1996;56:1418-1425. Cancer Res   Michael A. Caligiuri, Matthew P. Strout, Steven A. Schichman, et al.   Defect in Acute Myeloid Leukemia with Trisomy 11

as a Recurrent MolecularALL1Partial Tandem Duplication of

  Updated version

  http://cancerres.aacrjournals.org/content/56/6/1418

Access the most recent version of this article at:

   

   

   

  E-mail alerts related to this article or journal.Sign up to receive free email-alerts

  Subscriptions

Reprints and

  .pubs@aacr.orgDepartment at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

  Permissions

  Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://cancerres.aacrjournals.org/content/56/6/1418To request permission to re-use all or part of this article, use this link

Research. on November 12, 2020. © 1996 American Association for Cancercancerres.aacrjournals.org Downloaded from