Osteopontin and Protein Kinase C Regulate PDLIM2Activation and STAT1 Ubiquitination in LPS-treated MurineMacrophages*

Received for publication, July 6, 2010, and in revised form, September 21, 2010 Published, JBC Papers in Press, October 1, 2010, DOI 10.1074/jbc.M110.161869

Hongtao Guo, Zhiyong Mi, Dawn E. Bowles, Syamal D. Bhattacharya, and Paul C. Kuo1

From the Department of Surgery, Duke University Medical Center, Durham, North Carolina 27710

The molecular pathways regulating signal transducer andactivator of transcription 1 (STAT1) levels in states of inflam-mation are incompletely understood. The suppressor of cyto-kine signaling, protein inhibitor of STAT, and SHP-1/2 tyrosinephosphatases ultimately regulate activity of STAT molecules.However, these mechanisms do not degrade STAT proteins. Inthis regard, using a murine macrophage model of LPS stimula-tion, we previously demonstrated that osteopontin (OPN)increased STAT1 ubiquitination and 26 S proteasome degrada-tion via the ubiquitin E3 ligase, PDLIM2. In this study, we fur-ther characterize OPN-dependent activation of PDLIM2 in amodel of LPS-stimulated RAW264.7 murine macrophages. Weidentify serine 137 as a protein kinase C-phosphorylation site inPDLIM2 that is required for ubiquitination of STAT1. PDLIM2phosphorylation requires OPN expression. Using phospho-mu-tants and phospho-mimetic constructs of PDLIM2, our in vivoand in vitro ubiquitination studies confirm the role of PDLIM2in formation and degradation of Ub-STAT1. The functionalconsequences of PDLIM2-mediated STAT1 degradation wereconfirmed using an IFN-�-regulated transcription factor STAT1�reporter construct and chromatin immunoprecipitation assayfor the inducible nitric-oxide synthase promoter. In a murinececal ligation and puncture model of sepsis in wild-type andOPN (�/�) animals, OPN was necessary for PDLIM2 serinephosphorylation and STAT1 ubiquitination in bone marrowmacrophages. We conclude that OPN and PDLIM2 are impor-tant regulators of STAT1-mediated inflammatory responses.

Macrophage inducible nitric-oxide synthase (iNOS)2 expres-sion is central to many of the systemic effects associated withendotoxin (LPS) stimulation (1). Utilizing both in vivo and invitromurine models of endotoxin (LPS) stimulation, we havepreviously demonstrated that osteopontin (OPN) is a potentNO feedback-regulated trans-repressor of iNOS expression(2, 3). However, the underlying molecular pathway has notbeen fully characterized. We have previously examined the

OPN-dependent effector arm of this NO-regulated negativefeedback loop, focusing on iNOS transcriptional regulation. Inthis regard, signal transducer and activator of transcription 1(STAT1) is an essential activator of LPS and/or pro-inflamma-tory cytokine-mediated iNOS transcription in murine, rat, andhuman cells (4). All mammalian iNOS promoters contain sev-eral sites with homologies to the interferon (IFN)-�-regulatedSTAT1�-binding sites (GAS). STAT signaling is tightly regu-lated, and several mechanisms have been proposed to accountfor this control (5). Post-translational modifications of STATproteins via ubiquitination have been suggested as an impor-tant means to regulate STAT signaling (6).Ubiquitination plays a major role in regulating many cellular

processes by marking proteins, including transcription factors,for degradation through the 26 S proteasome-dependent path-way (7). Conjugation of ubiquitin to target proteins requiresthree enzymes, ubiquitin-activating enzyme (E1), ubiquitin-conjugating enzyme (E2), and ubiquitin ligase (E3). E3 interactswith both E2 and the target protein to facilitate transfer of ubiq-uitin to the substrate. It is E3 ligase that confers specificity tothe reaction. In the case of STAT1, Kim and Maniatis (6) werethe first to demonstrate that IFN-activated STAT1 levels maybe regulated by the ubiquitin-proteasome pathway. Tanaka etal. (8) were the first to identify PDLIM2 protein (previouslyknown as SLIM ormystique) as a STAT ubiquitin E3 ligase anddemonstrate a central role for ubiquitination in regulation ofthe IFN-STAT signaling pathway. Previously, using a murinemacrophage model of LPS stimulation, we found that OPNincreased STAT1 ubiquitination and degradation through theubiquitin E3 ligase, PDLIM2 (9). In this study, we build uponour former observations to demonstrate that LPS- and OPN-dependent activation of PDLIM2 and subsequent STAT1 ubiq-uitination require protein kinase C (PKC)-regulated phosphor-ylation of PDLIM2 Ser-137.

EXPERIMENTAL PROCEDURES

Materials—N-Carbobenzoxyl-L-leucinyl-L-norleucinal (MG132),M2 anti-FLAG (Asp-Tyr-Lys-Asp-Asp-Asp-Asp-Lys)-agarose,and �-actin antibody were purchased from Sigma. The follow-ing PKC inhibitors were ordered from Calbiochem: bisindolyl-maleimide I (G06850); 12-(2-cyanoethyl)-6,7,12,13-tetrahy-dro-13-methyl-5-oxo-5H-indolo(2,3-a)pyrrolo(3,4-c)-carbazole(G06976); rottlerin; and Myr-SIYRRGARRWRKL-OH, myris-toylated protein kinase C� pseudosubstrate inhibitor (PKC�inhibitor). Anti-mouse His antibody was purchased fromInvitrogen. Antibodies against Stat1 p84/p91 were obtained

* This work was supported, in whole or in part, by National Institutes of HealthGrants R01-GM065113 (to P. C. K.) and T32-GM069331 (to P. C. K.).

1 To whom correspondence should be addressed: 224 Hanes House, DukeUniversity Medical Center 3522, Durham, NC 27710. Fax: 919-684-8716;E-mail: pkuo@lumc.edu.

2 The abbreviations used are: iNOS, inducible nitric-oxide synthase; SOCS,suppressor of cytokine signaling; PIAS, protein inhibitor of STAT; STAT,signal transducer and activator of transcription; OPN, osteopontin; GAS,IFN-�-regulated STAT1�-binding site; BMM, bone marrow macrophage; IP,immunoprecipitation; Ab, antibody; CLP, cecal ligation and puncture.

THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 285, NO. 48, pp. 37787–37796, November 26, 2010© 2010 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in the U.S.A.

NOVEMBER 26, 2010 • VOLUME 285 • NUMBER 48 JOURNAL OF BIOLOGICAL CHEMISTRY 37787

This article has been retracted by the publisher. The same data were

reused to represent different experimental conditions. Specifically,

lanes 2-4 and 6-8 of the actin immunoblot in Fig. 3A were duplicated.

Additionally, the nuclear P-STAT1 immunoblot from Fig. 3A was reused

as P-STAT1 in Fig. 3B.

by guest on February 2, 2018http://w

ww

.jbc.org/D

ownloaded from

by guest on February 2, 2018

http://ww

w.jbc.org/

Dow

nloaded from

by guest on February 2, 2018http://w

ww

.jbc.org/D

ownloaded from

from Santa Cruz Biotechnology (Santa Cruz, CA). Rabbit anti-mouse PDLIM2 serum has been described previously (8, 10).Anti-mouse iNOS antibodywas obtained fromBDBiosciences.Anti-phosphoserine antibody was purchased fromZymed Lab-oratories Inc.. Hemagglutinin (HA) monoclonal antibody(3F10) was obtained from Roche Applied Science. Proteinkinase C� was obtained from Calbiochem.PlasmidConstructs—pCMV-FLAG-Stat1was described pre-

viously (11). HA-ubiquitin vector was kindly provided by Dr.Bohmann (University of Rochester, Rochester, NY). PathDe-tect GAS cis-reporting vector was purchased from Stratagene(La Jolla, CA).Wild-type PDLIM2was described previously (8).S137A-PDLIM2, S137D-PDLIM2, and T138A-PDLIM2 desig-nate mutant His-PDLIM2 expression vectors, in which aminoacidsweremutated to an alanine or aspartic residue. Allmutantvectors were generated by using the QuikChange II site-di-rected mutagenesis kit (Stratagene, La Jolla, CA) using primersas follows: S137A, sense, 5�-CTTCGCAACCCCACCCCCCA-CCAGCCCAG-3�, and antisense, 5�-GGGTTGCGAAGGGG-CTGCAAGGCCTGGGG-3�; S137D sense, 5�-CTTCGACAC-CCCACCCCCCACCAGCCCAG-3�, and antisense, 5�-GGG-TGTCGAAGGGGCTGCAAGGCCTGGGG-3�; and T138Asense, 5�-CTCCGCACCACCCCCCACCAGCCCAGTTG-3�,and antisense. 5�-GTGGTGCGGAGAAGGGGCTGCAA-GGCCTG-3�.Cell Lines—RAW264.7, 293, and COS-1monkey kidney cells

were maintained at 37 °C under 5% CO2 in DMEM supple-mentedwith 10% heat-inactivated FCS, 100 units/ml penicillin,and 100 �g/ml streptomycin. LPS (50 ng/ml) was used to treatRAW264.7 cells; after incubation at 37 °C in 5%CO2, the super-natants and cells were harvested for further assays.Assay of NO Production—NO released from cells in culture

was quantified by measurement of the NO metabolite, nitrite(12). After stimulation, 50�l of culturemediumwasmixedwith50�l of 1% sulfanilamide in 0.5 NHCl. After a 5-min incubationat room temperature, an equal volume of 0.02% N-(1-naphthyl)-ethylenediaminewas added. Following incubation for 10min atroom temperature, the absorbance at 540 nm was comparedwith that of NaNO2 standard on a MAXLINE micro-platereader.Construction and Characterization of AdV-PDLIM2 Expres-

sion Virus—PDLIM2 cDNA was inserted into the multiplecloning site of pShuttle-CMV vector (Stratagene, La Jolla, CA)to obtain pShuttle-CMV-PDLIM2. pShuttle-CMV-PDLIM2and pAdEasy-1 vector (Stratagene, La Jolla, CA) were cotrans-fected into BJ5183 cells for homologous recombination. Therecombinants were screened to obtain pAdV-PDLIM2. Theverification of the AdV-PDLIM2 genome was carried out byDNA sequencing. The verified recombinant AdV-PDLIM2waspropagated in HEK 293 cells and then purified and stored at�80 °C until use. Functional characterization was done bymonitoring PDLIM2 expression using Western blot analysis.AdV-PDLIM2-infected RAW264.7—RAW264.7 cells were

plated on 150-mm dishes at a density of 1.5 � 107 per dish.After 24 h, cells were infected at a 1000multiplicity of infection.At 48 h post-infection, the cells were treated with LPS (50ng/ml) for 6 h. The disheswerewashed two timeswith PBS, andcells were harvested with lysate buffer.

Phosphopeptide Mapping of PDLIM2—WT-PDLIM2 wasisolated from cell lysates and separated by PAGE. The resolvinggel was stained; the WT-PDLIM2 band was excised and storedat�80 °C until use. The gel slices were subjected to in-gel tryp-tic and chymotryptic digestions after reduction and carboxy-amidomethylation. The resultant digests were pooled just priorto liquid chromatography MS/MS (tandemMS) injection. Thephosphorylated peptide sequence analyses were performed atHarvard Microchemistry Facility, Cambridge, MA, by micro-capillary reverse-phase HPLC nano-electrospray tandem massspectrometry on a Finnigan LCQ DeCA XP plus quadrupoleion trap mass spectrometer.WesternBlot Analysis—Cellswere lysed in buffer (0.8%NaCl,

0.02% KCl, 1% SDS, 0.1% Triton X-100, 0.5% sodium deoxy-cholic acid, 0.144% Na2HPO4, 0.024% KH2PO4, and 2 mM

phenylmethylsulfonyl fluoride, pH 7.4), put on ice for 30 min,homogenized, and centrifuged at 12,000 � g for 10 min at 4 °C.The protein concentrationwas determined by the protein assaykit (Bio-Rad). The protein samples were separated by 4–20%SDS-PAGE and electrotransferred onto polyvinylidene difluo-ride membranes (Amersham Biosciences) by semi-dry trans-fer. The membrane was blocked with 5% skim milk in PBS,0.05% Tween for 1 h at room temperature and probed usingprimary antibodies for 1 h at room temperature, usingappropriate horseradish peroxidase-conjugated secondaryantibody. Bound peroxidase activity was detected by WestPico chemiluminescent kit (Pierce).Immunoprecipitation Studies—Immunoprecipitation stud-

ies were performed as described previously (12). Cells werewashed with cold PBS and lysed in IP buffer (10 mmol of Tris-HCl, pH 7.5, 3 mmol of EGTA, 20 mmol of NaCl, 0.02% TritonX-100, 1� protease inhibitors mixture, 0.2mmol of dithiothre-itol, 1 mmol of phenylmethylsulfonyl fluoride). After homoge-nization, cell lysates were clarified by centrifugation at 13,000rpm for 20 min at 4 °C. Aliquots (500 �g) were precleared byaddition of 1.0 �g of normal IgG and 20 �l of appropriate aga-rose conjugate for 1 h at 4 °C. After centrifugation, the super-natant was collected and incubated with 2 �g of correspondingAb for 1 h at 4 °C. A total of 20 �l of appropriate agarose con-jugate was then added, and the mixture was incubated over-night. After washing five times with lysis buffer, immunoblot-ting was performed as described above.Transient Transfection and Luciferase Assay—1.5 � 105

RAW264.7 cells were plated on a 24-well plate and allowed togrow for 24 h before transfection. DNA transfections were car-ried out in 24-well plates using JetPEI macrophage reagent(Genesee, San Diego). At least 24 h later, the medium waschanged, and the cells were stimulated with 50 ng/ml LPS for12 h. To control transfection efficiency between groups, 0.1 �gof pRL-TK vector was added to each well. Cells were harvestedin 0.1 ml of reporter lysis buffer (Promega, Madison, WI), andDual-Luciferase reporter assays were performed using themanufacturer’s protocol (Promega, Madison, WI).In Vitro PhosphorylationAssay—His-tagged PDLIM2,mu-

tant His-tagged PDLIM2-S137A, and mutant His-taggedPDLIM2-S137D vectors were expressed in COS-1 cells. Therecombinant proteins were purified with MagneHis proteinpurification system (Promega, Madison, WI). Prior to phos-

Osteopontin and PDLIM2

37788 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 285 • NUMBER 48 • NOVEMBER 26, 2010

by guest on February 2, 2018http://w

ww

.jbc.org/D

ownloaded from

phorylation, recombinant proteins were dialyzed (24 h, 4 °C)against 10mMTris-HCl, pH 7.5, containing 1mMDTT and 100mM NaCl. The reaction for PKC activity was carried out in asolution containing 20 mM Tris-HCl, pH 7.5, 10 mM MgCl2, 1mMDTT, 0.25mM EDTA, 0.4 mMCaCl2, 0.3 mg/ml phosphati-dylserine, 0.03mg/ml diacylglycerol, 0.1mg/ml BSA, and 10�gof recombinant PDLIM2 protein, 5 �Ci of [�-32P]ATP, and 0.1unit of PKC� (Calbiochem). A negative control was performedin the absence of PKC. After 30 min at 30 °C, reactions werestopped with 2� SDS-loading buffer, and the proteins wereseparated by SDS-PAGE. Gels were dried and subjected toautoradiography.In Vitro Ubiquitination Assay—The in vitro ubiquitination

assay was described previously (9). Recombinant wild-typePDLIM2,mutantHis-tagged PDLIM2, or emptyHis vector wasexpressed in RAW264.7 cells. Following LPS stimulation for6 h, recombinant proteins were purified with the MagneHisprotein purification system (Promega, Madison, WI) as thesource of E3 ligase. Presence of PDLIM2was confirmed by rab-bit anti-PDLIM2 Ab. FLAG-tagged P-STAT1 was expressed inLPS-treated RAW264.7 cells; the cells were lysed, and wholecell extracts were subjected to immunoprecipitation with anti-STAT1 orM2 anti-FLAG-agarose as the source of substrate forin vitro ubiquitination. Anti-FLAG STAT1 immunoprecipi-tates were washed five times with lysis buffer and once withubiquitination buffer (50 mM Tris-Cl, pH 7.5, 2 mM MgCl2, 2mM ATP, and 1 mM DTT) and incubated in 40 �l of ubiquiti-nation buffer with 5 �g of Ub, 100 ng of Ub-activating enzyme(E1), and 100 ng of GST-UbcH5a (Calbiochem) in the absenceor presence of recombinant PDLIM2 for 3 h at 30 °C. After invitro ubiquitination, all samples were washed thee times withlysis buffer, eluted with SDS-sample buffer, resolved by SDS-PAGE, and transferred electrophoretically to PVDFmembrane.STAT1 ubiquitination was detected using Western blotting.In Vivo Ubiquitination Assay—In vivo ubiquitination assays

were carried out in RAW264.7. Plasmids were cotransfectedwith HA-ubiquitin and FLAG-STAT1 expression vectors intocells using JetPEI macrophage reagent (Genesee, San Diego).After 24 h, RAW264.7 cells were treatedwith 10�MMG132 for2 h and incubated for 6 h with 50 ng/ml LPS prior to harvest.Cells lysates were clarified by centrifugation at 14,000 rpm for20min at 4 °C, and the supernatant was preclearedwith proteinG-agarose for 1 h at 4 °C. The lysates were subsequently immu-noprecipitated using anti-STAT1 or M2 anti-FLAG-agarose at4 °C for 12 h. Immunoprecipitated proteins were subjected toSDS-PAGE analysis and analyzed with anti-HA antibody usingWestern blot analysis.Chromatin Immunoprecipitation/Real Time-PCR—Chro-

matin was fixed and immunoprecipitated using the chroma-tin immunoprecipitation (ChIP) assay kit (Upstate Biotech-nology, Billerica, MA) as recommended by the manufacturer.Sequences were identified for the mouse iNOS promoter(GenBankTM accession number L09126). Purified chromatinwas immunoprecipitated using anti-STAT1 (Santa Cruz Bio-technology) or 5 �l of rabbit nonimmune serum. Eluted DNAfragments were purified to serve as templates. The input frac-tion corresponded to 0.1 and 0.05% of the chromatin solutionbefore immunoprecipitation. The average size of the sonicated

DNA fragments subjected to immunoprecipitation was 500bp as determined by ethidium bromide gel electrophoresis.After DNA purification, the presence of the selected DNAsequencewas quantified by real time-PCR. ChIP assays for acti-vated Stat1 binding to its IFN-�-regulated transcription factorSTAT1� (GAS) site on the iNOS promoter used primersACACGAGGCTGAGCTGACTT and CACACATGGCATG-GAATTTT, resulting in a 186-bp fragment. Serial dilutions ofgenomic DNA were used to generate standard curves for RT-PCR using the corresponding primer sets. Copy numbers of theeluted promoter were normalized against the copy numbers inthe corresponding inputs and expressed in arbitrary units.Murine Cecal Ligation and Puncture Model of Sepsis—Wild-

type (WT) and OPN(�/�) 129 male mice (12–16 weeks old)were utilized. OPN(�/�) animals were a gift from David Den-hardt, Rutgers University. They were maintained on sterilestandard laboratory chow and water ad libitum in individualventilated cages under specific pathogen-free conditions in theanimal facility at DukeUniversity. All animal experiments wereapproved by theDukeUniversity Institutional Animal Care andUse Committee. Via a midline laparotomy incision, the cecumwas ligated by 4.0 silk distal to the ileocecal junction; a 18-gaugeneedle was passed through both walls of the cecum. After asmall amount of fecal matter was expressed, the cecum wasreturned to the peritoneal cavity, and the abdomen was closed.Sham-operated animals served as controls. A saline bolus (20ml/kg) was administered subcutaneously to provide resuscita-tion. At 24 h, animals were euthanized, and bone marrowmacrophages (BMM) were isolated.Isolation of BMM—BMM were isolated by lavage of excised

femurs, washed in PBS, plated in DMEM with 0.2% BSA intotwo 100-mm tissue culture dishes, and allowed to adhere for 2 hat 37 °C. After washing out nonadherent cells, cells were cul-tured in DMEM with 10% FBS and 20% L cell-conditionedmedium (as a source of M-CSF) to generate confluent BMM.Primary BMM were maintained at 37 °C under 5% CO2 inDMEM supplemented with 10% heat-inactivated FCS, 100units/ml penicillin, and 100 �g/ml streptomycin. After incuba-tion for the designated time period at 37 °C in 5%CO2, the cellsor media were harvested for assays.Isolation of Peritoneal Macrophages—Mice were sacrificed,

and macrophages were harvested by peritoneal lavage. Physio-logical saline (10ml)was injected into the peritoneal cavity. Theperitoneum was then massaged for �2 min to bring cells intosuspension, and the fluid was extracted using a hypodermicneedle. Cells were then centrifuged at 200 � g and pooled intoRPMI 1640 culturemedium supplementedwith 10% FBS, 2mM

L-glutamine, 20mMHEPES, penicillin, and streptomycin at 2�106 cells/ml. The cell suspension was then seeded into polysty-rene Petri dishes (10 ml per dish) and incubated overnight inan atmosphere of 5% (v/v) CO2 in air at 37 °C to allow selec-tive macrophage adherence. Contaminating nonadherentcells were removed by thoroughlywashing each dishwith phos-phate-buffered saline (without Ca2� andMg2�) at pH 7.4. Puri-fied macrophages were then removed by incubation with 0.5%(w/v) trypsin, 0.2% (w/v) EDTA at 37 °C.

Osteopontin and PDLIM2

NOVEMBER 26, 2010 • VOLUME 285 • NUMBER 48 JOURNAL OF BIOLOGICAL CHEMISTRY 37789

by guest on February 2, 2018http://w

ww

.jbc.org/D

ownloaded from

Statistical Analysis—All data are presented as mean � S.D.Analysis was performed using the Student’s t test. Values of p�0.05 were considered significant.

RESULTS

Identification of LPS-dependent Serine/Threonine Phosphor-ylation Sites in PDLIM2—In the setting of LPS stimulation ofRAW264.7 macrophages, OPN increases STAT1 ubiquitina-tion and degradation through PDLIM2. Phosphopeptide map-ping was performed to identify the specific PDLIM2 aminoacid phosphorylation targets in the setting of LPS exposure.Sequence analysis using PhosphoScan-site 2.0 indicates thepotential presence of 28 serine, 8 threonine, and/or 2 tyrosinephosphorylation sites. To determine whether LPS and OPNinduce PDLIM2 phosphorylation, we treated RAW264.7 cellswith LPS (50 ng/ml) for 6 h and performed IP to measure theextent of phosphorylated serine, threonine, and tyrosine inPDLIM2 (Fig. 1). Controls consisted of untreated cells and LPS� siRNA OPN-treated cells. The results demonstrate that LPSincreased PDLIM2 serine phosphorylation compared withuntreated controls and LPS � siRNA OPN. Repletion of OPNto LPS � siRNA OPN cells restored serine phosphorylation inPDLIM2. An adenovirus PDLIM2 expression vector pAdV-PDLIM2 was constructed. RAW264.7 cells were infected at a1000multiplicity of infection byAdV-PDLIM2. After 24 h, cellswere treated with LPS or LPS � siRNA OPN for 6 h, andPDLIM2 protein was purified by PAGE and submitted to theHarvard Microchemistry and Proteomics Analysis Facility forcharacterization. Untreated cells and cells infected with emptypAdV served as additional controls.When compared with con-trol and LPS � siRNA OPN, LPS induces two potentiallyunique serine/threonine phosphorylations sites, Ser-137 andThr-138, within the sequence RPCSPFSTPP. Otherwise, there

were no additional phosphorylated serine, threonine, or tyro-sine residues noted under any of the treatment conditions. Todetermine the potential functional relevance of these phosphor-ylation sites, each was mutated to a phosphoresistant (Ser/Thrto Ala) or phosphomimetic (Ser to Asp) amino acid, expressed,isolated, and tested in subsequent studies.E3 Ligase Function and PDLIM2 Mutants—Three PDLIM2

phosphorylation mutants, S137A, T138A, and S137D, werecreated and examined for E3 ligase activity using in vivo and invitro ubiquitination assays (Fig. 2). Recombinant His-taggedPDLIM2, His-tagged PDLIM2 mutants, or empty His vectorswere transfected and expressed in RAW264.7 cells and purifiedto use as the source of E3 ligase. In selected instances, cells werestimulated with LPS (50 ng/ml) for 6 h. FLAG-tagged STAT1

FIGURE 1. Identification of PDLIM2 phosphorylation sites. To deter-mine whether LPS and OPN induce PDLIM2 phosphorylation, we treatedRAW264.7 cells with LPS (50 ng/ml) for 6 h and performed IP to measureextent of phosphorylated serine, threonine, and tyrosine in PDLIM2. Inselected cases, cells were exposed to siRNA directed against OPN. Mis-match siRNA (siRNA MM) served as a control. Blot is representative of threeexperiments. IB, immunoblot.

FIGURE 2. Function of PDLIM2 phosphorylation mutants, S137A, T138A,and S137D, in in vivo and in vitro ubiquitination assays. a, in vitro ubiquiti-nation assay. Recombinant His-tagged PDLIM2, His-tagged PDLIM2 mutants,or empty His vector were transfected and expressed in RAW264.7 cells andpurified to use as the source of E3 ligase. In selected instances, cells werestimulated with LPS (50 ng/ml) for 6 h. FLAG-tagged STAT1 was expressedin RAW264.7 cells and used as the source of substrate for in vitro ubiquiti-nation. After in vitro ubiquitination, all samples were resolved by SDS-PAGE and transferred electrophoretically to PVDF membrane. The blot isrepresentative of three experiments. b, in vivo ubiquitination assay.RAW264.7 cells were cotransfected with WT-PDLIM2 or mutant forms ofPDLIM2 with HA-Ub and FLAG-STAT1 vectors. After 24 h, cells were treatedwith MG132 (10 �M) and in selected instances and stimulated with LPS (50ng/ml) for 6 h. The Ub-STAT1 complex was immunoprecipitated and sub-jected to Western blot analysis using anti-HA Ab. The blot is representative ofthree experiments. IB, immunoblot.

Osteopontin and PDLIM2

37790 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 285 • NUMBER 48 • NOVEMBER 26, 2010

by guest on February 2, 2018http://w

ww

.jbc.org/D

ownloaded from

was expressed in RAW264.7 cells and used as the source ofsubstrate for in vitro ubiquitination. (Fig. 2a) AUb-STAT1 lad-der was found in LPS � WT-PDLIM2 and LPS � T138A butwas absent in the LPS � S137A. Similarly, Ub-STAT1 was alsofound in the control S137D setting.We then performed in vivo ubiquitination assays in which

RAW264.7 cells were cotransfected with WT-PDLIM2 ormutant forms of PDLIM2 with HA-Ub and FLAG-STAT1 vec-tors. After 24 h, cells were treated with MG132 (10 �M) and inselected instances were stimulated with LPS (50 ng/ml) for 6 h(Fig. 2b). The Ub-STAT1 complex was immunoprecipitatedand subjected to Western blot analysis using anti-HA Ab. Ub-STAT1 was found in LPS � WT-PDLIM2, LPS � T138A, andLPS � T138D cells, but it was absent in the LPS � S137A.Ub-STAT1was not found in the control S137D setting, second-ary to the absence of activated STAT1. These data suggest thatphosphorylation of PDLIM2at Ser-137 is required forOPN-de-pendent formation of ubiquitinated P-STAT1 in LPS-treatedmacrophages.OPN-dependent PDLIM2 Ser-137 Phosphorylation and

STAT1—Given its defined role as a STAT1 E3 ligase, the func-tional role of LPS-dependent PDLIM2 Ser-137 phosphoryla-tion was then determined in the context of STAT1 degradationusing PDLIM2-S137A as an antagonist or PDLIM2-S137Das an agonist (8, 9). Using RAW cells, total cellular and phos-phorylated nuclear STAT1s (P-STAT1) were measured in thepresence and absence of LPS (Fig. 3a). In selected instances,cells were transfected with PDLIM2-S137A, PDLIM2-S137D,and/or siRNAOPNprior to LPS stimulation. In the presence ofLPS, nuclear P-STAT1 was readily detected in contrast tountreated controls. When PDLIM2-S137A or siRNA OPNwere addedwith LPS, the levels of both P-STAT1 (�4-fold) andtotal STAT1 (�9-fold) were significantly increased comparedwith LPS alone (p � 0.05 LPS versus LPS � S137A and LPS �siRNA OPN for both P-STAT1 and total STAT1). ExogenousOPN restored expression of both STAT1 signals to base-linelevels in LPS � siRNA OPN, but it had no effect in LPS �PDLIM2-S137A (p � 0.05 LPS versus LPS � S137A � OPN forboth P-STAT1 and total STAT1).WhenPDLIM2-S137Dphos-phomimeticwas added to LPS or LPS�OPNgroups, P-STAT1and total STAT1 were both detected at levels equivalent or lessthan that of LPS alone. LPS�mismatch siRNAdid not alter theSTAT1 profile in comparison to LPS alone; OPN added tounstimulated control cells did not alter STAT1 expression incomparison with control alone (data not shown).IP studies were then performed to assess the extent of Ub-

associated P-STAT1 in the presence of cycloheximide andMG132 (Fig. 3b). Immunoblot analysis for P-STAT1 was per-formed as a control. In the setting of LPS stimulation, P-STAT1and Ub-P-STAT1 were readily detected compared with un-stimulated controls. However, when OPN expression wasablated in the LPS � siRNA OPN group, the ubiquitinatedP-STAT1 was not seen despite the presence of P-STAT1. Res-toration of OPN to this treatment condition resulted in a dra-matic increase in Ub-P-STAT1 to a level no different from thatof LPS. When PDLIM2-S137A was added to LPS cells, Ub-P-STAT1 was significantly decreased (�8-fold) compared withLPS alone (p � 0.02), although the level of P-STAT1 was

increased. Addition of exogenous OPN in this setting does notsignificantly alter the levels of P-STAT1 or Ub-P-STAT1. Theaddition of S137D to LPS cells did not alter their P-STAT1 andUb-P-STAT1 profiles. LPS � mismatch siRNA and OPN �control cells did not alter the P-STAT1 profile in comparisonwith LPS or control cells, respectively (data not shown). Takenas a whole, these data suggest that LPS and OPN mediatePDLIM2 Ser-137 phosphorylation, and PDLIM2 Ser-137 phos-phorylation was required for formation of Ub-P-STAT1 and itssubsequent degradation via the 26 S proteasome pathway.OPN Signal Transduction and PDLIM2 Phosphorylation—

The amino acid sequence surrounding Ser-137 was submittedfor protein kinase substrate analysis by NetPhosK 1.0 (13).Based upon these results, we utilized pharmacological inhibi-tors for PKC, p38, PKA, PI3K, and MEK1/2 in LPS-stimulatedRAW264.7 cells and performed IP for serine-phosphorylatedPDLIM2 (Fig. 4a). Administration of the general PKC inhibitor,G06850, was associated with significantly decreased serine-

FIGURE 3. OPN-dependent PDLIM2 Ser-137 phosphorylation and STAT1.a, functional role of LPS-dependent PDLIM2 Ser-137 phosphorylation wasdetermined in the context of STAT1 degradation using PDLIM2-S137A as anantagonist or PDLIM2-S137D as an agonist. Immunoblot analysis was per-formed using RAW cells to measure total cellular and phosphorylated nuclearSTAT1 (P-STAT1) in the presence and absence of LPS. In selected instances,cells were transfected with PDLIM2-S137A, PDLIM2-S137D, and/or siRNA OPNprior to LPS stimulation. Blot is representative of three experiments. b, IPstudies were performed to assess the extent of Ub-associated P-STAT1 in thepresence of cycloheximide (10 �g/ml) and MG132 (10 �M). Cell lysates (500�g) were immunoprecipitated with P-STAT1 Ab and immunoblotted (IB) withanti-Ub Ab. In selected instances, cells were transfected with PDLIM2-S137A,PDLIM2-S137D, and/or siRNA OPN prior to LPS stimulation. Immunoblot anal-ysis for P-STAT1 was performed as a control. Blot is representative of threeexperiments.

Osteopontin and PDLIM2

NOVEMBER 26, 2010 • VOLUME 285 • NUMBER 48 JOURNAL OF BIOLOGICAL CHEMISTRY 37791

by guest on February 2, 2018http://w

ww

.jbc.org/D

ownloaded from

phosphorylated PDLIM2. This was not reversed by addition ofexogenous OPN.We then used several PKC inhibitors to iden-tify the roles of PKC isoforms in LPS-induced PDLIM2 phos-phorylation (Fig. 4b). RAW264.7 cells were transfected withAdV-PDLIM2 for 24 h and then pretreated with G06850 (gen-eral PKC inhibitor), G06976 (PKC� and PKC� inhibitor),rottlerin (PKC� and PKC� inhibitor), and pseudosubstrate pep-tide (PKC� inhibitor). DMSO treatment served as a control;cells were stimulated with LPS. We found that LPS-inducedPDLIM2 phosphorylation was not altered by a pseudosubstratepeptide inhibitor of PKC�, but it was significantly suppressed byG06976 and G06850; also, it was slightly inhibited by rottlerin,which has reduced potency for inhibiting PKC� and PKC�. Inthe presence of cycloheximide andMG132, we then performedin vivo ubiquitination assays forUb-STAT1 in LPS-treated cells

using the various PKC inhibitors(Fig. 4c). Again, LPS induced a Ub-P-STAT1 ladder; this was signifi-cantly diminished in the presence ofG06850 and G096976, suggestingsignificantly decreased PDLIM2 ac-tivity in the presence of these PKCinhibitors.In vitro phosphorylation assays

were performed (Fig. 4d). PDLIM2was immunoprecipitated from RAWcells and incubated in the pre-sence of classical PKC�. S137Aand S137D were used as controls.PKC isoform phosphorylated onlywild-type PDLIM2. In contrast,we saw no phosphorylation of theS137A or S137D mutants. TotalPDLIM2 protein in the immuno-precipitates, detected by immuno-blot analysis, showed similar pro-tein levels for all of the mutantstested. These results implicate ser-ine 137 as the only PKC-dependentPDLIM2phosphorylation site in thepresence of LPS. These results indi-cate that PKC� plays a significantrole in PDLIM2 phosphorylationandP-STAT1ubiquitinationinLPS-treated macrophages.PDLIM2 and STAT1 Function—

AGAS luciferase reporter constructwas then used to assess the poten-tial impact of PDLIM2 functionon P-STAT1 transcriptional acti-vity (Fig. 5a). Transient transfec-tion assays were repeated using apGL3 luciferase reporter plasmidconstruct bearing a quadruple re-peat of the GAS enhancer element,agtttcataTTACTCTAAatc. LPSstimulation significantly increasedSTAT1-dependent luciferase activ-

ity in both LPS and LPS � PDLIM2 when compared withunstimulated controls. OPN knockdown in LPS � PDLIM2 �siRNAOPN resulted in an additional 2.2-fold increase in lucif-erase activity. When PDLIM2-S137A was added to LPS cells,luciferase activity was significantly increased compared withLPS � PDLIM2 and LPS alone. In LPS � S137D, luciferaseactivity was 75% that found in LPS � PDLIM2; in LPS �T138A, luciferase activity was not statistically different fromLPS � PDLIM2 and LPS alone.We nextmeasured nitrite levels, anNOmetabolite, as an end

point of P-STAT1 transactivation of the iNOS promoter (Fig.5b). Themurine iNOSpromoter contained twoNF-�B-bindingsites, NF-�B1 (nucleotides �1044 to �1034) and NF-�B2(nucleotides �114 to �104), and a single STAT1-binding site(GAS; nucleotides �942 to �934), deemed critical for iNOS

FIGURE 4. Protein kinase C and PDLIM2 phosphorylation. a, pharmacological inhibitors of PKC, p38, PKA,PI3K, and MEK1/2 were incubated with LPS-stimulated RAW264.7 cells. IP was performed for PDLIM2 and thenblotted with anti-phosphoserine Ab to determine serine phosphorylated PDLIM2. Immunoblot for PDLIM2 wasperformed as a control. Blot is representative of three experiments. b, PKC pharmacological inhibitors, G06850(general PKC inhibitor), G06976 (PKC� and PKC� inhibitor), rottlerin (PKC� and PKC� inhibitor), and pseudosub-strate peptide (PKC� inhibitor), were incubated with LPS-stimulated RAW264.7 cells. IP was performed forPDLIM2 and then blotted with anti-phosphoserine Ab to determine serine-phosphorylated PDLIM2. Immuno-blot for PDLIM2 was performed as a control. Blot is representative of three experiments. c, in vivo ubiquitinationassay. RAW264.7 cells were cotransfected with WT-PDLIM2, HA-Ub, and FLAG-STAT1 vectors. The PKC phar-macological inhibitors, G06850 (general PKC inhibitor), G06976 (PKC� and PKC� inhibitor), rottlerin (PKC� andPKC� inhibitor), and pseudosubstrate peptide (PKC� inhibitor), were utilized. After 24 h, cells were treated withMG132 (10 �M) and stimulated with LPS (50 ng/ml) for 6 h. The Ub-STAT1 complex was immunoprecipitatedand subjected to Western blot analysis using anti-HA Ab. The blot is representative of three experiments. d, invitro phosphorylation assay. PDLIM2, S137A, and S137D were immunoprecipitated from RAW cells and incu-bated in the presence and absence of classical PKC� and [�-32P]ATP. S137A and S137D were used as controls.Blot is representative of two experiments.

Osteopontin and PDLIM2

37792 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 285 • NUMBER 48 • NOVEMBER 26, 2010

by guest on February 2, 2018http://w

ww

.jbc.org/D

ownloaded from

expression (9). RAW264.7 cells were transfected using emptyvector, wild-type PDLM2, PDLIM2-S137A, PDLIM2-S137D,or PDLIM2-T138A; after 24 h, cells were treated with LPSand nitrite measured in the culture medium following a 6-hincubation. Compared with wild-type PDLIM2, PDLIM2-S137A significantly increased nitrite levels, reflecting increasedP-STAT1. Ablation of OPN with siRNA also resulted in signif-icantly increased nitrite in the culture medium. PDLIM2-S137D and PDLIM2-T138A did not significantly alter nitriteproduction. These data suggest that increased levels of P-STAT1 functionally translate into increased NO production.We then proceeded to perform ChIP/RT-PCR assays to deter-mine the extent of LPS-mediated STAT1 binding to the iNOSpromoter (Fig. 5c). These results demonstrate significantlyincreased STAT1 binding in the presence of S137A and siRNAto OPN, reflecting increased STAT1 as the result of decreasedUb-dependent degradation.PDLIM2 Phosphorylation in a Murine CLP Model of Sepsis—

To determine the in vivo relevance of these observations, weutilized a CLP model of sepsis utilizing WT and OPN(�/�)mice. Animals were sacrificed after 24 h, and BMMswere stud-ied (Fig. 6). PDLIM2 was immunoprecipitated and Western-blotted for serine phosphorylation. In WT animals, CLP wasassociated with significantly increased PDLIM2 serine phos-phorylation. In OPN(�/�), serine-phosphorylated PDLIM2was essentially absent in CLP. Western blot analysis in BMMwas then performed to determine iNOS, P-STAT1, and OPNexpression in CLP in WT and OPN null animals at 0 and 24 h.WT expression of iNOS and P-STAT1 in BMM was signifi-cantly less (�10-fold) than that of OPN(�/�) (p � 0.01 foriNOS and P-STAT1). These results show that iNOS andP-STAT1were significantly increased in the absence of OPN inaCLPmodel of sepsis.WT-sham andOPN(�/�) sham expres-sion of iNOS, P-STAT1, andOPN at 0 and 24 h was statisticallyequivalent to the expressions seen in WT-CLP and OPN null

FIGURE 5. Functional assessment of PDLIM2-dependent STAT1 degrada-tion. a, transient transfection analysis of consensus GAS promoter activity.RAW cells were transiently transfected with WT-PDLIM2, mutant forms of

PDLIM2, siRNA OPN or the mismatch control siRNA MM for 24 h. The cells thenunderwent repeat transfection using a pGL3 luciferase reporter plasmid con-struct bearing a quadruple repeat of the GAS enhancer element. At least 24 hlater, the medium was changed, and cells were exposed to LPS (50 ng/ml) for6 h. Wild-type cells served as controls. Data are presented as mean � S.E. offour experiments. *, p � 0.01 versus wild type; **, p � 0.01 versus wild type,GAS, GAS � PDLIM2, GAS � S137D, and GAS � T138A; @, p � 0.05 versus wildtype, GAS, GAS � PDLIM2, and GAS � T138A. b, nitrite production. RAW cellswere transiently transfected with empty vector, WT-PDLIM2, mutant forms ofPDLIM2, siRNA OPN, or the mismatch control (siRNA MM) for 24 h. At least 24 hlater, the medium was changed, and cells were exposed to LPS (50 ng/ml) for6 h. Nitrite was measured in the culture medium. Wild-type cells served ascontrols. Data are presented mean � S.E. of four experiments. *, p � 0.01versus wild type, empty vector, PDLIM2, S137D, and T138A. c, ChIP-RT-PCRassay for activated STAT1 binding to the iNOS promoter. RAW cells were tran-siently transfected with empty vector, WT-PDLIM2, mutant forms of PDLIM2,siRNA OPN, or the mismatch control (siRNA MM) for 24 h. At least 24 h later, themedium was changed, and cells were exposed to LPS (50 ng/ml) for 6 h.Wild-type cells served as controls. Purified chromatin was immunoprecipi-tated using anti-STAT1 (Santa Cruz Biotechnology) or 5 �l of rabbit nonim-mune serum; eluted DNA fragments were purified to serve as templates. ChIPassays for P-Stat1 binding to its GAS site in the iNOS promoter used primersACACGAGGCTGAGCTGACTT and CACACATGGCATGGAATTTT, resulting in a186-bp fragment. Serial dilutions of genomic DNA were used to generatestandard curves for real time PCR using the corresponding primer sets. Copynumbers of the eluted promoter were normalized against the copy numbersin the corresponding inputs and expressed in arbitrary units. Data are pre-sented mean � S.E. of three experiments. *, p � 0.01 versus wild type, emptyvector, PDLIM2, S137D, and T138A.

Osteopontin and PDLIM2

NOVEMBER 26, 2010 • VOLUME 285 • NUMBER 48 JOURNAL OF BIOLOGICAL CHEMISTRY 37793

by guest on February 2, 2018http://w

ww

.jbc.org/D

ownloaded from

CLP at 0 h for both BMM and liver, respectively (data notshown). To address the role of OPN in ubiquitination ofP-STAT1 in this CLP model, P-STAT1 was immunoprecipi-tated to determine Ub-P-STAT1 expression in BMM at 24 h.In BMM from WT animals, CLP was associated with ubiq-

uitination of P-STAT1; in OPN(�/�), Ub-P-STAT1 was sig-nificantly less than that noted inWT (p� 0.01;WT versusOPN(�/�)), although overall P-STAT1 levels were increased in the

OPN(�/�) animals. These in vivo studies indicate that OPN isnecessary for PDLIM2 serine phosphorylation and STAT1ubiquitination to regulate downstream STAT1-dependentfunctions such as iNOS expression.We then addressed PDLIM2 serine phosphorylation, P-

STAT1 formation, and nitrite expression in primary mu-rine peritoneal macrophages (Fig. 7). Serine-phosphorylatedPDLIM2 was readily detected on IP with LPS treatment; in thepresence of PDLIM2-S137A or G06850, LPS-induced serine-phosphorylated PDLIM2 was significantly decreased (p � 0.01LPS versus LPS � S137A or LPS � G06850). Nuclear P-STAT1was also significantly increased in the presence of LPS withPDLIM2-S137A or G06850. Nitrite production in BMM andperitoneal macrophages was measured to support functionalbiological significance. LPS-induced NO was significantly in-creased with exogenous PDLIM2 and, conversely, decreasedwith PDLIM2-S137A (p � 0.01 LPS versus LPS � PDLIM2 orLPS � PDLIM2-S137A).In summary, our results indicate that OPN functions as a

feedback inhibitor of iNOS expression by PKC-mediated acti-vation of the E3 ligase, PDLIM2, which targets STAT1 for deg-radation by the 26 S proteasome.

DISCUSSION

Evidence indicates that LPS-mediated iNOS gene transcrip-tion is an exceedingly complex and redundant signal transduc-tion pathway with varying signal- and cell-dependent re-sponses. Specifically, in systemic inflammation induced by LPS,the macrophage is responsible for the majority of thecirculating NOmetabolites. Macrophage iNOS expression iscentral to many of the systemic effects associated with LPSstimulation. However, although the molecular pathways thatup-regulate iNOS expression have been extensively studied inmultiple cell types, including the macrophage, little is knownof the parallel counter-regulatory pathways that repress orinhibit macrophage iNOS expression in the context of endo-toxemia and sepsis. Previously, using a system of LPS-treatedRAW264.7macrophages, we demonstrated thatOPN regulatesubiquitin-dependent degradation of STAT1 through the activ-ity of PDLIM2 as the ubiquitin E3 ligase (9). This regulation ofSTAT1 degradation underlies the effect of OPN as an inhibitorof iNOS gene transcription. These results define OPN as aunique and as yet incompletely characterized trans-activator ofSTAT1 degradation by the Ub-proteasome system. In thisstudy, we demonstrate that LPS- and OPN-dependent activa-tion of PDLIM2 and subsequent STAT1 ubiquitination requirePKC phosphorylation of PDLIM2 Ser-137.STAT signaling is tightly regulated, and several mechanisms

have been proposed to account for this control (14). Thesuppressor of cytokine signaling (SOCS) and protein inhibi-tor of STAT (PIAS) families of proteins have been shown tobind to and inhibit either the cytokine receptor-associatedJanus kinase (JAK) or activated STAT molecule, respectively.SOCS proteins are induced following cytokine stimulation,bind to JAK kinases, and inhibit activated JAK kinases fromfurther phosphorylation of STAT proteins (15, 16). As a resultof inhibition by SOCS proteins, STAT signaling becomes atransient response, and levels of phosphorylated STAT pro-

FIGURE 6. PDLIM2 and Ub-P-STAT1 in a murine cecal ligation and punc-ture (CLP) model. Wild-type and OPN(�/�) 129 male mice (12–16 weeks old)were utilized for this CLP model of sepsis. At 0 and 24 h, BMMs were isolated.A, serine-phosphorylated PDLIM2. IP studies were performed to assess theextent of Ub-associated P-STAT1 in BMM. Cell lysates (500 �g) were immuno-precipitated with PDLIM2 Ab and immunoblotted (IB) with anti-phospho-serine Ab. Immunoblot analysis for PDLIM2 was performed as a control. Blot isrepresentative of three experiments. B, Western blot of iNOS, phosphorylatedSTAT1 (P-STAT1), and OPN expression in CLP in WT and OPN(�/�) animals at0 and 24 h. Western blot analysis was performed for iNOS, OPN, and P-STAT1proteins, as described under “Experimental Procedures.” Blot is representa-tive of four experiments. C, immunoprecipitation and ubiquitination ofP-STAT1 in CLP. Cells were lysed and cleared by centrifugation. Aliquots wereprecleared by addition of normal IgG and 20 �l of appropriate agarose con-jugate. After centrifugation, the supernatant was collected and incubatedwith 2 �g of P-Stat1 Ab. After washing, immunoblotting was performed usingUb AB. Blot is representative of four experiments.

Osteopontin and PDLIM2

37794 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 285 • NUMBER 48 • NOVEMBER 26, 2010

by guest on February 2, 2018http://w

ww

.jbc.org/D

ownloaded from

teins decrease within hours of activation. However, the SOCSfeedback mechanism does not result in reduced levels of STATproteins. Each member of the PIAS family has been shown toinhibit STAT-mediated gene activation. Another mechanism

that down-regulates STAT signaling involves tyrosine phos-phatases, such as SHP-1 and SHP-2. These tyrosine phospha-tases have been shown to down-regulate the activity of STAT1,STAT3, or STAT5 following activation by IFN-�, leukemiainhibitory factor, or IL-2 either by dephosphorylating STATproteins directly or through dephosphorylation of JAK kinases(17–19). Like the SOCS and PIAS mechanisms, the down-reg-ulation through tyrosine phosphatases also does not lead toreduced levels of STAT proteins.PDLIM2 (also known asMystique and SLIM) is a postsynap-

tic density-95 (PSD-95)/discs large (DLG)/zonula occludens-1(ZO-1)-Lin-11, Isl-1, Mec-3 (PDZ-LIM) domain protein thatwas identified in cells transformed by overexpression of theinsulin-like growth factor-I receptor (20). It is a member of theactinin-associated LIM protein family of proteins that containsa singleN-terminal PDZ andC-terminal LIMdomain. PDLIM2contains a PDZ domain and a LIM domain and interacts in thenucleus with tyrosine-phosphorylated STAT molecules (21).The LIM domain forms a zinc finger structure related to theRING finger and PHD structures; similar proteins have beenshown to possess E3 ligase activity (8). For a specific substrate,E3 ligase is the onlymember of the E1, E2, and E3 sequence thatundergoes regulation (21, 22). The PDZ and LIM domainsmediate protein-protein interactions. The cDNA encodingmouse PDLIM2 is 1509 bp (GenBankTM BC024556) for mousewith an open reading frame of 349 amino acids (8, 21). It isexpressed as a 38-kDa nuclear protein. The human transcript(GenBankTM NM_021630) is homologous to mouse with 77%identity at the amino acid level and 79% identity at the cDNAlevel. It is highly expressed in lung, spleen, thymocytes, andprimary hematopoietic cells, including macrophages (8, 9).PDLIM2 is the first identified ubiquitin ligase with specificityfor STAT proteins.The relationship between OPN and PDLIM2 has not been

previously characterized. OPN is a secreted glycoprotein that isrich in aspartate and sialic acid residues and contains functionaldomains for calcium binding, phosphorylation, glycosylation,and extracellular matrix adhesion (23). OPN appears to medi-ate cell-matrix interactions and cellular signaling through bind-ingwith integrin, primarily�v�3, andCD44 receptors. A varietyof stimuli, including phorbol 12-myristate 13-acetate, 1,25-di-hydroxyvitamin D, basic fibroblast growth factor (bFGF),TNF-�, IL-1, IFN-�, and LPS appears to regulate OPN expres-sion. OPN has multiple molecular functions that mediate celladhesion, chemotaxis, macrophage-directed IL-10 suppres-sion, stress-dependent angiogenesis, prevention of apoptosis,and anchorage-independent growth of tumor cells (23). Ourstudies have demonstrated that OPN functions as a feedbackregulated trans-repressor of iNOS expression (2, 3). Our dataindicate that the underlying molecular pathway is LPS- andOPN-dependent PKC-regulated phosphorylation of PDLIM2Ser-137 with subsequent ubiquitination and proteasome deg-radation of STAT1. A link between OPN and PKC has beenpreviously established. In PC-3 prostate cancer cells, Jain et al.(24) demonstrated that exogenously administered OPNinduces PKC� activation with subsequent phosphorylation ofNF-�B p65. Similarly, Zhou et al. (25), Tuck et al. (26), Hull-inger et al. (27), and Nodi (28) have each published data indi-

FIGURE 7. PDLIM2 phosphorylation and P-STAT1 in primary murine peri-toneal macrophages. A, serine-phosphorylated PDLIM2. IP studies were per-formed to assess the extent of phosphorylated PDLIM2. We treated primarymurine peritoneal macrophages with LPS (50 ng/ml) for 6 h. In selectedinstances, G06850 (general PKC inhibitor) or PDLIM2-S137A was also added.IP was performed for PDLIM2 and then blotted with anti-phosphoserine Ab todetermine serine-phosphorylated PDLIM2. Blot is representative of threeexperiments. B, P-STAT1 formation. Western blot analysis was performed forP-STAT1 proteins, as described under “Experimental Procedures.” Blot is rep-resentative of four experiments. c, nitrite production in BMM and primaryperitoneal macrophages (PM). Data are presented as mean � S.E. of fourexperiments. *, p � 0.01 versus control and LP; **, p � 0.01 versus control. IB,immunoblot.

Osteopontin and PDLIM2

NOVEMBER 26, 2010 • VOLUME 285 • NUMBER 48 JOURNAL OF BIOLOGICAL CHEMISTRY 37795

by guest on February 2, 2018http://w

ww

.jbc.org/D

ownloaded from

cating a critical role for PKC� activation in OPN-dependentmigration of prostate and/or breast cancer cells. In a similarfashion, we demonstrate the critical role of PKC�/� in OPN-dependent phosphorylation of PDLIM2 in murine macro-phages exposed to LPS.Recently, PDLIM2 has been found to play a similar role in

NF-�B metabolism as described for STAT1. Tanaka et al. (10)have shown that PDLIM2 negatively regulates NF-�B activityby acting as a nuclear ubiquitin E3 ligase targeting the p65 sub-unit of NF-�B. PDLIM2 was bound to p65, promoted p65polyubiquitination, and targeted p65 to discrete intranuclearcompartments where Ub-p65 was degraded by the 26 S pro-teasome. Subsequently, Healy and O’Connor (20) examinedPDLIM2 in the context of phorbol 12-myristate 13-acetate-stimulated RAW264.7 cells. In a fashion reminiscent of ourresults, PDLIM2 exhibited retarded mobility indicative of ser-ine phosphorylation, which could be reversed by phosphatasesand by inhibition of protein kinase C. In this case, PDLIM2 waslocated predominantly in the cytoplasm (20). Also, PDLIM2knock-out mice produce more of the proinflammatory cyto-kines IL-6 and IL-12 in response to LPS (10, 20). In summary,previous studies support our current results by demonstrating acritical relationship between OPN and PKC, while simulta-neously suggesting that serine phosphorylation of PDLIM2 iscritical for its E3 ligase activities. Certainly, in our setting, phos-phorylation of PDLIM2 Ser-137 is required for Ub-P-STAT1formation and degradation by the 26 S proteasome system.OPN and PDLIM2 appear to be important regulators of bothSTAT1- and NF-�B-mediated inflammatory responses.

REFERENCES1. Doursout, M. F., Kilbourn, R. G., Hartley, C. J., and Chelly, J. E. (2000) J.

Crit. Care 15, 22–292. Guo, H., Cai, C. Q., Schroeder, R. A., and Kuo, P. C. (2001) J. Immunol.

166, 1079 –10863. Gao, C., Guo, H., Wei, J., Mi, Z., Wai, P., and Kuo, P. C. (2004) J. Biol.

Chem. 279, 11236 –112434. Meraz, M. A., White, J. M., Sheehan, K. C., Bach, E. A., Rodig, S. J., Dighe,

A. S., Kaplan, D. H., Riley, J. K., Greenlund, A. C., Campbell, D., Carver-

Moore, K., DuBois, R. N., Clark, R., Aguet, M., and Schreiber, R. D. (1996)Cell 84, 431– 442

5. Boushaba, K., Levine, H., and Hamilton, M. N. (2009) Math. Biosci. 220,131–142

6. Kim, T. K., and Maniatis, T. (1996) Science 273, 1717–17197. Liu, Y. C. (2004) Annu. Rev. Immunol. 22, 81–1278. Tanaka, T., Soriano, M. A., and Grusby, M. J. (2005) Immunity 22,

729 –7369. Gao, C., Guo, H., Mi, Z., Grusby, M. J., and Kuo, P. C. (2007) J. Immunol.

178, 1870 –188110. Tanaka, T., Grusby, M. J., and Kaisho, T. (2007) Nat. Immunol. 8, 584 –59111. Gao, C., Mi, Z., Guo, H., and Kuo, P. C. (2007) Neoplasia 9, 699 –70612. Guo, H., Mi, Z., and Kuo, P. C. (2008) J. Biol. Chem. 283, 25209 –2521713. Blom, N., Sicheritz-Ponten, T., Gupta, R., Gammeltoft, S., and Brunak, S.

(2004) Proteomics 4, 1633–164914. Shuai, K., and Liu, B. (2003) Nat. Rev. Immunol. 3, 900 –91115. Endo, T. A., Masuhara, M., Yokouchi, M., Suzuki, R., Sakamoto, H., Mit-

sui, K., Matsumoto, A., Tanimura, S., Ohtsubo, M., Misawa, H., Miyazaki,T., Leonor, N., Taniguchi, T., Fujita, T., Kanakura, Y., Komiya, S., andYoshimura, A. (1997) Nature 387, 921–924

16. Starr, R., Willson, T. A., Viney, E. M., Murray, L. J., Rayner, J. R., Jenkins,B. J., Gonda, T. J., Alexander, W. S., Metcalf, D., Nicola, N. A., and Hilton,D. J. (1997) Nature 387, 917–921

17. Haque, S. J., Harbor, P., Tabrizi, M., Yi, T., and Williams, B. R. (1998)J. Biol. Chem. 273, 33893–33896

18. You, M., Yu, D. H., and Feng, G. S. (1999) Mol. Cell. Biol. 19, 2416 –242419. Bousquet, C., Susini, C., and Melmed, S. (1999) J. Clin. Invest. 104,

1277–128520. Healy, N. C., and O’Connor, R. (2009) J. Leukocyte Biol. 85, 481– 49021. Loughran, G., Healy, N. C., Kiely, P. A., Huigsloot, M., Kedersha, N. L., and

O’Connor, R. (2005) Mol. Biol. Cell 16, 1811–182222. Ungureanu, D., and Silvennoinen, O. (2005) Sci. STKE 2005, e4923. Denhardt, D. T., Noda, M., O’Regan, A. W., Pavlin, D., and Berman, J. S.

(2001) J. Clin. Invest. 107, 1055–106124. Jain, S., Chakraborty, G., and Kundu, G. C. (2006) Cancer Res. 66,

6638 – 664825. Zhou, H., Lu, N., Chen, Z. Q., Song, Q. L., Yu, H. M., and Li, X. J. (2009)

Basic Clin. Pharmacol. Toxicol. 104, 164 –17026. Tuck, A. B., Hota, C., Wilson, S. M., and Chambers, A. F. (2003) Oncogene

22, 1198 –120527. Hullinger, T. G., Taichman, R. S., Linseman, D. A., and Somerman, M. J.

(2000) J. Cell Biochem. 78, 607– 61628. Noti, J. D. (2000) Int. J. Oncol. 17, 1237–1243

Osteopontin and PDLIM2

37796 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 285 • NUMBER 48 • NOVEMBER 26, 2010

by guest on February 2, 2018http://w

ww

.jbc.org/D

ownloaded from

Hongtao Guo, Zhiyong Mi, Dawn E. Bowles, Syamal D. Bhattacharya and Paul C. KuoUbiquitination in LPS-treated Murine Macrophages

Osteopontin and Protein Kinase C Regulate PDLIM2 Activation and STAT1

doi: 10.1074/jbc.M110.161869 originally published online October 1, 20102010, 285:37787-37796.J. Biol. Chem. 

10.1074/jbc.M110.161869Access the most updated version of this article at doi:

 Alerts:

When a correction for this article is posted•When this article is cited•

to choose from all of JBC's e-mail alertsClick here

http://www.jbc.org/content/285/48/37787.full.html#ref-list-1This article cites 27 references, 10 of which can be accessed free at

by guest on February 2, 2018http://w

ww

.jbc.org/D

ownloaded from

VOLUME 285 (2010) PAGES 37787–37796DOI 10.1074/jbc.A110.161869

Osteopontin and protein kinase C regulate PDLIM2activation and STAT1 ubiquitination in LPS-treatedmurine macrophages.Hongtao Guo, Zhiyong Mi, Dawn E. Bowles, Syamal D. Bhattacharya,and Paul C. Kuo

This article has been retracted by the publisher. The same data werereused to represent different experimental conditions. Specifically,lanes 2– 4 and 6 – 8 of the actin immunoblot in Fig. 3A were duplicated.Additionally, the nuclear P-STAT1 immunoblot from Fig. 3A wasreused as P-STAT1 in Fig. 3B.

THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 292, NO. 3, p. 1142, January 20, 2017© 2017 by The American Society for Biochemistry and Molecular Biology, Inc. Published in the U.S.A.

1142 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 292 • NUMBER 3 • JANUARY 20, 2017

ADDITIONS AND CORRECTIONS

Authors are urged to introduce these corrections into any reprints they distribute. Secondary (abstract) services are urged to carry notice ofthese corrections as prominently as they carried the original abstracts.

Hongtao Guo, Zhiyong Mi, Dawn E. Bowles, Syamal D. Bhattacharya and Paul C. KuoUbiquitination in LPS-treated Murine Macrophages

Osteopontin and Protein Kinase C Regulate PDLIM2 Activation and STAT1

doi: 10.1074/jbc.M110.161869 originally published online October 1, 20102010, 285:37787-37796.J. Biol. Chem. 

  10.1074/jbc.M110.161869Access the most updated version of this article at doi:

 Alerts:

  When a correction for this article is posted• 

When this article is cited• 

to choose from all of JBC's e-mail alertsClick here

  http://www.jbc.org/content/285/48/37787.full.html#ref-list-1

This article cites 27 references, 10 of which can be accessed free at

by guest on February 2, 2018http://w

ww

.jbc.org/D

ownloaded from