© 2015 Gao et al. This work is published by Dove Medical Press Limited, and licensed under Creative Commons Attribution – Non Commercial (unported, v3.0) License. The full terms of the License are available at http://creativecommons.org/licenses/by-nc/3.0/. Non-commercial uses of the work are permitted without any further

permission from Dove Medical Press Limited, provided the work is properly attributed. Permissions beyond the scope of the License are administered by Dove Medical Press Limited. Information on how to request permission may be found at: http://www.dovepress.com/permissions.php

International Journal of Nanomedicine 2015:10 7109–7128

International Journal of Nanomedicine Dovepress

submit your manuscript | www.dovepress.com

Dovepress 7109

O r I g I N a l r e s e a r c h

open access to scientific and medical research

Open access Full Text article

http://dx.doi.org/10.2147/IJN.S94045

Osteoinductive peptide-functionalized nanofibers with highly ordered structure as biomimetic scaffolds for bone tissue engineering

Xiang gao1,2,*Xiaohong Zhang3,*Jinlin song1,2

Xiao Xu4

anxiu Xu1

Mengke Wang4

Bingwu Xie1

enyi huang2

Feng Deng1,2

shicheng Wei2–4

1college of stomatology, 2chongqing Key Laboratory of Oral Diseases and Biomedical sciences, chongqing Medical University, chongqing, 3center for Biomedical Materials and Tissue engineering, academy for advanced Interdisciplinary studies, Peking University, 4Department of Oral and Maxillofacial surgery, Laboratory of Interdisciplinary studies, Peking University school and hospital of stomatology, Beijing, People’s Republic of China

*These authors contributed equally to this work

Abstract: The construction of functional biomimetic scaffolds that recapitulate the topographical

and biochemical features of bone tissue extracellular matrix is now of topical interest in bone

tissue engineering. In this study, a novel surface-functionalized electrospun polycaprolactone

(PCL) nanofiber scaffold with highly ordered structure was developed to simulate the critical

features of native bone tissue via a single step of catechol chemistry. Specially, under slightly

alkaline aqueous solution, polydopamine (pDA) was coated on the surface of aligned PCL

nanofibers after electrospinning, followed by covalent immobilization of bone morphogenetic

protein-7-derived peptides onto the pDA-coated nanofiber surface. Contact angle measurement,

Raman spectroscopy, and X-ray photoelectron spectroscopy confirmed the presence of pDA

and peptides on PCL nanofiber surface. Our results demonstrated that surface modification

with osteoinductive peptides could improve cytocompatibility of nanofibers in terms of cell

adhesion, spreading, and proliferation. Most importantly, Alizarin Red S staining, quantitative

real-time polymerase chain reaction, immunostaining, and Western blot revealed that human

mesenchymal stem cells cultured on aligned nanofibers with osteoinductive peptides exhibited

enhanced osteogenic differentiation potential than cells on randomly oriented nanofibers.

Furthermore, the aligned nanofibers with osteoinductive peptides could direct osteogenic dif-

ferentiation of human mesenchymal stem cells even in the absence of osteoinducting factors,

suggesting superior osteogenic efficacy of biomimetic design that combines the advantages of

osteoinductive peptide signal and highly ordered nanofibers on cell fate decision. The presented

peptide-decorated bone-mimic nanofiber scaffolds hold a promising potential in the context of

bone tissue engineering.

Keywords: biomimetic, nanofiber, peptide, bone tissue engineering

IntroductionWith the aging population, the occurrence of bone defect associated with tumors,

osteoporosis, and osteoarthritis is rising so dramatically that governments around the

world have to boost budget to balance the growing expenditure for health care every

year.1 Despite the availability of invasive surgeries using metallic/polymeric implants

or autografts, it remains a great challenge to completely restore the large bone defects

in clinics.2 Stem cell-based tissue engineering (STE), which combines stem cells with

a supportive scaffold, offers an enabling alternative for reconstruction and functional

recovery of seriously damaged bone tissues.2,3 However, the virtual translation of

STE from “bench-to-bedside” still faces many hurdles. One of the major obstacles

lies in that the traditional design of scaffold lacks biomimicry and mismatches in

tissue morphology, or chemical properties, ultimately leading to the failure of stem

cell transplantation.4

correspondence: shicheng Wei; Feng DengChongqing Key Laboratory of Oral Diseases and Biomedical sciences, chongqing Medical University, 426 North songshi road, chongqing 401147, People’s Republic of ChinaTel/fax +86 23 8886 0222email weishicheng99@163.com; deng63@263.net

Journal name: International Journal of NanomedicineArticle Designation: Original ResearchYear: 2015Volume: 10Running head verso: Gao et alRunning head recto: Osteoinductive peptide-functionalized nanofibers for bone tissue engineeringDOI: http://dx.doi.org/10.2147/IJN.S94045

International Journal of Nanomedicine 2015:10submit your manuscript | www.dovepress.com

Dovepress

Dovepress

7110

gao et al

Nanofibrous materials fabricated by electrospinning

technology have attracted considerable interest in bone tissue

regeneration, due to the structural resemblance to the bone

tissue extracellular matrix (ECM) in micro- to nanoscale.5

The electrospun nanofibers feature a porous network with

a large surface area, rendering an ideal microenvironment

for initial cell anchorage and growth in tissue engineering.6,7

Many degradable polymers, with either a synthetic or a natural

origin, can be electrospun into nanofibers.5 Nevertheless, the

flexibility and shape availability of synthetic nanofibers give

them greater potential in the bone regeneration field.5 Through

adjusting the electrospinning parameters and collector design,

synthetic polymers can be readily processed into various fiber

diameters or nanopatterns,3 of which highly ordered nanofibers

have been extensively studied for bone tissue engineering

toward the treatment of a variety of bone defects8,9 since its

topographical feature is similar to the well-aligned organiza-

tion (eg, long parallel bundles of type I collagen fiber) observed

in bone tissue.10 On such aligned substrates, stem cells are

arranged in a direction parallel to the nanofibers’ alignment.8

Moreover, increased calcium and collagen production was

observed in stem cells cultured on aligned nanofibers as

opposed to randomly oriented scaffolds11 because cytoskeletal

elongation altered by aligned nanofibers may activate certain

osteo-related gene expression via mechanotransduction.11

Given the superior performance in bone formation, highly

ordered nanofibers are considered a promising candidate of

scaffolds for bone tissue engineering.12

It has been gradually recognized that among various

parameters that influence cell–material interactions, not only

topographical but also biochemical cues should be considered

in the design of scaffold materials that can mimic the chemical

and physical features of microenvironments in native tissues.13

Thus, the functionalization of nanofibers with bioactive fac-

tors is a critical step to construct bone biomimetic scaffolds,

which could simultaneously present multiple cues for the

regulation of cell fates. Inspired by the manner of biomol-

ecules tethering to the native ECM, a great deal of efforts have

been focused on the surface functionalization of nanofibers

with osteogenesis-associated proteins in recent years. Bone

morphogenetic proteins (BMPs), members of the transform-

ing growth factor-β superfamily, are widely implicated

in the regulation of skeletal development, including

proliferation and differentiation of mesenchymal stem cells

(MSCs) toward osteogenic fates.3,14 It has been proved that

covalent surface immobilization of scaffolds with BMP

proteins could convey osteoinductive signals to the local cell

microenvironment in a sustained manner.15 However, the

complicated multilevel structure of proteins makes them prone

to degradation in the physiological environment,16 probably

causing the loss of bioactivity. Therefore, short peptide

sequences have attracted much attention over the past decade

due to their higher structure stability and less immunogenic-

ity compared to large proteins.16 Recently, bone-forming

peptide-1 (BFP-1), a novel sequence derived from the imma-

ture region of BMP-7, was reported to exhibit more excel-

lent osteogenetic efficacy over BMP-7 protein in vitro and

in vivo.14 Accordingly, considerable benefits in osteogenic

differentiation of stem cells may derive from a combination of

bioinspired nanotopography fabricated with aligned nanofibers

and biochemical signaling from BFP-1 peptides.

Guided by these considerations, we developed an inno-

vative bone-mimic BFP-decorated polycaprolactone (PCL,

a model synthetic polymer) nanofiber scaffold with highly

ordered structure. To surface functionalization of synthetic

nanofibers with osteogenic peptides, dopamine chemistry

was employed to bridge these two stimulators in the scaffold

design. To the best of our knowledge, this is the first report

that the presented biomimetic materials, which combine

aligned nanofibers and osteogenic peptides, are designed to

promote osteogenesis for bone tissue engineering. To evalu-

ate the cytocompatibility and osteogenic activity of these

materials, the adhesion, growth, and differentiation of human

mesenchymal stem cells (hMSCs) cultured on the peptide-

decorated nanofibers were deeply investigated in vitro.

Materials and methodsMaterialsPCL (molecular weight [MW] =80,000 g/mol) and dopamine

hydrochloride were purchased from Sigma-Aldrich Co. (St

Louis, MO, USA). Hexafluoro-2-propanol and Tris–HCl

were purchased from Aladdin Reagent Co, Ltd (Shanghai,

People’s Republic of China). α-Minimum Essential Medium

(α-MEM medium), fetal bovine serum, phosphate-buffered

saline (PBS), trypsin–ethylenediaminetetraacetic acid, and

penicillin–streptomycin were purchased from Thermo Fisher

Scientific (Waltham, MA, USA). Distilled water (DW) was

obtained from the Milli-Q Plus System (EMD Millipore,

Billerica, MA, USA). The peptide (KGGQGFSYPYKAVF-

STQ sequence) was synthesized by China Peptides Co, Ltd

(Shanghai, People’s Republic of China). All other chemicals

and solvents were purchased from Sigma-Aldrich Co.

Preparation of PCL nanofibers and surface functionalizationPCL nanofibers were fabricated using a commercial electro-

spinning equipment (SS-2535; YongKang Technology Co,

Ltd, Beijing, People’s Republic of China) (Figure 1A).

International Journal of Nanomedicine 2015:10 submit your manuscript | www.dovepress.com

Dovepress

Dovepress

7111

Osteoinductive peptide-functionalized nanofibers for bone tissue engineering

In brief, PCL solution (8 wt%) prepared in hexafluoro-2-

propanol was fed into a plastic syringe with a stainless-steel

blunt needle (23 G). Randomly oriented and aligned nanofi-

bers were collected on a flat collector (applied voltage, 14 kv;

feed rate, 1 mL/h; collection distance, 10 cm) and a high-

speed rotating collector (applied voltage, 10 kV; solution

feed rate, 2 mL/h; collection distance, 5 cm), respectively.

The as-prepared fibers were dried in vacuum for 1 day to

remove residual organic solvent. For surface functionaliza-

tion, the nanofibers were pre-immersed in dopamine solution

(2 mg/mL, 10 mM Tris buffer, pH 8.5) and gently shaken for

1 hour at room temperature (RT), as previously described.17

The polydopamine (pDA)-coated substrates were then thor-

oughly rinsed with DW and further reacted with BFP-1 pep-

tide (KGGQGFSYPYKAVFSTQ sequence) solution in PBS

overnight at 37°C (Figure 1B, and Figures S1 and S2). The

codes for the prepared samples are presented in Table 1.

The surface topography of nanofibers was observed by

a scanning electron microscope (SEM, S-4800; Hitachi

Ltd, Tokyo, Japan) and a white-light interferometer (WLI,

Contour GT-X8; Bruker Corporation, Billerica, MA, USA).

Furthermore, the surface chemistry of nanofibers was char-

acterized by water contact angle measurement (SL200B;

KINO Industry, New York, NY, USA), Raman spectroscopy

(Renishaw, Gloucestershire, UK), and X-ray photoelectron

spectroscopy (XPS, AXIS Ultra; Kratos Analytical, Ltd,

Manchester, UK).

cell culture and osteogenic differentiationAll protocols involving human cells were approved by the

Institutional Review Board of Peking University (Beijing,

People’s Republic of China). hMSCs, purchased from Sci-

enCell Research Laboratories (Carlsbad, CA, USA), were

subcultured in α-MEM containing fetal bovine serum (10%)

and penicillin–streptomycin (1%) under standard culture

condition. The growth media were changed every 2 days. To

evaluate cell responses to materials, the nanofiber matrices

were punched into round shape and sterilized with ethanol

(75%) for 1 hour before cell culture experiment. hMSCs

were plated onto fibers at a density of 2.0×104 cells/cm2.

After 1 day, the media were replaced with osteoinductive

media (OM), which was prepared by adding ascorbic acid

(50 μg/mL), β-glycerophosphate (10 mM), and dexametha-

sone (100 nM) to the growth medium.

Imaging cell morphology using seMAt predetermined time points, the samples were washed twice

with PBS (1×), fixed in glutaraldehyde (2.5%) for 2 hours, and

then dehydrated with gradient ethanol (30%–100%). Each sam-

ple was dried with hexamethyldisilazane for 15 minutes prior

to sputter coating with gold for SEM observation.

ccK-8 assayCell adhesion and proliferation on functionalized nano-

fibers were evaluated by Cell Counting Kit-8 (CCK-8;

Dojindo Laboratories, Kumamoto, Japan) according to the

manufacturer’s instructions. At preset time points, the culture

medium was removed and the samples were washed with

PBS. Afterward, CCK-8 reagent (10%) in culture media

was added to each well. After 2-hour incubation, supernatant

(100 μL) from each well was transferred to a 96-well plate

for the measurement of absorbance value at 450 nm using a

microplate reader.

live/dead assayAt 1, 3, and 5 days, after washing twice with PBS, cells on the

samples were incubated with serum-free culture media con-

taining fluorescein diacetate (FDA, 5 μg/mL) and propidium

iodide (PI, 20 μg/mL) at RT for 5 minutes in dark. Images

were captured using a laser scanning confocal microscope to

visualize FDA-stained live cells and PI-stained dead cells.

alkaline phosphatase assayAlkaline phosphatase (ALP) activity of hMSCs was evaluated

by an assay reagent kit (Nanjing Jiancheng Bioengineering

Institute, Jiangsu, People’s Republic of China). On days 7

and 14, the supernatant was removed and Triton X-100 solu-

tion (1%, 100 μL) was added into each well for cell lysis.

After 1-hour incubation at 4°C, 30 μL of cell lysate from

each well was transferred to a 96-well plate, cultivated with

carbonated buffer solution (50 μL, pH 10) and 4-amino-

antipyrine solution (50 μL) at 37°C for 15 minutes. Then

potassium ferricyanide (150 μL) was added into the above

solution, and the production of p-nitrophenol was deter-

mined by the absorbance at 405 nm. For normalization, the

total protein content was measured by a bicinchoninic acid

protein assay kit (Thermo Fisher Scientific), and ALP activ-

ity was expressed as U/mg protein. Furthermore, enzyme

histochemistry staining was performed to visualize ALP

expression using a 5-bromo-4-chloro-3-indolylphosphate/

nitro blue tetrazolium ALP color development kit (Beyotime

Biotechnology, Shanghai, People’s Republic of China)

according to the manufacturer’s instructions.

alizarin red s stainingAfter 21 days of culture, cells were fixed in ethanol (95%) for

30 minutes, followed by washing thrice with DW. Then, the

International Journal of Nanomedicine 2015:10submit your manuscript | www.dovepress.com

Dovepress

Dovepress

7112

gao et al

Figure 1 schematic illustration of (A) fabrication of electrospun nanofibers and (B) surface functionalization of PCL nanofibers with BFP-1 peptides for directing hMSCs osteogenic commitment.Abbreviations: aPCL, aligned PCL nanofibers; PCL, polycaprolactone; BFP-1, bone-forming peptide-1; hMSCs, human mesenchymal stem cells; pDA, polydopamine; pep, peptide; alP, alkaline phosphatase; OcN, osteocalcin; OPN, osteopontin; h, hour.

International Journal of Nanomedicine 2015:10 submit your manuscript | www.dovepress.com

Dovepress

Dovepress

7113

Osteoinductive peptide-functionalized nanofibers for bone tissue engineering

fixed cells were stained with Alizarin Red S (ARS) (2%,

pH 4.2) for 10 minutes at RT and thoroughly washed with

DW for imaging using scanner. To quantify the orange-red

coloration of ARS, the colorant on the samples was eluted

with cetylpyridinium chloride (10%) solution for 1 hour at

RT, and the eluate (200 μL) was transferred to a 96-well

plate for the measurement of absorbance value at 550 nm

using a microplate reader.

rNa isolation and real-time polymerase chain reactionThe expression of osteogenic-specific genes encoding Runt-

related transcription factor 2 (Runx2), type I collagen alpha

1 (Col1a1), and osteocalcin (OCN) at messenger RNA

level was characterized on day 14 by real-time polymerase

chain reaction (RT-PCR) (Thermo Fisher Scientific). Total

RNA was isolated with TRIzol and reverse transcribed with

RevertAid™ First Strand cDNA Synthesis Kit (Fermentas,

Vilnius, Lithuania). The resultant complementary DNA was

applied for the PCR using SYBR Green. The relative level

of each target gene was normalized by glyceraldehyde-3-

phosphate dehydrogenase (GAPDH) using a comparative

cycle threshold (ddCt) method. Primers used in this study

were listed in Table S1.

ImmunocytochemistryAt preset time points, cells on the samples were fixed with

4% paraformaldehyde for 10 minutes and permeabilized

with Triton X-100 (0.1%) for 5 minutes. After blocking with

bovine serum albumin solution (1%) for 2 hours, the samples

were incubated overnight at 4°C with primary antibodies:

mouse monoclonal anti-human OCN (1:100 dilution; Abcam,

Cambridge, MA, USA), rabbit polyclonal anti-human osteo-

pontin (OPN, 1:500 dilution; Abcam), and mouse monoclonal

anti-human paxillin (1:1,000 dilution; BD Biosciences, San

Jose, CA, USA). Afterward, cells were washed thrice with

PBS and incubated for 1 hour at RT with the appropriate

secondary antibody: fluorescein isothiocyanate-488 goat

anti-rabbit (1:1,000; Cell Signaling Technology, Boston,

MA, USA) or tetramethylrhodamine isothiocyanate-543

goat anti-mouse (1:1,000; Cell Signaling Technology). Sub-

sequently, 4′,6-diamidino-2-phenylindole (10 μg/mL) and

fluorescein isothiocyanate–phalloidin (5 μg/mL) were used

for counterstaining of cell nuclei and F-actin, respectively.

Fluorescence signals were captured under confocal micro-

scope (Carl Zeiss Meditec AG, Jena, Germany).

Western blottinghMSCs were harvested on day 14 and lysed by radio immuno-

precipitation assay buffer containing protease inhibitor cock-

tail. Protein concentration was determined by a bicinchoninic

acid protein assay kit (Thermo Fisher Scientific) according

to the manufacturer’s instructions. Protein samples (25 μg)

were separated by sodium dodecyl sulfate-polyacrylamide

gel electrophoresis (10%) and transferred to poly vinylidene

fluoride membranes (EMD Millipore). After blocking with

skimmed milk (5%) in TBS containing 0.05% Tween-20

(TBST) for 1 hour, the membranes were incubated over-

night at 4°C with primary antibodies: anti-β-actin (1:1,000;

Cell Signaling Technology), anti-GAPDH (1:1,000; Cell

Signaling Technology), anti-human Runx2 (1:3,200; Cell

Signaling Technology), anti-human Col1a1 (1:1,000; Santa

Cruz Biotechnology Inc., Dallas, TX, USA), and anti-human

paxillin (1:1,000; BD Biosciences), followed by washing

thrice with TBST. Afterward, the membranes were incubated

with horseradish peroxidase-conjugated secondary antibodies

(1:10,000; Cell Signaling Technology) for 1 hour at RT. After

washing thrice with TBST, the horseradish peroxidase reac-

tion product was detected by ECL Western Blotting kit.

statistical analysisAll experiments were performed in triplicate, and the results

were expressed as mean ± standard deviations. One-way analy-

sis of variance and Tukey’s post hoc test were applied to statisti-

cally evaluate significant differences among groups by means of

SPSS software (version 13.0; SPSS Inc., Chicago, IL, USA). A

value of P,0.05 was considered statistically significant.

Results and discussionMicrostructural characteristics of functionalized nanofibersAs shown in SEM images (Figure 2A), the pure aligned

and randomly oriented nanofibers exhibited smooth and

uniform morphology without bead defects. However, some

nanosized particulates and incremental discrepancies in

surface roughness were observed on nanofibers after surface

modification of pDA and peptides, even though no significant

Table 1 PCL nanofiber formulations

Sample code

Nanofiber orientation

pDA coating (h)

Peptide solution (μg/mL)

r-pDa random 1 –r-pDa-pep random 1 200a-pDa aligned 1 –a-pDa-pep aligned 1 200

Abbreviations: h, hour; Pcl, polycaprolactone; pDa, polydopamine; pep, peptide; R, pure randomly oriented PCL nanofiber; A, pure aligned PCL nanofiber.

International Journal of Nanomedicine 2015:10submit your manuscript | www.dovepress.com

Dovepress

Dovepress

7114

gao et al

Figure 2 Surface characterization of functionalized nanofibers.Notes: (A) SEM images of peptide-decorated nanofibers. The white arrows represent the pDA aggregate particulates. The corresponding SEM images obtained at low magnification are shown as insets. (B) Fiber diameter measurement of nanofibers. (C) Representative surface topographical images of peptide-decorated nanofibers. The white arrows indicate the reference direction for orientation evaluation. The compass images represent the orientation distribution of peptide-decorated nanofibers with random and aligned orientation. (D) Water contact angle and representative images of water droplet on PCL nanofibers with different surface chemistries. (E) raman spectra analysis of PCL and pDA-coated nanofibers. (F) High-resolution carbon peaks (C1s) from PCL nanofibers with different surface chemistries. The table shows the peak percentage in the carbon peaks (C1s) core-level XPS in different nanofibers.Abbreviations: seM, scanning electron microscope; pDa, polydopamine; Pcl, polycaprolactone; XPs, X-ray photoelectron spectroscopy; r, pure randomly oriented Pcl nanofiber; A, pure aligned PCL nanofiber; pep, peptide.

ωδ

ν

International Journal of Nanomedicine 2015:10 submit your manuscript | www.dovepress.com

Dovepress

Dovepress

7115

Osteoinductive peptide-functionalized nanofibers for bone tissue engineering

differences in fiber diameters were detected among groups

(P.0.05; Figure 2B). These findings were quantitatively

confirmed by WLI analysis as shown in Table S2 (P,0.05),

suggesting pDA and peptides could roughen the surface of the

substrates.18 Moreover, the orientation degree of nanofibers

was analyzed by WLI (Figure 2C). Most nanofibers in the

randomly oriented substrates showed a broad distribution

of ±90° with respect to the reference axis, while the aligned

ones presented an intensive distribution with the majority

of nanofibers within −30°, implying potential differences

in the cell fate commitment associated with nanofiber

orientation.

Construction of biomimetic materials that simulate

the microstructural features of bone ECM is critical to the

advancement of scaffold design targeted at an efficient

control of stem cell fate. Recently, diverse bone-mimic

nanopatterned platforms for directed osteogenic differentia-

tion were reported.2,19 For instance, work done by Kim et al19

demonstrated that hMSCs grown on the polyurethane acrylate

substrates with bone-like nanoscale groove-shaped topogra-

phy exhibited significant upregulation of osteo-specific mark-

ers expression compared to those on unpatterned surfaces.

Despite a straightforward approach for in vitro research,

such reported patterned substratum, merely a simplified

platform, cannot create three-dimensional architecture with

desired topographies such as fibrous building blocks and

highly interconnected porous structures.3,20 Furthermore, the

fabrication of these substrates requires complex processing

procedures such as photolithography and electrochemical

etching, limiting their applicable potential in clinics. On the

contrary, the nanofibrous matrices fabricated by electrospin-

ning process have gained increasing interest over the past

decade, mainly due to the structural similarity to the tissue

ECM, the processing availability to a wide range of materi-

als, as well as simple setup and operation at low cost.5 These

intriguing features endow electrospun nanofibers with greater

promise as scaffolds for bone tissue engineering.

surface characterization of functionalized nanofibersWater contact angle is a convenient approach to evaluate the

hydrophilic–hydrophobic attributes of nanofiber surfaces.

It is documented that pDA coating could improve the hydro-

philicity properties of polymeric biomaterials.21 Consistent

with previous reports, the water contact angle on the aligned

PCL nanofibers coated with pDA for 1 hour decreased from

120.1°±5.3° to 91.3°±6.5° (Figure 2D), due to the hydrophi-

licity of dopamine molecules with a catecholamine group.

Moreover, the immobilization of peptides on the pDA-coated

nanofiber surface further decreased the water contact angle

to 53.1°±9.6°, which implies the successful conjugation of

peptides onto nanofibers (P,0.05).

To further validate the results of water contact angle,

Raman spectra and XPS were obtained as shown in Figure 2E

and F, respectively. Typical bands in the range of 1,725 cm−1

(νC=O), 1,419–1,470 cm−1 (δCH2), 1,282–1,308 cm−1 (ωCH

2),

and 1,112 cm−1 (skeletal stretching) for PCL nanofibers were

detected in Raman spectra,22 whereas pDA-coated sample

displayed additional peaks at ~1,590 cm−1 and 1,440 cm−1,

which correspond to the deformation and stretching of cat-

echol, respectively,21 indicating the successful deposition of

pDA onto nanofibers. In XPS (Figure 2F), peaks at 284.8 eV

(C–C), 286.2 eV (C–O), and 288.8 eV (C=O) were observed

on PCL nanofibers, which could be ascribed to the presence

of esters in the main backbone of the polymer,23 whereas a

signal for C–N bond (286 eV) was recorded on both pDA-

coated and peptide-decorated nanofibers. Quantification of

the intensity of C–N bond revealed a gradual enhancement

on the pDA-coated and peptide-decorated PCL nanofiber

surfaces (Figure 2F), proving the presence of pDA and pep-

tides on the functionalized nanofibers.

Surface functionalization is a straightforward and robust

approach to regulate cell behaviors. To modify the interfacial

attributes of synthetic nanofibers, physical adsorption and

chemical covalent conjugation have been widely explored in

recent years.6 Physical adsorption is the simplest and drug-

friendly strategy for loading biomolecules on the nanofibrous

mesh. However, the binding affinity is highly dependent on the

type of materials, and long-term stability is not guaranteed.24

Thereby, chemical covalent conjugation is favored over

physical adsorption in tissue engineering because the

covalently grafted molecules are not easily leached out from

the surface-modified nanofibers for long-term application.6

On the other hand, conventional chemical conjugation

approaches often require complicated chemical steps, which

may lead to denaturation or partial inactivation of the grafted

molecules in the harsh chemical environment, limiting their

applicability in clinic.24 Recently, a facile, green, and potent

surface modification strategy for immobilizing bioactive

factors via simple dip-coating with dopamine solution was

reported.25 Dopamine, a mussel-inspired monomer, could

initiate oxidative self-polymerization and form a thin adherent

polymer film on material surfaces in weak alkaline solution,

which enable easy conjugation of biomolecules containing

thiols or primary amines moieties via Schiff base reactions or

Michael addition,25 thereby holding a promising potential in

the surface engineering of bone-mimic nanofiber materials.

International Journal of Nanomedicine 2015:10submit your manuscript | www.dovepress.com

Dovepress

Dovepress

7116

gao et al

cell adhesion and spreading on functionalized nanofibersAdhesion and spreading are the first event of cell response to

a substrate, which plays a profound role in determining stem

cell fate such as self-renewal and differentiation.26 Therefore,

early adhesion and spreading of hMSCs on functionalized

nanofibers were evaluated under serum-free conditions in

order to eliminate the disturbance of soluble ECM adhesion

proteins from serum (Figure S3).

As shown in SEM (Figure 3A), time-dependent shape

of hMSCs was observed on functionalized nanofibers. At

2 hours after seeding, cells on control glass exhibited fried

egg-like morphology without pseudopodium, but on nanofi-

ber surfaces, regardless of fiber orientation, short lamellipo-

dia were observed at the periphery of cells, showing favorable

affinity of nanofiber substrates to cell adhesion. In addition,

compared to hMSCs in R-pDA and A-pDA groups, cells

in R-pDA-pep and A-pDA-pep groups displayed improved

spreading morphology, highlighting the significance of

BFP-1 peptides for early cell spreading on nanofibers. In

consistent with SEM observation, CCK-8 data (Figure 3B)

showed that at 2 hours, the number of cells in R-pDA-pep and

A-pDA-pep groups was more than that in R-pDA and A-pDA

groups (P,0.05), respectively. However, no significant dif-

ferences were showed between R-pDA and A-pDA groups,

or between R-pDA-pep and A-pDA-pep groups (P.0.05),

which was further confirmed by laser scanning confocal

microscope photographs (Figure S4), suggesting the little

effect of fiber orientation on early cell attachment. Similar

trend was found at 4 hours after seeding. At these time points,

hMSCs on randomly oriented nanofibers presented noticeable

polygonal profile without a preferential direction, whereas

cells on aligned fibers showed spindle-like shape and arrayed

along the fiber axis, which recapitulated the aboriginal cell

shape and orientation in bone tissue.27 In contrast, hMSCs

on glass only began to extend lamellipodia. At 24 hours

after seeding, hMSCs had been sufficiently spread out in

all groups. Our results showed that surface modification of

Figure 3 hMSCs’ adhesion, proliferation, and viability on surface-functionalized PCL nanofibers.Notes: (A) SEM observation and (B) CCK-8 assay of adhering hMSCs on samples in serum-free growth media. Scale bars indicate 15 μm. (C) The proliferation of hMscs on functionalized nanofibers for 1, 3, and 5 days. #compared with r-pDa, P,0.05; *compared with a-pDa, P,0.05. (D) Viability of hMSCs on functionalized nanofibers labeled by FDA/PI staining. Live cells: green; dead cells: red. Scale bars indicate 100 μm.Abbreviations: SEM, scanning electron microscope; CCK-8, Cell Counting Kit-8; hMSCs, human mesenchymal stem cells; pDA, polydopamine; FDA, fluorescein diacetate; PI, propidium iodide; h, hours; TCP, tissue culture plate; PCL, polycaprolactone; R, pure randomly oriented PCL nanofiber; A, pure aligned PCL nanofiber; pep, peptide.

International Journal of Nanomedicine 2015:10 submit your manuscript | www.dovepress.com

Dovepress

Dovepress

7117

Osteoinductive peptide-functionalized nanofibers for bone tissue engineering

BFP-1 peptides may contribute to the adhesion and spreading

of hMSCs on pDA-coated nanofibers.

Cell proliferation and viability on functionalized nanofibersSuccessful engineered scaffolds are not only supportive of

cell adhesion but also improve cell proliferation. Clearly,

Figure 3C shows that all test groups exhibited good time-

dependent cell growth. However, lower optical density

value was observed in all experimental groups compared

with tissue culture plate (TCP) control during incubation

(P,0.05), indicating somewhat negative influence on cell

growth of nanofibers, regardless of orientation and surface

chemistries. The possible explanation is that the scaffold in

pursuit of osteogenic differentiation may inhibit cell prolif-

eration to some extent.28 Still, A-pDA-pep and R-pDA-pep

groups displayed higher optical density value than A-pDA

and R-pDA groups (P,0.05), respectively, after incubating

for 3 and 5 days, even though no statistical difference was

showed between A-pDA-pep and R-pDA-pep samples as

well as between A-pDA and R-pDA samples (P.0.05) dur-

ing culture period. In agreement with the results of lactate

dehydrogenase (Figure S5) and proliferation assay, FDA/

PI staining (Figure 3D) displayed that hMSCs grew well in

each group during 5-day cultivation, and much more viable

cells were captured in R-pDA-pep and A-pDA-pep groups

on days 3 and 5, compared to R-pDA and A-pDA groups,

respectively, suggesting that nanofiber orientation has little

impact on cell growth, but proper surface modification with

BFP-1 peptides could endow the nanofibers with more desir-

able cytocompatibility.

hMscs osteogenic differentiation under osteoinductive conditionsTo evaluate the osteogenic bioactivity of peptide-decorated

nanofibers with aligned orientation, the extent of osteogen-

esis in hMSCs on functionalized nanofibers with different

orientation and surface chemistries was assessed under

osteoinductive condition.

Among the major osteogenic hallmarks, the upregula-

tion of ALP activity is considered a key event occurring

during the early time points of osteogenesis.1 As shown in

Figure 4A, compared to control TCP group, all test groups

demonstrated an enhancement in ALP activity. A-pDA

group exhibited higher ALP activity in both time points

than R-pDA group (P,0.05), indicating the positive influ-

ence of aligned nanofibers on the osteogenic differentiation

of stem cells. Furthermore, an increase in ALP activity was

detected in A-pDA-pep and R-pDA-pep samples with a peak

at 14 days due to the immobilization of BFP-1 peptides on

the nanofiber surfaces. This finding suggests that the pres-

ence of peptides on the nanofiber surfaces is capable of

triggering an upregulation of ALP, correlated with the first

checkpoint for osteogenic differentiation. It is noteworthy

that more than a 1.5-fold increase in ALP activity was

observed in A-pDA-pep samples compared to R-pDA-pep

samples on day 14, highlighting a significant synergistic

effect between aligned nanofibers and peptides on the ALP

expression of hMSCs, which was further qualitatively con-

firmed via enzyme histochemistry staining of ALP at 14 days

(Figures 4A and S6).

The production of calcium deposit at late stage of dif-

ferentiation is another critical indicator for osteogenic effi-

ciency of hMSCs.29 As the osteogenic culture of hMSCs on

functionalized nanofibers progressed to 21 days, cells aggre-

gated together and formed bone-like structures that were

stained for ARS (Figure 4B). Similar to the trend observed

with ALP activity, more calcium nodules were detected on

all nanofibers in comparison with TCP surface, suggesting

the osteogenic advantages of nanofibers over TCP surface.

Furthermore, it is clearly seen that the aligned nanofibers

induced denser red staining than random nanofibers. Due

to the conjugation of peptides on nanofibers, a significant

increment in the amount of mineralized matrix was observed

in both R-pDA-pep and A-pDA-pep groups. Particularly,

hMSCs on peptide-conjugated aligned nanofibers showed

the highest production of calcium nodules among all groups

(P,0.05). In addition, it is noteworthy that R-pDA-pep

group induced more production of calcium deposition than

A-pDA group by day 21 (P,0.05). This result suggests that

biochemical cues arising from BFP-1 peptides may play

a greater role in the osteogenic differentiation of hMSCs

than topographical cues imparted by aligned nanofibers.

However, an opposite result was observed in the ALP

assay. The hMSCs on A-pDA samples presented relatively

higher ALP activity compared to those on R-pDA-pep

samples at 7 days according to the quantitative measure-

ment of ALP (P,0.05). The reasonable explanation is that

the impact of topography cues on osteoblast differentiation

may commence in the earlier stage compared to biochemi-

cal cues, which attributes to the dramatic cell response to

aligned fibers since the moment the cells are in contact

with substrates, resulting in the cytoskeletal reorganization

in the short term and subsequent activation of intracellular

signaling associated with osteogenesis. But as far as final

osteogenic efficiency is concerned, BFP-1 peptides may

International Journal of Nanomedicine 2015:10submit your manuscript | www.dovepress.com

Dovepress

Dovepress

7118

gao et al

Figure 4 (Continued)

International Journal of Nanomedicine 2015:10 submit your manuscript | www.dovepress.com

Dovepress

Dovepress

7119

Osteoinductive peptide-functionalized nanofibers for bone tissue engineering

Figure 4 The effect of functionalized nanofibers on osteogenic differentiation of hMSCs under osteoinductive condition.Notes: (A) representative staining of alP on day 14 and determination of alP activity at 7 and 14 days. (B) ars staining and determination of calcium deposition on day 21. (C) RT-qPCR analysis for osteo-specific genes on day 14. (D) Representative immunofluorescent images of OCN (green) and OPN (red) in different groups on day 14. Scale bars indicate 100 μm. (E) Western blot analysis of Col1a1 and Runx2 expression in hMSCs on different samples. #compared with r-pDa, P,0.05; *compared with a-pDa, P,0.05; $compared with r-pDa-pep, P,0.05.Abbreviations: hMscs, human mesenchymal stem cells; alP, alkaline phosphatase; ars, alizarin red s; rT-qPcr, real-time quantitative polymerase chain reaction; OcN, osteocalcin; OPN, osteopontin; col1a1, type I collagen alpha 1; runx2, runt-related transcription factor 2; pDa, polydopamine; TcP, tissue culture plate; gaPDh, glyceraldehyde-3-phosphate dehydrogenase; PCL, polycaprolactone; R, pure randomly oriented PCL nanofiber; A, pure aligned PCL nanofiber; pep, peptide.

β

exert stronger influence on the cell fate in comparison with

aligned fibers.

To better understand the cellular interactions with func-

tionalized nanofibers at transcript level, the expressions of

osteo-specific genes were analyzed on day 14 (Figure 4C).

The fold change of target genes was normalized to undif-

ferentiated control hMSCs. Of all the osteo-related genes,

OCN is regarded as the most specific marker for the mature

osteoblast and mineralization during the course of osteo-

genesis.30 It accumulates in the calcified bone due to its high

affinity to hydroxyapatite crystals. As shown in Figure 4C,

OCN gene was upregulated in A-pDA group in comparison

with R-pDA group (P,0.05). When cells were cultured

with peptide-decorated nanofibers, even higher expression

of OCN was detected compared to peptide-unmodified

group, irrespective of fiber orientation (P,0.05). It is noted

that hMSCs in A-pDA-pep group showed a nearly 20-fold

upregulation in expression of OCN, which was more than

nearly 1.5 times of the expression observed in R-pDA-pep

group. Clearly, the modification of BFP-1 peptides on nano-

fibers could further elevate the OCN expression, especially

when applied to the aligned fibers, which is also confirmed

along with another osteo-specific protein OPN in immu-

nofluorescence test (Figure 4D). Moreover, the expression

International Journal of Nanomedicine 2015:10submit your manuscript | www.dovepress.com

Dovepress

Dovepress

7120

gao et al

profiles of gene Runx2, which is associated with the initiation

of osteoblast differentiation,31 and Col1a1, which is involved

in the biosynthesis of ECM, correlated well with the change

in OCN, and Western blot analysis appeared to support this

result at protein level (Figure 4E).

hMscs osteogenic differentiation under non-osteoinductive conditionshMSCs could experience spontaneous osteogenic differ-

entiation in the OM due to the presence of osteoinducing

factors, dexamethasone, β-glycerophosphate, and ascorbic

acid. To circumvent the interference of OM in the intrinsic

osteoinductive activity of peptide-functionalized nanofibers,

we concomitantly assessed the differentiation of hMSC in

normal media via the same set of experiments performed

under osteoinductive condition.

As shown in Figures 5A, B and S6, hMSCs on TCP

surface maintained an undifferentiated state under non-

osteoinductive condition because of extreme low level of

ALP activity in cells during early time points and little

production of calcium nodules after 21 days of culture.

However, when hMSCs were seeded on peptide-decorated

aligned nanofibers, the ALP expression in cells was sig-

nificantly elevated at 14 days and exhibited highest level

among groups even though the activity decreased under

non-osteoinductive condition (Figure 5A). Similar to the

trend of ALP expression, hMSCs in A-pDA-pep group

formed much more bone-like nodules compared to other

three groups on day 21 (Figure 5B). RT-PCR results

showed that when BFP-1 peptides were grafted to aligned

nanofiber surfaces, a significant upregulation of OCN and

Runx2 genes was observed in hMSCs after 14 days of

coculture (Figure 5C). The results of immunofluorescent

staining and Western blot corroborated the similar effect

as well. Due to the surface modification of BFP-1 peptides

to aligned nanofibers, a manifest enhancement in the depo-

sition of OCN and OPN was viewed in confocal images

(Figure 5D). Western blotting analysis also revealed that

the expression of Runx2 protein in A-pDA-pep group was

much stronger than that in R-pDA-pep group even though

the production of Col1a1 protein between them was abut-

ting, corresponding to the data from RT-PCR (Figure 5E).

Taken together, the osteogenic capacity of hMSCs cultured

in normal media is not comparable to those in OM. However,

the combined application of aligned nanofibers and BFP-1

peptides showed predominant activation in the osteogenic

differentiation of hMSCs even without addition of soluble

osteoinducing factors.

Enhanced focal adhesion of hMSCs by aligned nanofibersThe enhanced osteogenic differentiation of hMSCs on func-

tionalized nanofibers with highly ordered structures may be

correlated to the upregulation of focal adhesion proteins by

the stimulation of nano- or microscale topographical features

emanating from cell culture substrates.26 Thereby, the expres-

sion of paxillin, a typical focal adhesion adaptor protein

found at the interface between the plasma membrane and the

actin cytoskeleton (Figure 6A),32 was investigated on day 7

by immunofluorescent staining and Western blot analysis.

Cells were cultured under serum-containing condition. As

shown in Figure 6B, the paxillin in hMSCs was polarized

along the direction of aligned nanofibers compared to the

negligible polarization on the randomly oriented nanofibers,

which accompanied with cytoskeletal alteration influenced

by fiber orientation. In addition, the distribution area of

fluorescence signal emitted from paxillin on A-pDA and

A-pDA-pep nanofibers was larger than that on R-pDA and

R-pDA-pep nanofibers, respectively, indicating the powerful

influence of aligned nanofibers on the focal adhesion forma-

tion of hMSCs. Western blot analysis clearly revealed that

nearly onefold increase in paxillin expression was detected

in hMSCs subjected to aligned nanofibers compared to those

on randomly oriented nanofibers (Figure 6C). Our results

may suggest that the enhancement in focal adhesion forma-

tion on aligned nanofibers could facilitate the osteogenesis

potential of hMSCs.

ConclusionIn this study, BFP-decorated PCL nanofibers with highly

ordered structures that simulated the crucial characteristics

of native bone tissue were developed via catechol chemistry

to support and regulate osteoblast differentiation of hMSCs.

Our results demonstrated that the surface modification of

BFP-1 peptides on nanofibers could improve hMSCs adhe-

sion, spreading, and proliferation. More importantly, the

aligned nanofibers and surface-grafted BFP-1 peptides can

act synergistically in combination to enhance the osteogenic

differentiation of stem cells even under non-osteoinductive

conditions. Other experiments are in progress to investigate

whether the combination of osteoinductive peptides and

aligned nanofibers could realize the synergistic effect on

bone formation in vivo as well as in vitro. We believe the

presented study provides an instructive insight in designing

biomimetic scaffolds targeted at efficient osteogenic dif-

ferentiation in the context of bone tissue engineering and

regenerative medicine.

International Journal of Nanomedicine 2015:10 submit your manuscript | www.dovepress.com

Dovepress

Dovepress

7121

Osteoinductive peptide-functionalized nanofibers for bone tissue engineering

Figure 5 The effect of functionalized nanofibers on osteogenic differentiation of hMSCs under non-osteoinductive condition.Notes: (A) representative staining of alP on day 14 and determination of alP activity at 7 and 14 days. (B) ars staining and determination of calcium deposition on day 21. (C) RT-qPCR analysis for osteo-specific genes on day 14. (D) Representative immunofluorescent images of OCN (green) and OPN (red) in different groups on day 14. Scale bars indicate 100 μm. (E) Western blot analysis of Col1a1 and Runx2 expression in hMSCs on different samples. #compared with r-pDa, P,0.05; *compared with a-pDa, P,0.05; $compared with r-pDa-pep, P,0.05.Abbreviations: hMscs, human mesenchymal stem cells; alP, alkaline phosphatase; ars, alizarin red s; rT-qPcr, real-time quantitative polymerase chain reaction; OcN, osteocalcin; OPN, osteopontin; col1a1, type I collagen alpha 1; runx2, runt-related transcription factor 2; pDa, polydopamine; TcP, tissue culture plate; gaPDh, glyceraldehyde-3-phosphate dehydrogenase; PCL, polycaprolactone; R, pure randomly oriented PCL nanofiber; A, pure aligned PCL nanofiber; pep, peptide.

β

International Journal of Nanomedicine 2015:10submit your manuscript | www.dovepress.com

Dovepress

Dovepress

7122

gao et al

Figure 6 Effect of fiber topography on the focal adhesion formation of hMSCs.Notes: (A) The location of paxillin in hMSCs cultured on glass. Scale bar indicates 20 μm. (B) Representative immunofluorescent images of paxillin expressed on different samples. Scale bars indicate 100 μm. DAPI (blue), phalloidin (green), and paxillin (red). (C) Western blot analysis of paxillin expression in hMSCs on different samples. GAPDH was used as control. *compared with r-pDa, P,0.05; #compared with r-pDa-pep, P,0.05.Abbreviations: hMscs, human mesenchymal stem cells; DaPI, 4′,6-diamidino-2-phenylindole; gaPDh, glyceraldehyde-3-phosphate dehydrogenase; pDa, polydopamine; PCL, polycaprolactone; R, pure randomly oriented PCL nanofiber; A, pure aligned PCL nanofiber; pep, peptide.

AcknowledgmentsThis work was supported in part by the National Natural Science

Foundation of China (No 81371697, No 81271183), Peking

University’s 985 Grants, the Open Project of Chongqing Key

Laboratory of Oral Diseases and Biomedical Sciences (No

ODBS-2014-001), Program for Innovation Team Building at

Institutions of Higher Education in Chongqing in 2013, Chongq-

ing Municipal Key Laboratory of Oral Biomedical Engineering

of Higher Education, Chongqing Research Program of Basic

Research and Frontier Technology (No cstc2013jcyjA10022)

and the Outstanding Doctoral Scientific Research Fund of

Chongqing Medical University. We would also like to thank

Linqian Yang, Xucheng Xu, Xiaoli Ji, Shuai Zhang, Ting Ma,

Mingyue Liu, and Yuying Shi for their help in this work.

Author contributionsAll authors contributed toward data analysis, drafting and

critically revising the paper, and agree to be accountable for

all aspects of the work.

DisclosureThe authors report no conflicts of interest in this work.

References1. Gaharwar AK, Mihaila SM, Swami A, et al. Bioactive silicate nanoplate-

lets for osteogenic differentiation of human mesenchymal stem cells. Adv Mater. 2013;25(24):3329–3336.

2. Kim J, Kim HN, Lim KT, et al. Synergistic effects of nanotopography and co-culture with endothelial cells on osteogenesis of mesenchymal stem cells. Biomaterials. 2013;34(30):7257–7268.

3. Lim SH, Mao HQ. Electrospun scaffolds for stem cell engineering. Adv Drug Deliv Rev. 2009;61(12):1084–1096.

4. Fernandez-Yague MA, Abbah SA, McNamara L, Zeugolis DI, Pandit A, Biggs MJ. Biomimetic approaches in bone tissue engineering: integrating biological and physicomechanical strategies. Adv Drug Deliv Rev. 2015; 84:1–29.

5. Jang J-H, Castano O, Kim H-W. Electrospun materials as potential plat-forms for bone tissue engineering. Adv Drug Deliv Rev. 2009;61(12): 1065–1083.

6. Yoo HS, Kim TG, Park TG. Surface-functionalized electrospun nanofi-bers for tissue engineering and drug delivery. Adv Drug Deliv Rev. 2009; 61(12):1033–1042.

7. Cipitria A, Skelton A, Dargaville TR, Dalton PD, Hutmacher DW. Design, fabrication and characterization of PCL electrospun scaffolds – a review. J Mater Chem. 2011;21(26):9419–9453.

International Journal of Nanomedicine 2015:10 submit your manuscript | www.dovepress.com

Dovepress

Dovepress

7123

Osteoinductive peptide-functionalized nanofibers for bone tissue engineering

8. Lee J-H, Lee YJ, Cho H-J, Shin H. Guidance of in vitro migration of human mesenchymal stem cells and in vivo guided bone regeneration using aligned electrospun fibers. Tissue Eng Part A. 2014;20(15–16): 2031–2042.

9. Ma J, He X, Jabbari E. Osteogenic differentiation of marrow stromal cells on random and aligned electrospun poly(l-lactide) nanofibers. Ann Biomed Eng. 2010;39(1):14–25.

10. Nikkhah M, Edalat F, Manoucheri S, Khademhosseini A. Engineering microscale topographies to control the cell-substrate interface. Bioma-terials. 2012;33(21):5230–5246.

11. Beachley V, Katsanevakis E, Zhang N, Wen X. Highly aligned polymer nanofiber structures: fabrication and applications in tissue engineering. Adv Polym Sci. 2011;246:171–212.

12. Kim HN, Jiao A, Hwang NS, Kim MS, Kim D-H, Suh K-Y. Nanotopography-guided tissue engineering and regenerative medicine. Adv Drug Deliv Rev. 2013;65(4):536–558.

13. Cha C, Liechty WB, Khademhosseini A, Peppas NA. Designing bio-materials to direct stem cell fate. ACS Nano. 2012;6(11):9353–9358.

14. Kim HK, Kim JH, Park DS, et al. Osteogenesis induced by a bone forming peptide from the prodomain region of BMP-7. Biomaterials. 2012;33(29):7057–7063.

15. Perikamana SK, Lee J, Ahmad T, et al. Effects of immobilized BMP-2 and nanofiber morphology on in vitro osteogenic differentiation of hMSCs and in vivo collagen assembly of regenerated bone. ACS Appl Mater Interfaces. 2015;7(16):8798–8808.

16. Marletta G, Ciapetti G, Satriano C, Pagani S, Baldini N. The effect of irradiation modification and RGD sequence adsorption on the response of human osteoblasts to polycaprolactone. Biomaterials. 2005;26(23): 4793–4804.

17. Ko E, Yang K, Shin J, Cho SW. Polydopamine-assisted osteoinduc-tive peptide immobilization of polymer scaffolds for enhanced bone regeneration by human adipose-derived stem cells. Biomacromolecules. 2013;14(9):3202–3213.

18. Rim NG, Kim SJ, Shin YM, et al. Mussel-inspired surface modifica-tion of poly(l-lactide) electrospun fibers for modulation of osteogenic differentiation of human mesenchymal stem cells. Colloids Surf B Biointerfaces. 2012;91:189–197.

19. Kim MJ, Lee B, Yang K, et al. BMP-2 peptide-functionalized nanop-atterned substrates for enhanced osteogenic differentiation of human mesenchymal stem cells. Biomaterials. 2013;34(30):7236–7246.

20. Hollister SJ. Porous scaffold design for tissue engineering. Nat Mater. 2005;4(7):518–524.

21. Ku SH, Ryu J, Hong SK, Lee H, Park CB. General functionalization route for cell adhesion on non-wetting surfaces. Biomaterials. 2010; 31(9):2535–2541.

22. Low WC, Rujitanaroj PO, Lee DK, et al. Nanofibrous scaffold-mediated REST knockdown to enhance neuronal differentiation of stem cells. Biomaterials. 2013;34(14):3581–3590.

23. Shin YM, Lee YB, Kim SJ, et al. Mussel-inspired immobilization of vascular endothelial growth factor (VEGF) for enhanced endothelializa-tion of vascular grafts. Biomacromolecules. 2012;13(7):2020–2028.

24. Ku SH, Park CB. Combined effect of mussel-inspired surface modification and topographical cues on the behavior of skeletal myoblasts. Adv Healthc Mater. 2013;2(11):1445–1450.

25. Lee H, Dellatore SM, Miller WM, Messersmith PB. Mussel-inspired surface chemistry for multifunctional coatings. Science. 2007;318(5849): 426–430.

26. Das RK, Zouani OF. A review of the effects of the cell environment phys-icochemical nanoarchitecture on stem cell commitment. Biomaterials. 2014;35(20):5278–5293.

27. Biggs MJP, Richards RG, Dalby MJ. Nanotopographical modification: a regulator of cellular function through focal adhesions. Nanomedicine. 2010;6(5):619–633.

28. Jiang X, Cao HQ, Shi LY, Ng SY, Stanton LW, Chew SY. Nanofiber topography and sustained biochemical signaling enhance human mes-enchymal stem cell neural commitment. Acta Biomater. 2012;8(3): 1290–1302.

29. Kaur G, Wang C, Sun J, Wang Q. The synergistic effects of multivalent ligand display and nanotopography on osteogenic differentiation of rat bone marrow stem cells. Biomaterials. 2010;31(22):5813–5824.

30. Kaur G, Valarmathi MT, Potts JD, Wang Q. The promotion of osteo-blastic differentiation of rat bone marrow stromal cells by a polyvalent plant mosaic virus. Biomaterials. 2008;29(30):4074–4081.

31. Kozhevnikova M, Mikaelyan A, Starostin V. Molecular and genetic regulation of osteogenic differentiation of mesenchymal stromal cells. Biol Bull. 2008;35(3):223–232.

32. Turner CE. Paxillin and focal adhesion signalling. Nat Cell Biol. 2000; 2(12):231–236.

International Journal of Nanomedicine 2015:10submit your manuscript | www.dovepress.com

Dovepress

Dovepress

7124

gao et al

Supplementary materialsQuantification of immobilized peptides on the nanofibersImmobilized peptides on the functionalized nanofibers

were determined by fluorescamine assay. After surface

modification, the supernatant was retrieved and reacted with

fluorescamine solution (100 μg/mL in acetone; Aladdin

Reagent Co, Ltd, Shanghai, People’s Republic of China)

in a 96-well plate (bone-forming peptide solution =75 μL,

fluorescamine solution =25 μL) for 5 minutes at room

temperature. Then, the fluorescence intensities for each

sample were measured at 365 nm excitation wavelength

and 470 nm emission wavelength using a Multilabel Reader

(PerkinElmer Inc., Waltham, MA, USA). The content of

grafted peptides was calculated from a standard curve

based on a series of peptide solutions with known concen-

trations. Moreover, the fluorescein isothiocyanate-labeled

peptides were immobilized on the nanofibers to visualize

the distribution and density of peptides on the fibers by

laser scanning confocal microscope (Carl Zeiss Meditec

AG, Jena, Germany).

lDh assayThe cytotoxicity of functionalized nanofibers was assessed

using lactate dehydrogenase (LDH) assay kit (Beyotime Bio-

technology, Shanghai, People’s Republic of China) following

the manufacturer’s protocol. After 24 hours of culture, 10 μL

of the supernatant was transferred to a 96-well plate along

with 100 μL LDH reaction mix and incubated for 30 minutes

at room temperature. Absorbance measurement was done at

450 nm. The supernatant of the untreated cells and the lysed

cells on tissue culture plate (TCP) were used as negative

(0%) and positive controls (100%), respectively. The LDH

leakage (% of positive control) is expressed as the percentage

of (ODtest

− ODblank

)/(ODpositive

− ODblank

), where ODblank

is the

optical density of supernatant from TCP group.

Table S1 Primer sequences used for rT-Pcr analysis

Genes 5′–3′ Primers

Osteocalcin (OcN) Forward ccTgaaagccgaTgTggTreverse agggcagcgaggTagTga

runt-related transcription factor 2 (runx2) Forward aggaaTgcgcccTaaaTcacTreverse acccagaaggcacagacagaag

Type I collagen alpha 1 (col1a1) Forward agacacTggTgcTaagggagagreverse gaccagcaacaccaTcTgcg

glyceraldehyde-3-phosphate dehydrogenase (gaPDh) Forward cgacagTcagccgcaTcTTreverse ccaaTacgaccaaaTccgTTg

Abbreviation: rT-Pcr, real-time polymerase chain reaction.

Table S2 The roughness in different nanofiber-based platforms

Specimen Ra (μm, mean ± SD) Sample Ra (μm, mean ± SD)

r 1.67±0.25 a 1.92±0.31r-pDa 2.02±0.33 a-pDa 2.17±0.15r-pDa-pep 2.74±0.42 a-pDa-pep 2.71±0.23

Abbreviations: SD, standard deviation; R, pure randomly oriented PCL nanofiber; A, pure aligned PCL nanofiber; pDA, polydopamine; PCL, polycaprolactone; pep, peptide.

International Journal of Nanomedicine 2015:10 submit your manuscript | www.dovepress.com

Dovepress

Dovepress

7125

Osteoinductive peptide-functionalized nanofibers for bone tissue engineering

Figure S1 Visualization and determination of BFP-1 peptides immobilized on nanofibers.Notes: The binding density of peptides on both randomly oriented and aligned nanofibers increased as the concentration of treated peptides rose (P,0.05). Though aligned fibers presented a little higher peptide density than randomly oriented fibers in each concentration group, but no statistical differences between them (P.0.05) were observed, suggesting the orientation has little effect on the grafting efficiency of peptides on the surface of nanofibers. Scale bars indicate 10 μm.Abbreviation: BFP-1, bone-forming peptide-1.

Figure S2 The screening for optimal concentration of BFP-1 solution in surface functionalization.Notes: (A) The cell proliferation of hMSCs cultured on aligned nanofibers treated with various concentrations of peptide for 1, 3, and 5 days. (B) alP activity and (C) osteogenic gene expression of hMSCs cultured on aligned nanofibers treated with various concentrations of peptide at day 7. The results of ALP activity and early osteogenic genes (Runx2, ALP, and Col1a1) expression showed that the immobilized peptides on PCL nanofibers could enhance the osteogenic capacity of hMSCs in a concentration-dependent manner (0–200 μg/ml). however, high peptide concentration (400 μg/mL) on surfaces may inhibit osteogenic differentiation of hMSCs, which probably attribute to the cell growth restriction in high concentration group in accordance with ccK-8 results. Therefore, 200 μg/ml BFP-1 solution is an optimal concentration for surface functionalization of nanofibers. *P,0.05.Abbreviations: hMscs, human mesenchymal stem cells; alP, alkaline phosphatase; runx2, runt-related transcription factor 2; col1a1, Type 1 collagen alpha 1; Pcl, polycaprolactone; CCK-8, Cell Counting Kit-8; BFP-1, bone-forming peptide-1; TCP, tissue culture plate; d, day; OCN, osteopontin.

International Journal of Nanomedicine 2015:10submit your manuscript | www.dovepress.com

Dovepress

Dovepress

7126

gao et al

Figure S3 SEM observation of adhering hMSCs on samples in serum-containing growth media.Notes: Due to the effect of adhesive proteins, such as laminin and fibronectin, in serum, no evident difference in cell morphology was observed between R-pDA and R-pDA-pep groups as well as between A-pDA and A-pDA-pep groups at different time points. This finding was correlated with the result of subsequent focal adhesion formation assay, which revealed that there were no significant differences in the paxillin expression between R-pDA and R-pDA-pep groups as well as between A-pDA and A-pDA-pep groups when cells were cultured in the serum-containing media. The possible explanation is that abundant serum-derived adhesive proteins, such as laminin and fibronectin, were adsorbed on the surface of nanofibers, and enabled cells sufficiently spread out on all sample surfaces. Hence, the contribution of nonadhesive BFPs to cell adhesion and spreading was covered by the potent adhesive proteins. Scale bars indicate 15 μm.Abbreviations: SEM, scanning electron microscope; hMSCs, human mesenchymal stem cells; pDA, polydopamine; BFP, bone-forming peptide; h, hours; R, pure randomly oriented PCL nanofiber; A, pure aligned PCL nanofiber; pep, peptide; PCL, polycaprolactone.

Figure S4 Confocal micrographs of hMSCs on glass and nanofibers in serum-free growth media.Notes: Cytoskeleton is colored green. Scale bars indicate 100 μm.Abbreviations: hMSCs, human mesenchymal stem cells; pDA, polydopamine; h, hours; R, pure randomly oriented PCL nanofiber; A, pure aligned PCL nanofiber; pep, peptide; Pcl, polycaprolactone.

International Journal of Nanomedicine 2015:10 submit your manuscript | www.dovepress.com

Dovepress

Dovepress

7127

Osteoinductive peptide-functionalized nanofibers for bone tissue engineering

Figure S6 alP and ars staining of hMscs on TcP.Notes: representative staining of alP on TcP surface under non-osteoinductive condition (A) and osteoinductive condition (B) at day 14. ars staining on TcP surface under non-osteoinductive condition (C) and osteoinductive condition (D) at day 21.Abbreviations: alP, alkaline phosphatase; TcP, tissue culture plate; ars, alizarin red s; OM, osteoinductive media; α-MeM, α-Minimum essential Medium; hMsc, human mesenchymal stem cell.

α

Figure S5 LDH release from hMSCs after culture for 24 hours on nanofibers (normalized to LDH release from positive control).Notes: LDH is a stable enzyme present in the cytoplasm and released after cell death due to the compromise of the integrity of plasma membranes. Therefore, the relative value of LDH can serve as an indicator to reflect the proportion of dead cells in whole group. Approximately 8% dead cells were detected on the TCP surface at 24 hours after cell seeding. Compared to the control group, there was no considerable enhancement in LDH releasing level (P.0.05) when cells were exposed to nanofibers with different orientation and surface chemistries, suggesting favorable cytocompatability of functionalized nanofibers prepared in our work.Abbreviations: lDh, lactate dehydrogenase; hMscs, human mesenchymal stem cells; TcP, tissue culture plate; pDa, polydopamine; r, pure randomly oriented Pcl nanofiber; A, pure aligned PCL nanofiber; pep, peptide; PCL, polycaprolactone.

International Journal of Nanomedicine

Publish your work in this journal

Submit your manuscript here: http://www.dovepress.com/international-journal-of-nanomedicine-journal

The International Journal of Nanomedicine is an international, peer-reviewed journal focusing on the application of nanotechnology in diagnostics, therapeutics, and drug delivery systems throughout the biomedical field. This journal is indexed on PubMed Central, MedLine, CAS, SciSearch®, Current Contents®/Clinical Medicine,

Journal Citation Reports/Science Edition, EMBase, Scopus and the Elsevier Bibliographic databases. The manuscript management system is completely online and includes a very quick and fair peer-review system, which is all easy to use. Visit http://www.dovepress.com/testimonials.php to read real quotes from published authors.

International Journal of Nanomedicine 2015:10submit your manuscript | www.dovepress.com

Dovepress

Dovepress

Dovepress

7128

gao et al