p63 and potential p63 targets in squamous cell carcinoma of the head and neck

UMEÅ UNIVERSITY MEDICAL DISSERTATIONS New Series No.1148 ISSN 0346-6612 ISBN 978-91-7264-473-1

p63 and potential p63 targets in squamous cell carcinoma of the head and neck

Linda Boldrup

Department of Medical Biosciences, Pathology

Umeå University, Sweden Umeå 2008

In memory of my grandfather

CONTENTS ABBREVIATIONS 6 ABSTRACT 7 POPULÄRVETENSKAPLIG SAMMANFATTNING 9 ORIGINAL ARTICLES 10 INTRODUCTION 11

Squamous cell carcinoma of the head and neck 11 Diagnosis and treatment 12 Molecular mechanisms behind SCCHN 12 The p53 family 13 Structure and regulation of p53 13 p53 in cancer 14

Structure and regulation of p63 15 p63 in epithelial development 16 Mutations in the human p63 gene 18 p63 in cancer 19 p73 19

Proteins connected to p63 and/or SCCHN 20 β-catenin and PP2A 20

CD44 21 Cyclooxygenase 2 (Cox-2) 22 Epidermal growth factor receptor (EGFR) 23 Keratins 23

AIMS 25 MATERIALS AND METHODS 26 Patients and specimens 26 Protein extraction 26 Immunoblot analysis and quantification 28 Cell transfections 29 Stable transfections 29

Transient transfections 30 RNA extraction 30

cDNA synthesis 30 PCR 31 Nested PCR 31 Quantitative PCR 31 Semi-quantitative PCR 31 Microarray 32 Chromatin immunoprecipitation (ChIP) 33 Immunohistochemistry 33 RESULTS AND DISCUSSION 34

Expression of p63, Cox-2, EGFR, β-catenin and PP2A in SCCHN patients and in oral mucosa from smokers (Paper I) 34

Expression of Cox-2, EGFR, β-catenin and PP2A in SCCHN patients and smokers/non-smokers 34 p63 expression in smokers/non-smokers and SCCHN patients 34 Protein expression in normal tissue adjacent to the tumours compared to normal tissue from non-smoking individuals 35

Expression of p53 isoforms in SCCHN (Paper II) 35 Various p53 isoforms at RNA level in SCCHN 36

Detection of in vitro translated and endogenously expressed p53 proteins 36 p53 isoform expression in FaDu cells 37

Over-expression of p63 in FaDu cells (Paper III) 37 Expression of p63 isoforms 37 Establishment of cell lines stably expressing p63 38 Potential p63 targets (Paper III and IV) 38 Cox-2 a potential target of p63 38

Expression and regulation of CD44 in FaDu cells 39 p63 regulates the expression of keratins 39 GENERAL DISCUSSION 41 CONCLUSIONS 44 ACKNOWLEDGMENTS 45 REFERENCES 48

ABBREVIATIONS ADULT Acro-dermato-ungual-lacrimal-tooth syndrome AEC Ankyloblepharon-ectodermal defects-cleft lip/palate syndrome APC Adenomatous polyposis coli AR Amphiregulin cDNA Complementary DNA ChIP Chromatin immunoprecipitation Cox Cyclooxygenase DBD DNA-binding domain EEC Ectrodactyly, ectodermal dysplasia and cleft lip/palate syndrome EGF Epidermal growth factor EGFR Epidermal growth factor receptor GSK3β Glycogen synthase kinase- 3β HER-1 Human epidermal factor 1 HPV Human papilloma virus LMS Limb mammary syndrome mdm Murine double minute miRNA MicroRNA NF-κB Nuclear factor- kappa b NLS Nuclear localization signal PCR Polymerase chain reaction PP2A Protein phosphatase 2A RE Response element RHS Rapp-Hodgkin syndrome RT-PCR Reverse transcriptase polymerase chain reaction SAM Sterile alpha motif SCC Squamous cell carcinoma SCCHN Squamous cell carcinoma of the head and neck SHFM Split hand/foot malformation STAT3 Signal transducer and activator of transcription SUMO-1 Small ubiquitin-like Modulator 1 TA Transactivation TGF-α Transforming growth factor- alpha TID Terminal inhibitory domain TNM Tumour-Node-Metastasis

6

ABSTRACT Squamous cell carcinoma of the head and neck (SCCHN), the 6th most common cancer worldwide, has a low 5-year survival. Disease as well as treatment often causes patients severe functional and aesthetic problems. In order to improve treatment and diagnosis at earlier stages of tumour development it is important to learn more about the molecular mechanisms behind the disease. p63, an important regulator of epithelial formation, has been suggested to play a role in the development of SCCHN. Six different isoforms of p63 have been found and shown to have various functions. The aim of the studies in this thesis was to learn more about the role of p63 and proteins connected to p63 in SCCHN. Expression of p63, Cox-2, EGFR, β-catenin, PP2A and p53 isoforms was mapped in tumours and normal tumour adjacent tissue from patients with SCCHN using western blot or RT-PCR. Results showed no significant difference between tumours and normal tumour adjacent tissue concerning expression of EGFR and β-catenin. Cox-2 and PP2A showed significantly higher expression in tumours while p63 was more expressed in normal tumour adjacent tissue. However, expression of all these proteins in normal tumour adjacent tissue differed from tissue from disease-free non-smoking individuals. Smoking in itself did not affect expression of these proteins. The p53 isoforms p53, p53β, p53γ, ∆133p53, ∆133p53β and ∆133p53γ were expressed at RNA level in samples both from tumours and normal tumour adjacent tissue, though most of them at fairly low levels. The functional properties of the different p63 isoforms have not been fully mapped. By establishing stable cell lines over-expressing the different p63 isoforms we investigated their specific effect on tumour cells from SCCHN. Only the ∆Np63 isoforms could be stably over-expressed, whereas no clones over-expressing TAp63 could be established. Using microarray technique, cell lines stably expressing the ∆Np63 isoforms were studied and CD44, Keratins 4, 6, 14, 19 and Cox-2 were found to be regulated by p63. In conclusion, the present project adds new data to the field of p63 and SCCHN. For example, we have shown that clinically normal tumour adjacent tissue is altered compared to normal oral mucosa in non tumour patients, and that smoking does not change expression of p63, Cox-2, EGFR, β-catenin or PP2A in oral mucosa. Novel p53 isoforms are expressed in SCCHN, and even though levels are very low they should not be overlooked. Furthermore, CD44, keratins 4, 6, 14, 19 and Cox-2 were identified as p63 targets in SCCHN.

7

POPULÄRVETENSKAPLIG SAMMANFATTNING Cancer är en samlingsterm för elakartade tumörer och den näst vanligaste dödsorsaken i Sverige. Vår kropp består av 10 000 miljarder celler av olika typer vilka hela tiden förnyas och delar på sig. När den mekanism som sköter regleringen av celldelning inte fungerar kan tumörer uppkomma. Cancer kan bildas i de flesta olika celltyper och organ och det finns mer än 200 olika typer av cancer. Av tumörer som uppkommer i huvud- och halsområdet uppstår 90% i ytskiktet, det så kallade skivepitelet, dessa tumörer kallas följaktligen ”skivepitelcancer i huvud- och halsregionen” (SCCHN). Detta är den 6:e vanligaste cancerformen i världen och i Sverige får ungefär 500 personer diagnosen varje år. Tyvärr är överlevnaden fortfarande låg och endast cirka 50% av patienterna lever 5 år efter diagnos. Såväl sjukdomen som behandlingen kan ge patienterna svåra funktionella och estetiska problem, som t.ex. ät- och talsvårigheter. Ofta ställs diagnosen i ett sent skede av tumörutvecklingen vilket försämrar prognosen. För att kunna ställa diagnos tidigare och för att kunna förutsäga vilken behandling som passar bäst för patienten är det viktigt att förstå mekanismen bakom denna sjukdom. Projekten sammanfattade i denna avhandling har genom olika metoder och modellsystem ökat vår kunskap om mekanismerna bakom SCCHN. Många av kroppens funktioner styrs med hjälp av proteiner. Proteinet p63 är viktigt för att bilda ytskiktet, det så kallade skivepitelet, vilket bygger upp bl.a. vår hud och munslemhinna. En orsak till defekter som gomspalt och harmynthet är att p63 inte fungerar normalt. p63 har också föreslagits vara inblandat i utvecklingen av SCCHN och studier av detta protein har varit centrala i avhandlingsarbetet. Några viktiga iakttagelser som gjorts är bland annat att vävnad som ligger nära SCCHN- tumörer och kliniskt ser normal ut inte är normal i fråga om innehåll av olika proteiner. Detta är en viktig upptäckt då denna typ av vävnad ofta används som kontrollvävnad i olika försök. Vidare verkar rökning, som är en riskfaktor för att drabbas av SCCHN, inte påverka produktionen av en del proteiner som man vet är inblandade i utvecklingen av SCCHN. Vårt material är dock alltför begränsat för att säkert kunna uttala sig om kopplingen mellan rökning och cancer. Det finns sex olika varianter av p63 vilka har olika funktion. För att kunna studera funktionen hos var och en av dessa varianter använde vi oss av tumörceller odlade i laboratorium. På så sätt kunde vi framställa celler som producerar de olika formerna av p63 och sedan analysera dessa. En spännande upptäckt var att flera gener som man sedan tidigare vet är inblandade i bildningen av tumörer, kan regleras av p63. Mina slutsatser tyder på att p63 spelar en viktig roll i uppkomsten av SCCHN- tumörer vilket är en viktig upptäckt för våra kommande studier med målet att kartlägga hur vi effektivast behandlar SCCHN.

9

ORIGINAL ARTICLES This thesis is based on the following articles referred to in the text by their roman numerals.

I. Boldrup L, Coates PJ, Hedberg Y, Sjöström B, Dahlqvist Å, Nylander K. Expression of p63, COX-2, EGFR and β-catenin in smokers and patients with squamous cell carcinoma of the head and neck reveal variations in non-neoplastic tissue and no obvious changes in smokers. Int J Oncol. 27:1661-1667, 2005

II. Boldrup L, Bourdon JC, Coates PJ, Sjöström B, Nylander K.

Expression of p53 isoforms in squamous cell carcinoma of the head and neck. Eur J Cancer. 43:617-623, 2007

III. Boldrup L, Coates PJ, Gu X, Bäcklund B, Nylander K. Elevated

expression of p63 causes up-regulation of Cox-2 in squamous cell carcinoma of the head and neck. Submitted 2007

IV. Boldrup L, Coates PJ, Gu X, Nylander K. ∆Np63 isoforms regulate

CD44 and keratins 4, 6, 14 and 19 in squamous cell carcinoma of head and neck. J Pathol. 213(4):384-391, 2007

The original articles were reprinted with permission from the publishers: Spandidos-publications (Paper I), Elsevier Ltd. (Paper II) and John Wiley & Sons Ltd. (Paper IV).

10

Introduction

INTRODUCTION SQUAMOUS CELL CARCINOMA OF THE HEAD AND NECK Squamous cell carcinoma of the head and neck (SCCHN) is the sixth most common cancer in the world, with about 500 000 new cases annually (Shirai and O'Brien, 2007). In Sweden, about 500 new cases of SCCHN are diagnosed every year (Socialstyrelsen: Cancerregistret). Of tumours arising in the head and neck area more than 90 % are squamous cell carcinoma, a tumour of epithelial origin. SCCHN is an umbrella term including cancers at several sites in the head and neck area, for example nasal cavity, oral cavity, nasopharynx, hypopharynx, oropharynx and larynx (Figure 1) with different aetiologies and prognosis. SCCHN develops in the lining of the mouth, nose and throat consisting of squamous cells. The location of the tumours can lead to severe problems relating to disfigurement and dysfunction caused by the disease as well as treatment. The mean age at diagnosis is around 60 years, however, an increased incidence of patients under the age of 40 has been seen, especially concerning SCCHN of the tongue (Annertz et al, 2002; Funk et al, 2002; Shiboski et al, 2005).

Figure 1. The term SCCHN includes tumours located at different sites. The most well known risk factors for development of SCCHN are smoking and alcohol abuse (Jefferies and Foulkes, 2001) which in combination have a synergistic effect. Other known risk factors are smokeless tobacco such as gutkha, masala and betel quid. In Sweden a type of smokeless tobacco, moist snuff (snus), is used by about 12% of the adult population (Folkhälsoinstitutet). Snuff as a risk factor is heavily discussed despite the fact that several studies have shown no increased risk for development of SCCHN in Swedish snuff users (Lewin et al, 1998; Luo et al, 2007). In vitro snuff extract has been shown to cause morphological changes in epithelial cells and long-term exposure causes disturbances in the differentiation process (Merne et al, 2004).

11

Introduction

Another risk factor discussed for development of SCCHN is human papilloma viruses (HPV), and about 20-30% of head and neck cancers contain HPV viruses (Schlecht et al, 2007; Syrjanen, 2005). There are more than 110 different HPV types, with HPV type 16 being the predominant type found in SCCHN (Schlecht et al, 2007; Syrjanen, 2005). Other risk factors that have been considered are familial and environmental issues. Diagnosis and treatment Diagnosis is often made at a late stage of SCCHN development. Staging of SCCHN is performed using the Tumour-Node-Metastasis (TNM) classification system which describes the anatomical extent of the disease based on three components: T – extent of the primary tumour N – absence or presence and extent of regional lymph node metastasis M – absence or presence of distant metastasis Based on the TNM system tumours can be classified into different stages, I-IV. Staging can be seen as a summary of the TNM classification and also provides some prognostic information, lower stages indicate a better prognosis and higher chance to survive. The treatment strategies vary between different hospitals and countries. In Umeå, Sweden, the common treatment includes surgery and/or radiation therapy, whereas chemotherapy is not used normally. In other countries chemotherapy is more commonly used, and at later stages of disease a combination of radiotherapy, surgery and chemotherapy has been suggested to increase disease free survival (Lefebvre, 2005). An issue discussed in the treatment of cancer is the role and existence of cancer stem cells (Blagosklonny, 2007; Mackenzie, 2006). Different markers for distinguishing stem cells from somatic cells have been suggested. For example, p63 has been suggested as a stem cell marker in keratinocytes (Pellegrini et al, 2001). However, the question of how to distinguish the different types of stem cell-like cells and what role they may play in cancer and in cancer treatment still remains. The five- year survival for SCCHN patients is about 50% including all SCCHN subgroups, however, prognosis varies between the different subtypes. Molecular mechanism behind SCCHN In order to improve treatment and enable diagnosis at an early stage, the understanding of the molecular mechanisms behind SCCHN is of importance and intense research is ongoing. Technologies such as microarrays, screening of gene changes in various samples easily generate very much data and hundreds of genes can be found to be differentially expressed between tumour and normal samples. These genes then need further analysis in order to evaluate the impact of each of them.

12

Introduction

A few examples of genes often discussed in connection with development of SCCHN are p53, p16/p21/p27, EGFR, STAT3 and cyclin D1 (Gleich and Salamone, 2002). This thesis focuses on a few of the genes that have been suggested to be involved in SCCHN development in particular p63 and genes connected to p63. THE P53 FAMILY In 1979 the tumour suppressor p53 was first described in cells transfected with the SV40 virus interacting with the large T-antigen (Lane and Crawford, 1979; Linzer and Levine, 1979). Two decades later, in 1997, two homologues to p53 were discovered, p63 and p73 (Kaghad et al, 1997; Schmale and Bamberger, 1997; Yang et al, 1998). p53 has been intensively studied regarding its function in tumour development, and p63 and p73 have also been suggested to be involved in tumourigenesis. However, it has turned out that both p63 and p73 seem essential in development; p63 plays an important role in development of epithelia (Mills et al, 1999; Yang et al, 1998; Yang et al, 1999) and p73 is involved in neurogenesis and natural immune responses (Pozniak et al, 2000; Yang et al, 2000). Intense research is ongoing in order to evaluate the role of the p53 family members in tumourigenesis as well as the cross-talk between them. The focus of this thesis is mainly on p63, but a small part also deals with p53. Structure and regulation of p53 The TP53 gene is located on chromosome 17p13 and encodes a protein of 393 amino acids consisting of several functional domains. The transactivation (TA) domain is located in the N-terminus containing both a transcriptional activating region and a proline rich domain. The middle part of the protein comprises the DNA-binding domain (DBD) which also is the major part of the protein. p53 forms dimers and tetramers and the oligomerization domain is located in the C-terminus. Adjacent to the oligomerization domain the basic domain is located, suggested as an additional DBD (Ahn and Prives, 2001). Initially p53 was suggested to be an oncogene but over the last decade it has been proposed to function as a tumour-suppressor in its wild-type conformation while when mutated it does not protect against tumour development. p53 is suggested to be involved in regulation of a wide variety of cellular processes such as cell-cycle arrest, DNA repair mechanisms, apoptosis and senescence. The short half-life (<20 minutes) gives low steady-state levels in the absence of cellular stress, while upon cellular stress p53 is activated leading to different cellular outcomes.

13

Introduction

p53 is tightly regulated by murine double minute 2 (mdm) which binds and ubiquitinates p53, targeting it for proteasomal degradation (Haupt et al, 1997; Kubbutat et al, 1997). p53 is also regulated through posttranslational modifications such as phosphorylation, acetylation, ubiquitination and sumoylation. For many years only one variant of p53 was acknowledged even if reports suggested the existence of different variants of p53 (Courtois et al, 2002; Flaman et al, 1996; Ghosh et al, 2004; Wolf et al, 1985; Yin et al, 2002). Recently several p53 variants were described in detail and at least nine different isoforms suggested to exist (Bourdon et al, 2005). In addition to full-length p53, alternative splicing of intron 9 produces p53β (also called p53i9) and p53γ (Bourdon et al, 2005; Chow et al, 1993; Flaman et al, 1996). Alternative splicing of intron 2 or alternative initiation of translation produces the ∆40p53 (also called p47 and ∆p53) isoforms (∆40p53, ∆40p53β and ∆40p53γ) which lack the 40 first amino acids in the N-terminus (Courtois et al, 2002; Ghosh et al, 2004; Yin et al, 2002). Furthermore, an internal promoter in intron 4 was found, producing the ∆133p53 isoforms (∆133p53, ∆133p53β and ∆133p53γ) (Bourdon et al, 2005). The same year another study proposed an additional p53 isoform lacking 198 nucleotides in exons 7, 8 and 9 (Rohaly et al, 2005), ∆p53. Consequently p53 can exist in at least ten different variants (Figure 2). Investigations of the roles of the individual p53 isoforms has just started, however, they seem to be expressed in a wide range of normal tissues but in a tissue dependent manner, suggesting specific regulation mechanisms of the internal promoter and splicing event (Bourdon et al, 2005). p53 in cancer TP53 is one of the most commonly mutated genes in human cancer, with about 50% of all human tumours studied showing a mutation. It was first thought to function as an oncogene because of its wide expression in tumours. However, later it was discovered that mutated p53 functions as an oncogene and wild type p53 as a tumour suppressor. Most of the mutations occur in the DBD of the TP53 gene (Greenblatt et al, 1994). In accordance with other human tumours, SCCHN shows mutations in approximately 50% of the cases (Boyle et al, 1993; Brachman et al, 1992). The prognostic significance of TP53 mutations in SCCHN varies between different studies (Nylander et al, 2000). The reason for this can be variable sensitivity and accuracy between different methodologies employed for studying p53 as well as the presence of different p53 isoforms with different characteristics (Munro et al, 2005). Recent research focuses on microRNA (miRNA) which are small RNA molecules, about 22 nucleotides, functioning as negative gene regulators. Several hundreds of different human miRNAs have been found and especially one, miR-34, has been suggested to function in a network with p53 (He et al, 2007). Further studies will reveal the impact of miRNAs in tumour biology.

14

Introduction

Transactivation Proline DNA Binding Domain NLS Oligo NLS

SAM TID

p53

p53β

p53γ

∆40p53

∆40p53β

∆40p53γ

∆133p53

∆133p53β

∆133p53γ

∆Np63α

∆Np63β

∆Np63γ

TAp63α

TAp63β

TAp63γ

∆p53

Figure 2. Structure of the ten p53 isoforms and the six p63 isoforms. α, β and γ isoforms are formed by alternative splicing, ∆40p53 isoforms are formed by alternative splicing of intron 2 or by alternative initiation of translation (previously called p47 or ∆p53). ∆133p53 isoforms are produced by an internal promoter in intron 4. ∆Np63 isoforms are formed by an alternative promoter in intron 3. NLS: Nuclear localization signal, SAM: sterile-alpha-motif, TID: Terminal inhibitor domain. Figure adapted from Paper II; Mills, 2006. Structure and regulation of p63 p63 is located on chromosome 3q27-29 and several variants of the p63 protein have been identified (Yang et al, 1998). Alternative promoter usage and differential mRNA splicing leads to formation of at least six different isoforms (Figure 2). The N-terminal promoter gives rise to the full-length proteins, TAp63, which contain the TA1 domain.

15

Introduction

An internal promoter gives rise to the N-terminal truncated isoforms, ∆Np63, with a second TA domain, TA2, within exons 11-12 (Ghioni et al, 2002) and a C-terminal inhibitory domain (TID) (Serber et al, 2002). Alternative splicing of the C-terminus forms three variants designated: α, β and γ. The structure of p63 resembles that of p53 with a TA domain, a DBD with 60% homology to the DBD of p53 and an oligomerization domain. p63 is able to bind the canonical p53-responsive element whereas the amino acid differences between the DBDs may alter the specificity of p63 DNA binding. In addition, specific response elements through which p63 can regulate target genes have been found (Ortt and Sinha, 2006; Osada et al, 2005). Both p53 and p63 contain the oligomerization domain in the C-terminal part of the protein. p53 has a basic domain suggested to have a regulatory function whereas the α isoforms of p63 contain a sterile alpha motif (SAM) domain thought to be involved in protein-protein interactions, no SAM domain is present in p53. Furthermore, an inhibitory domain adjacent to the SAM domain causes decreased activity and the p63β isoforms lacking both the SAM and inhibitory domain but containing the TA2 domain consequently are efficient transactivators (Ghioni et al, 2002) whilst the p63γ isoforms lack the SAM domain, the TID domain as well as the TA2 domain. Degradation of proteins occurs via lysosomal and proteasomal pathways. Several pathways for p63 degradation have been suggested, for example through the E3 ligase Itch which interacts with and ubiquitinates p63 promoting p63 proteasomal degradation (Rossi et al, 2006a; Rossi et al, 2006b). Moreover, sumoylation has been implied to be involved in degradation, and small ubiquitin-like modulator 1 (SUMO-1) attaches to ∆Np63α and targets it for proteasome mediated degradation (Ghioni et al, 2005). Additional stress signals such as ultraviolet radiation and cisplatin treatment have been observed to induce phosphorylation and ubiquitin-mediated degradation of p63 (Fomenkov et al, 2004; Westfall et al, 2005). Mdm2 plays an important role in degradation of p53, however, the effect of the interaction between mdm2 and p63 is not clear as one study indicates mdm2 to enhance the transcriptional activity of p63 (Calabro et al, 2002) whereas another study shows mdm2 to repress p63-mediated transcription (Kadakia et al, 2001). p63 in epithelial development Two main theories about p63’s function in development of stratified epithelia are discussed, agreeing upon the important role of p63 in this process. The various isoforms complicate the situation further and give different results. The two main hypotheses are that:

• p63 regulates the differentiation program of squamous epithelial cells (Mills et al, 1999)

• p63 maintains the proliferative potential of stem cells (Yang et al, 1999)

16

Introduction

These hypotheses are based on two separate knockout mice models with different genetic backgrounds developed by two separate labs (Mills et al, 1999; Yang et al, 1999). The overall phenotype is similar and the knockout mice have severe development defects for example lack of squamous epithelia such as oral mucosa, mammary and salivary glands, hair follicles and skin, and die soon after birth due to dehydration (Mills et al, 1999; Yang et al, 1998; Yang et al, 1999). Defects in limb and craniofacial development are also seen. The craniofacial defects include cleft lip and palate as well as lack of teeth. On the other hand, the different knockout mice differ in development phenotypes, for example Yang et al, 1999, found clumps of differentiated keratinocytes that were thought to be remnants of epidermis. From this they draw the conclusion that p63 is required for epidermal stem cell maintenance. In accordance with this another study also showed enrichment of p63 in epithelial stem cells (Pellegrini et al, 2001). However, several studies have also failed to show the p63 enrichment in stem cells (Larderet et al, 2006; Morris et al, 2004) thus the subject is still an open question. In contrast, the other mouse knockout model by Mills showed no development of differentiated epidermis and concluded that p63 plays a role in differentiation of keratinocytes (Mills et al, 1999). p63 has also been suggested to be required in regulation of cell death during neural development (Jacobs et al, 2005). Expression of the different isoforms also seems to differ in various backgrounds. Koster et al observed TAp63 to be expressed already at E7.5, earlier than ∆Np63 which is expressed from E9.5 (Koster et al, 2004). Furthermore, ectopically expressed TAp63 in mice induced stratification of the single layered lung epithelium as well as blocked skin differentiation. In vitro TAp63 but not ∆Np63 was able to block keratinocyte differentiation and induce expression of K14. This lead to the conclusion that TAp63 is the molecular switch responsible for epithelial stratification whereas the main function for ∆Np63 is to counterbalance TAp63 enabling cell differentiation (Koster et al, 2004). Other studies have, however, shown ΔNp63 to be the main isoforms expressed even in early development of epithelial tissue (Laurikkala et al, 2006). ∆Np63 is also the main isoform detected in mature epidermis, expressed mainly in the basal layers (Nylander et al, 2002; Thurfjell et al, 2004). Its expression is down-regulated in suprabasal layers, a down-regulation suggested to be caused by signalling through Notch (Nguyen et al, 2006). In vitro the ΔNp63α isoform has been suggested to have a dominant-negative effect on the TAp63 isoforms (Yang et al, 1998).

17

Introduction

Mutations in the human p63 gene The developmental role of p63 in animal models can be connected to human developmental disorders. Mutations in the human TP63 gene cause dominantly inherited syndromes with developmental defects with the hallmarks of ectodermal dysplasia, facial clefting and limb abnormalities. Ectodermal dysplasia is characterized by abnormal development or growth of tissues derived from the embryonic ectoderm. Facial clefting is the result of incomplete fusion of embryonic facial processes. Limb abnormalities are often split hand/foot malformations. Five different syndromes and one non-syndromic single malformation are known to be the result of mutations in different domains of the TP63 gene and are characterized by various combinations of the p63 syndrome phenotypes. Ectrodactyly, ectodermal dysplasia and cleft lip/palate syndrome (EEC): mainly caused by mutations in the DNA-binding domain (Celli et al, 1999). Characterized by ectodermal dysplasia and facial clefts. Ankyloblepharon-ectodermal defects-cleft lip/palate syndrome (AEC), also known as Hay-Wells syndrome: Mutations in the SAM domain has been found in these patients (McGrath et al, 2001). A typical hallmark of AEC syndrome is the fusion of eyelids. Limb mammary syndrome (LMS): Mutations in the N and C-terminals have been found (van Bokhoven et al, 2001). The phenotype of LMS includes malformation of the hands and/or feet and hypoplastic nipples and/or mammary glands. Acro-dermato-ungual-lacrimal-tooth syndrome (ADULT): One mutation has been found in the DNA-binding domain (Propping et al, 2000) and exons 3 and 4 (Amiel et al, 2001; Slavotinek et al, 2005). Clinically the syndrome is very similar to LMS, however, orofacial clefting has not been observed in ADULT while nails, skin and teeth are very often affected. Rapp-Hodgkin syndrome (RHS): Mutations have been localized to the C-terminus of the p63 protein (Bougeard et al, 2003; Kantaputra et al, 2003). Disease features include orofacial clefting and sparse fine hair. Split hand/foot malformation (SHFM): Caused by several mutations along the whole TP63 gene (van Bokhoven et al, 2001) and is characterized by limb malformations. For a summary of all syndromes caused by p63 mutation see Rinne et al, 2007.

18

Introduction

p63 in Cancer The homology between p53 and p63 led to the speculation that p63 also plays an important role as tumour suppressor. However, p63 is rarely mutated in human tumours indicating that it is not a tumour suppressor. In many different tumour types an over-expression of p63 has been seen, for example breast cancer, bladder cancer, lung cancer and SCCHN, indicating that p63 may function as an oncogene. There is an ongoing debate whether p63 is an oncogene or a tumour suppressor. It has been suggested that TAp63 isoforms are p53-like and work as tumour suppressors, activating known p53 targets such as p21, bax and mdm2 (Shimada et al, 1999). TAp63α induces apoptosis in several cell systems by triggering signals via death receptors and mitochondria (Gressner et al, 2005). On the other hand, ∆Np63 seems to be anti-p53 like and works as an oncogene. Recently two different p63 +/- strains showed different results regarding p63’s role in tumourigenesis, with one indicating that p63 heterozygous mice are more tumour prone than p63 homozygous mice (Flores et al, 2005) while the other study showed that p63 +/- are less tumour prone (Keyes et al, 2006). One strategy to investigate the role of p63 in tumour development is to identify p63 targets. Regulation of downstream targets occurs by binding to sequence-specific response elements (REs). p63 can bind p53 REs and activate p53 targets such as bax and p21 involved in apoptosis and cell cycle arrest. p63-specific REs have, however, also been identified differing from canonical p53 REs (Osada et al, 2005; Trink et al, 2007). p73 p73 is located on chromosome 1p36 in a region frequently demonstrating loss of heterozygosity in human cancers (Kaghad et al, 1997). Like p53 and p63, p73 exists in several variants, and two promoters and/or differential splicing provide four different ways to produce p73 N-terminal variants. Furthermore alternative splicing of downstream exons can give rise to nine different C-terminal ends (α, β, γ, δ, ζ, ε, θ, η and η1) (Murray-Zmijewski et al, 2006). Altogether 14 different p73 proteins have been described even though theoretically 35 mRNA variants can be expressed encoding 29 different proteins. From studies using knockout mice lacking both TAp73 and ∆Np73 showing developmental defects in their nervous systems it was suggested that p73 contributes to neural development (Yang et al, 2000) and in the developing mouse brain ∆Np73 isoforms are highly expressed (Pozniak et al, 2000). In cancer the p73 gene is rarely mutated, however, both over-expression and reduced expression has been detected in different tumour types. For example lymphomas and leukaemias show reduced expression of p73 while tumours such as breast, ovary, lung and colorectal cancer show over-expression of p73 (Chen et al, 2000; Sun, 2002; Tokuchi et al, 1999; Zaika et al, 1999).

19

Introduction

PROTEINS CONNECTED TO P63 AND/OR SCCHN Several genes/proteins are involved in the development of tumours and mapping this network is important in understanding the cause of the disease. One suggested player in the development of SCCHN is p63 although not as a single player but as a part of numerous different genes/proteins interacting with or in some way connected to p63 and cooperating in tumourigenesis. In this thesis some of the proteins with a suggested connection to p63 or SCCHN have been studied and discussed. β- catenin and PP2A Glycoproteins that act as adhesion molecules can be divided into five major families: cadherins, the immunoglobulin superfamily, the integrins, the selectins and CD44 (El-Bahrawy and Pignatelli, 1998). Catenins belong to the cadherin family and three forms of catenins, α-catenin, β-catenin and γ-catenin have been identified. β-catenin is a 92 kDa protein with homology to the Drosophila segment polarity gene Armadillo (McCrea et al, 1991). Several studies have demonstrated E-cadherin/catenin complexes to play a key role in cell adhesion. β-catenin is a target of the Wnt signalling cascade, which contributes to the control of cell proliferation during development and tumorigenesis. In the absence of Wnt signals, a complex containing GSK3β, axin and APC promotes phosphorylation of β-catenin leading to ubiquitination of the protein and degradation via the proteasomal pathway giving low levels of β-catenin. On the other hand, when the cell is stimulated, soluble Wnt factors bind to receptors called frizzleds whereby the GSK3β, axin and APC complex is inhibited leading to accumulation of β-catenin in the nucleus. In the nucleus β-catenin forms a complex with Tcf family members and works as a transcription factor. Another factor involved in the regulation of β-catenin is protein phosphatase 2A (PP2A) a serine-threonine protein phosphatase (Janssens and Goris, 2001; Kikuchi, 2000). Simplified, it can be said that PP2A associates with APC, axin and GSK3β and contributes to β-catenin destruction (Figure 3). p63 can in turn interact with PP2A leading to accumulation of β-catenin in the nucleus (Patturajan et al, 2002). Alterations in the β-catenin signalling pathway is discussed in cancer and in SCCHN effects of such alterations have been suggested to promote cell invasion (Yang et al, 2006) and also impact survival, where low expression of β-catenin indicates decreased patient survival (Rodriguez-Pinilla et al, 2005; Yu et al, 2005).

20

Introduction

Frizzled Frizzled Wnt

Axin APC

GSK-3β

P P

β-catenin P P

β-catenin degradation

Axin

APC GSK-3β

β-catenin

β-catenin

Tcf Tcf

A B

PP2A PP2A

Figure 3. Activation of β-catenin. A. In the absence of signals through the wnt pathway β-catenin is degraded. B. Wnt activates the Frizzled receptor leading to transport of β-catenin into the nucleus. Adapted from Barker and Clevers, 2000; Kikuchi, 2000. CD44 The type 1 transmembrane glycoprotein CD44 is a cell surface receptor for hyaluronate (Aruffo et al, 1990). CD44 contains at least 19 exons and alternative splicing of exons 5a to 14, called exons v1-v10, causes huge heterogeneity of mRNA transcribed from the gene (Screaton et al, 1992). Several hundreds of different combinations of sequences can theoretically be created. Two groups of transcripts are formed with the smaller group known as CD44 standard transcripts (CD44s) lacking all of the 10 variant exons. The other group comprises the larger CD44 variants (CD44v) encoding transcripts containing sequences from exons v1-v10. CD44 is important in cell-cell interactions, cell adhesion and migration, processes critical in normal immune system development and function, and control of cell proliferation (Kaya et al, 1997). Its’ involvement in cancer includes interaction between hyaluronate and CD44, a signalling pathway influencing tumour cell progression and resistance to chemotherapy.

21

Introduction

The different variants of CD44 have been reported to be involved in tumour progression (Franzmann et al, 2001; Gunthert et al, 1991) and CD44v6 is highly expressed in SCCHN and squamous cell carcinoma (SCC) of the lung, cervix and skin (Heider et al, 2004; Schrijvers et al, 1993). CD44v3 is associated with tumour cell growth and migration in SCCHN (Wang et al, 2007). CD44 also physically associates with EGFR in cancer cells and promotes EGFR-mediated signalling and tumour progression (Wang and Bourguignon, 2006). CD44 has recently received attention as a marker of cancer stem cells in SCCHN. The CD44+ population of SCCHN cells possess stem cell properties of self-renewal and differentiation, whereas CD44- cells do not show self-renewal properties (Prince et al, 2007). Cyclooxygenase 2 (Cox-2) Cyclooxygenase, or prostaglandin-endoperoxidase, is an enzyme catalysing the production of prostaglandin from arachidonic acid. The existence of two variants of the enzyme is well known, Cox-1 and Cox-2. Cox-1 is constitutively expressed in many tissues and involved in the production of prostaglandins that control normal physiological functions. While in contrast Cox-2 is not detected in normal tissue but is rapidly induced by growth factors, oncogenes, carcinogens and tumour-promoting phorbol esters (inflammatory and mitogenic stimuli), the constitutively expressed Cox-1 is essentially unaffected by these factors (Herschman et al, 2003). Cox-2 is important in for example neonatal survival (Loftin et al, 2001) and in inflammatory processes induction of Cox-2 can both promote inflammation via prostaglandins but also have an anti-inflammatory role (Lawrence et al, 2002). In several types of cancer including SCCHN Cox-2 has been observed to be up-regulated (Chan et al, 1999; Gallo et al, 2002; Terakado et al, 2004). The up-regulation of Cox-2 in cancer is suggested to decrease apoptosis (Tsujii and DuBois, 1995) and up-regulate VEGF leading to increased angiogenesis which is important for tumour growth (Gallo et al, 2001). In addition, Cox-2 up-regulation has been connected with increased invasiveness (Tsujii et al, 1997). SCCHN patients expressing high levels of Cox-2 have been seen to have a shorter disease-free as well as overall survival and also respond more poorly to radiotherapy (Chen et al, 2005; Itoh et al, 2003; Nix et al, 2004; Terakado et al, 2004). A supposed connection between p53 and Cox-2 is somewhat contradictory with results on the one hand indicating that p53 induces Cox-2 and that absence of Cox-2 can enhance p53-mediated apoptosis (Benoit et al, 2006; Han et al, 2002). On the other hand, p53 has been reported to decrease the expression of Cox-2 in SCCHN cell line systems (Lee et al, 2004). In accordance with this wild-type p53 was shown to repress expression of Cox-2 while mutated p53 had no effect (Subbaramaiah et al, 1999). p63 has been found to be correlated with Cox-2 in skin tumours (Wu et al, 2007).

22

Introduction

Epidermal growth factor receptor (EGFR) The transmembrane glycoprotein, EGFR also called human epidermal factor 1 (HER-1) or c-erbB-1 is a member of the c-erbB family of receptor tyrosine kinases. EGFR is a receptor containing an extracellular receptor domain, a transmembrane domain and an intracellular domain with tyrosine kinase function. Several ligands have been suggested to activate the receptor, for example epidermal growth factor (EGF), transforming growth factor alpha (TGF-α) and amphiregulin (AR). Ligand binding to the receptor results in homo- or heterodimerization leading to autophosphorylation of the receptor. This activation leads to downstream signalling through different pathways, for example Ras/MAPK, PI-3 kinase, akt and STAT, pathways that regulate gene expression, proliferation, angiogenesis and inhibition of apoptosis. EGFR is expressed on all normal cells except hematopoietic cells and is over-expressed in a wide variety of tumours including breast cancer, non-small-cell lung cancer and SCCHN (Hynes and Lane, 2005). The most common mutation in EGFR in human cancers is known as EGFRvIII, a deletion of a part of the extracellular domain leading to a constitutively active receptor (Lorimer, 2002). Different strategies for inhibition of EGFR signalling in therapy are the use of antibodies or small molecule tyrosine kinase inhibitors. However, EGFR inhibitors have only shown limited success as monotherapy in SCCHN (Choong and Cohen, 2006). p63 is suggested to be downstream of EGFR (Matheny et al, 2003), however, in contrast another study have shown TAp63γ to repress EGFR expression (Nishi et al, 2001). A connection between EGFR and Cox-2 has been found showing that EGFR inhibition in combination with Cox-2 inhibitors gives effective inhibition of angiogenesis and tumour growth (Chen et al, 2004). Tobacco smoke increases the amount of EGFR ligands in oral epithelia (Du et al, 2005; Moraitis et al, 2005). Keratins The function of epithelial tissue is to protect the organism from physical, chemical and microbial damage. Epithelial tissue can be divided into three different classes

• Keratinized stratified squamous epithelium – such as epidermis, palate, and gingiva

• Stratified non-keratinized epithelia – such as buccal mucosa and esophagus

• Simple non-stratified epithelia – such as kidney and liver A network of proteins forms the structure of the epithelial tissue, the cytoskeleton, with one of the main components being keratins. In humans keratins consist of a large family of numerous members (Presland and Dale, 2000) divided into type I (acidic) and type II (neutral or basic) keratins depending on their sequence.

23

Introduction

Usually keratins form pairs comprising one type I keratin and one type II keratin. The expression and function of different keratins is complex and varies at different differentiation stages and in different epithelial tissues. Overall it can be said that keratins regulate migration of normal and transformed epithelial cells and several keratins are used as epithelial differentiation markers. For example: Keratin 4: Expressed in non-keratinized epithelia such as buccal mucosa, esophagus and vagina, often in pair with K13. Has been shown to be lower expressed in oral SCC compared to leukoplakia (Ohkura et al, 2005). Keratin 6: Two isoforms exist with keratin 6A being the main form expressed (Takahashi et al, 1995). It is essential for proliferative and migratory responses and often expressed in squamous cancers. Keratin 14: Expressed in dividing keratinocytes of the skin epidermis and in oral stratified squamous epithelia, in pair with keratin 5. K14 is down-regulated when cells start to differentiate and is significantly higher expressed in oral SCC compared to premalignant lesions (Ohkura et al, 2005). p63 can regulate the expression of K14 (Romano et al, 2007). Keratin 19: As K14, K19 is expressed in the basal layer of oral stratified epithelia but down-regulated in cells lines established from invasive oral SCC (Crowe et al, 1999).

Dermis

Basal layer

Spinous layer

Granular layer

Stratum Corneum

K14

K6

Dermis

Basal layer

Intermediate layer

K14 K19

K4

Keratinized Non-keratinized

Superficial layer

Figure 4. Keratin expression in keratinized and non-keratinized epithelium. Adapted from Presland and Dale, 2000.

24

Aims

AIMS The goal of this thesis was to learn more about the molecular mechanisms behind SCCHN and in particular the involvement of p63 and p63 connected proteins. SPECIFIC AIMS

• Map protein expression profiles of p63, Cox-2, EGFR, β-catenin and PP2A in normal and tumour tissue from patients with SCCHN

• Investigate if there is variation in expression of p63, Cox-2,

EGFR, β-catenin and PP2A in heavy smokers compared to non-smokers

• Map the expression of p53 isoforms in normal and tumour

tissue from patients with SCCHN • Establish and investigate cell lines of SCCHN origin stably

expressing the different isoforms of p63 • Identify potential targets of p63 using cell lines stably over-

expressing p63 isoforms

25

Materials and methods

MATERIALS AND METHODS PATIENTS AND SPECIMENS Tissue samples comprised punch biopsies (4 mm in diameter) from the buccal mucosa of heavy smokers and age- and sex- matched controls, together with tumour and corresponding normal tissue from patients with SCCHN. A person who had smoked for at least ten years and currently smoked at least ten cigarettes per day was considered a heavy smoker. None of the smokers/non-smokers showed any clinical signs of inflammation and all samples were histologically normal with no signs of neoplastic changes. From the SCCHN patients, both tumour material and corresponding clinically normal tissue was collected. Tissue samples were divided into two and immediately frozen in liquid nitrogen and stored at -80°C. All samples were collected after informed consent and permission for the project had been granted by the Ethics Committee at Umeå University (dnr 01-057 and dnr 01-210). Information about all participants is summarised in table 1. Cell lines used were FaDu (ATCC), a cell line derived from a human squamous cell carcinoma of the oropharynx, and Saos-2, a cell line derived from human osteosarcoma. Both cell lines were cultured in DMEM (Gibco, Invitrogen) with 10% foetal calf serum (Invitrogen) at 37°C with 10% CO2. p53, p63 and p73 status for these cell lines is given in table 2. PROTEIN EXTRACTION One piece of each tissue sample was used for protein extraction through pulverisation using a Microdismembrator (B. braun biotech international) thereafter ~100µl lysis buffer (0.5% NP-40, 0.5 % Na-doc, 0.1% SDS, 150 mM NaCl, 50 mM Tris pH 7.5, 1 mM EDTA, 1mM NaF and protease inhibitor cocktail (Sigma-Aldrich Chemie, Steinheim, Germany)) was added to the sample. Protein concentrations were determined using BCA Protein Assay Kit (Pierce, Rockford, IL, USA). The same procedure was used for extracting protein from cell lines except that the cell pellet was washed with PBS, and lysis buffer then directly added to the cell pellet. When analysing the established stable clones these were directly lysed in wells using 100 µl of another lysis buffer (2% SDS, 30% glycerol, 300 mM β-mercaptoethanol and 100 mM Tris-HCL (pH 6,8)) (Ghioni et al, 2002). Protein concentration was not measured for these samples.

26


Table 1. Summary of participants Samples from age- and sex-matched smokers and non-smokers Smokers Non-smokers Nr Sex Age Years of smoking Nr Sex Age Study 1 M 40 25 1 M 40 I 2 M 55 35 2 M 55 I 3 M 27 13 3 M 27 I, II 4 M 35 15 4 M 35 I 5 M 58 38 5 M 55 I, II 6 M 26 10 6 M 25 I 7 F 47 34 7 F 46 I, II 8 F 47 25 8 F 47 I 9 F 59 41 9 F 56 I 10 F 51 31 10 F 52 I 11 F 45 25 11 F 43 I, II 12 F 47 33 12 F 49 I, II 13 F 57 34 13 F 57 II 14 F 46 22 14 F 44 II 15 M 36 15 15 M 35 II Samples from SCCHN patients

Nr Sex Age Smoking status Location TNM Study 1 F 54 S Tonsil T2N2bM0 I, II 2 F 91 S Tonsil/tongue base T4N2cM1 I, II 3 M 54 S Gingiva/buccal mucosa T4N1M0 I, II 4 M 63 S Tonsil/tongue base T4N2bM0 I, II 5 M 62 S Tongue/floor of the mouth T4N2cM0 I 6 F 78 NS Tongue T2N0M0 I, II 7 M 50 NS Tonsil T3N2bM0 I 8 M 55 NS Retromolar T1N0M0 I, II 9 F 64 NS Tongue T1N0M0 I, II 10 M 65 PS Tongue T1N0M0 I, II 11 F 30 PS Border of the tongue T3N0M0 I, II 12 M 64 S Retromolar/tongue base T4N2bM0 I, II 13 M 64 ? Tuber T4NXM0 I, II 14 F 65 NS Border of the tongue T2N0M0 I, II 15 M 68 ? Buccal mucosa T2N0M0 II 16 M 39 ? Border of the tongue T2N0M0 II 17 F 80 ? Gingiva T4N2bM0 II 18 M 85 ? Gingiva T4N0M0 II 19 M 72 ? Gingiva T4NXMX II 20 F 24 NS Border of the tongue T2N0M0 II 21 M 63 ? Palate T4N0M0 II 22 M 73 ? Floor of the mouth T4N0M0 II 23 M 56 ? Hypopharynx T4N0M0 II M – male, F – female, S – smoker, NS – non-smoker, and PS – previous smoker

27


Table 2. p53 family status of cell lines used FaDu FaDu* Saos-2 Saos-2* RNA Status P53 + - P53β + - P53γ + - ∆133p53 + - ∆133p53β + - ∆133p53γ + - P63α + + - + P63β + + - - P63γ + + - + ∆Np63 + + - - TAp63 + + - + P73α + + - + P73β - + - + Protein status P53 (Do-1) + - P63 (4A4) + - P63 (∆2) + - p53 RNA detected by nested RT-PCR, p63 and p73 RNA detected by light cycler with a cut-off value of 31 cycles or * 36 cycles. Proteins were detected by antibodies indicated within parenthesis using western blot. IMMUNOBLOT ANALYSIS AND QUANTIFICATION Bio-Rad PROTEAN III mini-gels and PROTEAN II xi/XL vertical electrophoresis systems were used to separate and analyse proteins. Thirty µg of total protein extract was mixed with loading buffer, boiled for 10 minutes and electrophoresed on gels of appropriate percentage acrylamide. From stable clones 20µl of the extracted protein was loaded on the gel. Proteins were transferred to nitrocellulose membranes (Hybond ECL;GE Healthcare, Buckinghamshire, UK) and stained with ponceau red for evaluation of transfer efficiency and loading. Membranes were blocked in 5% milk with 0,4% Tween in PBS thereafter incubated with antibodies diluted in the same blocking solution. An overview of the antibodies used is given in table 3. For chemiluminiscence detection, Chemidoc XRS (Bio-Rad) was used in combination with ECL Advance (GE Healthcare, Buckinghamshire, UK). For quantification in paper I a standard curve of known protein concentration samples was created and relative protein concentrations calculated. In paper III a relative quantification between samples was performed. All experiments were repeated at least two times.

28


Table 3. Antibodies used in the different studies Primary antibodies Ab Company Name/nr Produced in Dilution Study β-actin Chemicon Int. MAB1501R Mouse 1/10000;1/20000 I,II,III,IV β-catenin BD Biosciences 610404 Mouse 1/2000 I c-myc NeoMarkers Ab-2 Mouse 1/500 III, IV Cox-2 Cayman chemicals Ab160112 Mouse 1/1000 I, III EGFR Abcam Ab1911 Sheep 1/2000 I Keratin 4 Abcam Ab9004 Mouse 1/250 IV Keratin 6A Abcam Ab18586 Mouse 1/50 IV Keratin 14 E.B. Lane LL001 Mouse 1/1000 IV Keratin 19 E.B. Lane LP2K Mouse 1/200 IV P53 J-C Bourdon DO1 Mouse 1/2000 II P53 J-C Bourdon DO12 Mouse 1/1000 II P53 Abcam 1801 Mouse 1/2000 II P53 J-C Bourdon Sapu Rabbit 1/2000 II P63 Abcam 4A4 Mouse 1/2000 I, III P63 Own prod. Δ2 Rabbit 1/1000 I, III, IV P63 Own prod. Long-2 Rabbit 1/1000 I PP2A Upstate 1D6 Mouse 1/1000 I Secondary antibodies Ab Company Name/nr Produced in Dilution Study anti-mouse DakoCytometric P.0260 Rabbit 1/50000 I,II,III,IV anti-rabbit DakoCytometric P.0448 Goat 1/50000 I,II,III,IV anit-sheep DakoCytometric P.0163 Rabbit 1/50000 I CELL TRANSFECTIONS Stable transfections In order to establish cell lines stably expressing the different p63 isoforms FaDu cells were seeded in 90 mm Petri dishes and at 90-95 % confluence transfected with 12.21µg DNA, either empty pcDNA3 vector or pcDNA3 vector with insert of myc-tagged ∆Np63α, ∆Np63β or ∆Np63γ cDNA (Yang et al, 1998), using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s protocol. Forty eight hours after transfection cells were plated at low concentration (20 000 cells/ml) on new plates and selected with G418, 800µg/ml (VWR international). Colonies formed and after approximately two weeks clones were picked and transferred to 12-well plates where they grew until confluence when they were divided into two wells, of which one was used for analysis of p63 protein expression. Clones expressing ∆Np63α, ∆Np63β and ∆Np63γ were saved and expanded for further analysis. Clones containing empty vector were screened by RT-PCR.

29


Transient transfections For transient transfections FaDu or Saos-2 cells in 90 mm petri dishes were transfected at 90-95% confluence with 12.21µg DNA, empty pcDNA3 vector or pcDNA3 vector with insert of myc-tagged TAp63α, TAp63β, TAp63γ, ∆Np63α, ∆Np63β or ∆Np63γ cDNA using Lipofectamine 2000 (Invitrogen) under conditions suggested by the manufacturer. Cells were harvested at 24, 48, 72, 96 and 120 hours after transfection. At least two independent transfections were performed. RNA EXTRACTION The other half of the biopsy was used for extraction of RNA. Tissue was cut into pieces in a petri dish on dry ice, covered with 250 µl TRIzol reagent (Invitrogen) and transferred to a tube and further homogenized with a pellet mixer (MERCK Eurolab), and another 250 µl TRIzol then added. For extraction from cell pellets TRIzol was added directly to the tube. The following procedure was the same for tissue and cell samples using 500 µl TRIzol, volume adjusted for small pieces of tissue and small cell pellets. All incubations were carried out at room temperature if nothing else is stated. After 5 minutes incubation with TRIzol, 100 µl chloroform was added and incubated for 3 minutes thereafter samples were centrifuged for 15 minutes at 13 000 rpm at 4°C. The upper aqueous phase was transferred to a new tube, diluted with equal amount of isopropyl alcohol, incubated for 10 minutes and centrifuged for 10 minutes at 13 000 rpm at 4°C. The supernatant was carefully removed and the pellet washed in 70% ethanol, air dried and dissolved in DEPC-H2O. Concentration was measured using a Nano-drop (ND-1000 spectrophotometer) and samples then stored at -80°C. CDNA SYNTHESIS Two different kits for cDNA synthesis were used. In paper II the Cloned AMV First-Strand cDNA Synthesis kit (Invitrogen) was used according to the manufacturer’s instructions, with 300 ng of total RNA. In the other experiments the 1st strand cDNA synthesis kit for RT-PCR (AMV) (Roche, Penzberg, Germany) was used according to the manufacturer’s instructions, with 500 – 1000 ng of total RNA in a reaction volume of 20µl.

30


PCR Nested PCR In paper II nested PCR was used to analyse different p53 isoforms in tumour and normal samples from SCCHN patients. cDNA synthesised using the kit from Invitrogen was amplified in one round or two rounds, comprising 35 cycles each, of PCR (nested PCR). In nested PCR two different primer pairs were used, the pair in the first round covering a longer part of cDNA while the second pair was located inside the first pair. For primer combinations and primer sequences see Tables 4 and 5. Table 4. Primer pairs used in nested PCR Isoform 1st PCR 2nd PCR Fragment size (bp) P53 e2.1/RT1 e2/RT2 ~1250 P53β e2.1/RT1 e2/p53b ~1050 P53γ e2.1/RT1 e2/p53g ~1000 Δ133p53 i4f1/RT2 i4f2/RDNp53 ~750 Δ133p53β i4f1/RT2 i4f2/p53b ~750 Δ133p53γ i4f1/RT2 i4f2/p53g ~750 Quantitative PCR Cox-2 expression was analysed using quantitative PCR and a human Cox-2 kit (Search LC, Heidelberg, Germany) on a Light-cycler™ from Roche. cDNA was synthesised with the kit from Roche, using 500 ng total RNA, and cDNA diluted 12 times before use in PCR. As internal control for cDNA integrity and relative cDNA quantity in the different tissue samples, β-actin was used. All reactions were run in duplicate and a mean value of the two samples calculated. Results were expressed as the relative amount of product adjusted to the level of internal control amplification obtained for the same sample. Semi-quantitative PCR For confirmation of differentially expressed genes in the microarray, semi-quantitative PCR was used with Fast Start taq DNA polymerase (Roche diagnostics). After optimization samples were subjected to 25-30 cycles and products analysed by gel electrophoresis.

31


Table 5. Sequences of primers used. Primer T (°) Study

CD44 5´ ATTCCAGAATGGCTGATCATC 60 IV 3´ TCC TTG TCTCATCAGCTGTCCD44 Var. 5´GCACAGACAGAATCCCTGCTACC 58 IV 3´GGGGTGGAATGTGTCTTGGTCTCCD44 ChIP 5ÁGTGGGATGATAGATGGACC 59 IV 3´GGAAAGAGGGAGAGCTCATTCox-2-ChIP 5ĆTGTTGAAAGCAACTTAGCT 58 III 3ÁGACTGAAAACCAAGCCCATCox-2-ChIP 5ÁCCAGTATCTCCTATGAAGG 60 III 3ĆTTCCTCTCCAGGAATCTGACox-2-ChIP 5´GATCCATGGTCACAACTCAT 59 III 3´GTCCTAAGCAGTTACCTGTIGFBP3 5ÁCAGCCAGCGCTACAAAGTT 54 III,IV 3ĆTGGGACTGAGCACATTGAGKeratin 4 5ĆAGAATGTC TGGAGAATGCC 60 IV 3´GTC TCC TCTATCGTC TCTTGKeratin 6A 5´GATCGACCACGTCAAGAAGCA 53 IV 3ĆATAGGAGTAGC TGC TTCCTCKeratin 14 5ĆAGATCCAGGAGATGATTGG 61 IV 3´TTG CCATCG TGCACATCCATKeratin 19 5´TCCGAACCAAGT TTGAGACGG 59 IV 3´TGAACCAGGCTTCAGCATCCNeomycin 5ÁCAGGATGAGGATCGTTTCG 60 III 3´TCATTTCGAACCCCAGAGTCTRAF4 - ChIP 5ÁGCCTGGATGACAGAGCAAG 61 III,IV 3ÁAGCTAGGCAGGCCTAATGG*p53: e2.1 5´GTCACTGCCATGGAGGAGCCGCA 60 II*p53: e2 5ÁTGGAGGAGCCGCAGTCAGAT 60 II*p53: i4f1 5ĆTGAGGTGTAGACGCCAACTCTCTCTAG 60 II*p53: i4f2 5´GCTAGTGGGTTGCAGGAGGTGCTTACAC 60 II*p53: RT1 3´GACGCACACCTATTGCAAGCAAGGGTTC 60 II*p53: RT2 3ÁATGTCAGTCTGAGTCAGGCCCTTCTGTC 60 II*p53: p53b 3´TTTGAAAGCTGGTCTGGTCCTGA 60 II*p53: p53g 3´TCGTAAGTCAAGTAGCATCTGAAGG 60 II*p53: RDNp53 3ĆTCACGCCCACGGATCTGA 60 II

*For combination of 5ánd 3´p53 primers see table 4. MICROARRAY The stable FaDu cells expressing ∆Np63α, ∆Np63β and ∆Np63γ respectively were used for microarray analysis. Total RNA was extracted as described above and 20 µg total RNA taken to the microarray facility at Umeå University for preparation of double-strand cDNA and biotinylated cRNA that was hybridized to HG-U133A chips (Affymetrix). All procedures were done according to the Affymetrix protocol in the department of clinical microbiology at Umeå University.

32


Expression values were calculated using dCHIP software (Li and Wong, 2001) and default setting (PM-MM model). Expression values from dCHIP were truncated to 0 and probe sets with high variance within replicates or no change between different conditions were excluded. By comparing triplicates of control cells with duplicate samples of each p63 over-expressing clone, genes were identified that had a fold change of at least 2.0 at 90% confidence and a mean expression level of at least 20 in either treated or control arrays. CHROMATIN IMMUNOPRECIPITATION (CHIP) To investigate whether p63 directly binds to the CD44 and Cox-2 gene promoters, chromatin immunoprecipitation assay (ChIP) was used, EZ ChIP™ (Upstate, Lake Placid, NY, USA), according to the manufacturer’s protocol. Potential binding sites were identified using a programme designed to recognize p53 response elements. Antibodies used were Δ2, which recognizes ΔNp63 isoforms (KN-Δ) (Nylander et al, 2002) and pre-immune sera from Δ2. Immunoprecipitated DNA was analysed by PCR using primers for the CD44 promoter region 573bp upstream of the transcription initiation site and primers for the Cox-2 promoter region 1076 bp upstream of the transcription initiation site. As positive control for the assay, TRAF4 (Gu et al, 2007) was used and at least three separate experiments were performed. Primer sequences are given in table 5. IMMUNOHISTOCHEMISTRY To confirm keratin expression in SCCHN tumours immunohistochemistry was performed. Paraffin-embedded samples were sectioned, dewaxed and protocols for each antibody optimized. Staining was performed using a Ventana staining machine and reagents according to the supplier’s recommendations. Immunohistochemistry was performed by Kerstin Näslund.

33

Results and discussion

RESULTS AND DISCUSSION EXPRESSION OF P63, COX-2, EGFR, β-CATENIN AND PP2A IN SCCHN PATIENTS AND IN ORAL MUCOSA FROM SMOKERS (PAPER I) p63, Cox-2, EGFR, β-catenin and PP2A are proteins suggested to be involved in the development of SCCHN, and smoking is one of the most well known risk factors for progression of SCCHN. Both Cox-2 and EGFR have previously been found to be altered in smokers compared to non-smokers (Moraitis et al, 2005; Takeyama et al, 2001). To investigate if smoking leads to alterations in protein expression we set out to map the expression of p63, Cox-2, EGFR, β-catenin and PP2A in oral mucosa from smokers compared to oral mucosa from non-smoking age- and sex- matched individuals. Furthermore, we investigated the expression of these proteins in squamous cell carcinoma of head and neck patients. Twelve matched pairs of smokers/non-smokers and 14 tumours and corresponding clinically normal tissue were studied using western blot and specific antibodies directed against the different proteins. Expression of the individual proteins was then quantified. Expression of Cox-2, EGFR, β-catenin and PP2A in SCCHN patients and smokers/non-smokers Results from western blot quantification showed that expression of Cox-2 and PP2A was significantly higher in samples from SCCHN patients than from normal tumour adjacent tissue, while expression of EGFR and β-catenin was not. Analysis of protein expression in smokers and non-smokers showed no significant difference in the expression of Cox-2, EGFR, β-catenin or PP2A. The reason we could not confirm previous data stating that Cox-2 and EGFR expression is connected to smoking could be that previous studies have mapped RNA levels whereas we studied protein expression. Another factor to take into consideration is the limited size of our material comprising 12 matched pairs of smokers/non-smokers. p63 expression in smokers/non-smokers and SCCHN patients Both smokers/non-smokers and tumour/normal tumour adjacent tissue were subjected to analysis with the 4A4 antibody recognizing all p63 isoforms and the long-2 antibody detecting the TAp63 isoforms only. The 4A4 antibody detected a band in 2/12 smokers, 6/12 non-smokers, 13/14 normal and 8/14 tumours whereas the long-2 antibody detected protein in 8/9 smokers, 8/11 non-smokers, 13/14 normal samples and 3/14 tumours. Due to lack of material, analysis with the long-2 antibody could not be done on all samples from smokers/non smokers.

34


The statistical analysis of p63 expression based on the 4A4 antibody revealed no significant difference between smokers and non-smokers, however, normal tumour adjacent tissue showed significantly higher levels of p63 compared to tumours. Previous data has indicated ∆Np63 to be up-regulated in tumours compared to normal tissue based on studies of RNA (Thurfjell et al, 2004). This could not be confirmed in the present study. The discordance between the results may be explained by the measurement of protein and RNA respectively. However, results from analysis with the long-2 antibody showed that TAp63 is up-regulated in normal tumour adjacent tissue which is in accordance with previous studies that have revealed TAp63 to be expressed in normal tissue in bladder cancer while levels in tumours decreased (Park et al, 2000). On the other hand, data from transgenic mice showed that in skin, reactivated expression of TAp63 predisposed to tumour development and progression (Koster et al, 2006). Taken together this suggests that TAp63 functions are highly complex and may not always activate tumour suppressor pathways. Protein expression in normal tissue adjacent to the tumours compared to normal tissue from non-smoking individuals Quantification of western results showed that clinically normal tissue adjacent to the tumour is not normal regarding expression of proteins involved in tumourigenesis. For example β-catenin, EGFR and PP2A were more expressed in normal tumour adjacent tissue compared to tissue from disease-free non-smokers although not statistically significant. Our data are in accordance with previous data showing that the genetic changes in tumour patients occur within a field of 7 cm in diameter from the tumour and can give rise to a second primary tumour (Tabor et al, 2004; Tabor et al, 2002). This finding is important to take into consideration when collecting control material from patients with neoplastic changes. EXPRESSION OF P53 ISOFORMS IN SCCHN (PAPER II) One of the most common genetic alterations in SCCHN is disruption of the p53-pathway. However, the prognostic significance of p53 in SCCHN is reported to vary. One reason may be presence of different isoforms of p53, thus we investigated the expression of p53 isoforms in tumour samples from patients with SCCHN.

35


Various p53 isoforms at RNA level in SCCHN Twenty-one tumour samples (T), sixteen normal tumour adjacent samples (N) and eight non-smokers (NS) were analysed using nested RT-PCR and primers designed previously by our collaborators (Bourdon et al, 2005). Primers used were p53 isoform specific for p53, p53β, p53γ, ∆133p53, ∆133p53β and ∆133p53γ. Results are summarized in table 6. Table 6. Summary of p53 isoform expression in SCCHN. Number of samples; tumours 21, normal tumour adjacent 16 and non-smokers 8 p53 p53β p53γ T N NS T N NS T N NS Positive 21 16 8 18 13 6 5 3 6 Variable 0 0 0 1 2 2 12 9 1 Negative 0 0 0 2 1 0 4 4 1 ∆133p53 ∆133p53β ∆133p53γ T N NS T N NS T N NS Positive 7 9 3 3 2 0 4 1 2 Variable 7 3 4 3 4 3 5 7 3 Negative 7 4 1 15 10 5 12 8 3 T – Tumour, N – Normal tumour adjacent, NS –Non-smokers In a few samples variable results were seen with one replicate showing positive result and one negative result. The reason for the variable results is most likely that levels of the isoforms were very low, and nested-PCR a very sensitive method enabling amplification of only a few molecules. By ordinary RT-PCR we could strengthen this assumption. Using more RNA as starting material could be a plausible way of getting more consistent results. However, our data indicated that the levels of the different p53 isoforms are low in SCCHN. Detection of in vitro translated and endogenously expressed p53 proteins p53 protein is mainly regulated by post-translational mechanisms and the expression of p53 RNA and protein thus not correlated, emphasising the importance of studying protein expression as well. By producing in vitro translated p53 isoform proteins we analysed different antibodies directed against p53, to see if they could recognize the different isoforms. Results showed that the DO-12 antibody directed against an epitope in the DNA-binding domain and the polyclonal antibody Sapu recognized all the different in vitro translated isoforms of p53.

36


DO-1, recognizing an epitope in the N-terminal, only identified p53, p53β and p53γ, and the 1801 antibody, distinguishing an epitope located within residues 32-79, recognised all isoforms except Δ133p53. When tumours and normal tumour adjacent tissue were analysed using DO-1 a few samples with several bands could be identified where a few of these bands showed a shift in molecular weight indicating that different isoforms were expressed. However, that could not be confirmed with the DO-12 antibody. Results showed p53 isoforms to be expressed at too low levels for detection with the antibodies used. A limiting factor is that antibodies are not specific for the individual isoforms and maybe also not sensitive enough. In order to determine the impact of the different isoforms in clinical samples we thus need better isoform specific antibodies. p53 isoform expression in FaDu cells In our control SCCHN cell line, FaDu, all isoforms except Δp53 were expressed at consistent RNA level. However, at protein level we could not detect any isoform except the full-length p53 using four different antibodies, indicating either low levels of these or lack of translation. OVER-EXPRESSION OF P63 IN FADU CELLS (PAPER III) The specific regulation of different p63 isoforms is not fully known and also hard to study in vivo. By transfecting cells with cDNA for the different isoforms and using a selective agent, the different isoforms can be constitutively expressed. The cell line used, FaDu, was derived from SCCHN of oropharynx. Expression of p63 isoforms Cells with different p63 status, FaDu and Saos-2 cells were transiently transfected with the six p63 variants in order to investigate protein expression and maintenance of the isoforms. Both FaDu and Saos-2 cells showed similar patterns using western blot analysis of protein extracts from cells harvested at 24, 48, 72, 96, and 120 hours after transfection. TAp63 isoforms were only detectable up to 48 hours after transfection and TAp63β more unstable than TAp63α and TAp63γ. ∆Np63α and ∆Np63γ were expressed up to 96 hours after transfection while ∆Np63β was lost after 72 hours. These data indicated that cells poorly tolerate TAp63 and expression decreases more rapidly than ∆Np63 that is more tolerated by cells. Alternatively it could be that the half-life of TAp63 is shorter than for ∆Np63.

37


Establishment of cell lines stably expressing p63 Due to an antibiotic resistance gene in the vector containing the gene of interest, transfected FaDu cells constitutively expressing the gene can be selected by using an antibiotic as selection “medium”. We used geneticin (G418) to select clones expressing p63. Established clones were screened by western blot except clones transfected with empty vector that were screened by RT-PCR. Among 115 G418-resistant clones tested, not a single clone expressed detectable levels of the TAp63 isoforms. The inability to express TAp63 isoforms may not be so strange due to its indicated ability to induce growth arrest and apoptosis (Ghioni et al, 2002; Gressner et al, 2005). On the other hand, a few clones expressing ∆Np63 could be established, one expressing ∆Np63α, one expressing ∆Np63β and two expressing ∆Np63γ. In total, 122 ∆Np63 transfected clones were tested. All clones selected for expression of the empty vector showed positive result by PCR. In accordance with previous data, ∆Np63β showed lower expression compared to ∆Np63α and ∆Np63γ (Ghioni et al, 2002). Data indicated that cells do not tolerate high levels of ∆Np63β which is the most efficient transactivator of the isoforms. POTENTIAL P63 TARGETS (PAPER III AND IV) The regulatory network of p63 is complex and incompletely mapped, however, it is known that p63 can activate or repress transcription of p53 target genes but also has unique transcriptional targets. p63 plays a key role in development of normal squamous epithelium and in squamous cancers alterations in p63 expression has been observed. To further investigate the p63 network intense research is ongoing trying to find potential regulators of p63 as well as potential targets. In these studies we used the microarray technology in the search for potential targets of p63 in the SCCHN derived cell lines over-expressing p63. Cox-2 a potential target of p63 Up-regulation of Cox-2 in various cancers including SCCHN has been previously seen. When analysing the clones stably over-expressing the different ∆Np63 isoforms using the microarray technique we identified Cox-2 up-regulation compared to control cells. ∆Np63α caused a 3.5 fold up-regulation, ∆Np63β an 11.6 fold up-regulation and ∆Np63γ a 2.7 fold up-regulation. Results were confirmed by quantitative RT-PCR showing similar data as the microarray. Further analysis of Cox-2 protein expression in p63 over-expressing cells showed an increase in all three clones compared to cells transfected with empty vector. In addition, transient transfections also revealed an up-regulation caused by p63 expression although a lower induction compared to stable transfectants.

38


As the transfection procedure itself induces Cox-2 expression, interpretation of transient transfections is more complicated. Chromatin immunoprecipitation of a potential p63 binding site in the Cox-2 promoter did not show any direct binding of p63 to the Cox-2 promoter indicating that the activation of Cox-2 by p63 occurs via an indirect mechanism. One way of regulating Cox-2 is via NF-κB, which is activated by IKKα, which in turn can be activated by p63. An association between accumulation of NFκB and ΔNp63 with SCCHN has previously been shown (King and Weinberg, 2007). Our data did, however, not support this theory, instead indicated activation through some other alternative pathway. Expression and regulation of CD44 in FaDu cells CD44 is a transmembrane glycoprotein cell receptor involved in cell migration and cell adhesion. RNA from the stable clones established was used for microarray analysis revealing CD44 as a potential target of p63. Microarray data showed a 2.0-fold up-regulation with both ∆Np63α and ∆Np63γ, and a 3.9-fold up-regulation with ∆Np63β. Microarray data was confirmed using semi-quantitative RT-PCR, where all three ∆Np63 isoforms showed induced expression of CD44 compared to cells transfected with empty vector. As CD44 has been suggested to be a cancer stem cell marker, our data indicated ∆Np63 as a regulator of stem cell phenotypes in SCCHN. We also investigated if p63 directly binds to the CD44 gene promoter by chromatin immunoprecipitation. Results could not confirm any direct binding of p63 to the CD44 promoter region used in this study. However, based on these results we cannot exclude that p63 binds to other sites in the CD44 promoter, or that CD44 regulation by p63 is indirect. In cancer, different CD44 isoforms are predominantly expressed and the importance of combinations of different variants of exons has been discussed. Using primers located in the exons before and after the region comprising the variant exons we could identify expression of several variants in FaDu cells. Especially one of the isoforms was induced by ∆Np63, the 1100 bp isoform. Sequencing of this isoform revealed it to be the isoform containing all variant exons except exon two. These data indicate that p63 has a role in regulation of CD44 mRNA splicing. p63 regulates the expression of keratins Keratins are important differentiation markers and their expression in SCCHN has been discussed and analysed. Our microarray data showed four keratins to be potentially regulated by the ∆p63 isoforms compared to control cells:

39


∆Np63α

∆Np63β ∆Np63γ

Keratin 6A: Up-regulated 12 15.7 13.2 Keratin 14: Up-regulated 3.4 4.2 4.1 Keratin 4: Down-regulated 37 52 38 Keratin 19: Down-regulated 2.5 3.0 2.6 Data was confirmed using semi-quantitative RT-PCR and western blots from protein extracts of the clones stably expressing the ∆Np63 isoforms. Results from these analyses were consistent with the microarray data. In addition, immunohistochemistry of normal buccal mucosa and SCCHN tissue identified ∆Np63 in the basal layer up to approximately two-thirds of the epithelial thickness in the normal buccal mucosa and strong expression all through the SCCHN tumours. Keratin 14 was highly expressed in the basal layer of normal oral epithelium and also strongly expressed in tumours while keratin 6A was not expressed in normal oral epithelium but expressed in tumour cells. Keratin 19 could not be detected and keratin 4 was not expressed in the most basal cells and cells at the surface of normal oral epithelium but highly expressed in the other cell layers. Keratin 4 was not expressed in tumours. Keratin 14 was significantly induced by p63 and expressed at high levels in SCCHN, and has previously been shown to have a binding site in the enhancer to which ∆Np63 binds and transactivates the gene (Romano et al, 2007). Combining these and our data indicated that increased expression of keratin 14 in SCCHN at least in part is due to transcriptional activation by increased amounts of the ∆Np63 isoforms.

40

General discussion

GENERAL DISCUSSION Novel findings add valuable information to the understanding of the mechanisms behind SCCHN although the picture also becomes more complex. Work included in this thesis focuses on a known player in SCCHN, p63, as well as potential targets of p63. Looking at the literature, controversies concerning results from different studies of these proteins are found, possibly due to the use of different model systems, different tissues as well as different techniques. Previous data from our lab has shown ∆Np63 to be significantly higher expressed in SCCHN tumours compared to normal tumour adjacent tissue at RNA level (Thurfjell et al, 2004). However, when analysing protein expression using western blot on samples from SCCHN patients, some of them also included in the previous study of RNA, no increased expression of the ∆Np63 isoforms could be seen. When comparing these western blot data with immunohistochemical staining of paraffin embedded samples of the same tumours it seemed that by immunohistochemistry proteins were highly expressed whereas when using western blot they were not recognized at all times. As no paraffin embedded samples from normal tumour adjacent tissue was available we could not compare the two methods on these samples, which were the ones showing highest TAp63 expression using western blot. However, it can be concluded that results from immunohistochemical and western blot analysis do not correlate, indicating that the antibodies we used for detection of p63 were not ideal for western blot analysis. Another reason for the difference between western blot and immunohistochemistry is the different levels of contamination by for example blood, lymphocytes and connective tissue that may vary in western blot samples whereas in immunohistochemistry you look at tumour cells only. Furthermore, it should be taken into consideration when comparing results from RNA and protein analysis that RNA and protein expression do not always correlate. It has previously been shown that p53 is mainly regulated at the post-translational level and p63 RNA and protein expression do not always correlate either (Gu et al, 2006; Katoh et al, 2000; Okada et al, 2002), which may reflect post-translational modifications of p63 that influence protein stability.

41

General discussion

Crosstalk between proteins Development of cancer is a complex event of genetic and epigenetic alterations and like a big puzzle all pieces must fit together in order to get the whole picture. The present work has investigated several players in the signalling pathways of SCCHN tumour formation, however, the crosstalk between the different molecules are only partly investigated. In addition, other studies have also found connections between the different players. The p53 family itself is complex with several isoforms and crosstalk between these are important to consider. For example it has been suggested that ∆Np73 and mutant p53 associate with the ∆Np63 promoter and induce its transcription (Lanza et al, 2006). Furthermore, p73 expression has been shown to affect the DNA-binding capabilities of p63 isoforms (Johnson et al, 2007). Previous studies have shown a physical interaction between EGFR and CD44 leading to phosphorylation of EGFR in a cell line derived from oral squamous cell carcinoma (Wang and Bourguignon, 2006). In addition, EGFR is connected to Cox-2 that in turn is connected with β-catenin as well as p63. Activation of EGFR stimulates Cox-2 production in colon cancer cell lines (Coffey et al, 1997) and accumulation of β-catenin can lead to up-regulation of Cox-2 (Araki et al, 2003). The link between Cox-2 and CD44 is somewhat contradicting, with studies that have found Cox-2 to suppress CD44 as well as studies showing activation of CD44 to induce Cox-2 (Kinugasa et al, 2004; Murphy et al, 2005). These results may depend on different model systems or the fact that different CD44 variants have different functions. The known correlations between p63 and these proteins show that ∆Np63 can induce β-catenin accumulation in the nucleus (Patturajan et al, 2002) and EGFR has been shown to regulate p63 (Matheny et al, 2003) but in contrast TAp63γ has been shown to repress EGFR expression (Nishi et al, 2001). Our data further indicate that p63 can regulate Cox-2, CD44 and keratins. Figure 5 shows a proposed model of the protein network in SCCHN. In summary, our data show that Cox-2 and PP2A are up-regulated and that several isoforms of p53 are expressed in SCCHN. Furthermore we show that p63 may be a regulator of Cox-2, CD44 and keratins, whereas no direct connection to β-catenin or EGFR could be identified. Our microarray data were confirmed using several methods, and in retrospect, additional immunohistochemical analysis as a complement to western blot analysis would have been valuable. The importance of confirming findings from cell lines in clinical material must also be stressed.

42

General discussion

EGFR

CD44

Cox-2

p63

β-catenin

Keratins PP2A

Figure 5. Network of p63 and potential p63 targets. p63 has previously been shown to interact with PP2A leading to β-catenin accumulation in the nucleus. Furthermore β-catenin has been suggested to induce Cox-2 expression. In our studies we saw a clear upregulation of Cox-2 by over-expression of p63. Another player suggested to interact with Cox-2 is CD44 which we in our studies has seen to be regulated by p63. EGFR can interact both with Cox-2 and CD44. Finally we also found that keratins can be regulated by p63 that has previously been observed to interact with CD44. Black arrows represent previously found connections and red arrows represent connections found in the present thesis. Double arrow represents the interaction in both directions.

43

Conclusions

CONCLUSIONS

• SCCHN tumours expressed significantly higher levels of Cox-2 and PP2A compared to clinically normal tissue adjacent to SCCHN, however no significant difference was seen in expression of EGFR or β-catenin. p63 was significantly higher expressed in normal tumour adjacent tissue compared to tumours. Furthermore a difference in protein expression of p63, Cox-2, EGFR, β-catenin, and PP2A could be observed between normal tumour adjacent tissue and normal tissue from disease-free non-smokers

• Smoking did not influence the expression of p63, Cox-2,

EGFR, β-catenin and PP2A proteins in oral mucosa

• p53 isoforms were expressed in SCCHN patients at RNA level, in particular the p53β isoform, but could not be detected at protein level

• Cell lines stably over-expressing the ∆Np63 isoforms could

be established but not cell lines over-expressing the TAp63 isoforms

• Cox-2 was found to be a potential p63 target, showing

increased expression at both RNA and protein levels in cells over-expressing p63 compared to control cells. p63 up-regulates expression of CD44 and specifically regulated expression of the CD44 variant lacking exon 2 in p63 over-expressing FaDu cells. Keratins 6A and 14 were up-regulated and keratins 4 and 19 down-regulated by p63

The molecular signalling behind SCCHN is a complicated process. Data from this thesis add to the field that p53 and p63 isoforms, CD44, keratins and Cox-2 may be potential players in this complicated network.

44

Acknowledgments

ACKNOWLEDGMENTS Till sist skulle jag vilja tacka alla som funnits där för mig under mina doktorandår och hjälpt mig på olika sätt och gjort resan så mycket trevligare. Speciellt TACK till: Min handledare Karin Nylander, det har varit otroligt lärorikt, roligt och spännande att få jobba med dig, tack vare att du gett mig så mycket frihet och ansvar har jag utvecklats och lärt mig så mycket om ”vårat” område, forskning och mig själv. Jag hade inte kunnat haft en bättre handledare än du. My co-supervisor Philip Coates, even though you have been in Dundee you have always been close by. With e-mails and skype we have solved a lot of scientific issues. I am grateful for all your help, valuable discussions about science and my projects. Your reviews have been invaluable. Göran Roos, min bihandledare, du har alltid funnits som ett tryggt stöd i rummet bredvid när jag behövt kloka råd. Tack för att du hjälpte mig att få ihop min första föreläsning. Our colleagues, Jean-Christophe Bourdon in Dundee and Borek Vojtesek in Brno, for fruitful collaborations and help with all kinds of questions and methods. Big thanks to you and your respective co-workers for all your hospitality when I was working in your labs. Bodil Bäcklund, vad skulle jag ha gjort utan dig. Din erfarenhet i labbet och cellodlingen är enorm och det har varit en ära att få lära mig smarta knep av dig. Tack för att du introducerat opera i mitt liv, perfekt att ha en egen biljettförsäljare så nära. Åke Dahlqvist, som tyvärr lämnade oss i förtid, var den drivande kraften i insamlandet av viktigt patientmaterial. Björn Sjöström, för att du tog över efter Åke och har samlat in ett väldigt värdefullt patientmaterial till oss. Tack för att du så gärna delar med dig av din stora kliniska kunskap. Magnus Walhgren, för att du tog dig tid med en frågestund angående klinikbiten. Ulla-Britt Westman, en levande uppslagsbok när det gäller alla möjliga metoder på lab, det har varit mycket värdefullt att få protokoll och tips från dig. Du har ju även med intresse följt mina stora händelser utanför jobbet. Åsa Skytt, du har alltid något smart knep när maskiner strular eller någon logisk förklaring till varför antikroppar inte fungerar. Veronica Janson, för att du har funnits som ett värdefullt bollplank när det gäller metoder, manuskriptskrivande och alla möjliga saker.

45

Acknowledgments

Ylva Hedberg, du lärde mig vikten av optimering av antikroppar vid western körning, hur man kvantifierar proteinband och kom med ovärderliga knep om manuskriptskrivande. Kerstin Näslund och Britta Lindgren , för hjälpen med immunohistofärgningar. Bethany van Guelpen, Anna Dahlin och Vincy Eklöf, mina rumskamrater, Bethany du hann ju flytta ut innan jag blev klar men tack för trevliga pratstunder om träning och allt annat viktigt i livet under våra år i rummet. Anna och Vincy, trevligt med nytt sällskap även om jag smet till annat rum på slutet. Karin Bodén, Terry Persson, Åsa Lundstén, Anette Lindström och Clara Olsson, för hjälpen med all pappersexercis och diskning. Hela fikagänget i 6M huset, för den trevliga stämningen här i 6M-huset, ni förgyller vardagen med små pratstunder och gott fika. KN gruppen: Niklas Thurfjell min gamla rumskamrat och doktorandkollega, för intressanta p63- diskussioner och trevligt sällskap. Xioalian Gu, thanks for all your help with methods we use, enjoyable company at conferences and for spreading so much happiness around you. Majid Ebrahimi, det var roligt att få guida dig på labbet och då du hann före mig med disputation kunde jag ju åka lite snålskjuts på ditt avhandlingskunnande. Matilda Rentoft, du har redan introducerat nya spännande metoder och tankesätt för oss, jag ser fram emot p63-mötet och fortsatt gott samarbete. Elisabet Berglöf, tack min vän för allt under åren. Tänk att det är snart 10 år sedan vi satt på universum och åt lunch för första gången, vi har hunnit med en del sen dess, tänk att vi snart är doktorer båda två! Vad ska vi nu hitta på? Mina vänner, det är så härligt att ni finns och förgyller min fritid. Det är toppen med ett avbrott från jobbets slit ibland, med en långlunch, filmkväll, middag, fest, en sväng till fjällen eller något annat roligt. Familjen Gustafsson, min svärfamilj, för att ni så hjärtligt välkomnat mig i er familj. Det är skönt och trevligt att ha en extrafamilj i stan när mamma och pappa bor en bit bort. Min underbara familj, Mamma, Pappa, Johan, Karin, Mormor och Farmor, för att ni alltid tror på mig och stöttar mig i allt jag gör. Det är alltid lika härligt att tillbringa tid tillsammans, jag älskar er! Mikael, min käre man, för att du alltid finns där för mig och får mig att inse att världen inte går under för att försöken på jobbet inte fungerat. Det är sagolikt att få dela livets äventyr med dig. Jag älskar dig av hela mitt hjärta!

46

Acknowledgments

This project was supported by Lion´s Cancer Research Foundation, Umeå University, The Swedish Cancer Society, Grant number 4569-B05-05XAC and Västerbotten County Council.

47

References

REFERENCES Ahn J, Prives C. The C-terminus of p53: the more you learn the less you know. Nat Struct Biol 2001; 8: 730-732 Amiel J, Bougeard G, Francannet C, Raclin V, Munnich A, Lyonnet S, Frebourg T. TP63 gene mutation in ADULT syndrome. Eur J Hum Genet 2001; 9: 642-645 Annertz K, Anderson H, Biorklund A, Moller T, Kantola S, Mork J, Olsen JH, Wennerberg J. Incidence and survival of squamous cell carcinoma of the tongue in Scandinavia, with special reference to young adults. Int J Cancer 2002; 101: 95-99 Araki Y, Okamura S, Hussain SP, Nagashima M, He P, Shiseki M, Miura K, Harris CC. Regulation of cyclooxygenase-2 expression by the Wnt and ras pathways. Cancer Res 2003; 63: 728-734 Aruffo A, Stamenkovic I, Melnick M, Underhill CB, Seed B. CD44 is the principal cell surface receptor for hyaluronate. Cell 1990; 61: 1303-1313 Barker N, Clevers H. Catenins, Wnt signaling and cancer. Bioessays 2000; 22: 961-965 Benoit V, de Moraes E, Dar NA, Taranchon E, Bours V, Hautefeuille A, Taniere P, Chariot A, Scoazec JY, de Moura Gallo CV, Merville MP, Hainaut P. Transcriptional activation of cyclooxygenase-2 by tumor suppressor p53 requires nuclear factor-kappaB. Oncogene 2006; 25: 5708-5718 Blagosklonny MV. Cancer Stem Cell and Cancer Stemloilds. Cancer Biol Ther 2007; Epub ahead of print Bougeard G, Hadj-Rabia S, Faivre L, Sarafan-Vasseur N, Frebourg T. The Rapp-Hodgkin syndrome results from mutations of the TP63 gene. Eur J Hum Genet 2003; 11: 700-704 Bourdon JC, Fernandes K, Murray-Zmijewski F, Liu G, Diot A, Xirodimas DP, Saville MK, Lane DP. p53 isoforms can regulate p53 transcriptional activity. Genes Dev 2005; 19: 2122-2137 Boyle JO, Hakim J, Koch W, van der Riet P, Hruban RH, Roa RA, Correo R, Eby YJ, Ruppert JM, Sidransky D. The incidence of p53 mutations increases with progression of head and neck cancer. Cancer Res 1993; 53: 4477-4480 Brachman DG, Graves D, Vokes E, Beckett M, Haraf D, Montag A, Dunphy E, Mick R, Yandell D, Weichselbaum RR. Occurrence of p53 gene deletions and human papilloma virus infection in human head and neck cancer. Cancer Res 1992; 52: 4832-4836

48

References

Calabro V, Mansueto G, Parisi T, Vivo M, Calogero RA, La Mantia G. The human MDM2 oncoprotein increases the transcriptional activity and the protein level of the p53 homolog p63. J Biol Chem 2002; 277: 2674-2681 Celli J, Duijf P, Hamel BC, Bamshad M, Kramer B, Smits AP, Newbury-Ecob R, Hennekam RC, Van Buggenhout G, van Haeringen A, Woods CG, van Essen AJ, de Waal R, Vriend G, Haber DA, Yang A, McKeon F, Brunner HG, van Bokhoven H. Heterozygous germline mutations in the p53 homolog p63 are the cause of EEC syndrome. Cell 1999; 99: 143-153 Chan G, Boyle JO, Yang EK, Zhang F, Sacks PG, Shah JP, Edelstein D, Soslow RA, Koki AT, Woerner BM, Masferrer JL, Dannenberg AJ. Cyclooxygenase-2 expression is up-regulated in squamous cell carcinoma of the head and neck. Cancer Res 1999; 59: 991-994 Chen CL, Ip SM, Cheng D, Wong LC, Ngan HY. P73 gene expression in ovarian cancer tissues and cell lines. Clin Cancer Res 2000; 6: 3910-3915 Chen WC, McBride WH, Chen SM, Lee KF, Hwang TZ, Jung SM, Shau H, Liao SK, Hong JH, Chen MF. Prediction of poor survival by cyclooxygenase-2 in patients with T4 nasopharyngeal cancer treated by radiation therapy: clinical and in vitro studies. Head Neck 2005; 27: 503-512 Chen Z, Zhang X, Li M, Wang Z, Wieand HS, Grandis JR, Shin DM. Simultaneously targeting epidermal growth factor receptor tyrosine kinase and cyclooxygenase-2, an efficient approach to inhibition of squamous cell carcinoma of the head and neck. Clin Cancer Res 2004; 10: 5930-5939 Choong NW, Cohen EE. Epidermal growth factor receptor directed therapy in head and neck cancer. Crit Rev Oncol Hematol 2006; 57: 25-43 Chow VT, Quek HH, Tock EP. Alternative splicing of the p53 tumor suppressor gene in the Molt-4 T-lymphoblastic leukemia cell line. Cancer Lett 1993; 73: 141-148 Coffey RJ, Hawkey CJ, Damstrup L, Graves-Deal R, Daniel VC, Dempsey PJ, Chinery R, Kirkland SC, DuBois RN, Jetton TL, Morrow JD. Epidermal growth factor receptor activation induces nuclear targeting of cyclooxygenase-2, basolateral release of prostaglandins, and mitogenesis in polarizing colon cancer cells. Proc Natl Acad Sci U S A 1997; 94: 657-662 Courtois S, Verhaegh G, North S, Luciani MG, Lassus P, Hibner U, Oren M, Hainaut P. DeltaN-p53, a natural isoform of p53 lacking the first transactivation domain, counteracts growth suppression by wild-type p53. Oncogene 2002; 21: 6722-6728 Crowe DL, Milo GE, Shuler CF. Keratin 19 downregulation by oral squamous cell carcinoma lines increases invasive potential. J Dent Res 1999; 78: 1256-1263

49

References

Du B, Altorki NK, Kopelovich L, Subbaramaiah K, Dannenberg AJ. Tobacco smoke stimulates the transcription of amphiregulin in human oral epithelial cells: evidence of a cyclic AMP-responsive element binding protein-dependent mechanism. Cancer Res 2005; 65: 5982-5988 El-Bahrawy MA, Pignatelli M. E-cadherin and catenins: molecules with versatile roles in normal and neoplastic epithelial cell biology. Microsc Res Tech 1998; 43: 224-232 Flaman JM, Waridel F, Estreicher A, Vannier A, Limacher JM, Gilbert D, Iggo R, Frebourg T. The human tumour suppressor gene p53 is alternatively spliced in normal cells. Oncogene 1996; 12: 813-818 Flores ER, Sengupta S, Miller JB, Newman JJ, Bronson R, Crowley D, Yang A, McKeon F, Jacks T. Tumor predisposition in mice mutant for p63 and p73: evidence for broader tumor suppressor functions for the p53 family. Cancer Cell 2005; 7: 363-373 Folkhälsoinstitutet, http://www.fhi.se/, 2007 Fomenkov A, Zangen R, Huang YP, Osada M, Guo Z, Fomenkov T, Trink B, Sidransky D, Ratovitski EA. RACK1 and Stratifin Target DeltaNp63alpha for a Proteasome Degradation in Head and Neck Squamous Cell Carcinoma Cells upon DNA Damage. Cell Cycle 2004; 3: 1285-1295 Franzmann EJ, Weed DT, Civantos FJ, Goodwin WJ, Bourguignon LY. A novel CD44 v3 isoform is involved in head and neck squamous cell carcinoma progression. Otolaryngol Head Neck Surg 2001; 124: 426-432 Funk GF, Karnell LH, Robinson RA, Zhen WK, Trask DK, Hoffman HT. Presentation, treatment, and outcome of oral cavity cancer: a National Cancer Data Base report. Head Neck 2002; 24: 165-180 Gallo O, Franchi A, Magnelli L, Sardi I, Vannacci A, Boddi V, Chiarugi V, Masini E. Cyclooxygenase-2 pathway correlates with VEGF expression in head and neck cancer. Implications for tumor angiogenesis and metastasis. Neoplasia 2001; 3: 53-61 Gallo O, Masini E, Bianchi B, Bruschini L, Paglierani M, Franchi A. Prognostic significance of cyclooxygenase-2 pathway and angiogenesis in head and neck squamous cell carcinoma. Hum Pathol 2002; 33: 708-714 Ghioni P, Bolognese F, Duijf PH, Van Bokhoven H, Mantovani R, Guerrini L. Complex transcriptional effects of p63 isoforms: identification of novel activation and repression domains. Mol Cell Biol 2002; 22: 8659-8668 Ghioni P, D'Alessandra Y, Mansueto G, Jaffray E, Hay RT, Mantia GL, Guerrini L. The Protein Stability and Transcriptional Activity of p63alpha are Regulated by SUMO-1 Conjugation. Cell Cycle 2005; 4: 183-190

50

References

Ghosh A, Stewart D, Matlashewski G. Regulation of human p53 activity and cell localization by alternative splicing. Mol Cell Biol 2004; 24: 7987-7997 Gleich LL, Salamone FN. Molecular genetics of head and neck cancer. Cancer Control 2002; 9: 369-378 Greenblatt MS, Bennett WP, Hollstein M, Harris CC. Mutations in the p53 tumor suppressor gene: clues to cancer etiology and molecular pathogenesis. Cancer Res 1994; 54: 4855-4878 Gressner O, Schilling T, Lorenz K, Schulze Schleithoff E, Koch A, Schulze-Bergkamen H, Maria Lena A, Candi E, Terrinoni A, Valeria Catani M, Oren M, Melino G, Krammer PH, Stremmel W, Muller M. TAp63alpha induces apoptosis by activating signaling via death receptors and mitochondria. Embo J 2005; 24: 2458-2471 Gu X, Coates PJ, Maccallum SF, Boldrup L, Sjostrom B, Nylander K. TRAF4 is Potently Induced by TAp63 Isoforms and Localised According to Differentiation in SCCHN. Cancer Biol Ther 2007; Epub ahead of print Gu X, Lundqvist EN, Coates PJ, Thurfjell N, Wettersand E, Nylander K. Dysregulation of TAp63 mRNA and protein levels in psoriasis. J Invest Dermatol 2006; 126: 137-141 Gunthert U, Hofmann M, Rudy W, Reber S, Zoller M, Haussmann I, Matzku S, Wenzel A, Ponta H, Herrlich P. A new variant of glycoprotein CD44 confers metastatic potential to rat carcinoma cells. Cell 1991; 65: 13-24 Han JA, Kim JI, Ongusaha PP, Hwang DH, Ballou LR, Mahale A, Aaronson SA, Lee SW. P53-mediated induction of Cox-2 counteracts p53- or genotoxic stress-induced apoptosis. Embo J 2002; 21: 5635-5644 Haupt Y, Maya R, Kazaz A, Oren M. Mdm2 promotes the rapid degradation of p53. Nature 1997; 387: 296-299 He L, He X, Lim LP, de Stanchina E, Xuan Z, Liang Y, Xue W, Zender L, Magnus J, Ridzon D, Jackson AL, Linsley PS, Chen C, Lowe SW, Cleary MA, Hannon GJ. A microRNA component of the p53 tumour suppressor network. Nature 2007; 447: 1130-1134 Heider KH, Kuthan H, Stehle G, Munzert G. CD44v6: a target for antibody-based cancer therapy. Cancer Immunol Immunother 2004; 53: 567-579 Herschman HR, Talley JJ, DuBois R. Cyclooxygenase 2 (COX-2) as a target for therapy and noninvasive imaging. Mol Imaging Biol 2003; 5: 286-303 Hynes NE, Lane HA. ERBB receptors and cancer: the complexity of targeted inhibitors. Nat Rev Cancer 2005; 5: 341-354

51

References

Itoh S, Matsui K, Furuta I, Takano Y. Immunohistochemical study on overexpression of cyclooxygenase-2 in squamous cell carcinoma of the oral cavity: its importance as a prognostic predictor. Oral Oncol 2003; 39: 829-835 Jacobs WB, Govoni G, Ho D, Atwal JK, Barnabe-Heider F, Keyes WM, Mills AA, Miller FD, Kaplan DR. p63 is an essential proapoptotic protein during neural development. Neuron 2005; 48: 743-756 Janssens V, Goris J. Protein phosphatase 2A: a highly regulated family of serine/threonine phosphatases implicated in cell growth and signalling. Biochem J 2001; 353: 417-439 Jefferies S, Foulkes WD. Genetic mechanisms in squamous cell carcinoma of the head and neck. Oral Oncol 2001; 37: 115-126 Johnson J, Lagowski J, Lawson S, Liu Y, Kulesz-Martin M. p73 expression modulates p63 and Mdm2 protein presence in complex with p53 family-specific DNA target sequence in squamous cell carcinogenesis. Oncogene 2007; Epub ahead of print Kadakia M, Slader C, Berberich SJ. Regulation of p63 function by Mdm2 and MdmX. DNA Cell Biol 2001; 20: 321-330 Kaghad M, Bonnet H, Yang A, Creancier L, Biscan JC, Valent A, Minty A, Chalon P, Lelias JM, Dumont X, Ferrara P, McKeon F, Caput D. Monoallelically expressed gene related to p53 at 1p36, a region frequently deleted in neuroblastoma and other human cancers. Cell 1997; 90: 809-819 Kantaputra PN, Hamada T, Kumchai T, McGrath JA. Heterozygous mutation in the SAM domain of p63 underlies Rapp-Hodgkin ectodermal dysplasia. J Dent Res 2003; 82: 433-437 Katoh I, Aisaki KI, Kurata SI, Ikawa S, Ikawa Y. p51A (TAp63gamma), a p53 homolog, accumulates in response to DNA damage for cell regulation. Oncogene 2000; 19: 3126-3130 Kaya G, Rodriguez I, Jorcano JL, Vassalli P, Stamenkovic I. Selective suppression of CD44 in keratinocytes of mice bearing an antisense CD44 transgene driven by a tissue-specific promoter disrupts hyaluronate metabolism in the skin and impairs keratinocyte proliferation. Genes Dev 1997; 11: 996-1007 Keyes WM, Vogel H, Koster MI, Guo X, Qi Y, Petherbridge KM, Roop DR, Bradley A, Mills AA. p63 heterozygous mutant mice are not prone to spontaneous or chemically induced tumors. Proc Natl Acad Sci U S A 2006; 103: 8435-8440 Kikuchi A. Regulation of beta-catenin signaling in the Wnt pathway. Biochem Biophys Res Commun 2000; 268: 243-248

52

References

King KE, Weinberg WC. p63: defining roles in morphogenesis, homeostasis, and neoplasia of the epidermis. Mol Carcinog 2007; 46: 716-724 Kinugasa Y, Hatori M, Ito H, Kurihara Y, Ito D, Nagumo M. Inhibition of cyclooxygenase-2 suppresses invasiveness of oral squamous cell carcinoma cell lines via down-regulation of matrix metalloproteinase-2 and CD44. Clin Exp Metastasis 2004; 21: 737-745 Koster MI, Kim S, Mills AA, DeMayo FJ, Roop DR. p63 is the molecular switch for initiation of an epithelial stratification program. Genes Dev 2004; 18: 126-131 Koster MI, Lu SL, White LD, Wang XJ, Roop DR. Reactivation of developmentally expressed p63 isoforms predisposes to tumor development and progression. Cancer Res 2006; 66: 3981-3986 Kubbutat MH, Jones SN, Vousden KH. Regulation of p53 stability by Mdm2. Nature 1997; 387: 299-303 Lane DP, Crawford LV. T antigen is bound to a host protein in SV40-transformed cells. Nature 1979; 278: 261-263 Lanza M, Marinari B, Papoutsaki M, Giustizieri ML, D'Alessandra Y, Chimenti S, Guerrini L, Costanzo A. Cross-talks in the p53 family: deltaNp63 is an anti-apoptotic target for deltaNp73alpha and p53 gain-of-function mutants. Cell Cycle 2006; 5: 1996-2004 Larderet G, Fortunel NO, Vaigot P, Cegalerba M, Maltere P, Zobiri O, Gidrol X, Waksman G, Martin MT. Human side population keratinocytes exhibit long-term proliferative potential and a specific gene expression profile and can form a pluristratified epidermis. Stem Cells 2006; 24: 965-974 Laurikkala J, Mikkola ML, James M, Tummers M, Mills AA, Thesleff I. p63 regulates multiple signalling pathways required for ectodermal organogenesis and differentiation. Development 2006; 133: 1553-1563 Lawrence T, Willoughby DA, Gilroy DW. Anti-inflammatory lipid mediators and insights into the resolution of inflammation. Nat Rev Immunol 2002; 2: 787-795 Lee DW, Park SW, Park SY, Heo DS, Kim KH, Sung MW. Effects of p53 or p27 overexpression on cyclooxygenase-2 gene expression in head and neck squamous cell carcinoma cell lines. Head Neck 2004; 26: 706-715 Lefebvre JL. Current clinical outcomes demand new treatment options for SCCHN. Ann Oncol 2005; 16 Suppl 6: vi7-vi12

53

References

Lewin F, Norell SE, Johansson H, Gustavsson P, Wennerberg J, Biorklund A, Rutqvist LE. Smoking tobacco, oral snuff, and alcohol in the etiology of squamous cell carcinoma of the head and neck: a population-based case-referent study in Sweden. Cancer 1998; 82: 1367-1375 Li C, Wong WH. Model-based analysis of oligonucleotide arrays: expression index computation and outlier detection. Proc Natl Acad Sci U S A 2001; 98: 31-36 Linzer DI, Levine AJ. Characterization of a 54K dalton cellular SV40 tumor antigen present in SV40-transformed cells and uninfected embryonal carcinoma cells. Cell 1979; 17: 43-52 Loftin CD, Trivedi DB, Tiano HF, Clark JA, Lee CA, Epstein JA, Morham SG, Breyer MD, Nguyen M, Hawkins BM, Goulet JL, Smithies O, Koller BH, Langenbach R. Failure of ductus arteriosus closure and remodeling in neonatal mice deficient in cyclooxygenase-1 and cyclooxygenase-2. Proc Natl Acad Sci U S A 2001; 98: 1059-1064 Lorimer IA. Mutant epidermal growth factor receptors as targets for cancer therapy. Curr Cancer Drug Targets 2002; 2: 91-102 Luo J, Ye W, Zendehdel K, Adami J, Adami HO, Boffetta P, Nyren O. Oral use of Swedish moist snuff (snus) and risk for cancer of the mouth, lung, and pancreas in male construction workers: a retrospective cohort study. Lancet 2007; 369: 2015-2020 Mackenzie IC. Stem cell properties and epithelial malignancies. Eur J Cancer 2006; 42: 1204-1212 Matheny KE, Barbieri CE, Sniezek JC, Arteaga CL, Pietenpol JA. Inhibition of epidermal growth factor receptor signaling decreases p63 expression in head and neck squamous carcinoma cells. Laryngoscope 2003; 113: 936-939 McCrea PD, Turck CW, Gumbiner B. A homolog of the armadillo protein in Drosophila (plakoglobin) associated with E-cadherin. Science 1991; 254: 1359-1361 McGrath JA, Duijf PH, Doetsch V, Irvine AD, de Waal R, Vanmolkot KR, Wessagowit V, Kelly A, Atherton DJ, Griffiths WA, Orlow SJ, van Haeringen A, Ausems MG, Yang A, McKeon F, Bamshad MA, Brunner HG, Hamel BC, van Bokhoven H. Hay-Wells syndrome is caused by heterozygous missense mutations in the SAM domain of p63. Hum Mol Genet 2001; 10: 221-229 Merne M, Heikinheimo K, Saloniemi I, Syrjanen S. Effects of snuff extract on epithelial growth and differentiation in vitro. Oral Oncol 2004; 40: 6-12 Mills AA. p63: oncogene or tumor suppressor? Curr Opin Genet Dev 2006; 16: 38-44

54

References

Mills AA, Zheng B, Wang XJ, Vogel H, Roop DR, Bradley A. p63 is a p53 homologue required for limb and epidermal morphogenesis. Nature 1999; 398: 708-713 Moraitis D, Du B, De Lorenzo MS, Boyle JO, Weksler BB, Cohen EG, Carew JF, Altorki NK, Kopelovich L, Subbaramaiah K, Dannenberg AJ. Levels of cyclooxygenase-2 are increased in the oral mucosa of smokers: evidence for the role of epidermal growth factor receptor and its ligands. Cancer Res 2005; 65: 664-670 Morris RJ, Liu Y, Marles L, Yang Z, Trempus C, Li S, Lin JS, Sawicki JA, Cotsarelis G. Capturing and profiling adult hair follicle stem cells. Nat Biotechnol 2004; 22: 411-417 Munro AJ, Lain S, Lane DP. P53 abnormalities and outcomes in colorectal cancer: a systematic review. Br J Cancer 2005; 92: 434-444 Murphy JF, Lennon F, Steele C, Kelleher D, Fitzgerald D, Long AC. Engagement of CD44 modulates cyclooxygenase induction, VEGF generation, and proliferation in human vascular endothelial cells. Faseb J 2005; 19: 446-448 Murray-Zmijewski F, Lane DP, Bourdon JC. p53/p63/p73 isoforms: an orchestra of isoforms to harmonise cell differentiation and response to stress. Cell Death Differ 2006; 13: 962-972 Nguyen BC, Lefort K, Mandinova A, Antonini D, Devgan V, Della Gatta G, Koster MI, Zhang Z, Wang J, Tommasi di Vignano A, Kitajewski J, Chiorino G, Roop DR, Missero C, Dotto GP. Cross-regulation between Notch and p63 in keratinocyte commitment to differentiation. Genes Dev 2006; 20: 1028-1042 Nishi H, Senoo M, Nishi KH, Murphy B, Rikiyama T, Matsumura Y, Habu S, Johnson AC. p53 Homologue p63 represses epidermal growth factor receptor expression. J Biol Chem 2001; 276: 41717-41724 Nix P, Lind M, Greenman J, Stafford N, Cawkwell L. Expression of Cox-2 protein in radioresistant laryngeal cancer. Ann Oncol 2004; 15: 797-801 Nylander K, Dabelsteen E, Hall PA. The p53 molecule and its prognostic role in squamous cell carcinomas of the head and neck. J Oral Pathol Med 2000; 29: 413-425 Nylander K, Vojtesek B, Nenutil R, Lindgren B, Roos G, Zhanxiang W, Sjostrom B, Dahlqvist A, Coates PJ. Differential expression of p63 isoforms in normal tissues and neoplastic cells. J Pathol 2002; 198: 417-427 Ohkura S, Kondoh N, Hada A, Arai M, Yamazaki Y, Sindoh M, Takahashi M, Matsumoto I, Yamamoto M. Differential expression of the keratin-4, -13, -14, -17 and transglutaminase 3 genes during the development of oral squamous cell carcinoma from leukoplakia. Oral Oncol 2005; 41: 607-613

55

References

Okada Y, Osada M, Kurata S, Sato S, Aisaki K, Kageyama Y, Kihara K, Ikawa Y, Katoh I. p53 gene family p51(p63)-encoded, secondary transactivator p51B(TAp63alpha) occurs without forming an immunoprecipitable complex with MDM2, but responds to genotoxic stress by accumulation. Exp Cell Res 2002; 276: 194-200 Ortt K, Sinha S. Derivation of the consensus DNA-binding sequence for p63 reveals unique requirements that are distinct from p53. FEBS Lett 2006; 580: 4544-4550 Osada M, Park HL, Nagakawa Y, Yamashita K, Fomenkov A, Kim MS, Wu G, Nomoto S, Trink B, Sidransky D. Differential recognition of response elements determines target gene specificity for p53 and p63. Mol Cell Biol 2005; 25: 6077-6089 Park BJ, Lee SJ, Kim JI, Lee CH, Chang SG, Park JH, Chi SG. Frequent alteration of p63 expression in human primary bladder carcinomas. Cancer Res 2000; 60: 3370-3374 Patturajan M, Nomoto S, Sommer M, Fomenkov A, Hibi K, Zangen R, Poliak N, Califano J, Trink B, Ratovitski E, Sidransky D. DeltaNp63 induces beta-catenin nuclear accumulation and signaling. Cancer Cell 2002; 1: 369-379 Pellegrini G, Dellambra E, Golisano O, Martinelli E, Fantozzi I, Bondanza S, Ponzin D, McKeon F, De Luca M. p63 identifies keratinocyte stem cells. Proc Natl Acad Sci U S A 2001; 98: 3156-3161 Pozniak CD, Radinovic S, Yang A, McKeon F, Kaplan DR, Miller FD. An anti-apoptotic role for the p53 family member, p73, during developmental neuron death. Science 2000; 289: 304-306 Presland RB, Dale BA. Epithelial structural proteins of the skin and oral cavity: function in health and disease. Crit Rev Oral Biol Med 2000; 11: 383-408 Prince ME, Sivanandan R, Kaczorowski A, Wolf GT, Kaplan MJ, Dalerba P, Weissman IL, Clarke MF, Ailles LE. Identification of a subpopulation of cells with cancer stem cell properties in head and neck squamous cell carcinoma. Proc Natl Acad Sci U S A 2007; 104: 973-978 Propping P, Friedl W, Wienker TF, Uhlhaas S, Zerres K. ADULT syndrome allelic to limb mammary syndrome (LMS)? Am J Med Genet 2000; 90: 179-182 Rinne T, Brunner HG, van Bokhoven H. p63-associated disorders. Cell Cycle 2007; 6: 262-268 Rodriguez-Pinilla M, Rodriguez-Peralto JL, Hitt R, Sanchez JJ, Sanchez-Verde L, Alameda F, Ballestin C, Sanchez-Cespedes M. beta-Catenin, Nf-kappaB and FAS protein expression are independent events in head and neck cancer: study of their association with clinical parameters. Cancer Lett 2005; 230: 141-148

56

References

Rohaly G, Chemnitz J, Dehde S, Nunez AM, Heukeshoven J, Deppert W, Dornreiter I. A novel human p53 isoform is an essential element of the ATR-intra-S phase checkpoint. Cell 2005; 122: 21-32 Romano RA, Birkaya B, Sinha S. A functional enhancer of keratin14 is a direct transcriptional target of deltaNp63. J Invest Dermatol 2007; 127: 1175-1186 Rossi M, Aqeilan RI, Neale M, Candi E, Salomoni P, Knight RA, Croce CM, Melino G. The E3 ubiquitin ligase Itch controls the protein stability of p63. Proc Natl Acad Sci U S A 2006a; 103: 12753-12758 Rossi M, De Simone M, Pollice A, Santoro R, La Mantia G, Guerrini L, Calabro V. Itch/AIP4 associates with and promotes p63 protein degradation. Cell Cycle 2006b; 5: 1816-1822 Schlecht NF, Burk RD, Adrien L, Dunne A, Kawachi N, Sarta C, Chen Q, Brandwein-Gensler M, Prystowsky MB, Childs G, Smith RV, Belbin TJ. Gene expression profiles in HPV-infected head and neck cancer. J Pathol 2007; 213: 283-293 Schmale H, Bamberger C. A novel protein with strong homology to the tumor suppressor p53. Oncogene 1997; 15: 1363-1367 Schrijvers AH, Quak JJ, Uyterlinde AM, van Walsum M, Meijer CJ, Snow GB, van Dongen GA. MAb U36, a novel monoclonal antibody successful in immunotargeting of squamous cell carcinoma of the head and neck. Cancer Res 1993; 53: 4383-4390 Screaton GR, Bell MV, Jackson DG, Cornelis FB, Gerth U, Bell JI. Genomic structure of DNA encoding the lymphocyte homing receptor CD44 reveals at least 12 alternatively spliced exons. Proc Natl Acad Sci U S A 1992; 89: 12160-12164 Serber Z, Lai HC, Yang A, Ou HD, Sigal MS, Kelly AE, Darimont BD, Duijf PH, Van Bokhoven H, McKeon F, Dotsch V. A C-terminal inhibitory domain controls the activity of p63 by an intramolecular mechanism. Mol Cell Biol 2002; 22: 8601-8611 Shiboski CH, Schmidt BL, Jordan RC. Tongue and tonsil carcinoma: increasing trends in the U.S. population ages 20-44 years. Cancer 2005; 103: 1843-1849 Shimada A, Kato S, Enjo K, Osada M, Ikawa Y, Kohno K, Obinata M, Kanamaru R, Ikawa S, Ishioka C. The transcriptional activities of p53 and its homologue p51/p63: similarities and differences. Cancer Res 1999; 59: 2781-2786 Shirai K, O'Brien PE. Molecular targets in squamous cell carcinoma of the head and neck. Curr Treat Options Oncol 2007; 8: 239-251

57

References

Slavotinek AM, Tanaka J, Winder A, Vargervik K, Haggstrom A, Bamshad M. Acro-dermato-ungual-lacrimal-tooth (ADULT) syndrome: report of a child with phenotypic overlap with ulnar-mammary syndrome and a new mutation in TP63. Am J Med Genet A 2005; 138: 146-149 Socialstyrelsen: Cancerregistret, http://www.socialstyrelsen.se/Statistik/statistik_amne/Cancer/cancerregistret.htm, 2006 Subbaramaiah K, Altorki N, Chung WJ, Mestre JR, Sampat A, Dannenberg AJ. Inhibition of cyclooxygenase-2 gene expression by p53. J Biol Chem 1999; 274: 10911-10915 Sun XF. p73 overexpression is a prognostic factor in patients with colorectal adenocarcinoma. Clin Cancer Res 2002; 8: 165-170 Syrjanen S. Human papillomavirus (HPV) in head and neck cancer. J Clin Virol 2005; 32 Suppl 1: S59-66 Tabor MP, Brakenhoff RH, Ruijter-Schippers HJ, Kummer JA, Leemans CR, Braakhuis BJ. Genetically altered fields as origin of locally recurrent head and neck cancer: a retrospective study. Clin Cancer Res 2004; 10: 3607-3613 Tabor MP, Brakenhoff RH, Ruijter-Schippers HJ, Van Der Wal JE, Snow GB, Leemans CR, Braakhuis BJ. Multiple head and neck tumors frequently originate from a single preneoplastic lesion. Am J Pathol 2002; 161: 1051-1060 Takahashi K, Paladini RD, Coulombe PA. Cloning and characterization of multiple human genes and cDNAs encoding highly related type II keratin 6 isoforms. J Biol Chem 1995; 270: 18581-18592 Takeyama K, Jung B, Shim JJ, Burgel PR, Dao-Pick T, Ueki IF, Protin U, Kroschel P, Nadel JA. Activation of epidermal growth factor receptors is responsible for mucin synthesis induced by cigarette smoke. Am J Physiol Lung Cell Mol Physiol 2001; 280: L165-172 Terakado N, Shintani S, Yano J, Chunnan L, Mihara M, Nakashiro K, Hamakawa H. Overexpression of cyclooxygenase-2 is associated with radioresistance in oral squamous cell carcinoma. Oral Oncol 2004; 40: 383-389 Thurfjell N, Coates PJ, Uusitalo T, Mahani D, Dabelsteen E, Dahlqvist A, Sjostrom B, Roos G, Nylander K. Complex p63 mRNA isoform expression patterns in squamous cell carcinoma of the head and neck. Int J Oncol 2004; 25: 27-35

58

References

Tokuchi Y, Hashimoto T, Kobayashi Y, Hayashi M, Nishida K, Hayashi S, Imai K, Nakachi K, Ishikawa Y, Nakagawa K, Kawakami Y, Tsuchiya E. The expression of p73 is increased in lung cancer, independent of p53 gene alteration. Br J Cancer 1999; 80: 1623-1629 Trink B, Osada M, Ratovitski E, Sidransky D. p63 transcriptional regulation of epithelial integrity and cancer. Cell Cycle 2007; 6: 240-245 Tsujii M, DuBois RN. Alterations in cellular adhesion and apoptosis in epithelial cells overexpressing prostaglandin endoperoxide synthase 2. Cell 1995; 83: 493-501 Tsujii M, Kawano S, DuBois RN. Cyclooxygenase-2 expression in human colon cancer cells increases metastatic potential. Proc Natl Acad Sci U S A 1997; 94: 3336-3340 van Bokhoven H, Hamel BC, Bamshad M, Sangiorgi E, Gurrieri F, Duijf PH, Vanmolkot KR, van Beusekom E, van Beersum SE, Celli J, Merkx GF, Tenconi R, Fryns JP, Verloes A, Newbury-Ecob RA, Raas-Rotschild A, Majewski F, Beemer FA, Janecke A, Chitayat D, Crisponi G, Kayserili H, Yates JR, Neri G, Brunner HG. p63 Gene mutations in eec syndrome, limb-mammary syndrome, and isolated split hand-split foot malformation suggest a genotype-phenotype correlation. Am J Hum Genet 2001; 69: 481-492 Wang SJ, Bourguignon LY. Hyaluronan and the interaction between CD44 and epidermal growth factor receptor in oncogenic signaling and chemotherapy resistance in head and neck cancer. Arch Otolaryngol Head Neck Surg 2006; 132: 771-778 Wang SJ, Wreesmann VB, Bourguignon LY. Association of CD44 V3-containing isoforms with tumor cell growth, migration, matrix metalloproteinase expression, and lymph node metastasis in head and neck cancer. Head Neck 2007; 29: 550-558 Westfall MD, Joyner AS, Barbieri CE, Livingstone M, Pietenpol JA. Ultraviolet radiation induces phosphorylation and ubiquitin-mediated degradation of DeltaNp63alpha. Cell Cycle 2005; 4: 710-716 Wolf D, Harris N, Goldfinger N, Rotter V. Isolation of a full-length mouse cDNA clone coding for an immunologically distinct p53 molecule. Mol Cell Biol 1985; 5: 127-132 Wu Y, Liu H, Li J. Expression of p63 and cyclooxygenase-2 and their correlation in skin tumors. J Huazhong Univ Sci Technolog Med Sci 2007; 27: 206-208 Yang A, Kaghad M, Wang Y, Gillett E, Fleming MD, Dotsch V, Andrews NC, Caput D, McKeon F. p63, a p53 homolog at 3q27-29, encodes multiple products with transactivating, death-inducing, and dominant-negative activities. Mol Cell 1998; 2: 305-316

59

References

Yang A, Schweitzer R, Sun D, Kaghad M, Walker N, Bronson RT, Tabin C, Sharpe A, Caput D, Crum C, McKeon F. p63 is essential for regenerative proliferation in limb, craniofacial and epithelial development. Nature 1999; 398: 714-718 Yang A, Walker N, Bronson R, Kaghad M, Oosterwegel M, Bonnin J, Vagner C, Bonnet H, Dikkes P, Sharpe A, McKeon F, Caput D. p73-deficient mice have neurological, pheromonal and inflammatory defects but lack spontaneous tumours. Nature 2000; 404: 99-103 Yang F, Zeng Q, Yu G, Li S, Wang CY. Wnt/beta-catenin signaling inhibits death receptor-mediated apoptosis and promotes invasive growth of HNSCC. Cell Signal 2006; 18: 679-687 Yin Y, Stephen CW, Luciani MG, Fahraeus R. p53 Stability and activity is regulated by Mdm2-mediated induction of alternative p53 translation products. Nat Cell Biol 2002; 4: 462-467 Yu Z, Weinberger PM, Provost E, Haffty BG, Sasaki C, Joe J, Camp RL, Rimm DL, Psyrri A. beta-Catenin functions mainly as an adhesion molecule in patients with squamous cell cancer of the head and neck. Clin Cancer Res 2005; 11: 2471-2477 Zaika AI, Kovalev S, Marchenko ND, Moll UM. Overexpression of the wild type p73 gene in breast cancer tissues and cell lines. Cancer Res 1999; 59: 3257-3263 Reference list updated 2008-01-07

60

p63 and potential p63 targets in squamous cell carcinoma of the head and neck

Documents

Transcript of p63 and potential p63 targets in squamous cell carcinoma of the head and neck