on August 31, 2020 by guest...2015/08/17 · 1 Cerium regulates expression of alte rnative methanol...
Transcript of on August 31, 2020 by guest...2015/08/17 · 1 Cerium regulates expression of alte rnative methanol...
![Page 1: on August 31, 2020 by guest...2015/08/17 · 1 Cerium regulates expression of alte rnative methanol dehydrogenases 2 in Methylosinus trichosporium OB3b 3 4 By 5 6 Muhammad Farhan](https://reader034.fdocuments.in/reader034/viewer/2022051823/5fedd26174f28a2523685b3e/html5/thumbnails/1.jpg)
Page 1 of 23
Cerium regulates expression of alternative methanol dehydrogenases 1
in Methylosinus trichosporium OB3b 2
3
By 4
5
Muhammad Farhan Ul Haque1*, Bhagylakshmi Kalidass1* Nathan Bandow2, Erick A. Turpin2, Alan 6
A. DiSpirito2 and Jeremy D. Semrau1# 7
8
1Department of Civil and Environmental Engineering, University of Michigan, Ann Arbor, MI, 9
48109-2125 10
2Roy J. Carver Department of Biochemistry, Biophysics and Molecular Biology, Iowa State 11
University, Ames, IA, 50011 12
13
#To whom correspondence should be addressed. Email: [email protected]; 14
Phone: (734) 764-6487; Fax: (734) 763-2275 15
16
*These authors contributed equally to the manuscript 17
18
Running title: Effect of cerium on gene expression in methanotrophs 19
20
AEM Accepted Manuscript Posted Online 21 August 2015Appl. Environ. Microbiol. doi:10.1128/AEM.02542-15Copyright © 2015, American Society for Microbiology. All Rights Reserved.
on Decem
ber 31, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 2: on August 31, 2020 by guest...2015/08/17 · 1 Cerium regulates expression of alte rnative methanol dehydrogenases 2 in Methylosinus trichosporium OB3b 3 4 By 5 6 Muhammad Farhan](https://reader034.fdocuments.in/reader034/viewer/2022051823/5fedd26174f28a2523685b3e/html5/thumbnails/2.jpg)
Page 2 of 23
ABSTRACT 21
Methanotrophs have multiple methane monooxygenases that are well-known to be regulated 22
by copper, i.e., a “copper-switch”. At low copper:biomass ratios the soluble methane 23
monooxygenase (sMMO) is expressed while expression and activity of the particulate methane 24
monooxygenase (pMMO) increases with increasing availability of copper. In many 25
methanotrophs there are also multiple methanol dehydrogenases (MeDH), one based on Mxa 26
and another based on Xox. Mxa-MeDH is known to have calcium in its active site, while Xox-27
MeDHs have been shown to have rare earth elements in their active site. Here we show 28
expression of Mxa-MeDH and Xox-MeDH in Methylosinus trichosporium OB3b significantly 29
decreased and increased respectively when grown in the presence of cerium but the absence of 30
copper as compared to the absence of both metals. Expression of sMMO and pMMO was not 31
affected. In the presence of copper the effect of cerium on gene expression was less 32
significant, i.e., expression of Mxa-MeDH in the presence of copper and cerium was slightly 33
lower as compared to just the presence of copper, but Xox-MeDH was again found to increase 34
significantly. As expected, the addition of copper caused sMMO and pMMO expression to 35
significantly decrease and increase respectively, but the simultaneous addition of cerium had 36
no discernable effect on MMO expression. As a result, it appears Mxa-MeDH can be uncoupled 37
from methane oxidation by sMMO in M. trichosporium OB3b, but not from pMMO. 38
39
on Decem
ber 31, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 3: on August 31, 2020 by guest...2015/08/17 · 1 Cerium regulates expression of alte rnative methanol dehydrogenases 2 in Methylosinus trichosporium OB3b 3 4 By 5 6 Muhammad Farhan](https://reader034.fdocuments.in/reader034/viewer/2022051823/5fedd26174f28a2523685b3e/html5/thumbnails/3.jpg)
Page 3 of 23
INTRODUCTION 40
It is well-known that microorganisms have diverse mechanisms to sense and respond to metals 41
in their environment. These mechanisms typically include strategies to regulate gene 42
expression in response to the presence or absence of metals such as copper, zinc, iron, 43
manganese, arsenic, and mercury (e.g., 1-4). One such phenomenon is the “copper-switch” in 44
methanotrophs. That is, these microbes utilize methane as their sole growth substrate, but 45
have two different monooxygenases for the initial oxidation of methane to methanol. One, the 46
particulate methane monooxygenase (pMMO) is found in the intracytoplasmic membranes of 47
these microbes, and its expression and activity increases with increasing availability of copper. 48
The second, the soluble methane monooxygenase (sMMO) is found in the cytoplasm and is only 49
expressed when copper is unavailable (5). These two forms of MMO have very different 50
structures, activities, and substrate ranges (5-14), and so careful consideration of the form of 51
MMO expressed is critical for understanding methanotrophic ecology as well for various 52
applications of methanotrophy, including the removal of chlorinated solvents and methane, a 53
potent greenhouse gas (5, 10, 12, 15). 54
55
Further, interest in commercial application of methanotrophy has dramatically accelerated in 56
recent years, in part due to increased methane supplies given advances in hydraulic fracturing 57
of shale formations. As a result, methane prices have become quite low, with the wellhead 58
price of natural gas dropping from $10.79 per 1000 ft3 in July 2008 to $3.38 per 1000 ft3 in 59
December 2012 (16). A great deal of effort has thus been put forward to determine how to 60
best valorize methane, e.g., through the use of methanotrophs to convert methane into 61
on Decem
ber 31, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 4: on August 31, 2020 by guest...2015/08/17 · 1 Cerium regulates expression of alte rnative methanol dehydrogenases 2 in Methylosinus trichosporium OB3b 3 4 By 5 6 Muhammad Farhan](https://reader034.fdocuments.in/reader034/viewer/2022051823/5fedd26174f28a2523685b3e/html5/thumbnails/4.jpg)
Page 4 of 23
products such as single-cell protein, bioplastics, biofuels, and osmo-protectants, amongst other 62
compounds (5, 17, 18). Given that the two MMOs have very different activities and affinities 63
for methane, any use of a methanotrophic platform to valorize methane is strongly affected by 64
the form of MMO present. 65
66
Recent findings, however, indicate that the subsequent step in the general pathway of methane 67
oxidation, i.e., the oxidation of methanol by the methanol dehydrogenase, may also play a 68
critical role in the application of methanotrophy for environmental and commercial purposes. 69
First, it was reported in 2006 that the pMMO likely forms a supercomplex with a 70
pyrroquinolone quinone (PQQ)-linked methanol dehydrogenase (MeDH). Cryoelectron 71
microscopy work done by Myronova et al., (19) indicated that the PQQ-linked MeDH likely 72
forms a “cap” to the pMMO “body”, with the PQQ-linked MeDH residing in the periplasmic 73
space. Subsequent studies support this conclusion and indicate that the PQQ-linked MeDH and 74
pMMO supercomplex is anchored via the intracytoplasmic membranes (20). Other research 75
also suggests that electron transfer from the PQQ-linked MeDH to pMMO may occur in vivo 76
(21, 22). As such, any attempt to utilize pMMO-expressing cells for any specific application 77
should also consider efforts to stabilize the PQQ-linked MeDH-pMMO supercomplex and also 78
ensure effective back transfer of electrons from the MeDH to pMMO to drive pMMO activity. 79
80
Interestingly, not only are there two known forms of MMO in methanotrophs, most 81
methanotrophs also have an alternative methanol dehydrogenase. As mentioned above, it is 82
well-known that methanol is oxidized to formaldehyde via a periplasmic PQQ-linked MeDH. 83
on Decem
ber 31, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 5: on August 31, 2020 by guest...2015/08/17 · 1 Cerium regulates expression of alte rnative methanol dehydrogenases 2 in Methylosinus trichosporium OB3b 3 4 By 5 6 Muhammad Farhan](https://reader034.fdocuments.in/reader034/viewer/2022051823/5fedd26174f28a2523685b3e/html5/thumbnails/5.jpg)
Page 5 of 23
This enzyme is a heterotetrameric protein (α2β2) with two 66-kDa (α) subunits (MxaF) and two 84
8.5 kDa (β) subunits (MxaI). In this MeDH, calcium is in the active site and is coordinated with 85
the PQQ group (23). It was initially believed that this enzyme was critical for methylotrophic 86
growth on methanol as no methanol dehydrogenase activity was observed in mutants defective 87
in the production of this protein (24). Subsequently, however, it was found that there is a 88
homolog to the large subunit, termed XoxF, with 50% sequence identity to MxaF (25, 26). This 89
also encodes a PQQ-dependent methanol dehydrogenase that is associated with the periplasm 90
(26, 27), but appears to be composed only of a single subunit with a predicted mass of 65 kDa 91
(28) or associated with the small subunit of MxaI (26), depending on the microbe. Further, it is 92
often observed that multiple homologs of XoxF are found in the genome of a variety of 93
methylotrophs and methanotrophs (25, 26, 29, 30). 94
95
Xox-MeDH, however, appears to have a rare earth element in its active site. Studies in 96
Methylobacterium radiotolerans and Methylobacterium extorquens AM1 showed that cerium 97
and lathanum both increased methanol oxidation by Xox-MeDH (31, 32). Such increase was not 98
due to increased expression of xoxF, but more likely due to post-translational activation (32). 99
Further, simple yet elegant studies showed that growth and overall MeDH activity of a M. 100
extorquens AM1 mutant in which mxaF was disrupted was severely limited in the absence of 101
lanthanum but growth recovered in its presence, regardless if calcium was simultaneously 102
present or not (32). Such results indicate that lanthanum was required for the activity of Xox-103
MeDH. Subsequent studies supported these findings, i.e., it was found that growth of the 104
Methylacidiphilum fumariolicum SolV was enhanced in the presence of multiple rare earth 105
on Decem
ber 31, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 6: on August 31, 2020 by guest...2015/08/17 · 1 Cerium regulates expression of alte rnative methanol dehydrogenases 2 in Methylosinus trichosporium OB3b 3 4 By 5 6 Muhammad Farhan](https://reader034.fdocuments.in/reader034/viewer/2022051823/5fedd26174f28a2523685b3e/html5/thumbnails/6.jpg)
Page 6 of 23
elements (e.g., cerium, lanthanum, praseodymium and neodymium [33]). Purification of the 106
active MeDH of M. fumariolicum SolV grown in the presence of praseodymium showed ~0.5-0.7 107
atoms of praseodymium per monomer, indicating that this may be part of the active site. 108
Subsequent crystallization of this MeDH revealed it to be encoded by XoxF, and that rare earth 109
metals were in the crystal structure (33). 110
111
Given these findings, we speculated that under selective growth conditions differential 112
expression of not only genes encoding for polypeptides of sMMO and pMMO would vary, but 113
genes encoding for the two alternative forms of MeDH would also vary. Here we report on the 114
effect of varying amounts of copper and cerium on gene expression and growth of 115
Methylosinus trichosporium OB3b. 116
117
METHODS AND MATERIALS 118
Bacterial growth conditions 119
M. trichosporium OB3b was grown on nitrate mineral salt (NMS) medium (34) using >18MΩ▪cm 120
H2O at 30 °C in 250 ml Erlenmeyer flasks under constant shaking at 200 rpm. Varying amounts 121
of copper (as CuCl2) and/or cerium (as CeCl3) prepared in >18MΩ▪cm H2O were added and 122
cultures harvested in the late exponential phase for analysis. Copper and cerium stock solutions 123
were filter sterilized using 0.2 µm polyethersulfone membranes. All chemicals used were of 124
American Chemical Society grade or better. All conditions were performed using biological 125
triplicates. 126
127
on Decem
ber 31, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 7: on August 31, 2020 by guest...2015/08/17 · 1 Cerium regulates expression of alte rnative methanol dehydrogenases 2 in Methylosinus trichosporium OB3b 3 4 By 5 6 Muhammad Farhan](https://reader034.fdocuments.in/reader034/viewer/2022051823/5fedd26174f28a2523685b3e/html5/thumbnails/7.jpg)
Page 7 of 23
Protein quantification 128
The procedure outlined by Semrau, et al. (35) was used to quantify protein concentrations. 129
Briefly, 5 mls of cultures of M. trichosporium OB3b was concentrated to 1 ml and digested in 130
2M NaOH (0.4 ml 5M NaOH per 1.0 ml of culture) at 98 °C for 15 min. The Bradford assay (Bio-131
Rad Laboratories, Hercules, CA) was then used to determine protein concentration following 132
manufacturer instructions. A plot of protein concentrations vs. different optical densities at 600 133
nm (OD600) of cultures of M. trichosporium OB3b yielded a linear regression with an OD600 of 1.0 134
equal to 850 µg protein per ml (R2 = 0.995). This correlation was used to calculate protein 135
concentration for all cultures. 136
137
Metal measurements 138
Copper and cerium associated with biomass and remaining in the supernatant after growth 139
were determined as described earlier (36). Briefly, cultures of M. trichosporium OB3b were 140
centrifuged at 5000 × g for 10 min at 4 °C. The supernatant was then transferred to sterile 141
plastic tubes and stored at -80 °C. Cell pellets were re-suspended in 1 mL of fresh NMS medium 142
without any added metals and then also stored at -80 °C. For subsequent metal analyses, 143
inductively coupled plasma mass spectrometry (ICP-MS; Agilent Technologies, Santa Clara, CA) 144
was used. All samples were first thawed at room temperature with supernatant samples then 145
diluted in NMS with 5% HNO3 (vol/vol) to achieve a final concentration of 2% HNO3 (vol/vol). 146
Cell suspensions were first acidified in 1 mL of 70% HNO3 (vol/vol) and then digested for 2 hours 147
at 95˚C. Digested cell suspensions were then diluted with sterile NMS medium to achieve a 148
on Decem
ber 31, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 8: on August 31, 2020 by guest...2015/08/17 · 1 Cerium regulates expression of alte rnative methanol dehydrogenases 2 in Methylosinus trichosporium OB3b 3 4 By 5 6 Muhammad Farhan](https://reader034.fdocuments.in/reader034/viewer/2022051823/5fedd26174f28a2523685b3e/html5/thumbnails/8.jpg)
Page 8 of 23
final HNO3 concentration of 2 % (vol/vol). Triplicate biological samples were analyzed with each 149
sample measured five times. 150
151
Isolation of Methanobactin. 152
M. trichosporium OB3b was cultured for methanobactin in 0.2 or 1.0 µM CuSO4 amended NMS 153
medium in sequential batch reactors and mb-SB2 purified from the spent medium as previously 154
described (37). 155
156
Nucleic acid extraction and cDNA preparation 157
Total RNA extraction from M. trichosporium OB3b was performed as described earlier (36). 158
Briefly, 2.5 ml of stop solution (5% buffer equilibrated phenol [pH 7.3] in ethanol) was first 159
added to cultures (22.5 ml) to stop synthesis of new mRNA. Cell pellets were then collected by 160
centrifugation at 5,000 × g for 10 min at 4 °C. The cells were re-suspended in 0.75 ml of 161
extraction buffer before lysis using 20 % SDS, 20% lauryl sarkosine, and bead beating. 162
Subsequent steps of RNA extraction were then performed as described previously (35, 38). 163
Total RNA was then subjected to RNase-free DNase treatment until free of DNA contamination 164
as via PCR amplification of the 16S rRNA gene. The purified RNA was quantified 165
spectrophotometrically using NanoDrop (NanoDrop ND1000; NanoDrop Technologies, Inc., 166
Wilmington, DE). RNA samples were stored at 80 °C and used for cDNA synthesis within 2 days 167
of extraction. DNA-free total RNA (500 ng) was treated with Superscript III reverse transcriptase 168
for reverse transcription of mRNA to cDNA (Invitrogen, Carlsbad, CA) following the 169
manufacturer’s instructions. 170
on Decem
ber 31, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 9: on August 31, 2020 by guest...2015/08/17 · 1 Cerium regulates expression of alte rnative methanol dehydrogenases 2 in Methylosinus trichosporium OB3b 3 4 By 5 6 Muhammad Farhan](https://reader034.fdocuments.in/reader034/viewer/2022051823/5fedd26174f28a2523685b3e/html5/thumbnails/9.jpg)
Page 9 of 23
171
Reverse transcription-quantitative PCR (RT-qPCR) 172
Gene specific primers (Table 1) were used for the RT-qPCR analyses of pmoA, mmoX, mxaF, 173
mxaI, xoxF1, xoxF2, and 16S rRNA in M. trichosporium OB3b grown under different 174
concentrations of copper and cerium. Gel electrophoresis and sequencing analyses were 175
performed to verify the specificities of these primers. Amplifications were performed in 96-well 176
reaction PCR plates using Mx3000P QPCR systems (Stratagene, La Jolla, CA) as previously 177
described (39). Each qPCR reaction was carried out in 20 μl total volume that contained: cDNA 178
(0.8 μl), Brilliant III SYBR Green QPCR Mastermix (1X) (Agilent Technologies, Santa Clara, CA), 179
ROX dye (15 nM), forward and reverse primers (0.5 μM each), and nuclease-free sterile water 180
(Ambion, life technologies, Grand Island, NY). Thermal cycler program for qPCR consisted of 40 181
cycles of denaturation (95 °C for 30 s), annealing (58 °C for 20 s) and extension (68 °C for 30 s) 182
after an initial denaturation at 95 °C for 10 min. After the completion of amplification cycles, 183
qPCR products were subjected to melting curve analysis with temperature ranging from 55 °C 184
to 95 °C to confirm their specificity. The threshold amplification cycle (Ct) values were then 185
imported from MxPro (Stratagene, La Jolla, CA) into Microsoft Excel to quantify the relative 186
expression of different genes. Relative gene expression levels were calculated using 187
comparative Ct method (2−ΔΔCt) (40) method with 16S rRNA as the housekeeping gene. ). 188
Calibration curves for examined qPCR products are shown in Supplementary Figure S1. 189
190
191
on Decem
ber 31, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 10: on August 31, 2020 by guest...2015/08/17 · 1 Cerium regulates expression of alte rnative methanol dehydrogenases 2 in Methylosinus trichosporium OB3b 3 4 By 5 6 Muhammad Farhan](https://reader034.fdocuments.in/reader034/viewer/2022051823/5fedd26174f28a2523685b3e/html5/thumbnails/10.jpg)
Page 10 of 23
Electrophoresis and N-terminal Sequence 192
Sodium dodecyl sulfate-polyacrylamine gel electrophoresis was performed on precast NuPAGE 193
4-12% Bis-Tris gradient gels from Invitrogen (Life Technologies, CA) with MES SDS running 194
buffer. Gels were stained for total protein with Coomassie brilliant blue R or blotted for N-195
terminal sequencing. Proteins were blotted onto polyvinyledene difluoride (PVDF) Plus transfer 196
membranes (Micron Separations, Inc. Westboro, MA) using an Xcell II Blot Module (Invitrogen, 197
Carlsbad, CA) according to the manufacturer’s specifications. 198
199
Amino Acid Sequence 200
Amino acid sequence analyses were performed via Edman degradation with a Perkin Elmer 201
Biosystems Model 494 Procise protein/peptide sequencer with an on-line Perkin Elmer Applied 202
biosystems Model 140C PTA Amino Acid Analyzer. Sequence analysis was performed on 203
samples electrobloted to PVDF membranes as described above. 204
205
Spectroscopy 206
UV-visible absorption spectra were determined on a Cary 50 (Varian Inc. Palo Alto, CA) 207
spectrophotometer. Cerium titration experiments were performed using 50 µM aqueous 208
solutions of methanobactin prepared in > 18MΩ▪cm H2O. 209
210
Isothermal Titration Calorimetry 211
Isothermal titration calorimetry (ITC) was performed at 25°C using a GE Microcal ITC200 212
microcalorimeter (GE Healthcare, Piscataway, NJ). Titrant solution was 1 mM CeCl3, and was 213
on Decem
ber 31, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 11: on August 31, 2020 by guest...2015/08/17 · 1 Cerium regulates expression of alte rnative methanol dehydrogenases 2 in Methylosinus trichosporium OB3b 3 4 By 5 6 Muhammad Farhan](https://reader034.fdocuments.in/reader034/viewer/2022051823/5fedd26174f28a2523685b3e/html5/thumbnails/11.jpg)
Page 11 of 23
prepared using > 18MΩ▪cm H2O. The injections were added at 180 sec intervals, and based on 214
injection volume the duration of the injection was predetermined by the software. An injection 215
volume of 1.5 µl into a cell containing 100 µM methanobactin in > 18MΩ▪cm H2O with a stir 216
rate of 800 rpm was used for all injections. The instrument was cleaned between experiments, 217
and the sample cell washed according to the manufacturer’s recommendation. The sample cell 218
was then conditioned with 100 µM methanobactin to remove residual metal. Data was 219
analyzed using nonlinear least-squares curve fitting in Origin 7.0 software (GE Healthcare) 220
following subtraction of the heat of dilution of CeCl3 into > 18MΩ▪cm H2O. 221
222
RESULTS 223
In the presence of varying amounts of copper and cerium, little difference of the growth of M. 224
trichosporium OB3b was observed (Figure S2). As found earlier (36, 39), copper associated with 225
biomass significantly increased (approximately three orders of magnitude; p < 6 x 10-3) with the 226
addition of copper (Figure 1A). Interestingly, as cerium was added, the amount of cerium 227
associated with biomass also increased significantly (by three to four orders of magnitude; p < 228
1.1 x 10-4; Figure 1B), and in fact, most of the added cerium (> 98%) was cell-associated. Cerium 229
binding by methanobactin was determined via spectral changes and isothermal calorimetry. 230
The spectral changes in methanobactin were minor following cerium addition and suggest 231
association is only to the enethiol groups and not to the oxazolone rings of methanobactin 232
(Supplementary Figure S3A). The binding of cerium by methanobactin, KCe = 4.35 x 103 M-1 233
(Supplementary Figure S3B and S3C) was orders of magnitude lower than that found earlier for 234
on Decem
ber 31, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 12: on August 31, 2020 by guest...2015/08/17 · 1 Cerium regulates expression of alte rnative methanol dehydrogenases 2 in Methylosinus trichosporium OB3b 3 4 By 5 6 Muhammad Farhan](https://reader034.fdocuments.in/reader034/viewer/2022051823/5fedd26174f28a2523685b3e/html5/thumbnails/12.jpg)
Page 12 of 23
copper, KCu = 1018 to 1058 M-1 (41-43) and copper displaced cerium associated with 235
methanobactin (results not shown). 236
237
Quantitative PCR (qPCR) of cDNA was then performed to determine if varying amounts of 238
copper and cerium affected expression of the various forms of both methane monooxygenase 239
and methanol dehydrogenase. As found previously (35, 36, 39) the addition of copper reduced 240
mmoX expression by ~four orders of magnitude (Figure 2A) while pmoA expression increased 241
~54-fold (Figure 2B), with both changes significant (p = 0.03 and 7.6 x 10-3, respectively). The 242
addition of cerium, however, did not significantly affect either mmoX or pmoA expression in 243
either the presence or absence of copper. 244
245
Expression of mxaF and mxaI however, did respond to both the addition of copper or cerium 246
(Figure 2C and 2D). When 25 µM cerium was added in the absence of copper, both mxaF and 247
mxaI expression decreased over 50-fold as compared to no added cerium and copper (p = 6.3 x 248
10-3 and 1.9 x 10-3, respectively). In the presence of 10 µM copper, the simultaneous addition 249
of 25 µM cerium caused mxaF and mxaI expression to be reduced by over 2.5-fold each as 250
compared to when no cerium was added in the presence of copper (p = 7.6 x 10-3 and 8.4 x 10-3, 251
respectively). Further, mxaF expression increased ~two-fold in the presence of 10 µM copper 252
as compared to no added copper (p = 0.038), while mxaI expression also increased ~2.4-fold (p 253
= 0.05). Expression of mxaF and mxaI in the presence of both copper and cerium, however, was 254
similar to that found in the absence of both metals (p = 0.4 and 0.5, respectively). 255
256
on Decem
ber 31, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 13: on August 31, 2020 by guest...2015/08/17 · 1 Cerium regulates expression of alte rnative methanol dehydrogenases 2 in Methylosinus trichosporium OB3b 3 4 By 5 6 Muhammad Farhan](https://reader034.fdocuments.in/reader034/viewer/2022051823/5fedd26174f28a2523685b3e/html5/thumbnails/13.jpg)
Page 13 of 23
Expression of both xoxF1 and xoxF2 (Figure 2E and F) increased over an order of magnitude 257
when cerium was added as compared to when both metals were absent (p = 3.3 x 10-4 and 4.7 x 258
10-3 respectively). In the presence of 10 µM copper, the expression of both xoxF1 and xoxF2 259
was not significantly different from that observed in the absence of both metals (p = 0.7 and 260
0.6, respectively). With the simultaneous addition of 25 µM cerium, however, xoxF1 and xoxF2 261
expression increased by approximately 9- and 3.5-fold, respectively, and again such increases 262
were significant (p = 7.0 x 10-3 and 0.02, respectively). 263
264
Given the response of mxaF, xoxF1, and xoxF2 expression to the presence of cerium in the 265
absence of copper, it appears that under some conditions, i.e., sMMO-expressing conditions, 266
that Xox-methanol dehydrogenase could replace the Mxa-methanol dehydrogenase. This was 267
examined more closely through SDS-PAGE protein gels. Given the similar sizes of XoxF1/F2 and 268
MxaF (65 and 66 kDa, respectively – 23, 28, 44), the presence of the small subunit of Mxa-269
methanol dehydrogenase, MxaI (8.5 kDa; 23), was tracked under varying growth concentrations 270
of copper and cerium. As can be seen in Figure 3, in the absence of copper and cerium, a strong 271
band at ~8.5 kDa was observed in the cell-free extract of M. trichosporium OB3b, and this band 272
was absent when 25 µM cerium was added. This band was visible, however, in the presence of 273
copper regardless of the presence or absence of cerium. The N-terminal sequence of this band 274
was determined, and all identified amino acids (10 of the first 11, with one unidentified residue) 275
aligned with the predicted amino acid sequence of MxaI from M. trichosporium OB3b 276
(Supplementary Figure S4). 277
278
on Decem
ber 31, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 14: on August 31, 2020 by guest...2015/08/17 · 1 Cerium regulates expression of alte rnative methanol dehydrogenases 2 in Methylosinus trichosporium OB3b 3 4 By 5 6 Muhammad Farhan](https://reader034.fdocuments.in/reader034/viewer/2022051823/5fedd26174f28a2523685b3e/html5/thumbnails/14.jpg)
Page 14 of 23
DISCUSSION 279
Here we show that multiple metals affect gene expression in M. trichosporium OB3b. That is, in 280
addition to the canonical “copper-switch” that is well-known to control expression of the two 281
forms of MMO (5), cerium also appears to regulate expression of multiple methanol 282
dehydrogenases found in this methanotroph. Specifically, expression of mxaF and mxaI 283
decreased significantly in the presence of cerium but with no added copper as compared to the 284
absence of both metals, while xoxF1 and xoxF2 increased. These findings suggest that Xox-285
methanol dehydrogenase could replace MxaF-methanol dehydrogenase when M. trichosporium 286
OB3b was expressing sMMO. Cerium, however, had little effect on mxaF or mxaI expression 287
under pMMO-expressing conditions, i.e., when 10 μM copper was present. Such findings 288
support earlier conclusions that the pMMO forms a supercomplex with the Mxa-MeDH (19, 20) 289
and that this complex is critical for the oxidation of methane in methanotrophs under pMMO-290
expressing conditions, i.e., in the presence of copper. Our findings suggest, however, that Mxa-291
MeDH is not essential in sMMO-expressing conditions; rather Xox-MeDH is sufficient for the 292
further oxidation of methanol. Further, SDS-PAGE data and subsequent N-terminal sequencing 293
show that in the absence of copper but the presence of cerium, the MxaI polypeptide was not 294
evident, suggesting that as found for methylotrophs, Xox-MeDH is active in M. trichosporium 295
OB3b and requires only XoxF, and not MxaI (28). 296
297
The finding that multiple metals affect gene expression in M. trichosporium is intriguing. It 298
suggests that this microbe has multiple mechanisms to sense and collect both copper and 299
cerium, and that these mechanisms may play a role in controlling the relative expression of 300
on Decem
ber 31, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 15: on August 31, 2020 by guest...2015/08/17 · 1 Cerium regulates expression of alte rnative methanol dehydrogenases 2 in Methylosinus trichosporium OB3b 3 4 By 5 6 Muhammad Farhan](https://reader034.fdocuments.in/reader034/viewer/2022051823/5fedd26174f28a2523685b3e/html5/thumbnails/15.jpg)
Page 15 of 23
Mxa- and Xox-methanol dehydrogenases. It has been shown that copper uptake in M. 301
trichosporium OB3b is regulated by the chalkophore, methanobactin, and a regulatory model 302
has been proposed whereby methanobactin serves to enhance the magnitude of the “copper-303
switch” but is not the basis of the switch (35). By analogy, there appears to be a separate 304
mechanism by which cerium is sensed by M. trichosporium OB3b, but it should be stressed that 305
this mechanism is still unknown. It does not appear that methanobactin is the mechanism for 306
cerium uptake as it was only loosely bound to methanobactin and copper displaced cerium 307
from methanobactin, yet most of the added cerium was found to be cell-associated. This is 308
intriguing for although cerium is considered a rare earth element, as noted elsewhere (33), such 309
metals are not actually “rare” as they are a significant fraction of the earth’s crust. Rather, they 310
are considered “rare” given that most species of these elements are sparingly soluble. From 311
the data presented here, it is tempting to speculate that systems for the uptake of rare earth 312
elements exist, and that the availability of and competition for these metals may have a 313
significant effect on overall methanotrophic community composition and activity. 314
315
It is recommended that this work be extended to see what, if any other rare earth elements 316
also affect expression of Mxa- vs. Xox-MeDH in methanotrophs and to also determine if any 317
growth parameters, e.g., yield and carbon conversion efficiency, are enhanced in the presence 318
of rare earth elements, particularly in sMMO-expressing conditions. It may be that rare earth 319
elements affect methanotrophic community composition as well as specific gene expression, 320
and that simple strategies whereby the presence of rare earth elements is controlled can 321
enhance the utility of methanotrophs for a variety of environmental and industrial applications. 322
on Decem
ber 31, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 16: on August 31, 2020 by guest...2015/08/17 · 1 Cerium regulates expression of alte rnative methanol dehydrogenases 2 in Methylosinus trichosporium OB3b 3 4 By 5 6 Muhammad Farhan](https://reader034.fdocuments.in/reader034/viewer/2022051823/5fedd26174f28a2523685b3e/html5/thumbnails/16.jpg)
Page 16 of 23
323
ACKNOWLEDGEMENTS 324
This research was supported by the Office of Science (BER), U.S. Department of Energy. 325
326
REFERENCES 327
1. Giedroc DP, Arunkumar AI. 2007. Metal sensor proteins: nature’s metalloregulated 328
allosteric switches. Dalton Trans. 29: 3107-3120. 329
2. Guerra AJ, Giedroc DP. 2012. Metal site occupancy and allosteric switching in bacterial 330
metal sensor proteins. Arch Biochem Biophy. 519: 210-222. 331
3. Lee J-W, Helmann JD. 2007. Functional specialization within the Fur family of 332
metalloregulators. Biometals. 20: 485-499. 333
4. Prisic S, Hwang H, Dow A, Baranaby O, Pan TS, Lonzanida JA, Chazin WJ, Steen H, Husson 334
RN. 2015. Zinc regulates a switch between primary and alternative S18 ribosomal 335
proteins in Mycobacterium tuberculosis. Mol Microbiol. In press. DOI: 336
10.1111/mmi.13022. 337
5. Semrau JD, DiSpirito AA, Yoon S. 2010. Methanotrophs and copper. FEMS Microbiol Rev 338
34: 496-531. 339
6. Choi D-W, Kunz R, Boyd ES, Semrau JD, Antholine WE, Han J-I, Zahn JA, Boyd JM, de la 340
Mora A, DiSpirito AA. 2003. The membrane-associated methane monooxygenase 341
(pMMO) and pMMO-NADH:quinone oxidoreductase complex from Methylococcus 342
capsulatus Bath. J Bacteriol. 185: 5755-5764. 343
on Decem
ber 31, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 17: on August 31, 2020 by guest...2015/08/17 · 1 Cerium regulates expression of alte rnative methanol dehydrogenases 2 in Methylosinus trichosporium OB3b 3 4 By 5 6 Muhammad Farhan](https://reader034.fdocuments.in/reader034/viewer/2022051823/5fedd26174f28a2523685b3e/html5/thumbnails/17.jpg)
Page 17 of 23
7. Colby, J., D. I. Stirling, and H. Dalton. 1977. Soluble methane mono-oxygenase of 344
Methylococcus capsulatus (Bath): its ability to oxygenate n-alkanes, n-alkenes, ethers, 345
and alicyclic, aromatic and heterocyclic compounds. Biochem J. 165: 395–402. 346
8. Collins MLP, Buchholz LA, Remsen CC. 1991. Effect of copper on Methylomonas albus 347
BG8. Appl Environ Microbiol. 57: 1261-1264. 348
9. Dalton H. 1980. Oxidation of hydrocarbons by methane monooxygenases from a variety 349
of microbes. Adv Appl Microbiol. 26: 71-87. 350
10. Lee S-W, Keeney DR, Lim D-H, DiSpirito AA, Semrau JD. 2006. Mixed pollutant 351
degradation by Methylosinus trichosporium OB3b expressing either soluble or 352
particulate methane monooxygenase: can the tortoise beat the hare? Appl Environ 353
Microbiol. 72: 7503-7509. 354
11. Lieberman RL, Rosenzweig AC. 2005. Crystal structure of a membrane-bound 355
metalloenzyme that catalyses the biological oxidation of methane. Nature. 434: 177-356
182. 357
12. Lontoh S, Semrau JD. 1998. Methane and trichloroethylene degradation by 358
Methylosinus trichosporium expressing particulate methane monooxygenase. Appl 359
Environ Microbiol. 64: 1106-1114. 360
13. Rosenzweig AC, Frederick CA, Lippard SJ, Nordlund P. 1993. Crystal structure of a 361
bacterial non-haem iron hydroxylase that catalyses the biological oxidation of methane. 362
Nature. 366: 537-543. 363
on Decem
ber 31, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 18: on August 31, 2020 by guest...2015/08/17 · 1 Cerium regulates expression of alte rnative methanol dehydrogenases 2 in Methylosinus trichosporium OB3b 3 4 By 5 6 Muhammad Farhan](https://reader034.fdocuments.in/reader034/viewer/2022051823/5fedd26174f28a2523685b3e/html5/thumbnails/18.jpg)
Page 18 of 23
14. Stirling DI, Colby J, Dalton H. 1979. A comparison of the substrate and electron-donor 364
specificities of the methane mono-oxygenases from three strains of methane-oxidizing 365
bacteria. Biochem. J. 177: 361-364. 366
15. Yoon S, Carey JN, Semrau JD. 2009. Feasibility of atmospheric methane removal using 367
methanotrophic biotrickling filters. Appl Microbiol Biotech. 83: 949-956. 368
16. U.S. Energy Information Administration. 369
http://www.eia.gov/dnav/ng/hist/n9190us3m.htm. Accessed April 21, 2015. 370
17. Khmelenina VN, Rozova ON, But SY, Mustakhimov II, Reshetnikov AS, Beschastnyi AP, 371
Trotsenko YA. 2015. Biosynthesis of secondary metabolites in methanotrophs: 372
biochemical and genetic aspects (review). Appl Biochem Microbiol. 51: 150-158. 373
18. Strong PJ, Xie S, Clarke WP. 2015. Methane as a resource: can the methanotrophs add 374
value? Environ Sci Technol. 49: 4001-4008. 375
19. Myronova N, Kitmitto A, Collins RF, Miyaji A, Dalton H. 2006. Three-dimensional 376
structure determination of a protein supercomplex that oxidizes methane to 377
formaldehyde in Methylococcus capsulatus (Bath). Biochem. 45: 11905-11914. 378
20. Culpepper MA, Rosenzweig AC. Structure and Protein−Protein Interac ons of Methanol 379
Dehydrogenase from Methylococcus capsulatus (Bath). Biochem. 53 (2014): 6211-6219. 380
21. Leak DJ, Dalton H. 1983. In vivo studies of primary alcohols, aldehydes, and carboxylic 381
acids as electron donors for the methane mono-oxygenase in a variety of 382
methanotrophs. J Gen Microbiol. 129: 3487-3497. 383
on Decem
ber 31, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 19: on August 31, 2020 by guest...2015/08/17 · 1 Cerium regulates expression of alte rnative methanol dehydrogenases 2 in Methylosinus trichosporium OB3b 3 4 By 5 6 Muhammad Farhan](https://reader034.fdocuments.in/reader034/viewer/2022051823/5fedd26174f28a2523685b3e/html5/thumbnails/19.jpg)
Page 19 of 23
22. Stanley SH, Prior SD, Leak DJ, Dalton H. 1983. Copper stress underlies the fundamental 384
change in intracellular location of methane monooxygenase in methane-oxidising 385
organisms: Studies in batch and continuous cultures. Biotechnol Lett 5: 487-492. 386
23. Williams PA, Coates L, Mohammed F, Gill R, Erskine PT, Coker A, Wood SP, Anthony C, 387
Copper JB. 2005. The atomic resolution structure of methanol dehydrogenase from 388
Methylobacterium extorquens. Acta Cryst. D61: 75-79. 389
24. Nunn D, Lidstrom ME. 1986. Phenotypic characterization of 10 methanol oxidation 390
mutant classes in Methylobacterium sp. strain AM1. J Bacteriol. 166: 591-597. 391
25. Skovran E, Palmer AD, Rountree AM, Good NM, Lidstrom ME. 2011. XoxF is required for 392
expression of methanol dehydrogenase in Methylobacterium extorquens AM1. J 393
Bacteriol. 193: 6032-6038. 394
26. Wu ML, Wessels HJCT, Pol A, Op den Camp HJM, Jetten MSM, van Niftrik L, Keltjens JT. 395
2015. XoxF-type methanol dehydrogenase from the anaerobic methanotroph 396
“Candidatus Methylomirabilis oxyfera”. Appl Environ Microbiol. 81: 1442-1451. 397
27. Harms N, Ras J, Koning S, Reijnders WNM, Stouthamer AH, van Spanning RJM. 1996. 398
Genetics of C1 metabolism regulation in Paracococcus dentrificans, p. 126-132. In 399
Lidstrom ME, Tabita FR (ed), Microbial growth on C1 compounds. Kluwer Academic 400
Publisher, Dordrecht Netherlands. 401
28. Schmidt S, Christen P, Kiefer P, Voholt JA. 2010. Functional investigation of methanol 402
dehydrogenase-like protein XoxF in Methylobacterium extorquens AM1. Microbiol. 156: 403
2575-2586. 404
on Decem
ber 31, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 20: on August 31, 2020 by guest...2015/08/17 · 1 Cerium regulates expression of alte rnative methanol dehydrogenases 2 in Methylosinus trichosporium OB3b 3 4 By 5 6 Muhammad Farhan](https://reader034.fdocuments.in/reader034/viewer/2022051823/5fedd26174f28a2523685b3e/html5/thumbnails/20.jpg)
Page 20 of 23
29. Matsen JB, Yang S, Stein LY, Beck D, Kalyuzhnaya MG. 2013. Global molecular analyses 405
of methane metabolism in methanotrophic alphaproteobacterium, Methylosinus 406
trichosporium OB3b. Part I: transcriptomic study. Front Microbiol. 4:40. 407
30. Lapidus A, Clum A, LaButti K, Kaluzhnaya MG, Lin S, Beck DAC, Glavina del Rio T, Nolan 408
M, Mavromatis K, Huntemann M, Lucas S, Lidstrom ME, Ivanova N, Chistoserdova L. 409
2011. Genomes of three methylotrophs from a single niche reveal the genetic and 410
metabolic divergence of the Methylophilaceae. J Bacteriol. 193: 3757-3764. 411
31. Hibi Y, Asai K, Arafuka H, Hamajima M, Iwama T, Kawai K. 2011. Molecular structure of 412
La3+-induced methanol dehydrogenase-like protein in Methylobacterium radiotolerans. 413
J Biosci Bioeng. 111: 547-549. 414
32. Nakagawa T, Mitsui R, Tutani A, Sasa K, Tashiro S, Iwama T, Hayakawa T, Kawai K. 2012. 415
A catalytic role of XoxF1 as La3+-dependent methanol dehydrogenase in 416
Methylobacterium extorquens strain AM1. PLoS One. 7: e50480. 417
33. Pol A, Barends TRM, Dietl A, Khadem AF, Eygensteyn J, Jetten MSM Op den Camp HJN. 418
2014. Rare earth metals are essential for methanotrophic life in volcanic mudpots. 419
Environ Microbiol. 16: 255-264. 420
34. Whittenbury R, Phillips KC, Wilkinson JF. 1970. Enrichment, isolation and some 421
properties of methane-utilizing bacteria. J Gen Microbiol. 61: 205-218. 422
35. Semrau JD, Jagadevan S, DiSpirito AA, Khalifa A, Scanlan J, Bergman BH, Freemeier BC, 423
Baral BS, Bandow NS, Vorobev A, Haft DH, Vuilleumier S, Murrell JC. 2013. 424
Methanobactin and MmoD work in concert to act as the “copper-switch” in 425
methanotrophs. Environ Microbiol 15:3077–3086. 426
on Decem
ber 31, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 21: on August 31, 2020 by guest...2015/08/17 · 1 Cerium regulates expression of alte rnative methanol dehydrogenases 2 in Methylosinus trichosporium OB3b 3 4 By 5 6 Muhammad Farhan](https://reader034.fdocuments.in/reader034/viewer/2022051823/5fedd26174f28a2523685b3e/html5/thumbnails/21.jpg)
Page 21 of 23
36. Kalidass B, Farhan Ul Haque M, Baral BS, DiSpirito AA, Semrau JD. 2014. Competition 427
between metals for binding to methanobactin enables expression of soluble methane 428
monooxygenase in the presence of copper. Appl Environ Microbiol. 81: 1024-2031. 429
37. Bandow NL, Gallager WH, Behling, L, Choi DW, Semrau JD, Hartsel SC, Gilles VS, DiSpirito 430
AA. 2011. Isolation of methanobactin from the spent media of methane oxidizing 431
bacteria. Meth. Enzymol. 495: 260 - 269. 432
38. Vorobev A, Jagadevan S, Baral BS, DiSpirito AA, Freemeier BC, Bergman BH, Bandow NL, 433
Semrau JD. 2013. Detoxification of mercury by methanobactin from Methylosinus 434
trichosporium OB3b. Appl Environ Microbiol. 79:5918–5926. 435
39. Farhan Ul Haque M, Kalidass B, Vorobev A, Baral BS, DiSpirito AA, Semrau JD. 2015. 436
Methanobactin from Methylocystis strain SB2 affects gene expression and methane 437
monooxygenase activity in Methylosinus trichosporium OB3b. Appl Environ Microbiol. 438
81: 2466-2473. 439
40. Schmittgen TD, Livak KJ. 2008. Analyzing real-time PCR data by the comparative CT 440
method. Nat Protoc. 3:1101–1108. 441
41. Choi DW, Zea CJ, Do YS, Semrau JD, Antholine WE, Hargrove MS, Pohl NL, Boyd ES, 442
Geesey GG, Hartsel SC, Shafe PH, McEllistrem MT, Kisting CJ, Campbell D, Rao V, de la 443
Mora AM, Dispirito AA. 2006. Spectral, kinetic, and thermodynamic properties of Cu(I) 444
and Cu(II) binding by methanobactin from Methylosinus trichosporium OB3b. 445
Biochemistry 45:1442-1453. 446
on Decem
ber 31, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 22: on August 31, 2020 by guest...2015/08/17 · 1 Cerium regulates expression of alte rnative methanol dehydrogenases 2 in Methylosinus trichosporium OB3b 3 4 By 5 6 Muhammad Farhan](https://reader034.fdocuments.in/reader034/viewer/2022051823/5fedd26174f28a2523685b3e/html5/thumbnails/22.jpg)
Page 22 of 23
42. El Ghazouani A, Basle A, Firbank SJ, Knapp CW, Gray J, Graham DW, Dennison C. 2011. 447
Copper-binding properties and structures of methanobactins from Methylosinus 448
trichosporium OB3b. Inorg Chem 50:1378-1391. 449
43. Pesch M-L, Christl I, Hoffmann M, Kraemer SM, Kretzschmar R. 2012. Copper 450
complexation of methanobactin isolated from Methylosinus trichosporium: OB3b: pH-451
dependent speciation and modeling. J Inorgan Biochem 116:55 - 62. 452
44. Kalyuzhnaya MG, Hristova KR, Lidstrom ME, Chistoserdova L. 2008. Characterization of a 453
novel methanol dehydrogenase in representatives of Burkholderiales: implications for 454
environmental detection of methylotrophy and evidence for convergent evolution. J 455
Bacteriol. 190: 3817-3823. 456
45. Knapp CW, Fowle DA, Kulczycki E, Roberts JA, Graham DW. 2007. Methane 457
monooxygenase gene expression mediated by methanobactin in the presence of 458
mineral copper sources. Proc. Natl Acad Sci. 104: 12040-12045. 459
460
461
on Decem
ber 31, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 23: on August 31, 2020 by guest...2015/08/17 · 1 Cerium regulates expression of alte rnative methanol dehydrogenases 2 in Methylosinus trichosporium OB3b 3 4 By 5 6 Muhammad Farhan](https://reader034.fdocuments.in/reader034/viewer/2022051823/5fedd26174f28a2523685b3e/html5/thumbnails/23.jpg)
Page 23 of 23
FIGURE LEGENDS 462
Figure 1. Metals associated with the biomass of M. trichosporium OB3b grown in the presence 463
of varying amounts of copper and cerium. (A) Copper. (B) Cerium. Errors bars represent the 464
standard deviation of triplicate samples. Columns in each plot labeled by different letters are 465
significantly different (P < 0.05). 466
467
Figure 2. RT-qPCR of (A) mmoX , (B) pmoA, (C) mxaF, (D) mxaI, (E) xoxF1, and (F) xoxF2 genes 468
in M. trichosporium OB3b grown in the presence of varying amounts of copper and cerium. 469
Errors bars represent the standard deviation of triplicate samples. Columns in each plot labeled 470
by different letters are significantly different (P < 0.05). 471
472
Figure 3. SDS-polyacrylamide gel electrophoresis of cell-free extracts of M. trichosporium OB3b 473
grown with varying amounts of copper and cerium. (S) molecular weight standards [kDa], (1) 474
M. trichosporium OB3b grown with 0 µM copper plus 0 µM cerium, (2) M. trichosporium OB3b 475
grown with 0 µM copper plus 25 µM cerium (3) M. trichosporium OB3b grown with 10 µM 476
copper plus 0 µM cerium, (4) M. trichosporium OB3b grown with 10 µM copper plus 25 µM 477
cerium. 478
479
on Decem
ber 31, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 24: on August 31, 2020 by guest...2015/08/17 · 1 Cerium regulates expression of alte rnative methanol dehydrogenases 2 in Methylosinus trichosporium OB3b 3 4 By 5 6 Muhammad Farhan](https://reader034.fdocuments.in/reader034/viewer/2022051823/5fedd26174f28a2523685b3e/html5/thumbnails/24.jpg)
Table 1. Primers used in this study.
primer Targeted gene Sequence (5’ – 3’) Reference
qpmoA_FO pmoA TTCTGGGGCTGGACCTAYTTC 45 qpmoA_RO CCGACAGCAGCAGGATGATG qmmoX_FO mmoX TCAACACCGATCTSAACAACG 45 qmmoX_RO TCCAGATTCCRCCCCAATCC
q16S rRNA_FO 16S rRNA GCAGAACCTTACCAGCTTTTGAC 45 q16S rRNA_RO CCCTTGCGGGAAGGAAGTC qmxaF_FO mxaF CTACATGACCGCCTATGACG This study qmxaF_RO ATTGGCCTTGTTGAAGTCGT qmxaI_FO mxaI TACGATCCCAAGCATGACCC This study qmxaI_RO CGTAGATCCATTTGCCGCTC qxoxF1_FO xoxF1 TCAAGGACAAGGTGTTCGTC This study qxoxF1_RO CGAGCCGTCCTTGATGTTAT qxoxF2_FO xoxF2 GCGCGAAGGATTGGGAATAT This study qxoxF2_RO GCCTCGTAATTCATGCACAG
on Decem
ber 31, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from