Overexpression of yeast karyopherin Pse1p/Kap121p ... · Overexpression of yeast karyopherin...

Overexpression of yeast karyopherin Pse1p/Kap121pstimulates the mitochondrial import of hydrophobicproteins in vivo

M. Corral-Debrinski,1 N. Belgareh,2 C. Blugeon,1 M. G.

Claros,3 V. Doye2 and C. Jacq1*1Ecole Normale SupeÂrieure, Laboratoire de GeÂneÂtique

MoleÂculaire URA CNRS 1302, 46 Rue d'Ulm, 75230 Paris

Cedex 05, France.2Institue Curie, CNRS UMR 144, 26 Rue d'Ulm, 75248

Paris Cedex 05, France.3Departamento de BiologõÂa Molecular y BioquõÂmica,

Facultad de Ciencias, Instituto Andaluz de BiotecnologõÂa,

Universidad de MaÂlaga, E-29071 MaÂlaga, Spain.

Summary

During evolution, cellular processes leading to the

transfer of genetic information failed to send all the

mitochondrial genes into the nuclear genome. Two

mitochondrial genes are still exclusively located in the

mitochondrial genome of all living organisms. They

code for two highly hydrophobic proteins: the apo-

cytochrome b and the subunit I of cytochrome oxidase.

Assuming that the translocation machinery could not

ef®ciently transport long hydrophobic fragments, we

searched for multicopy suppressors of this physical

blockage. We demonstrated that overexpression of

Pse1p/Kap121p or Kap123p, which belong to the

superfamily of karyopherin b proteins, facilitates the

translocation of chimeric proteins containing several

stretches of apocytochrome b fused to a reporter mito-

chondrial gene. The effect of PSE1/KAP121 over-

expression (in which PSE1 is protein secretion

enhancer 1) on mitochondrial import of the chimera

is correlated with an enrichment of the correspond-

ing transcript in cytoplasmic ribosomes associated

with mitochondria. PSE1/KAP121 overexpression also

improves the import of the hydrophobic protein

Atm1p, an ABC transporter of the mitochondrial inner

membrane. These results suggest that in vivo PSE1/

KAP121 overexpression facilitates, either directly or

indirectly, the co-translational import of hydrophobic

proteins into mitochondria.

Introduction

The majority of mitochondrial proteins are encoded by the

nuclear genome, translated in the cytoplasm, and trans-

located into the organelle. However, all the mitochondrial

genomes known so far always contain two genes, coding

for apocytochrome b and for the subunit I of cytochrome

oxidase. This speci®c feature suggests that the mitochon-

drial import machinery cannot cope with some properties

shared by these two proteins. Genetic engineering of the

yeast apocytochrome b coding sequence has shown that

two or more of its transmembrane segments can not be

imported easily to mitochondria. Therefore, a combination

of hydrophobicity characteristics, designated as meso-

hydrophobicity, distinguish proteins that cannot be mito-

chondrially imported (Claros et al., 1995). Usually,

proteins delivered to mitochondria have at their amino

terminal region a mitochondrial targeting sequence (mts)

characterized by positive charges and amphiphilicity,

which is related to the folding tightness of the attached

passenger protein. Hydrophobic proteins, such as the

ATPase subunit 9 of Neurospora crassa (F0-9), have a par-

ticularly long mts spanning the two mitochondrial mem-

branes, a feature that accelerates the unfolding of the

precursor (Matouschek et al., 1997). Early recognition of

the precursor via mts identi®cation is certainly a critical

step in the import process (Cartwright et al., 1997; George

et al., 1998). Cytosolic factors interacting directly with the

mts are involved in the delivery of the protein to the mito-

chondrial surface. The precursor is subsequently recog-

nized by the translocase of the outer mitochondrial

membrane (TOM), which, together with the translocase

of the inner mitochondrial membrane (TIM), accomplishes

transportation across both membranes. These mechan-

isms have been the focus of intensive research, resulting

in an elaborate picture of the process as a whole (for

reviews, see Schatz, 1996; Neupert, 1997). In vitro, a

very tight coupling between precursor synthesis and

membrane transport was observed when the translation

of several precursors was performed in the presence of

mitochondria, indicating a co-translational import mechan-

ism (Fujiki and Verner, 1991; 1993; Verner, 1993). In addi-

tion, it has been reported that ribosomes are speci®cally

associated with the mitochondrial surface (Kellems and

Butow, 1974; Kellems et al., 1974; 1975; Pon et al.,

Molecular Microbiology (1999) 31(5), 1499±1511

Q 1999 Blackwell Science Ltd

Received 9 September, 1998; revised 30 November, 1998; accepted3 December, 1998. *For correspondence. E-mail [email protected]; Tel. (�33) 144 323 546; Fax (�33) 144 323 570.

1989), where they can actively translate mitochondrial

proteins and be involved in the co-translational transport

of nascent precursors (Ades and Butow, 1980; Suissa

and Schatz, 1982; Pon et al., 1989).

To test whether cellular sorting of highly hydrophobic

proteins could reveal new elements of the mitochondrial

import machinery, we initiated studies to identify proteins

that when overproduced would permit the mitochon-

drial import of a reporter protein fused to transmembrane

domains of the apocytochrome b. Unexpectedly, we found

that two multicopy suppressors encode Pse1p/Kap121p

and Kap123p. These highly similar proteins belong to the

karyopherin b family, which carries proteins and/or RNAs

through the nuclear pore complexes (NPC) (GoÈrlich,

1997; Rout et al., 1997; Schlenstedt et al., 1997; Seedorf

and Silver, 1997). We propose that, either directly or

indirectly, PSE1/KAP121 overexpression facilitates the

co-translational import of hydrophobic proteins.

Results

Respiration de®ciency of CW02 cells can be

corrected by the overexpression of PSE1/KAP121

To study the inhibitory effects of protein hydrophobicity on

the mitochondrial import process, we previously constructed

a universal code version of apocytochrome b (Claros et al.,

1995). Several chimeric proteins were designed to be cyto-

plasmically translated and targeted to mitochondria. They

were named according to the presence of the N. crassa

ATPase subunit 9 mts (S) and to the presence of the differ-

ent apocytochrome b transmembrane helices (1±8) and

the bI4 RNA maturase (M). This last protein acts as a

reporter to complement the bI4 intron deletion and is

involved in apocytochrome b and cytochrome oxidase sub-

unit I (COXI ) mRNA maturation (Banroques et al., 1986;

1987). We previously demonstrated that CW02 cells

expressing either S12345M or S678M chimeric proteins

are unable to grow on glycerol medium, indicating that

these proteins were not imported into the mitochondria

to ful®l the maturase function (Claros et al., 1995). To iso-

late multicopy suppressors of this mitochondrial import

defect, CW02 cells producing these chimeras were trans-

formed with a genomic library constructed with a multicopy

vector (Claros et al., 1996). One of the most active sup-

pressor genes turned out to code for a C-terminal trun-

cated version of the 1089-amino-acid Pse1p/Kap121p

protein, a member of the karyopherin b family (Rout

et al., 1997; Seedorf and Silver, 1997). This truncated ver-

sion, which contains the 600 N-terminal amino acids of

Pse1p, will be referred to hereafter as PSE1-t. The entire

PSE1 gene was obtained by PCR and tested for its ability

to restore CW02 cell respiration in the presence of S1234M,

S12345M, S56M or S678M chimeras. As shown in Fig. 1A

for the S12345M and S678M constructs, the 600 N-terminal

amino-acid form of Pse1p/Kap121p (PSE1-t 600) and the

full-length protein (PSE1 ) were equally able to restore

CW02 cell respiration. To determine whether shorter ver-

sions of Pse1p/Kap121p remained active in this assay, we

constructed different truncated versions of PSE1/KAP121.

We observed that a protein composed of the 453 N-terminal

amino acids is still active (PSE1-t 453), whereas a shorter

protein with only the 265 N-terminal amino acids (PSE1-t

265) is not able to act as a multicopy suppressor

(Fig. 1A). To assess the exact role of the mitochondrial

targeting sequence (mts) in the in vivo assays, we con-

structed mts-less versions of some of the chimeric genes.

When the chimeric constructions S678M or S56M were

deleted for the presequence (S), no restoration of respira-

tion for the CW02 strain was observed upon overexpres-

sion of PSE1 or PSE1-t (Fig. 1B). This result indicates

that the PSE1-driven translocation of the cytoplasmically

made chimeras requires the presence of a mts and is likely to

be dependent on the major mitochondrial import system.

The C-terminal truncated form of Pse1p/Kap121p

does not complement the lethal phenotype of

the pse1 disruption and is not associated with the

NPCs

Pse1p/Kap121p is essential for yeast growth (Seedorf

and Silver, 1997). When heterozygous diploids, in which

one copy of PSE1 was replaced by TRP1, were trans-

formed with the PSE1-t plasmid, only two viable Trpÿ

spores were obtained per tetrad after asci dissection, indi-

cating that the C-terminal region of Pse1p is required for its

essential function. Both full-length and truncated Pse1p

were tagged with the green ¯uorescent protein (GFP).

GFP-Pse1p rescues the lethal phenotype of the PSE1 dis-

ruption. In addition, GFP-PSE1 or GFP-PSE1-t, when

overexpressed, restore CW02 cell respiration, and thus

the fusion proteins behave as the untagged proteins

(data not shown). Western blot analysis revealed that

both fusion proteins migrated at the expected sizes and

were expressed at similar levels (Fig. 2A). Subcellular local-

ization of GFP-Pse1p, examined by ¯uorescence micro-

scopy, revealed a perinuclear labelling together with some

cytoplasmic and intranuclear staining. When expressed

in nup133ÿ cells that display a constitutive NPC clustering

phenotype (Doye et al., 1994), GFP-Pse1p was localized

to one or only a few clusters around the nuclear envelope,

indicating that Pse1p/Kap121p interacts with nuclear pore

proteins. In contrast, GFP-Pse1p-t did not accumulate at

the nuclear periphery in wild-type cells and was not local-

ized to NPC clusters in nup133 cells (Fig. 2B). Thus, the

C-terminal region of Pse1p, which is dispensable in our

mitochondrial assay, is required for both its essential

function and subcellular localization.

Q 1999 Blackwell Science Ltd, Molecular Microbiology, 31, 1499±1511

1500 M. Corral-Debrinski et al.


Fig. 1. Cytoplasmically made bI4 RNA maturasefused to apocytochrome b fragments, with afunctional mts, complement mitochondrialde®ciencies when PSE1/KAP121 isoverexpressed.A. The nomenclature of the set of chimericproteins (upper part) is: S 1 . . . 8 M, in which Srefers to the mts of the subunit 9 of the ATPaseof N. crassa (Fo9-ts), 1 . . . . 8 to thecorresponding transmembrane helices ofapocytochrome b , and M to the bI4 RNAmaturase. CW02 cells transformed with multicopyvectors directing the expression of the S12345M(left) or the S678M (right) chimera do not growon glycerol (control). Overexpression of the entirePSE1 gene (PSE1 ) or its truncated versionsPSE1-t 600 and PSE1-t 453, which code, respec-tively, for 600 and 453 amino-acid N-terminalforms of Pse1p, restores the ability of CW02 togrow on glycerol. In contrast, the 265 N-terminalamino-acid form of Pse1p/Kap121p (PSE1-t 265)is unable to rescue CW02 cell respiration.B. PSE1-t represents the construct encoding the600 N-terminal amino acids of Pse1p/Kap121p.CW02 strains overexpressing PSE1 or PSE1-tand transformed with multicopy vectors directingthe expression of the S56M or the S678Mchimera are able to grow on glycerol. In contrast,overexpression of the 56M or 678M mts-lesssequences does not rescue CW02 respiration.Transformant cells were grown on syntheticcomplete medium containing 2% glucose until anOD600 of 2. Two independent clones were seriallydiluted (1:5) and spotted either on syntheticmedium containing 2% glucose (glucose) or on2% glycerol medium (glycerol). The plates wereincubated at 308C for 2 days (glucose) or 8 days(glycerol).

Fig. 2. Expression and localization of GFP±Pse1p fusion proteins.A. Whole cell extract from BMA41 cells expressing GFP±Pse1p and GFP±Pse1p-t proteins were analysed by Western blotting usingantibodies directed against GFP and against Nup133p. Both GFP±Pse1p and GFP±Pse1p-t are produced at similar levels and migrated attheir expected sizes.B. Fluorescence microscopy of BMA41 and nup133ÿ living cells expressing GFP±Pse1p and GFP±Pse1p-t proteins showed that the full-length Pse1p fusion protein interacts with the NPC, whereas the truncated GFP±Pse1p-t is mainly cytosolic. Cells were also photographedwith Nomarski optics.

PSE1 overexpression improves mitochondrial protein delivery 1501

Overproduction of Kap123p but not Kap95p/Kap60p

facilitates mitochondrial import of hydrophobic

proteins

To determine whether the ability to restore CW02 cell

respiration in the presence of S12345M or S678M is

restricted to Pse1p/Kap121p, we tested two other karyo-

pherin b family members, Kap95p and Kap123p. These

proteins have in common a role in the traf®cking of mole-

cules across the nuclear pores and the ability to bind Ran,

an essential element of all the nucleocytoplasmic transport

processes studied so far (GoÈrlich, 1997; GoÈrlich et al.,

1997). Kap95p, known as karyopherin b1, is a soluble

transport protein that interacts with the nuclear localization

signal (NLS) receptor, Kap60p, to allow the translocation

of nuclear proteins across the NPC (for reviews, see GoÈr-

lich, 1997; Nigg, 1997). KAP123, the closest homologue

of PSE1/KAP121, was recently shown to be involved in

the nuclear import of ribosomal proteins, and its associa-

tion to mRNA export was also suggested (Rout et al., 1997;

Schlenstedt et al., 1997; Seedorf and Silver, 1997). A

recent report showed that Pse1p/Kap121p is also involved

in the nuclear import of the transcription factor Pho4p

(Kaffman et al., 1998). Figure 3 shows the respiration abil-

ity of CW02 cells expressing the S12345M or S678M con-

structs, and transformed with high-copy number plasmids

carrying KAP123 or KAP95 expressed under the control

of their endogenous promoters. We also transformed CW02

cells with a high-copy number vector carrying KAP60,

alone or in combination with the KAP95 plasmid. We

observed that Kap95p overproduction did not allow CW02

cells to grow on glycerol medium, even when KAP60 was

overexpressed at the same time. Interestingly, Kap123p,

like Pse1p/Kap121p, restores CW02 respiration for all the

chimeric constructs tested, indicating that overexpression

of only a subset of karyopherin b proteins interferes with

the mitochondrial phenotype described in this study.

Overproduction of Pse1p/Kap121p can usher an excess

of the ABC transporter Atm1p into mitochondria

Restoration of CW02 cell respiration by overexpression of

PSE1 and apocytochrome b domains fused to the maturase

implies the complete translocation of the chimera into the

mitochondrial matrix. It was therefore important to determine

the impact of PSE1 overexpression on the transport of

hydrophobic proteins which are naturally imported into mito-

chondria. For that purpose, we chose Atm1p, a recently

described ABC transporter of the mitochondrial inner mem-

brane (Leighton and Schatz, 1997). Atm1p contains six

putative transmembrane fragments, and its mesohydro-

phobicity level is very high although still compatible with

an in vivo mitochondrial import (Fig. 4A). To con®rm the

mitochondrial localization of Atm1p, we puri®ed mito-

chondria from cells expressing a C-terminal myc-tagged

version of Atm1p produced from a multicopy vector (Fig.

4B). Puri®ed mitochondria and mitoplasts were enriched

for Atm1p as they were for the mitochondrial Abf2 protein

(Caron et al., 1979; Dif¯ey and Stillman, 1991), in contrast

they lacked the nucleoporin Nup133p (Doye et al., 1994).


Fig. 3. PSE1/KAP121, KAP123, KAP95, KAP60and the mitochondrial import of hydrophobicchimeras. Experiments similar to those describedin Fig. 1 were carried out in CW02 cellstransformed with S12345M (left) or S678M (right)plasmids and overproducing Kap123p, Kap95p,Kap60p, or the combination of Kap95p andKap60p. Two independent clones for eachtransformation were serially diluted and grown onglucose (for 2 days) or glycerol (for 8 days).


To assess PSE1 overexpression effect on Atm1p mito-

chondrial translocation, puri®ed mitochondria from cells

producing an excess of Atm1p alone (control) or in combi-

nation with Pse1p (PSE1 ) or its truncated form (PSE1-t )

were treated with proteinase K (PK) and submitted to

Western blot analyses (Fig. 4C). The amounts of Cox2p

and Abf2p were successively determined and used to

normalize the Atm1-myc signal for each mitochondrial pre-

paration. Cox2p, encoded by the mitochondrial genome, is

located in the inner mitochondrial membrane and Abf2p,

encoded by the nuclear genome, is a highly hydrophilic pro-

tein which binds mitochondrial DNA in the mitochondrial


Fig. 4. PSE1 or PSE1-t overexpression improves the mitochondrial delivery of the ABC transporter Atm1p.A. Mitochondrial proteins used in this study are distributed according to their mesohydrophobicity values (which is an average regionalhydrophobicity value determined over a 60±80 residue window) and to the hydrophobicity of the most hydrophobic 17 residue segment(< H17>) using the MITOPROT II software (Claros and Vincens, 1996). The hatched area represents the border between proteins which can(lower part, left) or cannot be mitochondrially imported. Atm1p is highly hydrophobic, whereas Abf2p is very hydrophilic. Both Atm1p andAbf2p are encoded by the nuclear DNA whereas Cox1p and Cytbp are encoded by the mitochondrial genome.B. Mitochondria were prepared from CW04 cells overexpressing both PSE1 and Atm1p-myc (Leighton and Schatz, 1997). SDS±PAGE wasperformed on 30 mg of proteins from ®ve steps in the mitochondrial preparation: whole yeast, low-speed supernatant, crude mitochondria(Yaffe, 1991), sucrose gradient-puri®ed mitochondria (Sargueil et al., 1990) and mitoplasts obtained by osmotic shock (Yaffe, 1991). Ascontrol, crude mitochondria from wild-type cells was used (CW04 ). Immunoblotting was performed with the following antibodies: monoclonalantibody Myc-9E10, polyclonal antibody against Abf2p, and polyclonal antibodies against the nuclear envelope protein Nup133p. No signalwas detected in crude mitochondria prepared from wild-type cells (CW04 ), con®rming the identity of the revealed 76 kDa polypeptide with theprotein expressed from the ATM1-myc plasmid.C. Mitochondria were puri®ed from wild-type cells (CW04 ), or from cells overproducing the Atm1p-c-myc tagged protein and transformed withthe pFL44L multicopy vector (control) or with multicopy vectors carrying PSE1 or PSE1-t . Proteins (30 or 10 mg) from untreated mitochondriaor 30 mg of proteins from proteinase K-treated mitochondria (PK; 0.4 or 0.2 mg mlÿ1) were submitted to Western blots analyses using themonoclonal antibody 9E10 against the myc epitope, the monoclonal 4B12-A5 antibody against Cox2p and polyclonal antibody against Abf2p.D. Densitometric analysis of eight experiments performed with three independent mitochondria puri®cations allowed us, after normalization ofthe Atm1p-myc signal with Cox2p signal, to determine the fraction of myc-tagged Atm1p which was successfully translocated into themitochondria. We clearly observed that Atm1p is more sensitive to proteolysis in mitochondria puri®ed from control cells (control) than fromcells overproducing Pse1p (PSE1 ) or its truncated form (PSE1-t ). This difference was signi®cant according to the paired Student's t-test(P < 0.0004).


matrix (Caron et al., 1979; Dif¯ey and Stillman, 1991).

Results from eight independent experiments unambiguously

showed that overproduction of Pse1p or Pse1p-t stimulates

by four- to sixfold the mitochondrial import of Atm1p, as

measured by the accessibility of the tagged protein to pro-

teolysis (Fig. 4, C and D). Noteworthy, we observed that

wild-type amounts of Pse1p led to the mitochondrial deliv-

ery of only 6% of the plasmid-borne Atm1p. In contrast,

<30% were successfully imported into the organelle

when cells overproduced Pse1p/Kap121p or its truncated

form (Fig. 4, C and D). Therefore, the mitochondrial import

machinery is not able to translocate an excess of the hydro-

phobic Atm1p protein in wild-type conditions, but when

cells overproduced Pse1p/Kap121p or its truncated form

the ef®ciency of this translocation is signi®cantly improved.

PSE1/KAP121 overexpression also facilitates the

mitochondrial translocation of apocytochrome b

transmembrane domains

For a better de®nition of the effect of PSE1/KAP121 over-

expression on the mitochondrial import of highly hydropho-

bic proteins, we puri®ed mitochondria from cells expressing

the chimeric protein S56HA1. The precursor (pS56HA1)

and the mature form of the chimera (m56HA1) were equally

enriched in crude mitochondria and in mitochondria puri-

®ed on sucrose density gradients (Fig. 5A). The presence

of m56HA1 polypeptide, obtained after the cleavage of the

presequence by the matrix processing peptidase (MPP),

indicates that the precursor recognizes the TOM complex

and engages in the translocation process. Both pS56HA1

and m56HA1 polypeptides were equally abundant in mito-

chondria from wild-type cells (control) and from cells over-

producing either Pse1p (PSE1 ) or its truncated form

(PSE1-t ). This is true for chimeras expressed from a multi-

copy vector (Fig. 5B) or from a low-copy number vector

(Fig. 5C). Thus, the steady-state levels of the precursor

and its ability to recognize the TOM complex do not depend

on PSE1 overexpression. When mitochondria were treated

with proteinase K (PK) (Fig. 5B and C), we clearly observed

that m56HA1 was much less accessible to proteolysis in

mitochondria puri®ed from cells overproducing Pse1p

(PSE1 ) or its truncated version (PSE1-t ) compared with

control cells, as observed for the Atm1p-myc protein.

The amounts of Cox2p and Abf2p were determined and

used to normalize the m56HA1 signal for each mitochon-

drial preparation. In contrast to m56HA1, we did not

observe any difference in the proportion of Abf2p in PK-

treated mitochondria when Pse1p/Kap121p or its truncated

form were overproduced (Fig. 5B and C). Densitometric

analyses clearly showed that PK-treated mitochondria

from cells overexpressing PSE1 or its truncated form accu-

mulate ®ve- to sevenfold more of the m56HA1 protein than

PK-treated mitochondria from control cells, independently

of the vector used to direct S56HA1 synthesis (Fig. 5B and

C). These results indicate that in wild-type cells most of the

chimera undergoes the initial steps of mitochondrial import,

but <90% gets stuck across the membranes. In this

blocked situation, the most hydrophobic part of the protein

remains in the cytoplasm, whereas the mts is cleaved by

the MPP in the mitochondrial matrix (Fig. 5D, I). When

Pse1p or its truncated form is overexpressed, the import


Fig. 5. Overexpression of PSE or PSE1-t improves the mitochondrial import of the S56HA1 chimera.A. Mitochondria were prepared from CW04 cells overexpressing both S56HA1 and PSE1. SDS±PAGE was performed on 30 mg of proteinsfrom ®ve steps in the mitochondrial preparation: whole yeast, low-speed supernatant, crude mitochondria (Yaffe, 1991), sucrose gradient-puri®ed mitochondria (Sargueil et al., 1990) and mitoplasts obtained by osmotic shock (Yaffe, 1991). As control, crude mitochondria fromwild-type cells was used (CW04 ) Immunoblotting was performed with the following antibodies: monoclonal 12CA5 antibody against the HA1epitope, polyclonal antibody against Abf2p, and polyclonal antibodies against the nuclear envelope protein Nup133p. No signal was detectedin mitochondria puri®ed from the wild-type strain (CW04 ), con®rming that the revealed polypeptides of 22 kDa and 14 kDa, respectively, weresynthesized from the S56HA1 plasmid. Both precursor and mature forms of the chimera were equally abundant in crude mitochondria and inmitochondria puri®ed on a sucrose density gradient. As expected, in mitoplasts from crude mitochondria (CM) and puri®ed mitochondria (PM),we only detected the mature form.B. Mitochondria from CW04 cells producing the epitope-tagged S56HA1 protein encoded by a multicopy vector in combination with either thepFL44L vector (control) or PSE1 gene (PSE1 ) or its truncated version (PSE1-t ) were submitted to Western blot analyses. Left: 32 or 16 mgfrom untreated mitochondria or 32 mg of mitochondria treated with proteinase K (PK; 0.4 or 0.2 mg mlÿ1). Control of PK digestion was carriedout in the presence of 1% Triton X-100 (Triton). The following antibodies were used: monoclonal antibody 12CA5 against the HA1 epitope(upper panel), monoclonal antibody against Cox2p (middle panel) and polyclonal antibody against Abf2p (lower panel). Right: densitometricanalyses using the TINA software were performed to calculate the ratio between m56HA1 and Cox2p signals in intact mitochondria (±PK) or inPK-treated mitochondria (�PK). As a control, ratios were also calculated between the Abf2p and Cox2p signals for both intact and PK-treatedmitochondria. Six independent mitochondria puri®cations, with at least three blot analyses per preparation, were used for quanti®cations.C. Experiments similar to those presented in B were conducted using CW04 cells expressing the hydrophobic construct S56HA1 from a low-copy vector (three HA1 epitopes were fused to the apocytochrome b domains in this vector). The graphic on the right presents densitometricanalyses performed with three independent mitochondria puri®cations and at least three blot analyses per preparation. The difference inm56HA1 amounts, fully translocated into the mitochondrial matrix, in normal cells and in cells overexpressing PSE1 or PSE1-t is signi®cantaccording to the paired Student's t-test, P < 0.0004 with the multicopy vector and P < 0.0007 with the low-copy number vector.D. Schematic representation of mitochondrial import intermediates. (I) the hydrophobic passenger protein can be trapped en route to thematrix. This does not prevent the cleavage of the mitochondrial targeting sequence (S) by the mitochondrial protease (MPP), but leaves therest of the protein accessible to the action of the proteinase K (PK). (II) A fraction of the hydrophobic protein is completely translocated to thematrix, thus preventing its PK-induced proteolysis.


process is successful for more than 50% of the precursor,

as measured by the amount of the mature form resistant to

proteolysis (Fig. 5D, II).

PSE1/KAP121 overexpression leads to an enrichment

of the S56M transcript in the ribosome population

associated with mitochondria

It was previously shown that mitochondria-associated ribo-

somes can be recovered by isolating mitochondria in the

presence of Mg2� and cycloheximide (Kellems et al., 1975;

Ades and Butow, 1980; Suissa and Schatz, 1982).

These ribosomes were found to be enriched in mRNA spe-

cies coding for imported mitochondrial proteins, and it has

been suggested that they were probably bound to mito-

chondria by the nascent chains of these proteins (Ades

and Butow, 1980; Suissa and Schatz, 1982; Pon et al.,

1989; Cartwright et al., 1997; George et al., 1998). The

process controlling this asymmetric distribution is, for the

time being, largely speculative. In connection with these

observations, we studied the in¯uence of PSE1/KAP121

overexpression on the speci®c localization of the S56M

mRNA coding for the hydrophobic chimeric protein. We

®rst observed that the steady-state level of the S56M

mRNA was not modi®ed upon PSE1/KAP121 overexpres-

sion (Fig. 6A). We then puri®ed free cytoplasmic ribo-

somes (Fig. 6B, R) and mitochondria-bound ribosomes

(Fig. 6B, M) to analyse their respective mRNA contents.

ACT1 mRNA and cytochrome oxidase subunit III (COXIII )

mRNA were considered as internal controls for free cyto-

plasmic ribosomes and mitochondria-bound ribosomes

fractions respectively. The 1.8 kb S56M mRNA was mainly

found in mitochondria-bound ribosomes, as expected for a

mitochondrially targeted protein (Ades and Butow, 1980;

Suissa and Schatz, 1982). This transcript is poorly repre-

sented in the free cytoplasmic ribosome fraction and only

detectable by RT-PCR (data not shown). When PSE1 or

its truncated form was overexpressed, we consistently

observed a three- to fourfold increase of the S56M mRNA

level in mitochondria-bound ribosomes (Fig. 6, B and C).

These data suggest that PSE1/KAP121 overexpression

might, somehow, enhance the asymmetric subcellular

localization of a mRNA coding for a highly hydrophobic

protein fused to a mitochondrial targeting sequence.

Further studies are required to assess the generality of

this phenomenon.

Discussion

Stuck hydrophobic precursors can be driven into

mitochondria when PSE1/KAP121 is overexpressed

We have previously studied the inhibitory effects on mito-

chondrial import of diverse combinations of apocyto-

chrome b transmembrane helices (1±8). When these

hydrophobic domains were fused to the mts of F0 subunit

9 of N. crassa (S) and maturase (M) to create chimeric

proteins such as S12345M, S678M or S56M, the ability

to complement a mitochondrial maturase de®ciency was

totally abolished (Claros et al., 1995). Here, we demon-

strated that very little of the S56M hybrid is actually deliv-

ered to the mitochondrial matrix because the precursor


Fig. 6. S56M mRNA level is increased in mitochondria-bound ribosomes from cells overexpressing PSE1 or PSE1-t.A. Northern blots were performed with 15 mg of total RNAs prepared from CW04 cells co-transformed with the S56M low-copy number vectorand pFL44L (control) or PSE1 (PSE1) or PSE1-t (PSE1-t) plasmids. Filters were stained with a methylene blue solution (top) and successivelyprobed with the maturase oligonucleotide and the ACT1 coding sequence.B. RNAs were puri®ed from mitochondria-bound ribosomes (M) and from free cytoplasmic ribosomes (R) fractions obtained from wild-typecells (CW04), CW04 cells co-transformed with the S56M low-copy number vector and pFL44L (control) or with either PSE1 (PSE1 ) or PSE1-t(PSE1-t ) plasmids. Before hybridization, membranes were stained with a methylene blue solution (top). Northern blot analyses wereperformed using successively ACT1, COXIII and maturase probes. Maturase probe revealed a 1.8 kb species corresponding to the S56MmRNA, longer exposure times revealed the signal for the apocytochrome b 3.6 kb RNA precursor, which contains the bI4 intron (not shown).C. Densitometric analyses of three independent experiments were performed using phosphorimager and TINA software systems. Ratiosbetween the S56M and COXIII signals are represented.


gets stuck between both membranes. This transport block

does not preclude the N-terminal cleavage of the precursor

by the matrix processing protease MPP. Such intermedi-

ates, spanning both mitochondrial membranes, have

been widely used in vitro to study the mitochondrial import

machinery and they have also been detected in vivo (Pon

et al., 1989; Schulke et al., 1997). Our genetic screen

revealed that overproduction of either Pse1p/Kap121p or

its C-terminal truncated versions improves the ability of

several combinations of apocytochrome b fragments fused

to the maturase to complement mitochondrial maturase

de®ciency. Biochemical analyses demonstrated that this

effect is unambiguously due to a more ef®cient delivery

of the chimeric protein into the mitochondrial matrix. The

fact that the Pse1p/Kap121p's effect entirely relies on the

presence of the mts indicates that its overproduction

acts in collaboration with the classical TOM/TIM mitochon-

drial import machinery (for reviews, see Neupert, 1997;

Schatz, 1996). Moreover, PSE1/KAP121 overexpression

can stimulate mitochondrial translocation of Atm1p, a

recently characterized hydrophobic protein (Leighton and

Schatz, 1997). These data strongly suggest that PSE1/

KAP121 overexpression actually improves, directly or

indirectly, a limiting step in the mitochondrial delivery of

hydrophobic proteins.

Connections between karyopherins b and the

mitochondrial import process

Structurally, Pse1p/Kap121p belongs to the karyopherin b

superfamily of proteins which bind Ran (GoÈrlich et al.,

1997; Rout et al., 1997; Schlenstedt et al., 1997; Seedorf

and Silver, 1997). All of these proteins share the same

set of motifs in their amino-terminal regions: the CRIME

motifs, the acidic domain and the ARM1±ARM2 domains

(Fornerod et al., 1997; Schlenstedt et al., 1997). Among

the karyopherins, Kap123p shares the closest homology

with Pse1p/Kap121p and showed similar effects on the

mitochondrial import of hydrophobic proteins. In contrast,

overproduction of Kap95p alone or in combination with

Kap60p did not have any effect on mitochondrial import,

con®rming that this phenotype is restricted to a subset of

karyopherins b. In the movement of macromolecules in

and out of the nucleus, two different functions have been

proposed for Pse1p/Kap121p and Kap123p. These karyo-

pherins could either control the nuclear import of ribo-

somal proteins (GoÈrlich et al., 1997; Rout et al., 1997;

Schlenstedt et al., 1997) or be involved in the nuclear

export of mRNAs (Seedorf and Silver, 1997). A recent

report showed that Pse1p/Kap121p is also involved in the

nuclear import of the transcription factor Pho4p (Kaffman

et al., 1998). How could PSE1/KAP121 overexpression

modify the nucleocytoplasmic traf®c? It seems that karyo-

pherins might act in dynamic competition to transport

more or less distinct classes of substrates (Rout et al.,

1997). In that respect, amino-terminal deletions of karyo-

pherin b1(Kutay et al., 1997) and Kap123p (Schlenstedt et

al., 1997) were shown to block bidirectional traf®c across

the NPC. In our system, a dynamic competition might be

in¯uenced by Pse1p/Kap121p overproduction and speci-

®c pathways of the nucleocytoplasmic traf®c may be modi-

®ed, particularly when the truncated form, poorly localized

to the nuclear envelope, is overexpressed.

PSE1 overexpression might improve the co-translational

import of hydrophobic proteins

Because we observed that PSE1/KAP121 overexpres-

sion does not quantitatively modify the steady-state levels

of either the hybrid mRNA or the corresponding protein,

we can discard the possibility that Pse1p/Kap121p could

control the transcription or translation of the chimera.

Instead, high levels of Pse1p/Kap121p lead to a success-

ful translocation of the hydrophobic protein into the mito-

chondria. It is then possible that translation might be

modi®ed in a way that prevents aggregation of the apo-

cytochrome b helices, bene®cially maintaining unfolded

structures required for the import. This is reminiscent of

a long-standing hypothesis in which mitochondrial import

could be a co-translational process (Ades and Butow,

1980; Suissa and Schatz, 1982; Verner, 1993). Although

controversial, this process is generally envisaged either

for subclasses of mitochondrially imported proteins (Neu-

pert, 1997) or during special growth conditions (Reid and

Schatz, 1982; Schatz and Butow, 1983). Recent reports

strengthen this hypothesis because both the nascent poly-

peptide-associated complex (NAC) and Mft52p, a protein

that binds both the presequence and Tom20p, co-operate

in initiating mitochondrial protein targeting in vivo (Cart-

wright et al., 1997; George et al., 1998). Therefore, hydro-

phobic proteins delivery to the mitochondria could actually

rely on a tight coupling between both translation and

import processes. It has been shown that mRNAs for dif-

ferent imported mitochondrial polypeptides are enriched

in mitochondria-bound polysomes fractions (Ades and

Butow, 1980; Suissa and Schatz, 1982). In our hands, mito-

chondria-bound ribosomes puri®ed from cells overpro-

ducing Pse1p/Kap121p are actually enriched in the mRNA

coding for the hydrophobic protein S56M. Further studies

are required to generalize this phenomenon to additional

hydrophobic protein messengers. Nevertheless, we postu-

late that the enrichment of mRNA species coding for hydro-

phobic proteins in mitochondria-bound ribosomes could

favour the co-translational import of this kind of protein

into the organelle.

Considering the possible role of mRNA binding proteins

in the transport of mRNAs through the cytosol, some rela-

tionships between mRNA export and mitochondrial protein



transport were proposed (Lithgow et al., 1997). In this

respect, it is worth remembering that a mutation in Npl3p,

an essential protein involved in mRNA traf®cking between

the nucleus and the cytoplasm (Bossie et al., 1992; Flach

et al., 1994; Singleton et al., 1995), restores the mitochon-

drial delivery of the ATPase subunit b, in which the tar-

geting signal was corrupted (Ellis and Reid, 1993).

Interestingly, the mammalian ATPase b mRNA was located

in the vicinity of mitochondria. A role for this localization in

fast tracking the sorting of the precursor protein to its mito-

chondrial destination has been suggested (Egea et al.,

1997; Izquierdo and Cuezva, 1997; Lithgow et al., 1997).

We therefore favour the hypothesis that PSE1/KAP121

overexpression can, either directly or indirectly, improve

the coupling between mRNA-speci®c localization/trans-

lation and mitochondrial import processes. Studies aimed

at generalizing mRNA-speci®c delivery and translation in

the vicinity of mitochondria for other hydrophobic proteins

and at characterizing sequences responsible for the asym-

metric distribution of mitochondrial transcripts are currently

in progress.

Experimental procedures

Yeast strains and growth conditions

All of the S. cerevisiae strains used in this study are isonuclearwith the strain W303-1B (MATa, leu2-3; ura 3-1; trp1-1, ade1-2,his3-11, can1-100 ). CW02 and CW04 strains were obtainedas described previously (Conde and Fink, 1976; Dujardin etal., 1980). CW02 cells do not possess the bI4 maturase activ-ity and are therefore unable to respire because the splicing ofthe aI4 intron in the precursor of COXI messenger does notoccur. CW04 cells used for mitochondria puri®cation possessa functional bI4 RNA maturase.

For PSE1 disruption, the BMA41 diploid strain was used(MATa/MATa, ura3-1/ura3-1, ade2-1/ade2-1, leu2-3,112/leu2-3,112, his3-11,15/his3-11,15, Dtrp1/Dtrp1 ). The diploidstrain disrupted for one pse1 locus was called MCD01(MATa/MATa, ura3-1/ura3-1, ade2-1/ade2-1, leu2-3,112,leu2-3,112, his3-11,15/his3-11,15, Dtrp1/Dtrp1, PSE1/pse1::TRP1 ). For GFP-Pse1p localization, the nup133ÿ

strain was used (Doye et al., 1994). Strains were grown at308C in rich medium (1% yeast extract, 2% peptone, 2% glu-cose and 30 mg mlÿ1 adenine) in glycerol medium (1% yeastextract, 2% peptone and 2% glycerol) or synthetic mediumcontaining 2% glucose supplemented with the appropriatenutritional requirements. For solid medium, 2% agar wasadded. Yeast cells were transformed using a simpli®ed lithiummethod (Gietz et al., 1992).

Plasmids and DNA manipulations

All bacteriological analyses and DNA manipulations were per-formed as previously described (Sambrook et al., 1989). Oligo-nucleotides used in this study are shown in Table 1.

Vectors used to express the S 1. . .8 M chimera [in which Srefers to the mts of the subunit 9 of the ATPase of N. crassa(Fo9-mts); 1±8, to the corresponding transmembrane helicesof apocytochrome b; and M to the bI4 RNA maturase] derivefrom the YEpJB1-21-2 plasmid (Banroques et al., 1986; 1987).Constructions devoid of the Fo9-mts were obtained by cloningsequences coding for apocytochrome b helices in the YEpBJ1-20-2 plasmid (Claros et al., 1995; 1996). To construct themulticopy vector expressing S56HA1, DNA encoding the nine-amino-acid epitope of in¯uenza virus haemagglutinin HA1was inserted after helices 5 and 6 of the apocytochromeb sequence. For the low-copy number vector expressingS56HA1, three HA1 epitopes were added after helices 5and 6 of the apocytochrome b sequence. The screen for multi-copy suppressors improving the delivery of highly hydrophobicproteins into the mitochondria was performed as previously


Table 1. Oligonucleotides used in this study.

58 Primer 38 Primer PCR product AUG position (bp)58±38 58±38 length (bp) STOP position (bp)

PSE1/KAP121 gataaaggatccaatagc gtctttggatccatcatttc 3970 � 365ctatcatggactatctg cttatccattgccgc � 3550

KAP123/YRB4 cgcatagtcgacaattca tcgtcagtcgacttacattt 4370 � 405caatgtaccaataattttta gtacaagaccaatatccg � 3744ctat gggc

KAP95 gcccatggatcctgttcc cattatggatccgggtac 3960 � 680gggggtggttgccaagt ctgctcattcgcattaccat � 3260ttcacta acat

KAP60 ccactaacgataagacat cgcctgttagatctttcag 2547 � 588ctgctattagcc ctgtggatatt � 2210

GFP tccatccacgtgatggtg gccgctcacgtggtaca 714 � 13agcaagggcgaggagc gctcgtccatgccgaga None, in frame with PSE1tgttca gtgatc

COXIII tattacctgcgattaaggcatgatgactat

Maturase atctaataggcttaacacctgatc


described (Claros et al., 1996). The sequence coding for the453 N-terminal amino acids of Pse1p/Kap121p was clonedusing the unique NaeI site present in the original pFL44L-PSE1-t vector. Gene sequences coding for full-length Pse1p,its 265 N-terminal amino-acid form, Kap123p, Kap60p andKap95p were obtained by a 16 cycle PCR ampli®cation,using as template yeast genomic DNA and the rTth DNA poly-merase XL (Perkin-Elmer Cetus) (Barnes, 1994). The DNAfrom PCR products was cloned in both high-copy number(pFL44L) and low-copy number (pFL38) vectors (Bonneaudet al., 1991).

PSE1 gene disruption and subcellular localization of

the corresponding protein

Two kilobases of the PSE1 coding sequence, including theAUG codon, was removed and replaced by the TRP1 gene.This sequence was used to disrupt the PSE1 chromosomallocus of the BMA41 strain. Tryptophan prototrophs obtainedwere checked by Southern blot and PCR analyses to con®rmthat PSE1 was correctly disrupted. The MCD01 strain obtainedwas sporulated and dissected. Each tetrad yielded only twoviable spores, which were trp1ÿ. To obtain the GFP±PSE1and GFP±PSE1-t fusion genes, the GFP-coding sequenceof pEGFP-N3 (Clonetech Laboratories) was ampli®ed byPCR using the Pfu protein and cloned in frame at the uniquePml I site of the PSE1 and PSE1-t vectors, located 27 nucleo-tides upstream of the PSE1 AUG codon. Therefore, the initia-tion codon for these fusion proteins is the GFP one, PSE1ORF being in frame with the last amino acid of the GFP andnine additional amino acids before the authentic PSE1 AUG(AIARTVTTSI).

Living cells expressing the GFP-tagged proteins wereobserved by ¯uorescence with a chilled CCD camera (Hama-matsu Photonics) as previously described (Doye et al., 1994).Whole cell extracts from BMA41 strains expressing the GFP±Pse1p or GFP±Pse1p-t proteins were prepared using glassbeads. Twenty micrograms of protein was applied on 8%SDS-polyacrylamide gels. Immune sera were used at dilutions1:250 for af®nity-puri®ed anti-Nup133p (Doye et al., 1994)and 1:2000 for polyclonal anti-GFP (Clontech).

Mitochondria puri®cation

Mitochondria were puri®ed either by successive centrifuga-tions or sucrose density gradients as described previously(Sargueil et al., 1990; Yaffe, 1991). To determine the fractionof the C-terminally tagged proteins which have been trans-located into the organelle, mitochondria were treated with200 or 400 mg mlÿ1 of proteinase K (PK) at 08C for 15 min. Ascontrol for protease accessibility, PK digestion was performedin the presence of 1% Triton X-100, a detergent that disruptsboth mitochondrial membranes. The proteolysis of the taggedprotein con®rms its location, somewhere in the organelle, in aprotease-sensitive form.

Western blot analyses

Proteins were resolved in SDS±PAGE and transferred to nitro-cellulose (Sambrook et al., 1989). Filters were probed with the

following antibodies: mouse monoclonal antibody 12CA5against the HA1 epitope (1:5000); mouse monoclonal anti-body 9E10 against the myc epitope (1:5000); rabbit polyclonalantibody against Abf2p (1:10 000); mouse monoclonal anti-body 4B12-A5 against Cox2p (1:10 000). Immunoreactivebands were visualized with either anti-mouse or anti-rabbitIgGs coupled to horseradish peroxidase followed by ECLdetection (Amersham International) according to the manufac-turer's instructions. Densitometric analyses were performedon independent mitochondrial preparations. Speci®c signalsfor m56HA1 and Atm1p-myc were normalized for each sample,using the Cox2p or the Abf2p signals (TINA software). In allthe experiments performed, both normalized results werevery similar, suggesting that Abf2p and Cox2p quantitieswere equivalent in all the mitochondria preparations tested.The amounts of m56HA1 and Atm1p-myc-tagged proteinresistant to proteolysis in mitochondria from wild-type cellsor from cells overproducing Pse1p were compared with apaired Student's t-test using a con®dence level of 95%.

Puri®cation of free and mitochondria-bound

ribosomes

Puri®cation of mitochondria-bound ribosomes and free cyto-plasmic ribosomes was performed as described previously(Ades and Butow, 1980; Suissa and Schatz, 1982). TotalRNA from both fractions and from whole cells were obtainedby a hot-phenol method (Schmiit et al., 1990). Northern blotswere performed using 15 mg of RNA electrophoresed throughdenaturing formaldehyde agarose gels, after transfer nylonmembranes were stained with methylene blue solution (Sam-brook et al., 1989). Probes used were the 1 kb EcoRI±HindIIIfragment of the ACT1 ORF, COXIII and Maturase oligonucleo-tides shown in Table 1, which revealed, respectively, ACT1mRNA, COXIII mRNA and the S56M hybrid transcript. Phos-phorimager system and TINA software were used to comparethe relative abundance of the S56M hybrid mRNA.

Acknowledgements

We would like to thank A. Delahodde, Suzanne Joyce and E.Fabre for friendly discussions and critical reading of themanuscript. We are grateful to J. P. diRago for the gift of theBMA41 strain and to Dr G. Schatz for the gift of the ATM1-c-myc vector. This work was supported by CNRS (URA1302)by the EÂ cole Normale SupeÂrieure and by a grant from theAFM (French Association for Myopathies, MNV 96).

References

Ades, I.Z., and Butow, R.A. (1980) The products of mitochon-drial-bound cytoplasmic polysomes in yeast. J Biol Chem255: 9918±9924.

Banroques, J., Delahodde, A., and Jacq, C. (1986) A mito-chondrial RNA maturase gene transferred to the yeastnucleus can control mitochondrial mRNA splicing. Cell46: 837±844.

Banroques, J., Perea, J., and Jacq, C. (1987) Ef®cient spli-cing of two yeast mitochondrial introns controlled by anuclear-encoded maturase. EMBO J 6: 1085±1091.



Barnes, W.M. (1994) PCR ampli®cation of up to 35 kb DNAwith high ®delity and high yield from l templates. ProcNatl Acad Sci USA 91: 2216±2220.

Bonneaud, N., Ozier-Kalogeropoulos, O., Li, G., Labouesse,M., Minvielle-Sebatia, L., and Lacoutre, F. (1991) A familyof low and high copy replicative, integrative and single-stranded S. cerivisiae/E. coli shuttle vectors. Yeast 7:609±615.

Bossie, M.A., DeHoratius, C., Barcelo, G., and Silver, P.A.(1992) A mutant nuclear protein with similarity to RNAbinding proteins interferes with nuclear import in yeast.Mol Biol Cell 3: 875±893.

Caron, F., Jacq, C., and RouvieÁre-Yaniv, J. (1979) Character-ization of a histone-like protein extracted from yeast mito-chondria. Proc Natl Acad Sci USA 76: 4265±4269.

Cartwright, P., Beilharz, T., Hansen, P., Garrett, J., and Lith-gow, T. (1997) Mft52, an acid-bristle protein in the cytosolthat delivers precursor proteins to yeast mitochondria. JBiol Chem 272: 5320±5325.

Claros, M.G., and Vincens, P. (1996) Computational methodsto predict mitochondrially imported proteins and their tran-sit peptides. Eur J Biochem 241: 779±786.

Claros, M.G., Perea, J., Shu, Y., Samatey, F.A., Popot, J.-L.,and Jacq, C. (1995) Limitations to in vivo import of hydro-phobic proteins into yeast mitochondria: the case of a cyto-plasmic synthesized apocytochrome b. Eur J Biochem228: 762±771.

Claros, M.G., Perea, J., and Jacq, C. (1996) Allotopic expres-sion of yeast mitochondrial maturase: To study mitochon-drial import of hydrophobic proteins. Methods Enzymol264: 389±403.

Conde, J., and Fink, G. (1976) A mutant of S. cerevisiaedefective for nuclear fusion. Proc Natl Acad Sci USA 73:3651±3655.

Dif¯ey, J.F.K., and Stillman, B. (1991) A close relative of thenuclear, chromosomal high-mobility group protein HMG1 inthe yeast mitochondria. Proc Natl Acad Sci USA 88: 7864±7868.

Doye, V., Wepf, R., and Hurt, E.C. (1994) A novel nuclearpore protein Nup133p with distinct roles in poly (A�) RNAtransport and nuclear pore distribution. EMBO J 13:6062±6075.

Dujardin, G., Pajot, P., Groudinsky, O., and Slonimski, P.(1980) Long range control circuits within mitochondriaand between nucleus and mitochondria. Mol Gen Genet179: 469±482.

Egea, G., Izquierdo, J.M., Martin, R.C.S., and Cuezva, J.M.(1997) Mrna encoding the b-subunit of the mitochondrialF1-ATPase is a localized mRNA in rat hepatocytes. Bio-chem J 322: 557±565.

Ellis, E.M., and Reid, G.A. (1993) The Saccharomyces ceri-visiae MTS1 gene encodes a putative RNA-binding proteininvolved in mitochondrial protein targeting. Gene 132:175±183.

Flach, J., Bossie, M., Vogel, J., Corbett, A., Jinks, T., Willins,D.A., and Silver, P.A. (1994) A yeast RNA-binding proteinshuttles between the nucleus and the cytoplasm. Mol CellBiol 14: 8399±8407.

Fornerod, M., Deursen, J., Baal, S., Reynolds, A., Davis,D., Murti, K.G., Fransen, J., and Grosveld, G. (1997)The human homologue of yeast CRM1 is in a dynamic

subcomplex with CAN/Nup214 and a novel nuclear porecomponent Nup88. EMBO J 16: 807±816.

Fujiki, M., and Verner, K. (1991) Coupling of protein synth-esis and mitochondrial import in a homologous yeast invitro system. J Biol Chem 266: 6841±6847.

Fujiki, M., and Verner, K. (1993) Coupling of cytosolic proteinsynthesis and mitochondrial protein import in yeast. J BiolChem 268: 1914±1920.

George, R., Beddoe, T., Landl, K., and Lithgow, T. (1998)The yeast nascent polypeptide-associated complex initiatesprotein targeting to mitochondria in vivo. Proc Natl AcadSci USA 95: 2296±2301.

Gietz, D., St. Jean, A., Woods, R.A., and Schiestl, R.H.(1992) Improved method for high ef®ciency transformationof intact yeast cells. Nucleic Acids Res 20: 1425.

GoÈrlich, D. (1997) Nuclear protein import. Curr Opin Cell Biol9: 412±419.

GoÈrlich, D., Dabrowski, M., Bischoff, F.R., Kutay, U., Bork,P., Hartmann, E., Prehn, S., and Izaurralde, E. (1997) Anovel class of Ran GTP binding proteins. J Cell Biol 138:65±80.

Izquierdo, J.M., and Cuezva, J.M. (1997) Control of the trans-lational ef®ciency of b-F1-ATPase mRNA depends on theregulation of a protein that binds the 38 untranslated regionof the mRNA. Mol Cell Biol 17: 5255±5268.

Kaffman, A., Rank, N.M., and O'Shea, E.K. (1998) Phosphor-ylation regulates association of the transcription factorPho4 with its import receptor Pse1/Kap121. Genes Dev12: 2673±2683.

Kellems, R.E., and Butow, R.A. (1974) Cytoplasmic type 80Sribosomes associated with yeast mitochondria. III.Changes in the amount of bound ribosomes in responseto changes in metabolic state. J Biol Chem 249: 3304±3310.

Kellems, R.E., Allison, V.F., and Butow, R.A. (1974) Cyto-plasmic type 80S ribosomes associated with yeast mito-chondria. II. Evidence for the association of cytoplasmicribosomes with the outer mitochondrial membrane in situ.J Biol Chem 249: 3297±3303.

Kellems, R.E., Allison, V.F., and Butow, R.A. (1975) Cyto-plasmic type 80S ribosomes associated with yeastmitochondria. IV. Attachment of ribosomes to the outermembrane of isolated mitochondria. J Cell Biol 65: 1±14.

Kutay, U., Izaurralde, E., Bischoff, F.R., Mattaj, I.W., andGoÈrlich, D. (1997) Dominant-negative mutants of importin-b block multiple pathways of import and export throughthe nuclear pore complex. EMBO J 16: 1153±1163.

Leighton, J., and Schatz, G. (1997) An ABC transporter inthe mitochondrial inner membrane is required for normalgrowth of yeast. EMBO J 14: 188±195.

Lithgow, T., Cuezva, J.M., and Silver, P.A. (1997) Highwaysfor protein delivery to the mitochondria. Trends BiochemSci 22: 110±113.

Matouschek, A., Azem, A., Ratliff, K., Glick, B.S., Schimd, K.,and Schatz, G. (1997) Active unfolding of precursor pro-teins during mitochondrial protein import. EMBO J 16:6727±6736.

Neupert, W. (1997) Protein import into mitochondria. AnnuRev Biochem 66: 683±717.

Nigg, E.A. (1997) Nucleocytoplasmic transport: signals,mechanisms and regulation. Nature 386: 779±787.



Pon, L., Moll, T., Vestweber, D., Marshallsay, B., and Schatz,G. (1989) Protein import into mitochondria: ATP-depen-dent translocation activity in submitochondrial fractionenriched membrane contact sites and speci®c proteins.J Cell Biol 109: 2603±2616.

Reid, G.A., and Schatz, G. (1982) Import of proteins intomitochondria. Yeast cells grown in the presence of carbonylcyanide m-chlorophenylhydrazone accumulate massiveamounts of some mitochondrial precursor polypeptides.J Biol Chem 257: 13056±13060.

Rout, M.P., Blobel, G., and Aitchison, J.D. (1997) A distinctnuclear import pathway used by ribosomal proteins. Cell89: 715±725.

Sambrook, K.J., Fritsch, E.F., and Maniatis, T. (1989) Mole-cular Cloning. Cold Spring Harbor, NY: Cold Spring HarborLaboratory Press.

Sargueil, B., Hatat, D., Delahodde, A., and Jacq, C. (1990) Invitro and in vivo analyses of an intron-encoded DNA endo-nuclease from yeast mitochondria. Nucleic Acids Res 18:5659±5665.

Schatz, G. (1996) The protein import system of mitochondria.J Biol Chem 271: 31763±31766.

Schatz, G., and Butow, R. (1983) How are proteins importedinto mitochondria? Cell 32: 316±318.

Schlenstedt, G., Smirnova, E., Deane, R., Solsbacher, J.,

Kutay, U., GoÈrlich, D., Ponstingl, H., and Bischoff, F.R.(1997) Yrb4p, a yeast Ran-GTP-binding protein involvedin import of ribosomal protein L25 into the nucleus.EMBO J 16: 6237±6249.

Schmiit, M.E., Brown, T.A., and Trumpower, B.L. (1990)A rapid and simple method for preparation of RNA fromSaccharomyces cerevisiae. Nucleic Acids Res 18: 3091.

Schulke, N., Sepuri, N.B., and Pain, D. (1997) In vivo zipper-ing of inner and outer mitochondrial membranes by astable intermediate. Proc Natl Acad Sci USA 94: 7314±7319.

Seedorf, M., and Silver, P.A. (1997) Importin/karyopherinprotein family members required for mRNA export fromthe nucleus. Proc Natl Acad Sci USA 94: 8590±8595.

Singleton, D.R., Chen, S., Hitomi, M., Kumagai, C., and Tar-takoff, A.M. (1995) A yeast protein that bidirectionallyaffects nucleocytoplasmic transport. J Cell Sci 108: 265±272.

Suissa, M., and Schatz, G. (1982) Import of proteins intomitochondria. J Biol Chem 257: 13048±13055.

Verner, K. (1993) Co-translational protein import into mito-chondria: an alternative view. Trends Biochem Sci 18:364±371.

Yaffe, M.P. (1991) Analysis of Mitochondrial function andassembly. Pasadena, CA: Academy Press.



Overexpression of yeast karyopherin Pse1p/Kap121p ... · Overexpression of yeast karyopherin...

Documents

Transcript of Overexpression of yeast karyopherin Pse1p/Kap121p ... · Overexpression of yeast karyopherin...